JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takefman, D. M.
Right arrow Articles by Wilson, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takefman, D. M.
Right arrow Articles by Wilson, C. A.

Journal of Virology, May 2001, p. 4551-4557, Vol. 75, No. 10
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.10.4551-4557.2001

Detection and Characterization of Porcine Endogenous Retrovirus in Porcine Plasma and Porcine Factor VIII

Daniel M. Takefman,1 Susan Wong,1 Thomas Maudru,2 Keith Peden,2 and Carolyn A. Wilson1,*

Division of Cellular and Gene Therapies1 and Division of Viral Products,2 Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland

Received 13 October 2000/Accepted 5 February 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The pig genome contains porcine endogenous retroviruses (PERVs) capable of infecting human cells. Detection of infectious retrovirus in porcine peripheral blood mononuclear cells and endothelial cells suggested to us that pig plasma is likely to contain PERV. Both PERV env sequences and viral reverse transcriptase (RT) activity were detected in all plasma samples isolated from four NIH minipigs. To detect infectious virus from plasma, we performed a culture assay using three cell lines of feline, swine, and human origin that had previously been shown to be permissive for PERV. Infectious virus was successfully cultured from all four NIH minipig plasmas on the swine cell line ST-IOWA. Using RT-PCR with env-specific primers, we could detect expression of PERV class C envelope in the supernatant of ST-IOWA cells that had been exposed to each pig plasma. We next examined a pig plasma derivative, Hyate:C (porcine factor VIII), and found evidence of PERV particles, since all six lots examined were positive for PERV RNA and RT activity. However, infectious virus could not be detected in clinical lots of Hyate:C, suggesting that the manufacturing process might reduce the load of infectious virus to levels below detectable limits of the assay. Detection of infectious virus in porcine plasma confirms and extends the previous findings that certain porcine cells express PERV when manipulated in vitro and clearly demonstrates that there are porcine cells that express infectious PERV constitutively in vivo.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Biological products derived from porcine plasma are currently licensed for clinical use. For example, hemophiliacs who develop antibodies to human factor VIII can effectively use porcine plasma-derived factor VIII (6, 19). In addition to porcine plasma, porcine organs have been considered for use in human recipients to alleviate the shortage of human organs for transplantation. Porcine cells, such as fetal neuronal cells, are now under clinical investigation for treatment of human disease (7). One problem with the safety of porcine organs and plasma is the potential to expose humans to pig-derived infectious agents. Of particular concern are the findings that the genomes of all pigs contain porcine endogenous retroviruses (PERVs) that are capable of giving rise to gammaretrovirus particles (2, 3, 12, 13, 22, 24). While recent reports have not found evidence for PERV infection of humans (10, 20, 21), little is known about levels of PERV expressed in vivo in pigs or the impact of exposure to PERV in different clinical settings, such as repeat injections of plasma derivatives or long-term exposure to transplanted pig cells.

The swine genome contains 20 to 50 copies of PERV, 10 to 20 copies of which correspond to full-length provirus (1, 12, 22). Sequence analysis of full-length clones indicates that PERV is most closely related to gibbon ape leukemia and murine leukemia virus (MuLV) genomes (1, 5), sharing approximately 60% amino acid identity with the gag and pol regions. In addition to there being multiple copies of PERV per genome, there are three known receptor classes based on sequence analysis, interference, and in vitro tropism studies, named PERV-A, PERV-B, and PERV-C (1, 12, 25). Retroviral pseudotypes bearing envelopes of class A or B are capable of infecting cell lines from several mammalian species, including human, while pseudotypes carrying PERV-C envelope are mostly restricted to cells of porcine origin (25).

PERVs derived from certain porcine cell lines (22), primary porcine endothelial cells (14), primary porcine islet cells (27), and activated porcine peripheral blood mononuclear cells (PBMC) (28) are capable of infecting various human cell lines. Recovery of infectious virus from both porcine PBMC (28) and porcine endothelial cells (14) suggests that one might expect PERV to be present in pig plasma. While reverse transcriptase (RT) activity and PERV-specific RNA have been found in porcine serum (10), it is not known whether PERV present in porcine plasma is infectious.

Over the last two decades, approximately half of the hemophiliac population contracted human immunodeficiency virus from contaminated plasma (4, 11). Given the use of porcine plasma derivatives and the current exploration of porcine cells and organs for human xenotransplantation, it is critical to ascertain if porcine plasma and its derivatives carry infectious PERV. In this study, porcine plasma and a plasma derivative, factor VIII (trade name, Hyate:C), were evaluated for the presence of RT activity and for PERV env sequences. In addition, we investigated whether infectious virus is present in either porcine plasma or the porcine plasma-derived factor VIII.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cells and viruses. Four different cell lines were used in infectivity assays: human embryonic kidney 293 cells (ATCC CRL-1573), swine testis ST-IOWA cells (obtained from Richard Fister, Tufts University), human fibrosarcoma HT1080 cells (ATCC CCL-121), and a feline line of glial cells (PG-4 cells; ATCC CRL 2032). ST-IOWA and 293 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 1 mM sodium pyruvate, 100 U of penicillin per ml, and 100 µg of streptomycin per ml. HT1080 cells were maintained in Eagle's minimal essential medium supplemented with 10% FBS, 1× nonessential amino acids (Biofluids, Rockville, Md.), 0.75% sodium bicarbonate (BioWhittaker, Walkersville, Md.), 1 mM sodium pyruvate, 100 U of penicillin per ml, and 100 µg of streptomycin per ml. PG-4 cells were maintained in McCoy's 5A medium supplemented with 15% FBS, 2 mM glutamine, 1 mM sodium pyruvate, 100 U of penicillin per ml, and 100 µg of streptomycin per ml. As a positive control for infectivity studies, virus-containing supernatant was harvested from postconfluent 293 cells infected with PERV (PERV-NIH-3°) and passed through a 0.45-µm-pore-size filter to remove residual cells. This PERV was originally isolated from the supernatant of phytohemagglutinin- and phorbol myristate acetate-stimulated PBMC isolated from NIH minipigs and passaged onto 293 cells (28). The virus obtained from this culture (PERV-NIH-1°) was subsequently passaged two additional times in 293 cells to produce PERV-NIH-3°, which hereafter will be referred to as PERV-NIH. PERV-NIH has been shown to contain envelope sequences most similar to those of PERV-A (29).

Plasma virus isolation. Porcine peripheral blood (100 ml) was collected in acid citrate dextrose from NIH minipigs (NIH animal facility, Poolesville, Md.). Blood was centrifuged at 200 × g for 15 min to clarify plasma, and plasma was centrifuged at 1,000 × g for 15 min to remove any residual cells. To purify and concentrate PERV that might be present, 10 ml of freshly collected plasma was diluted with 19 ml of phosphate-buffered saline and ultracentrifuged over 7.5 ml of 20% (wt/vol) sucrose in TEN (10 mM Tris [pH 8.0], 1 mM EDTA, 100 mM NaCl) in a Beckman SW28 rotor (25,000 rpm, 3 h, 4°C). The pelleted material was resuspended in 1.5 ml of appropriate culture medium and immediately used in infectivity studies. Pilot experiments using analogous ultracentrifuge conditions resulted in reproducible recovery of infectious PERV-NIH, albeit with reductions in infectivity titer (data not shown).

Plasma used as a source material for porcine factor VIII (referred to as Speywood plasma) was obtained from Speywood BioPharm, Ltd. (Berkshire, United Kingdom), and collected as previously described (18). Briefly, blood from approximately 60 pigs that are a cross between Large White and Landrace was collected in Pallecon anticoagulant and pooled. Plasma was separated by continuous-flow centrifugation and then passed through a 0.45-µm-pore-size microbial filter. This pooled plasma was frozen before use in infectivity studies.

Detection of PERV in porcine plasma and Hyate:C. Plasma samples and clinical lots of Hyate:C were assayed for RT activity by a product-enhanced RT assay that utilizes TaqMan technology for quantitative detection (TM-PERT), performed as previously described (17). Absolute RT activities were determined by running serial dilutions of known activities of either avian myeloblastosis virus or Moloney MuLV RT (Life Technologies, Rockville, Md.). All plasma samples were ultracentrifuged prior to use in the TM-PERT as described above (i.e., 10 ml was pelleted and resuspended in 1.5 ml of medium). In all cases, the test article was examined for inhibitory effects in the assay by including a sample of the test article spiked with the positive control RT. Spiked test articles resulted in values comparable with the positive control without the test article, indicating no inhibitory effects. Negative controls of buffer without sample were run with every TM-PERT assay, and no RT activity was observed in each case. The assay baseline was the lowest concentration of positive control RT that produced a fluorescence value above threshold levels in the TaqMan assay as previously described (17).

Plasmas were also assayed for the presence of PERV-specific nucleic acids. RNA was isolated from pelleted plasma and converted to cDNA as previously described (29). To detect the three known envelope classes, the following primer pairs specific for the envelope region were used to amplify cDNA by PCR: PL 170 and PL 171 for detection of PERV-A (GenBank accession no. Y12238) (12); PL 172 and PL173 for detection of PERV-B (GenBank accession no. Y12239) (12); and MSL 1 and MSL 2 for detection of PERV-C (GenBank accession no. AF038600) (29). The PCR conditions were as follows: 30 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min after an initial 1-min denaturation step at 94°C. After the PCR products were fractionated on a 1% agarose gel, the DNA fragments were immobilized onto nylon membranes by Southern transfer. Immobilized PCR products were detected by hybridization at 37°C with the following alkaline phosphatase-labeled env-specific probes (AlkPhos Direct labeling and detection system; Amersham Life Science, Buckinghamshire, United Kingdom): PERV A env (5' GGG GAA TAG TGT ACT ATG GAG GCT CTG GGA GAA AGA AAG GA 3') for PERV-A detection (GenBank accession no. Y12238) (12); PERV B env (5' GGG ACG AGG GTC CAC TTT AAC CAT TCG CCT TAG GAT AGA G 3') for PERV-B detection (GenBank accession no. Y12239) (12); and PERV C env (5' CAG CTG GAG CCT CCA ATG GCT ATA GGA CCA AAT ACG GTC 3') for PERV C detection (GenBank accession no. AF038600) (1). All washes following hybridization were done at room temperature, and visualization was achieved by chemiluminescence with CDP-Star (Amersham Life Science) followed by exposure of autoradiography film for 1 h and overnight.

Clinical lots of Hyate:C were analyzed by RT-PCR for the presence of PERV pol sequences using previously described methods (29).

Infectivity assays using porcine plasma. Target cells were seeded into 24-well dishes at a concentration of 50,000 cells/well 1 day prior to exposure to virus. On the day of infection, PERV was harvested from postconfluent 293/PERV-NIH cultures for use as a positive control. Dilutions of PERV-NIH were prepared in culture medium, adjusted to a final Polybrene concentration of 6 µg/ml, and added to each target cell type. For plasma-derived material, ultracentrifuged pellets were resuspended in 1.5 ml of culture medium containing 6 µg of Polybrene/ml. One milliliter of either ultracentrifuged plasma or PERV-NIH-containing supernatant was added to the target cells. The following day, cells were washed with fresh medium. Negative controls were parallel cultures grown and maintained in a similar manner that were not exposed to PERV-NIH or porcine plasma.

To monitor PERV infection, cell culture supernatants were sampled periodically for a total of 8 weeks. These samples were monitored for viral RT by a conventional RT assay as previously described (28). In some cases, culture supernatants were assayed for the presence of viral RNA. RNA was isolated and converted to cDNA as previously described (29). cDNA was amplified by PCR using primers specific for the pol region of PERV (GenBank accession no. AF033259), PB906 (5'ACGTACTGGAGGAGGGTCACCTGA3') and PB908 (5'GTCCCGAACCCTTATAACCTCTTG 3'). The PCR conditions were as described above. Amplified products were fractionated on a 1% agarose gel and immobilized onto nylon membranes by Southern transfer. PCR products were detected with an alkaline phosphatase-labeled probe for pol sequences (5' TTC GAA TGG AGA GAT CCA GGT ACG GGA AGA ACC GGG CAG C 3'). Hybridization conditions and detection methods were as described above.

Infectivity assays using Hyate:C. Six lots of lyophilized Hyate:C were reconstituted with 20 ml of sterile water for injection (USP grade) according to the manufacturer's instructions. Each lot of reconstituted Hyate:C was diluted fivefold in either culture medium or PERV-containing supernatant and adjusted to a final Polybrene concentration of 6 µg/ml (based on a previous analysis of cytotoxicity of Hyate:C, it was determined that a fivefold dilution was optimal). These Hyate: C preparations were then inoculated onto triplicate wells of 12-well dishes that had been seeded 1 day previously with porcine ST-IOWA, human 293, or feline PG-4 cells. Cultures were maintained for a total of 8 weeks, with passaging twice per week. Cell supernatants were sampled every 2 weeks and assayed for PERV production by either RT activity (ST-IOWA cultures) or RT-PCR for viral RNA (293 and PG-4 cultures) (29). All positive-control cultures were assessed for RT activity by the conventional assay (28). To determine whether latent virus may be present in the Hyate:C-inoculated cultures, genomic DNA was isolated at week 8 and examined for PERV sequences by PCR as previously described (28). Negative controls were parallel cultures not exposed to Hyate:C or PERV-NIH. Positive controls included cultures inoculated with various dilutions of PERV-NIH.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Analysis of porcine plasma for presence of PERV. Plasma was isolated from four different NIH minipigs and purified by ultracentrifugation through sucrose as described in Materials and Methods. TM-PERT was used to detect retrovirus in the ultracentrifuged plasma (17). As seen in Fig. 1, RT activity was present in all four minipig plasma samples. The RT activity of the NIH minipig plasmas ranged from 3.3 × 106 to 2.4 × 107 pU of RT activity per µl, while the RT activity of the positive control PERV-NIH supernatant was 8.8 × 108 pU/µl. These values were more than 3 orders of magnitude over the assay baseline of 103 pU/µl. In parallel, each sample was independently spiked with 3.3 × 107 pU of RT enzyme. Levels of activity were comparable with the activity of a standard used as a spike, demonstrating lack of inhibitory effects (data not shown).


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 1.   RT activity in porcine plasma. All plasmas were ultracentrifuged through 20% sucrose prior to testing as described in Materials and Methods. Samples were assayed for RT activity by TM-PERT (17). Values were standardized using a curve generated from assay of serial dilutions of a stock of Moloney MuLV RT with known enzymatic activity. The assay baseline was 103 pU/µl.

RT-PCR analysis was done on the same samples to determine if the plasmas contained PERV-specific sequences. Three sets of primers were used to detect each of the three envelope classes (A, B, and C) (see Materials and Methods). All four minipig plasmas tested positive for each of the three envelope classes (data not shown).

Susceptibility of target cells to PERV-NIH. To determine whether the porcine plasma contained infectious PERV particles, three different cell lines were used to allow detection of any of the three receptor classes of PERV. Previous experiments have shown ST-IOWA cells to be permissive to retroviral pseudotypes containing each of the three env classes, while 293 and PG-4 cells are permissive to virus containing class A or class B env (25, 29). Plasmas 1 to 4 were tested in independent culture experiments with positive and negative controls included for each experiment. Positive controls were serial dilutions of PERV-NIH supernatant added to each target cell culture in parallel to exposure to pig plasma to demonstrate that culture conditions were able to support PERV replication. Infection of target cells was monitored by detection of RT activity. All cell lines tested in each of the four assays were permissive for PERV-NIH, although to varying degrees (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Relative susceptibility of target cells to PERV-NIH

Analysis of porcine plasma for infectious PERV. Plasmas from the four NIH minipigs were isolated and then ultracentrifuged over 20% sucrose to purify viral particles. Pelleted material was resuspended in culture medium and added to duplicate wells of target cells. To detect PERV replication, we assayed culture supernatants for RT activity and for viral pol sequences by RT-PCR for a period of 8 weeks. PERV replication was not detected in PG-4 and 293 cells exposed to NIH minipig plasmas. However, the ST-IOWA cells became positive for RT activity after exposure to each of the ultracentrifuged plasma samples. In Fig. 2, the levels of [3H]TTP incorporation measured in supernatants from the ST-IOWA/plasma cultures over time are shown. The average RT activity of the plasma cultures at week 8 was increased 17.1 ± 4.8 (average ± standard deviation) times the values obtained from parallel cultures of uninfected ST-IOWA cells. This consistent high increase in RT over time activity indicates that the ST-IOWA cells were infected with plasma-derived virus and that virus spread throughout the culture.


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2.   Time course of ST-IOWA infection with porcine plasma-derived virus. Culture supernatants were assayed for RT activity in a conventional RT assay (28) at weekly intervals. All control uninfected ST-IOWA cells had consistently low endogenous RT activity, and values from one representative uninfected control are shown.

Envelope classification of infectious plasma virus. Of the three cell lines used in this experiment, only ST-IOWA cells are permissive to infection by pseudotypes of PERV expressing class C envelope (25). To determine the envelope class of the infectious PERV isolated from the pig plasma, RT-PCR analysis was done on the supernatants from the ST-IOWA cells exposed to plasma 8 weeks previously, using envelope primers specific for class C (1). Since ST-IOWA cells express endogenous envelope A and B sequences (25), only expression of PERV class C sequences could be analyzed. As seen in Fig. 3, class C envelope sequences were detected in each of the four ST-IOWA cultures exposed to ultracentrifuged plasma samples, while these sequences were not detected in any of the control uninfected ST-IOWA cells or in the cultures exposed to PERV-NIH. Therefore, infection of ST-IOWA cells exposed to porcine plasma was likely the result of plasma-derived PERV that has a type C envelope.


View larger version (43K):
[in this window]
[in a new window]
 
FIG. 3.   Analysis of viral env RNA from ST-IOWA cell cultures after exposure to NIH minipig plasmas. RT-PCR analysis was done on supernatants from replicate cultures of ST-IOWA cells after exposure to each of the NIH minipig plasma samples 1 to 4, PERV-NIH, or uninfected control cells. Primers specific for class C PERV envelope sequences were used to amplify PERV-C env from these samples (25), and DNA products were detected by Southern blot analysis using a class C envelope-specific probe.

Detection of PERV in Hyate:C. To determine whether PERV would be present in a manufactured product derived from pig plasma, we analyzed six clinical lots of Hyate:C (porcine factor VIII) for the presence of PERV RNA by RT-PCR for pol sequences and for evidence of retroviral particles by measuring RT activity using TM-PERT. As shown in Fig. 4A, PERV pol RNA could be detected by RT-PCR in all lots examined. To assess whether the viral RNA may be associated with viral particles, we next tested the same lots for the presence of retroviral RT activity by TM-PERT (17). Using this method, all six lots analyzed had measurable levels of RT activity in the range of 105 to 106 pU of RT activity per µl of Hyate:C analyzed (Fig. 4B). By comparison, PERV-NIH-containing supernatant was shown to have activity 4 to 5 logs higher in the same assay (RT activity of approximately 3.3 × 1010 pU/µl).


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4.   Detection of PERV in Hyate:C. Six lots of Hyate:C, labeled A through F, were examined for PERV by RT-PCR for PERV RNA pol sequences (A) or for RT activity by TM-PERT (B). The values for RT activity were derived from a standard curve generated using dilutions of a quantitated stock of avian myeloblastosis virus RT measured in the same assay. The assay baseline was 103 pU/ml.

Since all of the lots examined were positive for both viral RNA and RT activity, we wanted to determine whether these findings correlated with the presence of infectious retrovirus in Hyate:C. Cultures of either ST-IOWA, 293, or PG-4 cells were inoculated in triplicate wells with each of the six Hyate:C lots. Over the 8-week culture period, we found that all PG-4 and 293 cultures inoculated with Hyate:C were negative for PERV pol RNA (by RT-PCR) and ST-IOWA cultures inoculated with Hyate:C were negative for RT activity (data not shown). Results from DNA PCR analysis of 293 and PG-4 cells inoculated with each of the six Hyate:C lots at the end of the 8-week culture period were also negative for PERV pol DNA sequences, indicating the absence of latently infected cells (Fig. 5A). In contrast, all control cultures inoculated with Hyate:C spiked with PERV-NIH supernatant had detectable RT activity, demonstrating that Hyate:C itself did not inhibit PERV replication (Fig. 5B).


View larger version (57K):
[in this window]
[in a new window]
 
FIG. 5.   (A) DNA PCR for PERV pol in 293 and PG-4 cells exposed to Hyate:C. Human 293 and feline PG-4 cells were exposed to each of six lots of Hyate:C in triplicate (labeled A through F). After 8 weeks of culture, DNA was isolated from each culture, and PERV pol sequences were amplified and hybridized to a pol-specific probe as described in Materials and Methods. P represents the PERV-NIH positive control. (B) RT activity in cell lines exposed to Hyate:C inoculated with PERV. Human 293, feline PG-4, or swine ST-IOWA cells were exposed to 1:2 dilution of PERV-NIH-containing supernatant alone (no Hyate:C) or to one of six lots of Hyate:C (labeled A through F) diluted 1:5 in the diluted PERV-NIH-containing supernatant. Cells not exposed to virus were negative controls for the experiment. The y axis represents [3H]TTP incorporated in a conventional RT assay as described in Materials and Methods; values for the negative controls were all less than 1,000 cpm.

To assess the relative sensitivity of PERV isolation in this experiment, each cell line was simultaneously inoculated with PERV-NIH-containing supernatant diluted 1:2, 1:10, 1:100, or 1:1,000. All cell lines became RT positive after exposure to the 1:100 dilution of virus supernatant, while only the human 293 and porcine ST-IOWA cells became RT positive after exposure to the 1:1,000 dilution of virus supernatant (data not shown).

Analysis of Speywood plasma infectivity. To determine whether the porcine plasma that is used as the starting material to manufacture Hyate:C contains infectious PERV, we obtained a sample of plasma from a pool of approximately 60 pigs used by Speywood BioPharm. Measurable RT activity was demonstrated by TM-PERT in this plasma sample, as shown in Fig. 1. Although RT levels were lower than those observed for NIH minipig plasmas (4.1 × 104 versus 3.3 × 106 pU/µl for the lowest NIH plasma sample), the activity detected was over 1 log above the assay baseline (103 pU/µl). Additionally, RT-PCR for PERV envelope sequences revealed that the Speywood plasma contains all three envelope classes (data not shown).

To assay for infectious PERV in the Speywood samples, 293, ST-IOWA, and HT1080 were used as target cells. Previous experiments have shown HT1080 cells to allow entry of retroviral pseudotypes containing each of the three env classes (25). Unlike the NIH minipig plasmas that were tested, the Speywood plasma was frozen prior to use. No evidence of infection was observed in 293, ST-IOWA, or HT1080 cells using the Speywood plasma as tested by conventional RT assay and by RT-PCR, whereas PERV-NIH-infected cells tested positive for RT activity.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In this report, we evaluated five porcine plasmas for the presence of PERV. All plasma samples examined had measurable levels of RT activity as detected by TM-PERT and PERV RNA as detected by RT-PCR. Four different cell substrates were used in this study to facilitate detection of PERVs with different in vitro tropisms. Viral RNA expression was detected in the culture supernatants of ST-IOWA cells that were exposed to each of four NIH minipig plasmas. In addition, these cultures were monitored for RT activity. The kinetics and amplitude of the RT activity measured indicated that the ST-IOWA cells were productively infected with virus derived from the porcine plasma.

RT-PCR analysis for envelope in culture supernatants of ST-IOWA cells exposed to porcine plasma revealed that the envelope was class C in all four samples. The absence of PERV-C env detection in uninfected ST-IOWA cells or in control cultures of ST cells exposed to PERV-NIH demonstrates that the PERV-C envelope sequences must have originated from the minipig plasma samples. In vitro tropism studies using retroviral pseudotypes demonstrate that PERV-C is mostly restricted to cells of porcine origin, with the one exception of the human fibrosarcoma cell line HT1080 (25). Although PERV-C does not appear to be infectious for most human cell lines examined to date, there may nonetheless be human cells in vivo that are susceptible to PERV-C infection. Furthermore, it is important to note that previous studies of MuLV have shown that as few as two to three amino acid substitutions in the envelope protein can change viral tropism (8, 15, 16). For example, Han et al. demonstrated that three amino acid changes in an amphotropic MuLV envelope allowed pseudotypes bearing this mutated envelope to infect Chinese hamster ovary cells; this represents an expanded species tropism for amphotropic MuLV (8). We do not know whether a similarly small change in PERV-C could alter the species tropism, but with mutations accumulating during viral replication, it is possible that a humantropic variant could arise.

In four of four plasma samples, neither human 293 nor feline PG-4 cell cultures were permissive for plasma-derived PERV, although both cell lines were permissive for PERV-NIH. Based on previous findings, it was expected that 293 and PG-4 cells were permissive for PERV expressing class A and class B envelopes (25, 29). Interestingly, sequences for all three PERV env classes were detected in the source plasma samples. These results suggest that the viral genomes encoding class A and class B env either were not generating infectious particles or were present at a level too low to be detected in our culture assay. Alternatively, we cannot exclude the possibility that PERV-A and PERV-B may be more labile than PERV-C upon ultracentrifugation though a sucrose cushion. Detection of infectious virus only in ST cells correlates with the previously reported tropism of PERV-C env pseudotypes that could not infect 293 cells or a feline cell line (25).

The finding that infectious virus could be isolated from porcine plasma suggested that PERV may be present in biologics manufactured using porcine plasma as a source material. To examine this possibility, we analyzed one pig plasma derivative, porcine factor VIII (Hyate:C), and showed it to contain PERV-specific RNA sequences and RT activity. These findings confirm observations made by Heneine and coworkers (9). Here, we extended these findings by looking specifically for evidence of infectious virus in the clinical lots of Hyate:C. Infectious PERV was not detected in any of the six lots analyzed despite extensive cultures with cell lines permissive of each of the three known PERV envelope classes. These infectivity data suggest either that the PERV associated with Hyate:C is noninfectious or that infectious PERV is present at a level below the current limit of detection. In this experiment, the 1:1,000 dilution of PERV-NIH could be detected in 293 and ST-IOWA cells but not PG-4 cells. The activity of RT detected in clinical lots of Hyate:C was approximately 4 to 5 logs lower than that of a typical PERV-NIH-containing tissue culture supernatant. One could infer that the amount of virus our culture system can detect is 10- to 100-fold higher than the amount of PERV in Hyate:C.

To investigate whether the source plasma used to make porcine factor VIII contains infectious PERV, we analyzed a pooled plasma sample obtained from Speywood BioPharm. Infectious virus was not detected, although the sample was positive for both PERV RNA and RT activity. Absence of infectious virus in this sample could be due to the fact that the RT activity detected in the Speywood sample was 80 times lower than that in the lowest-activity NIH minipig plasma, representing a level that could be below our assay limit of detection. Alternatively, other differences between the Speywood plasma and the NIH minipig plasmas could contribute to the different results. The Speywood sample had been previously filter sterilized and frozen. This process may have removed or inactivated the infectious PERV to below detectable levels. Additionally, breed-specific differences may influence the amount of infectious PERV found in plasma. With the data currently available, it cannot be concluded which of these factors affected the result or whether the result was due to combined effects of all of them.

The absence of detectable infectious virus in both the Speywood plasma and the clinical lots of Hyate:C provides support for the continued use of Hyate:C in the treatment of individuals with hemophilia who have developed inhibitors to human factor VIII. Based on this analysis, it is unclear whether the pigs used to produce Hyate:C may contain a lower level of PERV in their plasma or whether the manufacturing process may contribute to a reduction in infectious virus in the clinical lots. Lyophilization has been shown to reduce the infectious titer of retroviruses (23, 26).

In summary, isolation of infectious PERV from porcine plasma of NIH minipigs demonstrates that in vivo there are porcine cells that constitutively express infectious PERV virions, reinforcing the inherent risk of exposure to PERV when porcine cells are used for human xenotransplantation. In addition, we show here that porcine plasma derivatives have the potential to carry virus, although it may be noninfectious. Our analyses suggest that differences in pig breeds and the incorporation of manufacturing steps that remove or decrease the load of infectious virus in the final product will reduce the risk to patients exposed to these products.


    ACKNOWLEDGMENTS

We thank Tom Lynch, formerly of the Office of Blood Research and Review at CBER, for helpful advice and suggestions on the design of the infectivity experiments to analyze Hyate:C, and we thank Hugh Burrill (formerly of Speywood BioPharm, Ltd.) for information on the manufacturing of Hyate:C and for access to the plasma used to manufacture Hyate:C. We also thank Andrew Chang and Nancy Markovitz for critical review of the manuscript.


    FOOTNOTES

* Corresponding author. Mailing address: CBER, FDA, Building 29B, Room NN11, 8800 Rockville Pike, Bethesda, MD 20892. Phone: (301) 827-0481. Fax: (301) 827-0449. E-mail: wilsonc{at}cber.fda.gov.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Akiyoshi, D. E., M. Denaro, H. Zhu, J. L. Greenstein, P. Banerjee, and J. A. Fishman. 1998. Identification of a full-length cDNA for an endogenous retrovirus of miniature swine. J. Virol. 72:4503-4507[Abstract/Free Full Text].
2. Armstrong, J. A., J. S. Porterfield, and A. T. De Madrid. 1971. C-type virus particles in pig kidney cell lines. J. Gen. Virol. 10:195-198[Abstract/Free Full Text].
3. Benveniste, R. E., and G. J. Todaro. 1975. Evolution of type C viral genes: preservation of ancestral murine type C viral sequences in pig cellular DNA. Proc. Natl. Acad. Sci. USA 72:4090-4094[Abstract/Free Full Text].
4. Chamberland, M., and R. F. Khabbaz. 1998. Emerging issues in blood safety. Emerg. Infect. Dis. 12:217-229.
5. Czauderna, F., N. Fischer, K. Boller, R. Kurth, and R. R. Tonjes. 2000. Establishment and characterization of molecular clones of porcine endogenous retroviruses replicating on human cells. J. Virol. 74:4028-4038[Abstract/Free Full Text].
6. Fiks-Sigaud, M., L. Bendelac, A. Parquet, F. Verroust, M. F. Torchet, A. M. Berthier, E. Fressinaud, C. Guerois, M. F. Aillaud, B. Boneu, A. Derlon, E. Subtil, M. A. Bertrand, J. Y. Borg, and Y. Laurian. 1993. Comparison of anti-human and anti-porcine factor VIII inhibitor levels in 63 patients with severe haemophilia A. A French Multicentric Study. Vox Sang. 64:210-214[Medline].
7. Fink, J. S., J. M. Schumacher, S. L. Ellias, E. P. Palmer, M. Saint-Hilaire, K. Shannon, R. Penn, P. Starr, C. VanHorne, H. S. Kott, P. K. Dempsey, A. J. Fischman, R. Raineri, C. Manhart, J. Dinsmore, and O. Isacson. 2000. Porcine xenografts in Parkinson's disease and Huntington's disease patients: preliminary results. Cell Transplant. 9:273-278[Medline].
8. Han, J. Y., P. M. Cannon, K. M. Lai, Y. Zhao, M. V. Eiden, and W. F. Anderson. 1997. Identification of envelope protein residues required for the expanded host range of 10A1 murine leukemia virus. J. Virol. 71:8103-8108[Abstract].
9. Heneine, W., W. M. Switzer, J. M. Soucie, B. L. Evatt, V. Shanmugam, G. V. Rosales, A. Mathews, P. Sandstrom, and T. M. Folks. 2001. Evidence of porcine endogenous retroviruses in porcine factor VIII and evaluation of transmission to recipients with hemophilia. J. Infect. Dis. 183:648-652[CrossRef][Medline].
10. Heneine, W., A. Tibell, W. M. Switzer, P. Sandstrom, G. V. Rosales, A. Mathews, O. Korsgren, L. E. Chapman, T. M. Folks, and C. G. Groth. 1998. No evidence of infection with porcine endogenous retrovirus in recipients of porcine islet-cell xenografts. Lancet 352:695-699[CrossRef][Medline].
11. Kroner, B. L., P. S. Rosenberg, L. M. Aledort, W. G. Alvord, and J. J. Goedert. 1994. HIV-1 infection incidence among persons with hemophilia in the United States and western Europe, 1978-1990. Multicenter Hemophilia Cohort Study. J. Acquir. Immune Defic. Syndr. 7:279-286.
12. Le Tissier, P., J. P. Stoye, Y. Takeuchi, C. Patience, and R. A. Weiss. 1997. Two sets of human-tropic pig retroviruses. Nature 389:681-682[CrossRef][Medline].
13. Lieber, M. M., C. J. Sherr, R. E. Benveniste, and G. J. Todaro. 1975. Biologic and immunologic properties of porcine type C viruses. Virology 66:616-619[CrossRef][Medline].
14. Martin, U., V. Kiessig, J. Blusch, A. Haverich, K. von der Helm, T. Herden, and G. Steinhoff. 1998. Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet 352:692-694[CrossRef][Medline].
15. Masuda, M., C. A. Hanson, W. G. Alvord, P. M. Hoffman, and S. K. Ruscetti. 1996. Effects of subtle changes in the SU protein of ecotropic murine leukemia virus on its brain capillary endothelial cell tropism and interference properties. Virology 215:142-151[CrossRef][Medline].
16. Masuda, M., C. A. Hanson, P. M. Hoffman, and S. K. Ruscetti. 1996. Analysis of the unique hamster cell tropism of ecotropic murine leukemia virus PVC-211. J. Virol. 70:8534-8539[Abstract].
17. Maudru, T., and K. Peden. 1998. Adaptation of the fluorogenic 5'-nuclease chemistry to a PCR-based reverse transcriptase assay. BioTechniques 25:972-975[Medline].
18. Middleton, S. 1982. Polyelectrolytes and preparation of Factor VIIIC, p. 109-120. In C. D. Forbes, and G.D.O. Lowe (ed.), Unresolved problems in haemophilia. MTP Press, Lancaster, United Kingdom.
19. Morrison, A. E., C. A. Ludlam, and C. Kessler. 1993. Use of porcine factor VIII in the treatment of patients with acquired hemophilia. Blood 81:1513-1520[Abstract/Free Full Text].
20. Paradis, K., G. Langford, Z. Long, W. Heneine, P. Sandstrom, W. M. Switzer, L. E. Chapman, C. Lockey, D. Onions, and E. Otto. 1999. Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue. Science 285:1236-1241[Abstract/Free Full Text].
21. Patience, C., G. S. Patton, Y. Takeuchi, R. A. Weiss, M. O. McClure, L. Rydberg, and M. E. Breimer. 1998. No evidence of pig DNA or retroviral infection in patients with short-term extracorporeal connection to pig kidneys. Lancet 352:699-701[CrossRef][Medline].
22. Patience, C., Y. Takeuchi, and R. A. Weiss. 1997. Infection of human cells by an endogenous retrovirus of pigs. Nat. Med. 3:282-286[CrossRef][Medline].
23. Quinnan, G. V., Jr., M. A. Wells, A. E. Wittek, M. A. Phelan, R. E. Mayner, S. Feinstone, R. H. Purcell, and J. S. Epstein. 1986. Inactivation of human T-cell lymphotropic virus, type III by heat, chemicals, and irradiation. Transfusion 26:481-483[CrossRef][Medline].
24. Strandstrom, H., P. Veijalainen, V. Moennig, G. Hunsmann, H. Schwarz, and W. Schafer. 1974. C-type particles produced by a permanent cell line from a leukemic pig. I. Origin and properties of the host cells and some evidence for the occurrence of type-C-like particles. Virology 57:175-178[CrossRef][Medline].
25. Takeuchi, Y., C. Patience, S. Magre, R. A. Weiss, P. T. Banerjee, P. L. Tissier, and J. P. Stoye. 1998. Host range and interference studies of three classes of pig endogenous retrovirus. J. Virol. 72:9986-9991[Abstract/Free Full Text].
26. Tersmette, M., R. E. de Goede, J. Over, E. de Jonge, H. Radema, C. J. Lucas, H. G. Huisman, and F. Miedema. 1986. Thermal inactivation of human immunodeficiency virus in lyophilised blood products evaluated by ID50 titrations. Vox Sang. 51:239-243[Medline].
27. van der Laan, L. J., C. Lockey, B. C. Griffeth, F. S. Frasier, C. A. Wilson, D. E. Onions, B. J. Hering, Z. Long, E. Otto, B. E. Torbett, and D. R. Salomon. 2000. Infection by porcine endogenous retrovirus after islet xenotransplantation in SCID mice. Nature 407:90-94[CrossRef][Medline].
28. Wilson, C., S. Wong, J. Muller, C. Davidson, T. Rose, and P. Burd. 1998. Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. J. Virol. 72:3082-3087[Abstract/Free Full Text].
29. Wilson, C. A., S. Wong, M. V. Brocklin, and M. J. Federspiel. 2000. Extended analysis of the in vitro tropism of porcine endogenous retrovirus. J. Virol. 74:49-56[Abstract/Free Full Text].


Journal of Virology, May 2001, p. 4551-4557, Vol. 75, No. 10
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.10.4551-4557.2001



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takefman, D. M.
Right arrow Articles by Wilson, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takefman, D. M.
Right arrow Articles by Wilson, C. A.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Mol. Cell. Biol. Microbiol. Mol. Biol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS