Previous Article | Next Article 
Journal of Virology, May 2001, p. 4551-4557, Vol. 75, No. 10
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.10.4551-4557.2001
Detection and Characterization of Porcine Endogenous
Retrovirus in Porcine Plasma and Porcine Factor VIII
Daniel M.
Takefman,1
Susan
Wong,1
Thomas
Maudru,2
Keith
Peden,2 and
Carolyn A.
Wilson1,*
Division of Cellular and Gene
Therapies1 and Division of Viral
Products,2 Center for Biologics Evaluation
and Research, Food and Drug Administration, Bethesda, Maryland
Received 13 October 2000/Accepted 5 February 2001
 |
ABSTRACT |
The pig genome contains porcine endogenous retroviruses (PERVs)
capable of infecting human cells. Detection of infectious retrovirus in porcine peripheral blood mononuclear cells and
endothelial cells suggested to us that pig plasma is likely to contain
PERV. Both PERV env sequences and viral reverse
transcriptase (RT) activity were detected in all plasma samples
isolated from four NIH minipigs. To detect infectious virus from
plasma, we performed a culture assay using three cell lines of feline,
swine, and human origin that had previously been shown to be
permissive for PERV. Infectious virus was successfully cultured from
all four NIH minipig plasmas on the swine cell line ST-IOWA. Using
RT-PCR with env-specific primers, we could detect
expression of PERV class C envelope in the supernatant of ST-IOWA cells
that had been exposed to each pig plasma. We next examined a pig plasma
derivative, Hyate:C (porcine factor VIII), and found evidence of PERV
particles, since all six lots examined were positive for PERV RNA and
RT activity. However, infectious virus could not be detected in
clinical lots of Hyate:C, suggesting that the manufacturing process
might reduce the load of infectious virus to levels below detectable
limits of the assay. Detection of infectious virus in porcine plasma confirms and extends the previous findings that certain porcine cells
express PERV when manipulated in vitro and clearly demonstrates that there are porcine cells that express infectious PERV
constitutively in vivo.
| |
INTRODUCTION |
Biological products derived from
porcine plasma are currently licensed for clinical use. For example,
hemophiliacs who develop antibodies to human factor VIII can
effectively use porcine plasma-derived factor VIII (6,
19). In addition to porcine plasma, porcine organs have been
considered for use in human recipients to alleviate the shortage of
human organs for transplantation. Porcine cells, such as fetal neuronal
cells, are now under clinical investigation for treatment of human
disease (7). One problem with the safety of porcine organs
and plasma is the potential to expose humans to pig-derived infectious
agents. Of particular concern are the findings that the genomes of all
pigs contain porcine endogenous retroviruses (PERVs) that are capable
of giving rise to gammaretrovirus particles (2, 3, 12, 13, 22,
24). While recent reports have not found evidence for PERV
infection of humans (10, 20, 21), little is known about
levels of PERV expressed in vivo in pigs or the impact of exposure to
PERV in different clinical settings, such as repeat injections of
plasma derivatives or long-term exposure to transplanted pig cells.
The swine genome contains 20 to 50 copies of PERV, 10 to 20 copies of
which correspond to full-length provirus (1, 12, 22).
Sequence analysis of full-length clones indicates that PERV is most
closely related to gibbon ape leukemia and murine leukemia virus (MuLV)
genomes (1, 5), sharing approximately 60% amino acid
identity with the gag and pol regions. In
addition to there being multiple copies of PERV per genome, there are
three known receptor classes based on sequence analysis, interference, and in vitro tropism studies, named PERV-A, PERV-B, and PERV-C (1, 12, 25). Retroviral pseudotypes bearing envelopes of class A or B are capable of infecting cell lines from several mammalian
species, including human, while pseudotypes carrying PERV-C envelope
are mostly restricted to cells of porcine origin (25).
PERVs derived from certain porcine cell lines (22),
primary porcine endothelial cells (14), primary porcine
islet cells (27), and activated porcine peripheral blood
mononuclear cells (PBMC) (28) are capable of infecting
various human cell lines. Recovery of infectious virus from both
porcine PBMC (28) and porcine endothelial cells
(14) suggests that one might expect PERV to be present in
pig plasma. While reverse transcriptase (RT) activity and PERV-specific
RNA have been found in porcine serum (10), it is not known
whether PERV present in porcine plasma is infectious.
Over the last two decades, approximately half of the hemophiliac
population contracted human immunodeficiency virus from contaminated plasma (4, 11). Given the use of porcine plasma
derivatives and the current exploration of porcine cells and organs for
human xenotransplantation, it is critical to ascertain if porcine
plasma and its derivatives carry infectious PERV. In this study,
porcine plasma and a plasma derivative, factor VIII (trade name,
Hyate:C), were evaluated for the presence of RT activity and
for PERV env sequences. In addition, we investigated whether
infectious virus is present in either porcine plasma or the porcine
plasma-derived factor VIII.
| |
MATERIALS AND METHODS |
Cells and viruses.
Four different cell lines were used in
infectivity assays: human embryonic kidney 293 cells (ATCC CRL-1573),
swine testis ST-IOWA cells (obtained from Richard Fister, Tufts
University), human fibrosarcoma HT1080 cells (ATCC CCL-121), and a
feline line of glial cells (PG-4 cells; ATCC CRL 2032). ST-IOWA and 293 cells were maintained in Dulbecco's modified Eagle's medium
supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 1 mM
sodium pyruvate, 100 U of penicillin per ml, and 100 µg of
streptomycin per ml. HT1080 cells were maintained in Eagle's minimal
essential medium supplemented with 10% FBS, 1× nonessential amino
acids (Biofluids, Rockville, Md.), 0.75% sodium bicarbonate
(BioWhittaker, Walkersville, Md.), 1 mM sodium pyruvate, 100 U of
penicillin per ml, and 100 µg of streptomycin per ml. PG-4 cells were
maintained in McCoy's 5A medium supplemented with 15% FBS, 2 mM
glutamine, 1 mM sodium pyruvate, 100 U of penicillin per ml, and 100 µg of streptomycin per ml. As a positive control for infectivity
studies, virus-containing supernatant was harvested from postconfluent 293 cells infected with PERV (PERV-NIH-3°) and passed through a
0.45-µm-pore-size filter to remove residual cells. This PERV was
originally isolated from the supernatant of phytohemagglutinin- and
phorbol myristate acetate-stimulated PBMC isolated from NIH minipigs and passaged onto 293 cells (28). The virus
obtained from this culture (PERV-NIH-1°) was subsequently passaged
two additional times in 293 cells to produce PERV-NIH-3°, which
hereafter will be referred to as PERV-NIH. PERV-NIH has been shown to
contain envelope sequences most similar to those of PERV-A
(29).
Plasma virus isolation.
Porcine peripheral blood (100 ml)
was collected in acid citrate dextrose from NIH minipigs (NIH
animal facility, Poolesville, Md.). Blood was centrifuged at
200 × g for 15 min to clarify plasma, and plasma was
centrifuged at 1,000 × g for 15 min to remove any residual cells. To purify and concentrate PERV that might be present, 10 ml of freshly collected plasma was diluted with 19 ml of
phosphate-buffered saline and ultracentrifuged over 7.5 ml of 20%
(wt/vol) sucrose in TEN (10 mM Tris [pH 8.0], 1 mM EDTA, 100 mM NaCl)
in a Beckman SW28 rotor (25,000 rpm, 3 h, 4°C). The pelleted
material was resuspended in 1.5 ml of appropriate culture medium and
immediately used in infectivity studies. Pilot experiments using
analogous ultracentrifuge conditions resulted in reproducible recovery
of infectious PERV-NIH, albeit with reductions in infectivity titer
(data not shown).
Plasma used as a source material for porcine factor VIII (referred to
as Speywood plasma) was obtained from Speywood BioPharm, Ltd.
(Berkshire, United Kingdom), and collected as previously described
(18). Briefly, blood from approximately 60 pigs that are a
cross between Large White and Landrace was collected in Pallecon
anticoagulant and pooled. Plasma was separated by continuous-flow centrifugation and then passed through a 0.45-µm-pore-size microbial filter. This pooled plasma was frozen before use in infectivity studies.
Detection of PERV in porcine plasma and Hyate:C.
Plasma
samples and clinical lots of Hyate:C were assayed for RT activity by a
product-enhanced RT assay that utilizes TaqMan technology for
quantitative detection (TM-PERT), performed as previously described
(17). Absolute RT activities were determined by running
serial dilutions of known activities of either avian myeloblastosis
virus or Moloney MuLV RT (Life Technologies, Rockville, Md.). All
plasma samples were ultracentrifuged prior to use in the TM-PERT as
described above (i.e., 10 ml was pelleted and resuspended in 1.5 ml of
medium). In all cases, the test article was examined for inhibitory
effects in the assay by including a sample of the test article spiked
with the positive control RT. Spiked test articles resulted in values
comparable with the positive control without the test article,
indicating no inhibitory effects. Negative controls of buffer without
sample were run with every TM-PERT assay, and no RT activity was
observed in each case. The assay baseline was the lowest concentration
of positive control RT that produced a fluorescence value above
threshold levels in the TaqMan assay as previously described
(17).
Plasmas were also assayed for the presence of PERV-specific nucleic
acids. RNA was isolated from pelleted plasma and converted
to cDNA as
previously described (
29). To detect the three known
envelope classes, the following primer pairs specific for the
envelope
region were used to amplify cDNA by PCR: PL 170 and PL
171 for
detection of PERV-A (GenBank accession no.
Y12238)
(
12);
PL 172 and PL173 for detection of PERV-B (GenBank accession
no.
Y12239)
(
12); and MSL 1 and MSL 2 for detection of PERV-C
(GenBank
accession no.
AF038600) (
29). The PCR conditions
were as
follows: 30 cycles at 94°C for 30 s, 55°C for 30 s, and
72°C for 1 min after an initial 1-min denaturation step at 94°C.
After the PCR products were fractionated on a 1% agarose gel,
the DNA
fragments were immobilized onto nylon membranes by Southern
transfer.
Immobilized PCR products were detected by hybridization
at 37°C with
the following alkaline phosphatase-labeled
env-specific
probes (AlkPhos Direct labeling and detection system; Amersham
Life
Science, Buckinghamshire, United Kingdom): PERV A
env
(5'
GGG GAA TAG TGT ACT ATG GAG GCT CTG GGA GAA AGA AAG GA 3')
for
PERV-A detection (GenBank accession no.
Y12238)
(
12); PERV
B
env (5' GGG ACG AGG GTC CAC
TTT AAC CAT TCG CCT TAG GAT AGA
G 3') for PERV-B detection
(GenBank accession no.
Y12239) (
12);
and PERV C
env (5' CAG CTG GAG CCT CCA ATG GCT ATA GGA CCA AAT
ACG
GTC 3') for PERV C detection (GenBank accession no.
AF038600)
(
1). All washes following hybridization were done at room
temperature,
and visualization was achieved by chemiluminescence with
CDP-Star
(Amersham Life Science) followed by exposure of
autoradiography
film for 1 h and
overnight.
Clinical lots of Hyate:C were analyzed by RT-PCR for the presence of
PERV
pol sequences using previously described methods
(
29).
Infectivity assays using porcine plasma.
Target cells were
seeded into 24-well dishes at a concentration of 50,000 cells/well 1 day prior to exposure to virus. On the day of infection, PERV was
harvested from postconfluent 293/PERV-NIH cultures for use as a
positive control. Dilutions of PERV-NIH were prepared in culture
medium, adjusted to a final Polybrene concentration of 6 µg/ml, and
added to each target cell type. For plasma-derived material,
ultracentrifuged pellets were resuspended in 1.5 ml of culture medium
containing 6 µg of Polybrene/ml. One milliliter of either
ultracentrifuged plasma or PERV-NIH-containing supernatant was added to
the target cells. The following day, cells were washed with fresh
medium. Negative controls were parallel cultures grown and maintained
in a similar manner that were not exposed to PERV-NIH or porcine plasma.
To monitor PERV infection, cell culture supernatants were sampled
periodically for a total of 8 weeks. These samples were
monitored for
viral RT by a conventional RT assay as previously
described
(
28). In some cases, culture supernatants were assayed
for
the presence of viral RNA. RNA was isolated and converted
to cDNA as
previously described (
29). cDNA was amplified by
PCR using
primers specific for the
pol region of PERV (GenBank
accession no.
AF033259), PB906 (5'ACGTACTGGAGGAGGGTCACCTGA3')
and PB908 (5'GTCCCGAACCCTTATAACCTCTTG 3'). The PCR
conditions
were as described above. Amplified products were
fractionated
on a 1% agarose gel and immobilized onto nylon membranes
by Southern
transfer. PCR products were detected with an alkaline
phosphatase-labeled
probe for
pol sequences (5' TTC GAA
TGG AGA GAT CCA GGT ACG GGA
AGA ACC GGG CAG C 3'). Hybridization
conditions and detection
methods were as described
above.
Infectivity assays using Hyate:C.
Six lots of lyophilized
Hyate:C were reconstituted with 20 ml of sterile water for injection
(USP grade) according to the manufacturer's instructions. Each lot of
reconstituted Hyate:C was diluted fivefold in either culture medium or
PERV-containing supernatant and adjusted to a final Polybrene
concentration of 6 µg/ml (based on a previous analysis of
cytotoxicity of Hyate:C, it was determined that a fivefold dilution was
optimal). These Hyate: C preparations were then inoculated onto
triplicate wells of 12-well dishes that had been seeded 1 day
previously with porcine ST-IOWA, human 293, or feline PG-4 cells.
Cultures were maintained for a total of 8 weeks, with passaging twice
per week. Cell supernatants were sampled every 2 weeks and assayed for
PERV production by either RT activity (ST-IOWA cultures) or RT-PCR for
viral RNA (293 and PG-4 cultures) (29). All
positive-control cultures were assessed for RT activity by the
conventional assay (28). To determine whether latent virus
may be present in the Hyate:C-inoculated cultures, genomic DNA was
isolated at week 8 and examined for PERV sequences by PCR as previously
described (28). Negative controls were parallel cultures
not exposed to Hyate:C or PERV-NIH. Positive controls included cultures
inoculated with various dilutions of PERV-NIH.
| |
RESULTS |
Analysis of porcine plasma for presence of PERV.
Plasma was
isolated from four different NIH minipigs and purified by
ultracentrifugation through sucrose as described in Materials and
Methods. TM-PERT was used to detect retrovirus in the ultracentrifuged plasma (17). As seen in Fig.
1, RT activity was present in all four
minipig plasma samples. The RT activity of the NIH minipig plasmas ranged from 3.3 × 106 to 2.4 × 107 pU of RT activity per µl, while the RT activity of
the positive control PERV-NIH supernatant was 8.8 × 108 pU/µl. These values were more than 3 orders of
magnitude over the assay baseline of 103 pU/µl. In
parallel, each sample was independently spiked with 3.3 × 107 pU of RT enzyme. Levels of activity were comparable
with the activity of a standard used as a spike, demonstrating lack of inhibitory effects (data not shown).
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
RT activity in porcine plasma. All plasmas were
ultracentrifuged through 20% sucrose prior to testing as described in
Materials and Methods. Samples were assayed for RT activity by TM-PERT
(17). Values were standardized using a curve generated
from assay of serial dilutions of a stock of Moloney MuLV RT with known
enzymatic activity. The assay baseline was 103 pU/µl.
|
|
RT-PCR analysis was done on the same samples to determine if the
plasmas contained PERV-specific sequences. Three sets of
primers were
used to detect each of the three envelope classes
(A, B, and C) (see
Materials and Methods). All four minipig plasmas
tested positive
for each of the three envelope classes (data not
shown).
Susceptibility of target cells to PERV-NIH.
To determine
whether the porcine plasma contained infectious PERV particles, three
different cell lines were used to allow detection of any of the three
receptor classes of PERV. Previous experiments have shown ST-IOWA cells
to be permissive to retroviral pseudotypes containing each of the three
env classes, while 293 and PG-4 cells are permissive to
virus containing class A or class B env (25,
29). Plasmas 1 to 4 were tested in independent culture
experiments with positive and negative controls included for each
experiment. Positive controls were serial dilutions of PERV-NIH
supernatant added to each target cell culture in parallel to exposure
to pig plasma to demonstrate that culture conditions were able to
support PERV replication. Infection of target cells was monitored by
detection of RT activity. All cell lines tested in each of the four
assays were permissive for PERV-NIH, although to varying degrees (Table
1).
Analysis of porcine plasma for infectious PERV.
Plasmas from
the four NIH minipigs were isolated and then ultracentrifuged over
20% sucrose to purify viral particles. Pelleted material was
resuspended in culture medium and added to duplicate wells of target
cells. To detect PERV replication, we assayed culture supernatants for
RT activity and for viral pol sequences by RT-PCR for a
period of 8 weeks. PERV replication was not detected in PG-4 and 293 cells exposed to NIH minipig plasmas. However, the ST-IOWA cells
became positive for RT activity after exposure to each of the
ultracentrifuged plasma samples. In Fig.
2, the levels of [3H]TTP
incorporation measured in supernatants from the ST-IOWA/plasma cultures
over time are shown. The average RT activity of the plasma cultures at
week 8 was increased 17.1 ± 4.8 (average ± standard deviation) times the values obtained from parallel cultures of uninfected ST-IOWA cells. This consistent high increase in RT over time
activity indicates that the ST-IOWA cells were infected with
plasma-derived virus and that virus spread throughout the culture.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Time course of ST-IOWA infection with porcine
plasma-derived virus. Culture supernatants were assayed for RT activity
in a conventional RT assay (28) at weekly intervals. All
control uninfected ST-IOWA cells had consistently low endogenous RT
activity, and values from one representative uninfected control are
shown.
|
|
Envelope classification of infectious plasma virus.
Of the
three cell lines used in this experiment, only ST-IOWA cells are
permissive to infection by pseudotypes of PERV expressing class C
envelope (25). To determine the envelope class of the infectious PERV isolated from the pig plasma, RT-PCR analysis was done
on the supernatants from the ST-IOWA cells exposed to plasma 8 weeks
previously, using envelope primers specific for class C
(1). Since ST-IOWA cells express endogenous envelope A and
B sequences (25), only expression of PERV class C
sequences could be analyzed. As seen in Fig.
3, class C envelope sequences were
detected in each of the four ST-IOWA cultures exposed to ultracentrifuged plasma samples, while these sequences were not detected in any of the control uninfected ST-IOWA cells or in the
cultures exposed to PERV-NIH. Therefore, infection of ST-IOWA cells
exposed to porcine plasma was likely the result of plasma-derived PERV
that has a type C envelope.
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of viral env RNA from ST-IOWA cell
cultures after exposure to NIH minipig plasmas. RT-PCR analysis was
done on supernatants from replicate cultures of ST-IOWA cells after
exposure to each of the NIH minipig plasma samples 1 to 4, PERV-NIH, or uninfected control cells. Primers specific for class C
PERV envelope sequences were used to amplify PERV-C env from
these samples (25), and DNA products were detected by
Southern blot analysis using a class C envelope-specific probe.
|
|
Detection of PERV in Hyate:C.
To determine whether PERV would
be present in a manufactured product derived from pig plasma, we
analyzed six clinical lots of Hyate:C (porcine factor VIII) for the
presence of PERV RNA by RT-PCR for pol sequences and for
evidence of retroviral particles by measuring RT activity using
TM-PERT. As shown in Fig. 4A, PERV pol RNA could be detected by RT-PCR in all lots examined. To
assess whether the viral RNA may be associated with viral particles, we
next tested the same lots for the presence of retroviral RT activity by
TM-PERT (17). Using this method, all six lots analyzed had
measurable levels of RT activity in the range of 105 to
106 pU of RT activity per µl of Hyate:C analyzed (Fig.
4B). By comparison, PERV-NIH-containing supernatant was shown to have
activity 4 to 5 logs higher in the same assay (RT activity of
approximately 3.3 × 1010 pU/µl).
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Detection of PERV in Hyate:C. Six lots of Hyate:C,
labeled A through F, were examined for PERV by RT-PCR for PERV RNA
pol sequences (A) or for RT activity by TM-PERT (B). The
values for RT activity were derived from a standard curve generated
using dilutions of a quantitated stock of avian myeloblastosis virus RT
measured in the same assay. The assay baseline was 103
pU/ml.
|
|
Since all of the lots examined were positive for both viral RNA and RT
activity, we wanted to determine whether these findings
correlated with
the presence of infectious retrovirus in Hyate:C.
Cultures of either
ST-IOWA, 293, or PG-4 cells were inoculated
in triplicate wells with
each of the six Hyate:C lots. Over the
8-week culture period, we found
that all PG-4 and 293 cultures
inoculated with Hyate:C were negative
for PERV
pol RNA (by RT-PCR)
and ST-IOWA cultures inoculated
with Hyate:C were negative for
RT activity (data not shown). Results
from DNA PCR analysis of
293 and PG-4 cells inoculated with each of the
six Hyate:C lots
at the end of the 8-week culture period were also
negative for
PERV
pol DNA sequences, indicating the absence
of latently infected
cells (Fig.
5A). In
contrast, all control cultures inoculated
with Hyate:C spiked with
PERV-NIH supernatant had detectable RT
activity, demonstrating that
Hyate:C itself did not inhibit PERV
replication (Fig.
5B).
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 5.
(A) DNA PCR for PERV pol in 293 and PG-4
cells exposed to Hyate:C. Human 293 and feline PG-4 cells were exposed
to each of six lots of Hyate:C in triplicate (labeled A through F).
After 8 weeks of culture, DNA was isolated from each culture, and PERV
pol sequences were amplified and hybridized to a
pol-specific probe as described in Materials and Methods. P
represents the PERV-NIH positive control. (B) RT activity in cell lines
exposed to Hyate:C inoculated with PERV. Human 293, feline PG-4, or
swine ST-IOWA cells were exposed to 1:2 dilution of PERV-NIH-containing
supernatant alone (no Hyate:C) or to one of six lots of Hyate:C
(labeled A through F) diluted 1:5 in the diluted PERV-NIH-containing
supernatant. Cells not exposed to virus were negative controls for the
experiment. The y axis represents [3H]TTP
incorporated in a conventional RT assay as described in Materials and
Methods; values for the negative controls were all less than 1,000 cpm.
|
|
To assess the relative sensitivity of PERV isolation in this
experiment, each cell line was simultaneously inoculated with
PERV-NIH-containing supernatant diluted 1:2, 1:10, 1:100, or 1:1,000.
All cell lines became RT positive after exposure to the 1:100
dilution
of virus supernatant, while only the human 293 and porcine
ST-IOWA
cells became RT positive after exposure to the 1:1,000
dilution of
virus supernatant (data not
shown).
Analysis of Speywood plasma infectivity.
To determine whether
the porcine plasma that is used as the starting material to manufacture
Hyate:C contains infectious PERV, we obtained a sample of plasma from a
pool of approximately 60 pigs used by Speywood BioPharm. Measurable RT
activity was demonstrated by TM-PERT in this plasma sample, as shown in
Fig. 1. Although RT levels were lower than those observed for NIH
minipig plasmas (4.1 × 104 versus 3.3 × 106 pU/µl for the lowest NIH plasma sample), the activity
detected was over 1 log above the assay baseline (103
pU/µl). Additionally, RT-PCR for PERV envelope sequences revealed that the Speywood plasma contains all three envelope classes (data not shown).
To assay for infectious PERV in the Speywood samples, 293, ST-IOWA, and
HT1080 were used as target cells. Previous experiments
have shown
HT1080 cells to allow entry of retroviral pseudotypes
containing each
of the three
env classes (
25). Unlike the NIH
minipig plasmas that were tested, the Speywood plasma was frozen
prior to use. No evidence of infection was observed in 293, ST-IOWA,
or
HT1080 cells using the Speywood plasma as tested by conventional
RT
assay and by RT-PCR, whereas PERV-NIH-infected cells tested
positive
for RT
activity.
| |
DISCUSSION |
In this report, we evaluated five porcine plasmas for the presence
of PERV. All plasma samples examined had measurable levels of RT
activity as detected by TM-PERT and PERV RNA as detected by RT-PCR.
Four different cell substrates were used in this study to facilitate
detection of PERVs with different in vitro tropisms. Viral RNA
expression was detected in the culture supernatants of ST-IOWA cells
that were exposed to each of four NIH minipig plasmas. In addition,
these cultures were monitored for RT activity. The kinetics and
amplitude of the RT activity measured indicated that the ST-IOWA cells
were productively infected with virus derived from the porcine plasma.
RT-PCR analysis for envelope in culture supernatants of ST-IOWA cells
exposed to porcine plasma revealed that the envelope was class C in all
four samples. The absence of PERV-C env detection in
uninfected ST-IOWA cells or in control cultures of ST cells exposed to
PERV-NIH demonstrates that the PERV-C envelope sequences must have
originated from the minipig plasma samples. In vitro tropism
studies using retroviral pseudotypes demonstrate that PERV-C is mostly
restricted to cells of porcine origin, with the one exception of the
human fibrosarcoma cell line HT1080 (25). Although PERV-C
does not appear to be infectious for most human cell lines examined to
date, there may nonetheless be human cells in vivo that are susceptible
to PERV-C infection. Furthermore, it is important to note that previous
studies of MuLV have shown that as few as two to three amino acid
substitutions in the envelope protein can change viral tropism
(8, 15, 16). For example, Han et al. demonstrated that
three amino acid changes in an amphotropic MuLV envelope allowed
pseudotypes bearing this mutated envelope to infect Chinese hamster
ovary cells; this represents an expanded species tropism for
amphotropic MuLV (8). We do not know whether a similarly
small change in PERV-C could alter the species tropism, but with
mutations accumulating during viral replication, it is possible that a
humantropic variant could arise.
In four of four plasma samples, neither human 293 nor feline PG-4 cell
cultures were permissive for plasma-derived PERV, although both cell
lines were permissive for PERV-NIH. Based on previous findings, it was
expected that 293 and PG-4 cells were permissive for PERV expressing
class A and class B envelopes (25, 29). Interestingly,
sequences for all three PERV env classes were detected in
the source plasma samples. These results suggest that the viral genomes
encoding class A and class B env either were not generating infectious particles or were present at a level too low to be detected
in our culture assay. Alternatively, we cannot exclude the possibility
that PERV-A and PERV-B may be more labile than PERV-C upon
ultracentrifugation though a sucrose cushion. Detection of infectious
virus only in ST cells correlates with the previously reported tropism
of PERV-C env pseudotypes that could not infect 293 cells or
a feline cell line (25).
The finding that infectious virus could be isolated from porcine plasma
suggested that PERV may be present in biologics manufactured using
porcine plasma as a source material. To examine this possibility, we
analyzed one pig plasma derivative, porcine factor VIII (Hyate:C), and
showed it to contain PERV-specific RNA sequences and RT activity. These
findings confirm observations made by Heneine and coworkers (9). Here, we extended these findings by looking
specifically for evidence of infectious virus in the clinical lots of
Hyate:C. Infectious PERV was not detected in any of the six lots
analyzed despite extensive cultures with cell lines permissive of each of the three known PERV envelope classes. These infectivity data suggest either that the PERV associated with Hyate:C is noninfectious or that infectious PERV is present at a level below the current limit
of detection. In this experiment, the 1:1,000 dilution of PERV-NIH
could be detected in 293 and ST-IOWA cells but not PG-4 cells. The
activity of RT detected in clinical lots of Hyate:C was approximately 4 to 5 logs lower than that of a typical PERV-NIH-containing tissue
culture supernatant. One could infer that the amount of virus our
culture system can detect is 10- to 100-fold higher than the amount of
PERV in Hyate:C.
To investigate whether the source plasma used to make porcine factor
VIII contains infectious PERV, we analyzed a pooled plasma sample
obtained from Speywood BioPharm. Infectious virus was not detected,
although the sample was positive for both PERV RNA and RT activity.
Absence of infectious virus in this sample could be due to the fact
that the RT activity detected in the Speywood sample was 80 times lower
than that in the lowest-activity NIH minipig plasma, representing a
level that could be below our assay limit of detection. Alternatively,
other differences between the Speywood plasma and the NIH minipig
plasmas could contribute to the different results. The Speywood sample
had been previously filter sterilized and frozen. This process may have
removed or inactivated the infectious PERV to below detectable levels.
Additionally, breed-specific differences may influence the amount of
infectious PERV found in plasma. With the data currently available, it
cannot be concluded which of these factors affected the result or
whether the result was due to combined effects of all of them.
The absence of detectable infectious virus in both the Speywood plasma
and the clinical lots of Hyate:C provides support for the continued use
of Hyate:C in the treatment of individuals with hemophilia who have
developed inhibitors to human factor VIII. Based on this analysis, it
is unclear whether the pigs used to produce Hyate:C may contain a lower
level of PERV in their plasma or whether the manufacturing process may
contribute to a reduction in infectious virus in the clinical lots.
Lyophilization has been shown to reduce the infectious titer of
retroviruses (23, 26).
In summary, isolation of infectious PERV from porcine plasma of NIH
minipigs demonstrates that in vivo there are porcine cells that
constitutively express infectious PERV virions, reinforcing the
inherent risk of exposure to PERV when porcine cells are used for human
xenotransplantation. In addition, we show here that porcine plasma
derivatives have the potential to carry virus, although it may be
noninfectious. Our analyses suggest that differences in pig breeds and
the incorporation of manufacturing steps that remove or decrease the
load of infectious virus in the final product will reduce the risk to
patients exposed to these products.
| |
ACKNOWLEDGMENTS |
We thank Tom Lynch, formerly of the Office of Blood Research and
Review at CBER, for helpful advice and suggestions on the design of the
infectivity experiments to analyze Hyate:C, and we thank Hugh Burrill
(formerly of Speywood BioPharm, Ltd.) for information on the
manufacturing of Hyate:C and for access to the plasma used to
manufacture Hyate:C. We also thank Andrew Chang and Nancy Markovitz for
critical review of the manuscript.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: CBER, FDA,
Building 29B, Room NN11, 8800 Rockville Pike, Bethesda, MD 20892. Phone: (301) 827-0481. Fax: (301) 827-0449. E-mail:
wilsonc{at}cber.fda.gov.
| |
REFERENCES |
| 1.
|
Akiyoshi, D. E.,
M. Denaro,
H. Zhu,
J. L. Greenstein,
P. Banerjee, and J. A. Fishman.
1998.
Identification of a full-length cDNA for an endogenous retrovirus of miniature swine.
J. Virol.
72:4503-4507[Abstract/Free Full Text].
|
| 2.
|
Armstrong, J. A.,
J. S. Porterfield, and A. T. De Madrid.
1971.
C-type virus particles in pig kidney cell lines.
J. Gen. Virol.
10:195-198[Abstract/Free Full Text].
|
| 3.
|
Benveniste, R. E., and G. J. Todaro.
1975.
Evolution of type C viral genes: preservation of ancestral murine type C viral sequences in pig cellular DNA.
Proc. Natl. Acad. Sci. USA
72:4090-4094[Abstract/Free Full Text].
|
| 4.
|
Chamberland, M., and R. F. Khabbaz.
1998.
Emerging issues in blood safety.
Emerg. Infect. Dis.
12:217-229.
|
| 5.
|
Czauderna, F.,
N. Fischer,
K. Boller,
R. Kurth, and R. R. Tonjes.
2000.
Establishment and characterization of molecular clones of porcine endogenous retroviruses replicating on human cells.
J. Virol.
74:4028-4038[Abstract/Free Full Text].
|
| 6.
|
Fiks-Sigaud, M.,
L. Bendelac,
A. Parquet,
F. Verroust,
M. F. Torchet,
A. M. Berthier,
E. Fressinaud,
C. Guerois,
M. F. Aillaud,
B. Boneu,
A. Derlon,
E. Subtil,
M. A. Bertrand,
J. Y. Borg, and Y. Laurian.
1993.
Comparison of anti-human and anti-porcine factor VIII inhibitor levels in 63 patients with severe haemophilia A. A French Multicentric Study.
Vox Sang.
64:210-214[Medline].
|
| 7.
|
Fink, J. S.,
J. M. Schumacher,
S. L. Ellias,
E. P. Palmer,
M. Saint-Hilaire,
K. Shannon,
R. Penn,
P. Starr,
C. VanHorne,
H. S. Kott,
P. K. Dempsey,
A. J. Fischman,
R. Raineri,
C. Manhart,
J. Dinsmore, and O. Isacson.
2000.
Porcine xenografts in Parkinson's disease and Huntington's disease patients: preliminary results.
Cell Transplant.
9:273-278[Medline].
|
| 8.
|
Han, J. Y.,
P. M. Cannon,
K. M. Lai,
Y. Zhao,
M. V. Eiden, and W. F. Anderson.
1997.
Identification of envelope protein residues required for the expanded host range of 10A1 murine leukemia virus.
J. Virol.
71:8103-8108[Abstract].
|
| 9.
|
Heneine, W.,
W. M. Switzer,
J. M. Soucie,
B. L. Evatt,
V. Shanmugam,
G. V. Rosales,
A. Mathews,
P. Sandstrom, and T. M. Folks.
2001.
Evidence of porcine endogenous retroviruses in porcine factor VIII and evaluation of transmission to recipients with hemophilia.
J. Infect. Dis.
183:648-652[CrossRef][Medline].
|
| 10.
|
Heneine, W.,
A. Tibell,
W. M. Switzer,
P. Sandstrom,
G. V. Rosales,
A. Mathews,
O. Korsgren,
L. E. Chapman,
T. M. Folks, and C. G. Groth.
1998.
No evidence of infection with porcine endogenous retrovirus in recipients of porcine islet-cell xenografts.
Lancet
352:695-699[CrossRef][Medline].
|
| 11.
|
Kroner, B. L.,
P. S. Rosenberg,
L. M. Aledort,
W. G. Alvord, and J. J. Goedert.
1994.
HIV-1 infection incidence among persons with hemophilia in the United States and western Europe, 1978-1990. Multicenter Hemophilia Cohort Study.
J. Acquir. Immune Defic. Syndr.
7:279-286.
|
| 12.
|
Le Tissier, P.,
J. P. Stoye,
Y. Takeuchi,
C. Patience, and R. A. Weiss.
1997.
Two sets of human-tropic pig retroviruses.
Nature
389:681-682[CrossRef][Medline].
|
| 13.
|
Lieber, M. M.,
C. J. Sherr,
R. E. Benveniste, and G. J. Todaro.
1975.
Biologic and immunologic properties of porcine type C viruses.
Virology
66:616-619[CrossRef][Medline].
|
| 14.
|
Martin, U.,
V. Kiessig,
J. Blusch,
A. Haverich,
K. von der Helm,
T. Herden, and G. Steinhoff.
1998.
Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells.
Lancet
352:692-694[CrossRef][Medline].
|
| 15.
|
Masuda, M.,
C. A. Hanson,
W. G. Alvord,
P. M. Hoffman, and S. K. Ruscetti.
1996.
Effects of subtle changes in the SU protein of ecotropic murine leukemia virus on its brain capillary endothelial cell tropism and interference properties.
Virology
215:142-151[CrossRef][Medline].
|
| 16.
|
Masuda, M.,
C. A. Hanson,
P. M. Hoffman, and S. K. Ruscetti.
1996.
Analysis of the unique hamster cell tropism of ecotropic murine leukemia virus PVC-211.
J. Virol.
70:8534-8539[Abstract].
|
| 17.
|
Maudru, T., and K. Peden.
1998.
Adaptation of the fluorogenic 5'-nuclease chemistry to a PCR-based reverse transcriptase assay.
BioTechniques
25:972-975[Medline].
|
| 18.
|
Middleton, S.
1982.
Polyelectrolytes and preparation of Factor VIIIC, p. 109-120.
In
C. D. Forbes, and G.D.O. Lowe (ed.), Unresolved problems in haemophilia. MTP Press, Lancaster, United Kingdom.
|
| 19.
|
Morrison, A. E.,
C. A. Ludlam, and C. Kessler.
1993.
Use of porcine factor VIII in the treatment of patients with acquired hemophilia.
Blood
81:1513-1520[Abstract/Free Full Text].
|
| 20.
|
Paradis, K.,
G. Langford,
Z. Long,
W. Heneine,
P. Sandstrom,
W. M. Switzer,
L. E. Chapman,
C. Lockey,
D. Onions, and E. Otto.
1999.
Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue.
Science
285:1236-1241[Abstract/Free Full Text].
|
| 21.
|
Patience, C.,
G. S. Patton,
Y. Takeuchi,
R. A. Weiss,
M. O. McClure,
L. Rydberg, and M. E. Breimer.
1998.
No evidence of pig DNA or retroviral infection in patients with short-term extracorporeal connection to pig kidneys.
Lancet
352:699-701[CrossRef][Medline].
|
| 22.
|
Patience, C.,
Y. Takeuchi, and R. A. Weiss.
1997.
Infection of human cells by an endogenous retrovirus of pigs.
Nat. Med.
3:282-286[CrossRef][Medline].
|
| 23.
|
Quinnan, G. V., Jr.,
M. A. Wells,
A. E. Wittek,
M. A. Phelan,
R. E. Mayner,
S. Feinstone,
R. H. Purcell, and J. S. Epstein.
1986.
Inactivation of human T-cell lymphotropic virus, type III by heat, chemicals, and irradiation.
Transfusion
26:481-483[CrossRef][Medline].
|
| 24.
|
Strandstrom, H.,
P. Veijalainen,
V. Moennig,
G. Hunsmann,
H. Schwarz, and W. Schafer.
1974.
C-type particles produced by a permanent cell line from a leukemic pig. I. Origin and properties of the host cells and some evidence for the occurrence of type-C-like particles.
Virology
57:175-178[CrossRef][Medline].
|
| 25.
|
Takeuchi, Y.,
C. Patience,
S. Magre,
R. A. Weiss,
P. T. Banerjee,
P. L. Tissier, and J. P. Stoye.
1998.
Host range and interference studies of three classes of pig endogenous retrovirus.
J. Virol.
72:9986-9991[Abstract/Free Full Text].
|
| 26.
|
Tersmette, M.,
R. E. de Goede,
J. Over,
E. de Jonge,
H. Radema,
C. J. Lucas,
H. G. Huisman, and F. Miedema.
1986.
Thermal inactivation of human immunodeficiency virus in lyophilised blood products evaluated by ID50 titrations.
Vox Sang.
51:239-243[Medline].
|
| 27.
|
van der Laan, L. J.,
C. Lockey,
B. C. Griffeth,
F. S. Frasier,
C. A. Wilson,
D. E. Onions,
B. J. Hering,
Z. Long,
E. Otto,
B. E. Torbett, and D. R. Salomon.
2000.
Infection by porcine endogenous retrovirus after islet xenotransplantation in SCID mice.
Nature
407:90-94[CrossRef][Medline].
|
| 28.
|
Wilson, C.,
S. Wong,
J. Muller,
C. Davidson,
T. Rose, and P. Burd.
1998.
Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells.
J. Virol.
72:3082-3087[Abstract/Free Full Text].
|
| 29.
|
Wilson, C. A.,
S. Wong,
M. V. Brocklin, and M. J. Federspiel.
2000.
Extended analysis of the in vitro tropism of porcine endogenous retrovirus.
J. Virol.
74:49-56[Abstract/Free Full Text].
|
Journal of Virology, May 2001, p. 4551-4557, Vol. 75, No. 10
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.10.4551-4557.2001
This article has been cited by other articles:
-
Issa, N. C., Wilkinson, R. A., Griesemer, A., Cooper, D. K. C., Yamada, K., Sachs, D. H., Fishman, J. A.
(2008). Absence of Replication of Porcine Endogenous Retrovirus and Porcine Lymphotropic Herpesvirus Type 1 with Prolonged Pig Cell Microchimerism after Pig-to-Baboon Xenotransplantation. J. Virol.
82: 12441-12448
[Abstract]
[Full Text]
-
Argaw, T., Figueroa, M., Salomon, D. R., Wilson, C. A.
(2008). Identification of Residues outside of the Receptor Binding Domain That Influence the Infectivity and Tropism of Porcine Endogenous Retrovirus. J. Virol.
82: 7483-7491
[Abstract]
[Full Text]
-
Martina, Y., Marcucci, K. T., Cherqui, S., Szabo, A., Drysdale, T., Srinivisan, U., Wilson, C. A., Patience, C., Salomon, D. R.
(2006). Mice transgenic for a human porcine endogenous retrovirus receptor are susceptible to productive viral infection.. J. Virol.
80: 3135-3146
[Abstract]
[Full Text]
-
Fenaux, M., Opriessnig, T., Halbur, P. G., Xu, Y., Potts, B., Meng, X.-J.
(2004). Detection and in vitro and in vivo characterization of porcine circovirus DNA from a porcine-derived commercial pepsin product. J. Gen. Virol.
85: 3377-3382
[Abstract]
[Full Text]
-
Klymiuk, N., Muller, M., Brem, G., Aigner, B.
(2003). Characterization of Endogenous Retroviruses in Sheep. J. Virol.
77: 11268-11273
[Abstract]
[Full Text]
-
Wilson, C. A., Laeeq, S., Ritzhaupt, A., Colon-Moran, W., Yoshimura, F. K.
(2002). Sequence Analysis of Porcine Endogenous Retrovirus Long Terminal Repeats and Identification of Transcriptional Regulatory Regions. J. Virol.
77: 142-149
[Abstract]
[Full Text]
-
Ritzhaupt, A., van der Laan, L. J. W., Salomon, D. R., Wilson, C. A.
(2002). Porcine Endogenous Retrovirus Infects but Does Not Replicate in Nonhuman Primate Primary Cells and Cell Lines. J. Virol.
76: 11312-11320
[Abstract]
[Full Text]
-
Takefman, D. M., Spear, G. T., Saifuddin, M., Wilson, C. A.
(2002). Human CD59 Incorporation into Porcine Endogenous Retrovirus Particles: Implications for the Use of Transgenic Pigs for Xenotransplantation. J. Virol.
76: 1999-2002
[Abstract]
[Full Text]
Top
Abstract
Introduction
