Previous Article | Next Article 
Journal of Virology, June 2001, p. 4990-4998, Vol. 75, No. 11
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.11.4990-4998.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Identification of Crucial Hydrogen-Bonding Residues for the
Interaction of Herpes Simplex Virus DNA Polymerase Subunits via
Peptide Display, Mutational, and Calorimetric Approaches
Kristie Grove
Bridges,
Connie S.
Chow,
and
Donald
M.
Coen*
Department of Biological Chemistry and
Molecular Pharmacology and Committee on Virology, Harvard Medical
School, Boston, Massachusetts 02115
Received 3 November 2000/Accepted 10 January 2001
 |
ABSTRACT |
The catalytic subunit, Pol, of herpes simplex virus DNA polymerase
interacts via its extreme C terminus with the processivity subunit,
UL42. This interaction is critical for viral replication and thus a
potential target for antiviral drug action. To investigate the
Pol-binding region on UL42, we engineered UL42 mutations
but also used random peptide display to identify artificial ligands of
the Pol C terminus. The latter approach selected ligands with homology
to residues 171 to 176 of UL42. Substitution of glutamine 171 with
alanine greatly impaired binding to Pol and stimulation of long-chain
DNA synthesis by Pol, identifying this residue as crucial for subunit
interactions. To study these interactions quantitatively, we used
isothermal titration calorimetry and wild-type and mutant forms of
Pol-derived peptides and UL42. Each of three peptides corresponding to
either the last 36, 27, or 18 residues of Pol bound specifically to
UL42 in a 1:1 complex with a dissociation constant of 1 to 2 µM.
Thus, the last 18 residues suffice for most of the binding energy,
which was due mainly to a change in enthalpy. Substitutions at
positions corresponding to Pol residue 1228 or 1229 or at UL42 residue
171 abolished or greatly reduced binding. These residues participate in
hydrogen bonds observed in the crystal structure of the C terminus of
Pol bound to UL42. Thus, interruption of these few bonds is sufficient
to disrupt the interaction, suggesting that small molecules targeting
the relevant side chains could interfere with Pol-UL42 binding.
 |
INTRODUCTION |
Protein-protein interactions are
crucial determinants of biological specificity, and the selective
disruption of these interactions has become an important goal of new
drug research. A potential target for this type of drug is the DNA
polymerase encoded by herpes simplex virus (HSV), which is a
heterodimer composed of a catalytic subunit, Pol, and a processivity
subunit, UL42. Although UL42 is not required for catalysis by Pol, it
is necessary for the synthesis of long-chain DNA products by Pol in
vitro and for viral DNA replication in cultured cells (13,
21). In addition to binding Pol, UL42 also binds in a
non-sequence-specific manner to double-stranded DNA (ds DNA) (15,
19). UL42 mutants specifically impaired for binding Pol and Pol
mutants specifically impaired for binding UL42 are unable to support
long-chain DNA synthesis in vitro and are also unable to complement the
replication of UL42 and pol null mutant viruses,
respectively (5, 6). The importance of the UL42-Pol
interaction for viral replication makes it an attractive target for
antiviral drug discovery.
The extreme C terminus of Pol is necessary for specific interaction
with UL42 (5, 14, 16, 18). Moreover, peptides corresponding to the last 36 (peptide A), 27 (here termed peptide G),
and 18 (peptide E) residues of Pol can inhibit the ability of UL42 to
stimulate the synthesis of long DNA chains by Pol in vitro (3, 8,
12, 14; unpublished results). Studies of peptide E identified
two substitutions that abolish its ability to inhibit long-chain DNA
synthesis without disrupting peptide structure
histidine-to-alanine
and glutamine-to-alanine substitutions at positions corresponding to
Pol residues 1228 and 1229 (H1228A and R1229A), respectively
(3). It has been assumed that peptides A, E, and G exert
their inhibitory activity by binding to UL42 and thus that the H1228A
and R1229A substitutions prevent binding to UL42. In support of this
assumption, immobilized fusion proteins consisting of peptide G fused
to the B subunit of Escherichia coli heat-labile enterotoxin
(11) or peptide A fused to glutathione S-transferase (22) can bind to UL42. Moreover,
peptide A forms a complex with UL42 that can be visualized by X-ray
crystallography (14). However, in these cases, binding was
not shown to be specific to both binding partners, for example, by
examining control or mutant proteins. Thus, it has not yet been
demonstrated that the extreme C terminus of Pol is sufficient to bind
specifically to UL42 in solution. Additionally, studies of the
energetics of this interaction, including measurements of binding
affinity, have not been reported.
In contrast to our relatively detailed understanding of the
UL42-binding surface on Pol, identification of UL42 residues required for Pol binding has lagged. Of more than 50 linker-insertion and deletion mutants of UL42 analyzed, the only one specifically impaired for Pol binding but not DNA binding contains a 4-residue insertion at
position 160 (6). Residues 148 to 163 of UL42 are
predicted to be hydrophilic, suggesting that they may be surface
exposed and accessible to the C terminus of Pol (6). These
findings led us to hypothesize that this region formed the Pol-binding surface of UL42. To test this hypothesis, we constructed and
characterized mutations in this region. We also undertook a
combinatorial approach to identify artificial ligands of the
UL42-binding surface of Pol as a starting point for drug discovery.
This latter approach unexpectedly led to the identification of UL42
residues crucial for Pol binding.
Then, to further assess the specificity and directly quantify the
binding of the C terminus of Pol to UL42 and to examine the
contributions to binding energy of specific residues, isothermal titration calorimetry (ITC) assays were performed with wild-type (wt)
and mutant forms of UL42 and peptides derived from the C terminus of
Pol. These assays yielded binding affinities and stoichiometries, thermodynamic parameters, and the effects of specific substitutions on
these values. Interestingly, although numerous hydrophobic interactions
are observed in the crystal structure of peptide A bound to UL42
(22), the present results identify specific hydrogen bonds
as crucial determinants of binding energy, information that may aid in
the design of new antiviral compounds.
 |
MATERIALS AND METHODS |
Plasmids.
The UL42 insertion mutation at codon
152 (I-152) was created by linearizing pINGUL42 (6) by
partial digestion with NdeI, end-filling with the Klenow
fragment of Escherichia coli DNA polymerase I, and insertion
of the oligonucleotide linker TGCATCGATGCA, which contains
an internal ClaI site. An internal deletion mutant
(
153-160), which has codons 153 to 160 deleted, was constructed by
digesting the I-152 and I-160 mutants with ClaI and
HindIII and ligating the 5' coding fragment from I-152
with the 3' coding fragment from I-160. Therefore,
153-160 contains
a 4-amino-acid insertion at the deletion site. Plasmid pGEX-PD3, which
encodes the last 36 residues of HSV Pol fused to gluathione
S-transferase (GST) was kindly provided by Z. He of this
laboratory and has been described previously (22). The
pGex6p (Invitrogen) plasmid was used to express GST alone. To express
and purify UL42 in E. coli, plasmids encoding UL42 fused to
maltose-binding protein (MBP) were used. Because full-length MBP-UL42
aggregates in E. coli (unpublished results), wt and mutant
versions of UL42 were truncated either at residue 320 or at residue
340, based on previous studies demonstrating that such truncated
proteins retain all known biochemical activities of UL42 (6, 9,
17). Plasmid MBPUL42
C340, which contains the N-terminal 340 residues of UL42 cloned into the XbaI and
HindIII sites of the pMal-c vector (New England
Biolabs), and plasmid MBPUL42
C320 (22) were generously
provided by D. Wilson and H. Zuccola, respectively, of the Hogle
laboratory. The MBPUL42
C340/I-160 plasmid was constructed by cutting
the PstI fragment from pIngUL42/I-160 (6) and
using it to replace the corresponding fragment in MBPUL42
C340. The
MBPUL42
C320/Q171A mutant was constructed by sequential PCR (1) using the mutagenic primers
GTGGTGCTGGTTCCCGCGGGAACCCCCGACGTTC and
GAACGTCGGGGGTTCCCGCGGGAACCAGCAC and the forward and reverse primers TCGGATCCATGACGGATTCC and
CGACCCGGGGAATTCTGCGGC, respectively, with the MBPUL42
C320
vector as the template. The resulting products were cloned into the
BamHI and SmaI sites of a modified pMal-c2 vector, pMBP-PP (a generous gift of A. Pearson of this laboratory), in
which the factor X cleavage site in the pMal-c vector has been replaced
with a Prescission protease site. The inserted DNA was sequenced by the
Biopolymers Laboratory in the Department of Biological Chemistry and
Molecular Pharmacology at Harvard Medical School and shown to contain
wt sequences except for the engineered mutation.
In vitro transcription-translation and immunoprecipitation.
In vitro transcription-translation and coimmunoprecipitation of
radiolabeled UL42 deletion and insertion mutant proteins with unlabeled
HSV Pol or E. coli
-galactosidase (
-Gal) were
performed as described previously (4). In vitro
transcription-translation of full-length Pol was performed using the
TNT coupled reticulocyte lysate system from Promega according to the
manufacturer's suggestion. The template used in the reactions was a
PCR product generated using the forward
primer TAATACGACTCACTATAGGGACCGCGATGTTTTCCGGTGGCGGCGC GGCC,
which contains the T7 promoter, and the reverse primer
TCATGCTA GAGTATCAAAGGCTCTATGCAACATTCGACGAGTTTCCTCCGCCG. Plasmid
pINGUL30 (7) was used as the template for PCR. The control
luciferase plasmid was provided with the kit. The translation products
were labeled with [35S]methionine and
[35S]cysteine.
Protein purification.
Purified HSV Pol, prepared as
described (20), was kindly provided by K. Kumura-Ishii and
K. Weisshart of this laboratory. Full-length UL42 was purified from
insect cells infected with the appropriate recombinant baculovirus as
described previously (8). Recombinant MBP-UL42 fusion
proteins, GST, and GST-peptide A were purified from E. coli
BL21(de3)pLysS harboring the appropriate plasmid. For UL42 fusion
proteins, after induction, cells were freeze-thawed, resuspended in
buffer A (30 mM Tris-Cl [pH 7.5], 2 mM dithiothreitol [DTT],
500 mM NaCl, 0.5 mM EDTA, 5% glycerol, and Complete protease
inhibitors [Roche Molecular Biochemicals]), and lysed by sonication
with a Branson sonifier until lysis was visibly complete. The proteins
were applied to amylose columns (New England Biolabs), washed
extensively with buffer B (buffer A minus the Complete tablets and
containing only 50 mM NaCl), and eluted with buffer B contaninig 10 mM
maltose. Proteins eluted from amylose columns were applied to
dsDNA-cellulose (Sigma) columns, washed with buffer B, and eluted with
buffer B containing 500 mM NaCl. For GST and GST-peptide A, bacteria
were lysed in buffer B containing 5 mM EDTA, and extracts were applied
to glutathione-Sepharose columns (Pharmacia) and eluted with 5 mM
reduced glutathione in buffer B. The eluted proteins were further
purified on anion-exchange columns and eluted with a linear NaCl
gradient from 50 to 500 mM in buffer B. Purified proteins were stored
in buffer B. Concentrations of UL42 fusion proteins were determined
using A280 values and extinction coefficients
derived from amino acid analysis of MBP-UL42
C320 standards.
Random peptide display.
The GST-peptide A fusion protein and
GST were allowed to bind glutathione-coated plates (Pierce) and washed
extensively with buffer B. Panning experiments were performed with the
FliTrx random peptide display library (Invitrogen) containing
approximately 1.7 × 108 primary clones displayed on
bacterial flagella, and the Ph.D.-12 peptide library kit (New England
Biolabs), containing approximately 1.9 × 109 primary
clones displayed on the minor coat protein pIII of M13, as suggested by
the manufacturers. The following modifications were made to the FliTrx
protocol for 96-well plates: after overnight growth of the primary
FliTrx library and a 6-h induction with tryptophan (100 µg/ml), dry
milk was added to the bacterial suspension to a final concentration of
1% and NaCl was added to a final concentration of 150 mM. This
suspension was then placed on the GST-peptide A-coated plates and
incubated for 1 h at 4°C with gentle shaking. The plates were
washed six times with 30 mM Tris-Cl (pH 7.5)-0.5 mM EDTA-50 mM
NaCl-1 mM DTT. Bound bacteria were eluted with 2 µM UL42, and the
remaining bacteria were eluted with vigorous vortexing as described in
the manual. The eluted bacteria were allowed to bind GST-coated plates,
and only the unbound fractions were amplified. After four biopanning
cycles, individual clones were isolated, and their inserts were
sequenced. The same modifications in buffer system and temperature were
made to the phage display protocol. With this system, phage that did
not elute with UL42 were eluted with 1 M NaCl. Five panning cycles were
performed with the Ph.D.-12 library.
Binding of radiolabeled Pol to UL42.
The indicated MBP-UL42
wt or mutant fusion protein (0.3 mg) was loaded onto 0.5-ml amylose
columns and washed extensively with buffer B, and 100 µl of in vitro
transcription-translation reactions was then loaded onto the columns.
The columns were washed with 5 ml of buffer B, and bound proteins were
eluted with buffer B containing 10 mM maltose. The proteins were
visualized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
and autoradiography.
Polymerase assays.
Purified MBP-UL42 mutant proteins were
tested for the ability to stimulate long-chain DNA synthesis using a
poly (dA) template and an oligo (dT) primer on which Pol alone adds
only a few bases as described previously (9). Reaction
mixtures contained 200 fmol of HSV Pol and various amounts of UL42
fusion proteins in a final volume of 25 µl. Reactions were carried
out at 37° C for 5 to 10 min. Reactions were stopped by placing the
mixtures on ice and adding 5 µl of alkaline loading buffer (2 mM
EDTA, 50 mM NaOH, 2.5% glycerol, 0.025% bromcresol green) and then
loading them onto a 4% alkaline agarose gel. Gels were dried overnight and used to expose film and phosphoresence screens.
Peptides.
Peptides A, G, and E, which correspond to the last
36, 27, and 18 residues of Pol, respectively were synthesized by the
Biopolymers Laboratory in the Department of Biological Chemistry and
Molecular Pharmacology at Harvard Medical School. The H1228A and R1229A variants of peptide E (termed H29A and R30A in reference
3) were generously provided by SmithKline Beecham. All
peptides were acetylated at the N terminus. Peptides were dissolved in
water, and concentrations were determined by quantitative amino acid analysis performed by the Molecular Biology Core Facility, Dana-Farber Cancer Institute. The peptides were then lyophilized prior to use.
ITC.
Purified UL42 fusion proteins were dialyzed against
buffer containing 30 mM Tris-Cl (pH 7.5), 50 mM NaCl, 0.5 mM EDTA, and 0.5 mM DTT immediately before performing the experiments in order to
reduce the concentration of DTT, which otherwise would interfere with
calorimetric measurements. Lyophilized synthetic peptides were
suspended in the dialysate from the UL42 samples. ITC was performed
using a VP-ITC calorimeter (MicroCal, Inc.) and protein concentrations
of 7 to 15 µM and peptide concentrations of 280 to 350 µM. Peptides
were titrated into the UL42-containing sample cell in 10-µl
injections at 25°C (unless otherwise indicated), with a mixing speed
of 270 rpm. The heats of dilution of both protein and ligand were
determined and subtracted prior to analysis, and the data were
integrated to generate curves in which the areas under the injection
peaks were plotted against the ratio of peptide to protein. Nonlinear
least-squares analysis of the data was performed using the software
provided with the instrument (Origin 5.0; MicroCal, Inc.), which fits
the area curves to the appropriate parametric binding equation using an
iterative Marquardt algorithm. This generates experimental values for
the change in enthalpy,
H, and the association constant,
Ka (which is the reciprocal of the dissociation
constant, Kd) and the stoichiometry. The change
in free energy (
G) and the change in entropy
(
S) were then calculated by the software using the
equations
G =
RTlnK and
G =
H
T
S, respectively, where
R is the gas constant, T is absolute temperature,
and K is the equilibrium constant.
CD spectroscopy.
For circular dichroism (CD) spectroscopy,
lyophilized peptides were resuspended in 10 mM KF and adjusted to pH 8 with KOH. Spectra were recorded with an Aviv 62DS SpectroPolarimeter at 0°C in a 0.1-cm pathlength cuvette. Wavelength scans were recorded at
1-nm intervals with a 1-s averaging time, and 10 to 20 scans were averaged.
 |
RESULTS |
Residues immediately upstream of 160 are not critical for Pol
binding.
Previous studies of UL42 led to the hypothesis that
residues 148 to 163 of UL42, which are predicted to be hydrophilic,
might be involved in Pol binding (6). In order to test
this hypothesis, a mutant with a UL42 linker insertion at
codon 152 and another mutant in which residues 154 to 160 were deleted
were constructed and expressed in reticulocyte lysates. These proteins
were then incubated with either purified Pol or
-Gal and
immunoprecipitated with an antibody against a Pol-
-Gal fusion
protein (Fig. 1). As demonstrated
previously (6), although the wt protein
coimmunoprecipitated with Pol, the I-160 mutant did not. In contrast,
the I-152 and
154-160 mutants were able to bind Pol more
extensively than they did
-Gal, although the
154-160 mutant
bound less extensively and less specifically (it also bound to
-Gal)
than did wt UL42. The I-152 mutant bound to Pol comparably to wt when
normalized to input radioactivity. All three UL42 mutant proteins
retained wt DNA-binding activity. Unlike the I-160 mutant, the two new mutants were able to stimulate long-chain DNA synthesis by Pol (data
not shown). These findings suggest that while mutations in this region
may affect the binding of UL42 to Pol, residues 152 to 159 are not
crucial for this activity.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 1.
Effects of mutations on binding UL42 to Pol. In
vitro-expressed wt or mutant radiolabeled UL42 was incubated with
either Pol (+) or -Gal ( ) and immunoprecipitated with antiserum
directed against a Pol- -Gal fusion, and the precipitates were
analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
and autoradiography. Lane T, equivalent amount of input protein. At
right are indicated the UL42 proteins assayed.
|
|
Random peptides selected for binding to the C terminus of Pol have
limited homology to residues 171 to 176 of UL42.
Characterization
of the UL42-binding region on Pol has indicated that it is a small
discrete surface that may be amenable to antiviral drug action
(3). We decided to use a combinatorial approach to
identify small peptides that bind to the C terminus of Pol and might be
useful starting points for anti-HSV compounds. One library of random
dodecapeptides was displayed on the flagella of bacteria, where the
peptides were constrained within a loop, and a second library was
displayed on a bacteriophage coat protein, where the peptides were
unconstrained. Each library was enriched for bacteria or phage that
bound to GST fused to the C-terminal 36 residues of Pol (GST-peptide A)
but not to GST and that could be eluted with UL42. Additionally,
bacteria or phage that bound specifically to GST-peptide A but did not
elute with UL42 were eluted separately by vortexing and with high salt,
respectively. The peptides identified were aligned in order to identify
a consensus Pol C terminus-binding sequence.
The constrained peptides displayed on bacteria that could be eluted
with UL42 showed a high degree of homology with one another
(see
below). However, all but one of the bacteria that bound to
GST-peptide
A but did not elute with UL42 (eluted by vortexing)
contained stop
codons in the peptide-coding sequence; their binding
may reflect
nonspecific sticking to proteins. Neither of the two
classes of
unconstrained peptides displayed on phage

those that
eluted with UL42
(class A) and those that eluted with high salt
(class B)

contained a
consensus sequence. However, we then asked
whether a consensus could be
found when the sequences were aligned
with the region of UL42
encompassing residue 160. We focused on
sequences downstream of residue
160, given that mutations upstream
had relatively little effect on Pol
binding. When this alignment
was performed, the constrained peptides
that eluted with UL42
(which were homologous to each other) and one of
the class A and
half of the class B unconstrained peptides showed some
homology
with residues 171 to 176 of UL42, identifying a QxxPxV motif
(Fig.
2A). Strikingly, many of the
peptides showing this homology with
UL42 were represented by multiple
isolates having the same amino
acid sequence but unique nucleotide
sequences. These findings
suggested that residues within this small
region of UL42 might
be involved in Pol binding.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Alignment of sequences of bacterial flagellar (top
four) and phage (bottom three) display-derived peptides with residues
170 to 176 of UL42. The number of individual isolates is shown in
parentheses. (Peptides whose sequences did not align are not shown.)
(B) Alignment of residues 170 through 176 of UL42 with homologs from
pseudorabies virus (PRV), equine herpesvirus 1 (EHV), and
varicella-zoster virus (VZV).
|
|
Residue 171 of UL42 is critical for Pol binding.
UL42 homologs
from other alphaherpesviruses show limited sequence homology and cannot
substitute for one another in vitro (2). However, residues
171 through 176 do lie within a region that is conserved among these
homologs (Fig. 2B). While the proline and valine residues of the QxxPxV
motif are conserved, the glutamine residue is not, suggesting that this
residue might be involved in conferring specificity. To determine if
residue 171 is important for Pol binding, a UL42 point
mutant in which the codon for Q171 was replaced by one for alanine
(Q171A) was constructed. To produce quantities of UL42 sufficient for
biochemical studies, proteins were expressed in E. coli as
MBP fusions. Because full-length MBP-UL42 aggregates in E. coli (unpublished results), two truncated but otherwise wt
proteins were fused to MBP
one truncated at residue 320 (
C320) and
the other at residue 340 (
C340)
based on previous studies
demonstrating that the N-terminal 315 residues of UL42 are sufficient
for all its known biochemical activities (6, 9, 17). The
Q171A mutant was truncated at residue 320. An I-160 mutant
(6) truncated at residue 340 was used as a negative control for Pol binding. All of these proteins were able to bind DNA,
as determined by column chromatography (they were purified by this
property) and ITC (unpublished data).
The ability of the UL42 mutants to bind full-length Pol was tested by
affinity column chromatography. MBP-UL42 proteins were
loaded onto
amylose columns and washed, and radiolabeled Pol or,
as a negative
control, luciferase that had been transcribed and
translated in
reticulocyte lysates was then loaded onto the columns.
The columns were
washed, and bound proteins were eluted with 10
mM maltose. The

C340
and

C320 proteins derived from wt UL42
bound full-length Pol equally
well (Fig.
3). As expected
(
6),
no Pol-binding activity could be detected with the

C340/I-160
mutant (Fig.
3). Very weak binding of Pol (less than
1/20th that
of

C320) could be detected with the

C320/Q171A mutant
(Fig.
3). Very similar results were obtained when radiolabeled Pol
expressed
in insect cells infected with a recombinant baculovirus was
assayed
in the same manner (unpublished data). Thus, the Q171A mutation
substantially and specifically impaired binding of UL42 to Pol.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 3.
MBP pulldown experiments. Radiolabeled wt or mutant
MBP-UL42 proteins (as indicated at the top of the figure) were allowed
to bind to amylose columns before loading in vitro-transcribed and
translated, radiolabeled Pol or, where indicated, luciferase as a
control. The columns were washed, and the proteins were eluted with 10 mM maltose. The first two lanes show 1/10th the amount of luciferase
input and 1/15th the amount of Pol input, respectively. The following
lanes show proteins eluted with maltose.
|
|
The Q171A mutant is defective for stimulation of long-chain DNA
synthesis by Pol.
The UL42 fusion proteins were tested for their
ability to stimulate long-chain DNA synthesis by Pol. As shown in Fig.
4, only the
C340 and
C320 proteins
derived from wt UL42 were able to increase the length of DNA products
synthesized by purified Pol. In contrast, even when a 3:1 (Fig. 4) or
4:1 (data not shown) ratio of UL42 to Pol was used, neither the Q171A
nor the I-160 mutant protein stimulated long-chain DNA synthesis. The
biochemical properties of each UL42 mutant are summarized in Table
1. These data show that the glutamine
residue at position 171 of UL42 is specifically critical for Pol
binding and for the stimulation of long-chain DNA synthesis by Pol.

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 4.
Ability of UL42 mutants to stimulate long-chain DNA
synthesis by Pol. Experiments were performed using a poly(dA) template
with an oligo(dT) primer and labeled TTP. The reaction products were
visualized by autoradiography following electrophoresis on a 4%
alkaline agarose gel. Lane 1,200 fmol of Pol alone; lanes 2 through
5,600 fmol of C340, C340/I-160, C320, and C320/Q171A alone,
respectively. The remaining lanes contain 200 fmol of Pol plus 400 (lane 6) and 600 (lane 7) fmol of C340, 400 (lane 8) and 600 (lane
9) fmol of C340/I-160, 400 (lane 10) and 600 (lane 11) fmol of
C320, and 400 (lane 12) and 600 (lane 13) fmol of C320/Q171A.
|
|
C terminus of Pol is sufficient to bind specifically to UL42 in
solution.
To examine the Pol-UL42 interaction more quantitatively,
we investigated the interaction of peptides corresponding to the C-terminal 18 to 36 residues of Pol with UL42. Although previous studies have suggested that such peptides are sufficient for UL42 binding (3, 8, 11, 22), specific binding in solution had
not yet been demonstrated. To demonstrate specific binding and obtain
affinities and thermodynamic parameters, we used ITC. ITC directly
measures heat generated or absorbed upon binding. A typical titration
experiment for binding of peptide A to an MBP-UL42 fusion protein,
C340, derived from wt UL42 is shown in Fig.
5. The raw data, which are shown in Fig.
5A, indicate an exothermic interaction, based on the negative values
observed for the peaks, each of which corresponds to a fixed amount of peptide injected into a solution containing the UL42 fusion protein. With each injection of peptide, less and less heat was released until
constant values were obtained (corresponding to the heat released due
to dilution), reflecting a saturable process. The area under each
injection peak was integrated, resulting in the curve shown in Fig. 5B,
in which the molar ratio of peptide to protein is plotted against the
kilocalories per mole of injected peptide.


View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
ITC of peptide A binding to UL42 C340. (A) Raw data
for the titration of peptide A with C340, in which the power output
in microcalories per second is measured as a function of time in
minutes. (B) The heats of dilution of both protein and ligand in A were
subtracted, and the area under each injection curve was integrated to
generate the points, which represent heat exchange in kilocalories per
mole, which are plotted against the cumulative peptide-to-protein ratio
for each injection. The solid line is the best-fit curve for the data.
(C) Raw data for titration of peptide A with the I-160 mutant of
UL42.
|
|
Evidence for the specificity of this interaction comes from its being a
saturable process with a stoichiometry of about 1
molecule of peptide
per molecule of UL42 fusion protein (Table
2), which can be approximated from the
peptide-protein ratio
at half-saturation (Fig.
5B). To further address
specificity,
the I-160 and Q171A mutants were tested. Although the wt

C340
and

C320 fusion proteins were able to bind peptide A
robustly
(Fig.
5; see also below), no release or absorption of heat was
detected when either

C340/I-160 (Fig.
5C) or

C320/Q171A (not
shown) was titrated with peptide A. A very small release of heat
(Table
2) was detected when a large excess of peptide A was added
to the

C320/Q171A mutant in a single injection, indicative of
a very weak
interaction. No release of heat was detected with
the I-160 mutant in a
similar single-injection experiment (not
shown). Also, substitutions in
Pol-derived peptides drastically
reduced the heat released (see below).
Thus, the interaction measured
by ITC is affected by mutations in the
binding partners previously
shown to specifically affect the Pol-UL42
interaction and is thereby
specific.
Energetics of binding.
Titration curves such as those shown in
Fig. 5 were analyzed by curve-fitting algorithms to provide values for
the stoichiometry, the change in enthalpy (
H), and the
dissociation constant (Kd) of the interaction, a
measure of affinity. The Kd value permits calculation of the change in free energy (
G), which then
permits calculation of the entropic term T
S.
These parameters for the binding of peptide A to the two wt-derived
UL42 fusion proteins are summarized in Table 2. For both fusion
proteins, stoichiometries were ~1 and Kds were
ca ~1 µM. A similar value for Kd has been obtained by using immobilized peptide A and baculovirus-expressed full-length UL42 in surface plasmon resonance measurements (S. Mahdiyoun and D. M. Coen, unpublished results). The
Kd values translate to
G values of
about
8.5 kcal/mol (Table 2). Of this energy, ~75% was derived
from enthalpic changes (
H
6.4 kcal/mol; Table 2).
Binding of Pol-derived peptides of different lengths to UL42.
Pol-derived peptides of three different lengths
36 (peptide A), 27 (here termed peptide G), and 18 residues (peptide E)
have previously
been used in studies of the Pol-UL42 interaction (3, 8, 11, 12,
14, 22). Nuclear magnetic resonance and X-ray crystallographic
studies of peptide A indicate that it contains a short N-terminal helix
and a longer C-terminal helix separated by a less ordered region
(3, 22); peptide E corresponds to the C-terminal helix and
peptide G to peptide A minus the N-terminal helix. To examine the
contribution of different regions of the Pol C terminus to binding
energy, ITC experiments were performed by titrating peptide A, E, or G
with
C340. The parameters for binding of these peptides are shown in
Table 3. Although the mean
Kd values for peptides E and G were slightly
higher and the mean
G values were thus slightly lower
than that for peptide A, these differences were not statistically
significant. These data demonstrate that most of the binding energy of
peptides A and G is due to interactions of UL42 with their C-terminal
18 residues, which correspond to peptide E.
Interestingly, although the
G of peptide G binding to
UL42 was only slightly lower than those of peptides A and E, the
H for binding of peptide G was significantly lower. The
less favorable
binding enthalpy was compensated for by an increase in
binding
entropy, suggesting that peptide G binds UL42 differently than
do peptides A and E. This led us to suspect that it might be altered
structurally. Previous studies with peptides corresponding to
the Pol C
terminus have demonstrated that CD spectroscopy can
identify structural
changes associated with decreased inhibitory
activity of these peptides
(
3,
8). Therefore, we compared
the CD spectrum of peptide
G with that of peptide A (Fig.
6).
Both
spectra were typical of helical peptides, with minima at
around 222 and
205 nm and a maximum at 190. However, the spectrum
of peptide G was
distorted, with the 205-nm minimum being both
much larger and shifted
to 203 nm. This type of distortion was
previously seen in a peptide E
variant that had severely impaired
ability to inhibit long-chain DNA
synthesis by Pol and UL42 (
3).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6.
CD spectra of peptides A and G. Wavelength scans of
peptides in 10 mM KF were recorded at 1-nm intervals with a 1-s
averaging time, and 10 to 15 scans were averaged. , peptide A; ,
peptide G.
|
|
Importance of Pol residues H1228 and R1229.
Previous studies
of peptide E identified two substitutions that abolish the inhibitory
activity of this peptide without disrupting peptide
structure
histidine-to-alanine and glutamine-to-alanine substitutions
at residues corresponding to Pol residues 1228 and 1229 (H1228A and
R1229), respectively (3). Titrations for binding of each
of these mutant peptides to
C340 are shown in Fig.
7. No binding of the H1228A variant was
detected. The R1229A variant had lower values for binding energy than
peptide E, and more injections were required to reach saturation.
Analysis of the binding data indicated that the
Kd of the R1229 variant was about 10-fold higher than that of peptide E (Kd = 17 µM). Thus,
each of these single-amino-acid substitutions had a dramatic impact on
binding to UL42.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
ITC of H1228 and R1229 variants of peptide E. Raw data
are shown as in Fig. 1A for the interaction of (a) H1228A, (b) R1229A,
and (c) wt peptide E with UL42 C340. Experiments were performed using
7.2 µM UL42 C340 and 335 µM peptide. The arrow indicates the
scale for heat exchange in microcalories per second.
|
|
 |
DISCUSSION |
The Pol-binding site of UL42.
Although UL42 has been well
characterized biochemically, identification of specific residues
involved in Pol binding has lagged. Previous mutational analyses led us
to hypothesize that UL42 residues immediately upstream of residue 160 are involved in Pol binding (6). However, we have shown
here that deleting these residues does not significantly impair UL42
function. By using random peptide display coupled with additional
mutational studies, we have identified the glutamine residue at
position 171 of UL42 as being critical for Pol binding. This residue
lies within a segment that is conserved among other alphaherpesvirus
UL42 homologs.
The mutational analysis presented here, which was conducted
independently of and prior to the recent solution of the crystal
structure of UL42 bound to peptide A, is strikingly consistent
with
that structure (
22). The structure indicates that the Q171
side chain of UL42, which is within a portion of UL42 encompassing
residues 160 to 175, known as the connector loop, is hydrogen
bonded to
the side chain of Pol residue R1229. The data presented
here
demonstrate the crucial importance of this interaction. Interestingly,
Pol residue 1229 is also important for the inhibitory activity
of
peptide E (
5) and for its binding affinity (Fig.
7).
The crystal structure also provides an explanation of the Pol-binding
phenotypes of the I-160, I-152, and

154-160 mutants.
Because
residue 160 is located at the beginning of the connector
loop, an
insertion of 4 residues at this position may force the
critical Q171
residue out of register. The residues immediately
upstream of 160 lie
within a flexible loop which could likely
accommodate the addition
(I-152) or deletion (

154-160) of several
residues without much
change in the register of Q171. In addition,
the 4-amino-acid insertion
at the deletion site in the

153-160
mutant may have lessened its
effect on the connector loop region
of UL42. The other UL42 residues
identified in the alignment of
the peptide display-derived peptides
were P174 and V176 of UL42.
Based on the crystal structure, neither of
these residues is directly
involved in binding to the Pol peptide, and
mutating them would
be unlikely to have a large effect on Pol binding.
The conservation
of these two residues among alphaherpesvirus homologs
suggests
that their role may be in maintaining the structure of
UL42.
The finding that the peptides identified by peptide display were
homologous to residues 171 to 176 of UL42 leads to the hypothesis
that
this region, which lies partially within a constrained segment
of UL42
known as the connector loop, is sufficient for Pol binding,
much as
residues 1218 to 1235 of Pol are sufficient for UL42 binding
(see
below). However, UL42 residues 160 to 190 fused to GST did
not bind
full-length Pol in a pull-down assay, nor did this fusion
protein bind
peptide A in ITC experiments (K. G. Bridges, B. Appleton,
and
D. M. Coen, unpublished results). The failure of residues
160 to
190 to interact with Pol may indicate a requirement to
be in a
constrained conformation, as they are in UL42. This also
might explain
why a good consensus sequence was obtained from
the library of
constrained peptides but not from the library of
unconstrained
peptides. Conversely, our data may indicate that
residues in other
regions of UL42 are essential for Pol binding.
The importance of Pol
residue H1228 (Fig.
7), which in the crystal
structure interacts with
UL42 residue R64 (
22), is consistent
with the latter
alternative. These issues are currently under
investigation.
The UL42 binding site of Pol.
Previous studies have shown that
the extreme C terminus of Pol is necessary for its interaction with
UL42 (5, 14, 16, 18). The data presented here demonstrate
that peptides corresponding to the C terminus of Pol bind in solution
to a UL42 fusion protein with 1:1 stoichiometry and in a manner
dependent upon specific Pol or UL42 residues. We conclude that this
region of Pol is sufficient to bind specifically to UL42 in solution.
The 18-residue peptide (peptide E) bound with an affinity slightly but
not significantly lower than that of the 36-residue
peptide (peptide
A). This is consistent with the crystal structure
of peptide A bound to
UL42, in which the vast majority of interactions
involve the region of
peptide A corresponding to peptide E (
22).
In studies of
these peptides as inhibitors of long-chain DNA synthesis
by Pol and
UL42, peptide E was only 3- to 15-fold less potent
an inhibitor than
peptide A, while peptides corresponding to other
portions of peptide A
had no specific inhibitory activity (
3,
8). Why peptide E
exhibits similar affinity to that of peptide
A but lower potency as an
inhibitor is not clear. Perhaps this
reflects less stable binding to
UL42 at the higher temperatures
of the polymerase inhibition assay
(37°C) than the ITC assay (25°C).
The 27-residue peptide (peptide G) also bound with an affinity slightly
but not significantly lower than those of peptides
A and E. More
surprisingly, its thermodynamics of binding differed
from those of the
other two peptides in that a change in entropy
dominated rather than a
change in enthalpy. This was accompanied
by a distorted CD spectrum,
suggestive of an altered secondary
structure. It is not clear what
accounts for these findings. One
speculation is that the N-terminal
portion of peptide G, which
is predicted to be disordered, interacts
with and perhaps stabilizes
the C-terminal portion that corresponds to
peptide E in a manner
prevented in peptide A by its N-terminal helix.
Upon binding to
UL42, this interaction would be lost, permitting free
movement
of the N-terminal portion and a gain in
entropy.
The data presented here do not address possible contributions by
regions upstream of the Pol C terminus to UL42 binding. Deletions
within the region upstream of the C-terminal 36 residues of Pol
affected binding to UL42 in coimmunoprecipitation experiments,
but not
drastically (
5). Additionally, Pol lacking the C-terminal
27 residues (peptide G) competed fourfold less well than full-length
Pol in a competition enzyme-linked immunosorbent assay
(
14).
These observations argue that if there is a
contribution of upstream
residues of Pol to binding UL42, it is small
relative to that
of the C terminus. On the other hand, based on a
titration of
UL42 for stimulation of long-chain DNA synthesis by Pol,
Hamatake
et al. (
9) reported an association
constant corresponding to
a
Kd of 80 nM. This
value, whose validity depends on several assumptions
about the
enzymatic assay used, is substantially lower than the
affinity of the C
terminus measured here, implying major contributions
to affinity by the
upstream region. Thus, contributions by this
region to UL42 binding
have yet to be quantified
directly.
Importance of hydrogen-bonding interactions.
The crystal
structure of peptide A bound to UL42 (22) reveals numerous
interactions that bury nearly half of the surface area of the peptide.
In particular, the C-terminal 18 residues of the peptide (corresponding
to peptide E) form a helix that binds in a deep groove of UL42. The
residues lying beneath the peptide are mainly hydrophobic, as is the
portion of the helix facing the groove (e.g., residues M1226, L1227,
A1230, F1231, L1234, and A1235); with residues F1231 and L1234 being
completely buried by the interaction. At first glance, one would
predict that the energy of the interaction would depend mainly on this large hydrophobic interface. However, while X-ray crystallography can
identify points of contact between two proteins, it does not provide
information on the importance of each contact to binding energy.
Indeed, the data presented here show that, despite the large
hydrophobic interface, a few specific hydrogen bonds are crucial for
the interaction. In particular, the role of a hydrogen-bonding network
which connects the side chain of Pol residue R1229 to UL42 residue
Q171, which in turn is hydrogen bonded to the main chain of Pol residue
F1211, is emphasized by the results here. The Q171A substitution of
UL42 drastically reduced both binding to and long-chain DNA synthesis
by Pol. It reduced
H >16-fold and affinity for peptide A
to unquantifiable levels. The R1229A variant of Pol peptide E exhibited
a 10-fold reduction in affinity for UL42, representing ~2 kcal/mol
less binding energy. The hydrogen bond of UL42 residue Q171 to the main
chain of Pol residue F1211 may explain why the Q171A substitution had a
greater effect on binding than the R1229A substitution. Additionally,
the H1228A variant of peptide E exhibited no detectable binding in this
study and no detectable inhibitory activity against long-chain DNA
synthesis by Pol and UL42. H1228 of Pol hydrogen bonds with R64 of
UL42. Interestingly, R64 of UL42 is also hydrogen bonded to the side chain of Pol residue D1232. Substitution of D1232 with an alanine residue in peptide E resulted in a 4.5-fold decrease in potency in the
inhibition assay (3). Thus, the data suggest that this hydrogen bond plays a role in the Pol-UL42 interaction, but not as
crucial a one.
Consistent with the idea that hydrogen bonds play a more important role
in the strength of Pol-UL42 binding than do hydrophobic
interactions
are the thermodynamic parameters. Often, binding
reactions driven by
hydrophobic interactions are dominated by
positive
S
values rather than by negative
H values (reviewed
in
reference
10). The
S values for the binding
of peptides
A and E to UL42 were positive but small, and the negative
G was
due mainly to a negative
H.
Preliminary studies of the heat capacity
of the binding of UL42 and
peptide A (data not shown) support
this
idea.
Implications for drug discovery.
Because the interaction of
Pol with UL42 is specific and essential, it is a promising target for
antiviral drugs. A study showing that the C-terminal 27 residues of Pol
fused to enterotoxin B could enter cells and inhibit viral replication
further supports the validity of the Pol-UL42 interface as a drug
target (12). Our initial goal in adopting the peptide
display approach was to identify novel inhibitors of this interaction.
Indeed, a consensus peptide derived from peptide A-binding sequences
identified with the constrained library was able to inhibit the ability
of UL42 to stimulate long-chain DNA synthesis by Pol in vitro, albeit weakly (data not shown). Optimization of this and/or other sequences that bind to the C terminus of Pol, perhaps aided by structure-based design, might ultimately lead to new anti-HSV drugs.
More generally, one obstacle to the discovery of small-molecule
inhibitors of protein-protein interactions is that these interactions
often involve a large surface area and multiple contacts. Another
obstacle to the development of small-molecule inhibitors of
protein-protein
interactions is that they often involve less specific
hydrophobic
contacts. We have demonstrated here, however, that despite
extensive
hydrophobic contacts observed in the crystal structure, much
of
the binding energy for the association of the Pol C terminus with
UL42 comes from only a few residues that are involved in specific
hydrogen bonds. These results suggest that a small molecule that
could
interfere with one or two of these hydrogen bonds would
effectively
disrupt the Pol-UL42 interaction and thus viral
replication.
 |
ACKNOWLEDGMENTS |
We thank the following: A. Pearson for the MBP-PP vector, K. Kumura-Ishii and K. Weisshart for purified Pol, Z. He for the GST-peptide A vector, H. Zuccola for the MBPUL42
C320 plasmid, and D. Wilson for the MBPUL42
C340 vector; J. Martin and P. Hensley of
SmithKline Beecham for provision of peptide E variants; D. Wiley and S. Harrison for use of a CD spectropolarimeter; and L. Lin and J. Brandts
of MicroCal, Inc., for advice on ITC. We also thank H. Zuccola, A. Griffiths, and J. Randell for helpful discussions and assistance,
especially with graphics.
This work was supported by NIH grants RO1 AI19838 and RO1 AI26077 to
D.M.C. and F32 AI10111 to K.G.B.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dept. of
Biological Chemistry and Molecular Pharmacology, Harvard Medical
School, 250 Longwood Ave., Boston, MA 02115. Phone: (617) 432-1691. Fax: (617) 432-3833. E-mail: Don_Coen{at}hms.harvard.edu
Present address: Wyeth Research, Department of Biological
Chemistry, Cambridge, MA 02140.
Present address: Department of Immunology and Infectious Diseases,
Harvard School of Public Health, Boston, MA 02115.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1987.
Current protocols in molecular biology.
Greene Publishing Associates and Wiley Interscience, New York, N.Y.
|
| 2.
|
Berthomme, H.,
S. J. Monahan,
D. S. Parris,
B. Jacquemont, and A. L. Epstein.
1995.
Cloning, sequencing, and functional characterization of the two subunits of the pseudorabies virus DNA polymerase holoenzyme: evidence for specificity of interaction.
J. Virol.
69:2811-2818[Abstract].
|
| 3.
|
Bridges, K. G.,
Q. Hua,
M. R. Brigham-Burke,
J. D. Martin,
P. Hensley,
C. E. Dahl,
M. A. Weiss, and D. M. Coen.
2000.
Secondary structure and structure-activity relationships of peptides corresponding to the subunit interface of herpes simplex virus DNA polymerase.
J. Biol. Chem.
275:472-478[Abstract/Free Full Text].
|
| 4.
|
Chow, C. S., and D. M. Coen.
1995.
Mutations that specifically impair the DNA binding activity of the herpes simplex virus protein UL42.
J. Virol.
69:6965-6971[Abstract].
|
| 5.
|
Digard, P.,
W. R. Bebrin,
K. Weisshart, and D. M. Coen.
1993.
The extreme C terminus of herpes simplex virus DNA polymerase is crucial for functional interaction with processivity factor UL42 and for viral replication.
J. Virol.
67:398-406[Abstract/Free Full Text].
|
| 6.
|
Digard, P.,
C. S. Chow,
L. Pirrit, and D. M. Coen.
1993.
Functional analysis of the herpes simplex virus UL42 protein.
J. Virol.
67:1159-1168[Abstract/Free Full Text].
|
| 7.
|
Digard, P., and D. M. Coen.
1990.
A novel functional domain of an -like DNA polymerase: the binding site on the herpes simplex virus polymerase for the viral UL42 protein.
J. Biol. Chem.
265:17393-17396[Abstract/Free Full Text].
|
| 8.
|
Digard, P.,
K. P. Williams,
P. Hensley,
I. S. Brooks,
C. E. Dahl, and D. M. Coen.
1995.
Specific inhibition of herpes simplex virus DNA polymerase by helical peptides corresponding to the subunit interface.
Proc. Natl. Acad. Sci. USA
92:1456-1460[Abstract/Free Full Text].
|
| 9.
|
Hamatake, R. K.,
M. Bifano,
D. J. Tenney,
W. W. Hurlburt, and M. G. Cordingley.
1993.
The herpes simplex virus type 1 DNA polymerase accessory protein, UL42, contains a functional protease-resistant domain.
J. Gen. Virol.
74:2181-2189[Abstract/Free Full Text].
|
| 10.
|
Ladbury, J. E., and B. Z. Chowdhry.
1996.
Sensing the heat: the application of isothermal titration calorimetry to thermodynamic studies of biomolecular interactions.
Chem. Biol.
3:791-801[CrossRef][Medline].
|
| 11.
|
Loregian, A.,
T. R. Hirst,
H. S. Marsden, and G. Palù.
1996.
Use of Vibrio spp. for expression of Escherichia coli enterotoxin B subunit fusion proteins: purification and characterization of a chimera containing a C-terminal fragment of DNA polymerase from herpes simplex virus type 1.
Protein Expr. Purif.
8:381-389[CrossRef][Medline].
|
| 12.
|
Loregian, A.,
E. Papini,
B. Satin,
H. S. Marsden,
T. R. Hirst, and G. Palù.
1999.
Intranuclear delivery of an antiviral peptide mediated by the B subunit of Escherichia coli heat-labile enterotoxin.
Proc. Natl. Acad. Sci. USA
96:5221-5226[Abstract/Free Full Text].
|
| 13.
|
Marchetti, M. E.,
C. A. Smith, and P. A. Schaffer.
1988.
A temperature-sensitive mutation in a herpes simplex virus type 1 gene required for viral DNA synthesis maps to coordinates 0.609 through 0.614 in UL.
J. Virol.
62:715-721[Abstract/Free Full Text].
|
| 14.
|
Marsden, H. S.,
M. Murphy,
G. L. McVey,
K. A. MacEachran,
A. M. Owisanka, and N. D. Stow.
1994.
Role of the carboxy terminus of herpes simplex virus type 1 DNA polymerase in its interaction with UL42.
J. Gen. Virol.
75:3127-3135[Abstract/Free Full Text].
|
| 15.
|
Parris, D. S.,
A. Cross,
L. Haarr,
A. Orr,
M. C. Frame,
M. Murphy,
D. J. McGeoch, and H. Marsden.
1988.
Identification of the gene encoding the 65-kilodalton DNA binding protein of herpes simplex virus type 1.
J. Virol.
62:818-825[Abstract/Free Full Text].
|
| 16.
|
Stow, N. D.
1993.
Sequences at the C-terminus of the herpes simplex virus type 1 UL30 protein are dispensable for DNA polymerase activity but not for viral origin-dependent DNA replication.
Nucleic Acids Res.
21:87-92[Abstract/Free Full Text].
|
| 17.
|
Tenney, D. J.,
W. W. Hurlburt,
M. Bifano,
J. T. Stevens,
P. A. Micheletti,
R. K. Hamatake, and M. G. Cordingley.
1993.
Deletions of the carboxy terminus of herpes simplex virus type 1 UL42 define a conserved amino-terminal functional domain.
J. Virol.
67:1959-1966[Abstract/Free Full Text].
|
| 18.
|
Tenney, D. J.,
P. A. Micheletti,
J. T. Stevens,
R. K. Hamatake,
J. T. Matthews,
A. R. Sanchez,
W. W. Hurlburt,
M. Bifano, and M. G. Cordingley.
1993.
Mutations in the C terminus of herpes simplex virus type 1 DNA polymerase can affect binding and stimulation by its accessory protein UL42 without affecting basal polymerase activity.
J. Virol.
67:543-547[Abstract/Free Full Text].
|
| 19.
|
Weisshart, K.,
C. S. Chow, and D. M. Coen.
1999.
The herpes simplex virus processivity factor, UL42, imparts increased DNA-binding specificity on viral DNA polymerase and decreased dissociation from primer-template without reducing elongation rate.
J. Virol.
73:55-66[Abstract/Free Full Text].
|
| 20.
|
Weisshart, K.,
A. A. Kuo,
C. B. C. Hwang,
K. Kumura, and D. M. Coen.
1994.
Structural and functional organization of herpes simplex virus DNA polymerase investigated by limited proteolysis.
J. Biol. Chem.
269:22788-22796[Abstract/Free Full Text].
|
| 21.
|
Wu, C. A.,
N. J. Nelson,
D. J. McGeoch, and M. D. Challberg.
1988.
Identification of herpes simplex virus type 1 genes required for origin-dependent DNA synthesis.
J. Virol.
62:435-443[Abstract/Free Full Text].
|
| 22.
|
Zuccola, H. Z.,
D. J. Filman,
D. M. Coen, and J. M. Hogle.
2000.
The crystal structure of an unusual processivity factor, herpes simplex virus UL42, bound to the C-terminus of its cognate polymerase.
Mol. Cell
5:267-278[CrossRef][Medline].
|
Journal of Virology, June 2001, p. 4990-4998, Vol. 75, No. 11
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.11.4990-4998.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Komazin-Meredith, G., Mirchev, R., Golan, D. E., van Oijen, A. M., Coen, D. M.
(2008). Hopping of a processivity factor on DNA revealed by single-molecule assays of diffusion. Proc. Natl. Acad. Sci. USA
105: 10721-10726
[Abstract]
[Full Text]
-
Komazin-Meredith, G., Santos, W. L., Filman, D. J., Hogle, J. M., Verdine, G. L., Coen, D. M.
(2008). The Positively Charged Surface of Herpes Simplex Virus UL42 Mediates DNA Binding. J. Biol. Chem.
283: 6154-6161
[Abstract]
[Full Text]
-
Loregian, A., Case, A., Cancellotti, E., Valente, C., Marsden, H. S., Palu, G.
(2006). Cloning, expression, and functional characterization of the equine herpesvirus 1 DNA polymerase and its accessory subunit.. J. Virol.
80: 6247-6258
[Abstract]
[Full Text]
-
Appleton, B. A., Brooks, J., Loregian, A., Filman, D. J., Coen, D. M., Hogle, J. M.
(2006). Crystal Structure of the Cytomegalovirus DNA Polymerase Subunit UL44 in Complex with the C Terminus from the Catalytic Subunit: DIFFERENCES IN STRUCTURE AND FUNCTION RELATIVE TO UNLIGANDED UL44. J. Biol. Chem.
281: 5224-5232
[Abstract]
[Full Text]
-
Randell, J. C. W., Komazin, G., Jiang, C., Hwang, C. B. C., Coen, D. M.
(2005). Effects of Substitutions of Arginine Residues on the Basic Surface of Herpes Simplex Virus UL42 Support a Role for DNA Binding in Processive DNA Synthesis. J. Virol.
79: 12025-12034
[Abstract]
[Full Text]
-
Loregian, A., Appleton, B. A., Hogle, J. M., Coen, D. M.
(2004). Specific Residues in the Connector Loop of the Human Cytomegalovirus DNA Polymerase Accessory Protein UL44 Are Crucial for Interaction with the UL54 Catalytic Subunit. J. Virol.
78: 9084-9092
[Abstract]
[Full Text]
-
Loregian, A., Appleton, B. A., Hogle, J. M., Coen, D. M.
(2004). Residues of Human Cytomegalovirus DNA Polymerase Catalytic Subunit UL54 That Are Necessary and Sufficient for Interaction with the Accessory Protein UL44. J. Virol.
78: 158-167
[Abstract]
[Full Text]
-
Loregian, A., Rigatti, R., Murphy, M., Schievano, E., Palu, G., Marsden, H. S.
(2003). Inhibition of Human Cytomegalovirus DNA Polymerase by C-Terminal Peptides from the UL54 Subunit. J. Virol.
77: 8336-8344
[Abstract]
[Full Text]