This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neff, S.
Right arrow Articles by Baxt, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neff, S.
Right arrow Articles by Baxt, B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*MONENSIN

 Previous Article  |  Next Article 

Journal of Virology, January 2001, p. 527-532, Vol. 75, No. 1
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.1.527-532.2001

The Ability of Integrin alpha vbeta 3 To Function as a Receptor for Foot-and-Mouth Disease Virus Is Not Dependent on the Presence of Complete Subunit Cytoplasmic Domains

Sherry Neff and Barry Baxt*

Foot-and-Mouth Disease Research Unit, United States Department of Agriculture, Agricultural Research Service, Plum Island Animal Disease Center, Greenport, New York 11944

Received 26 April 2000/Accepted 29 September 2000


    ABSTRACT
Top
Abstract
Text
References

The integrin alpha vbeta 3 has been shown to function as one of the integrin receptors on cultured cells for foot-and-mouth disease virus (FMDV), and high-efficiency utilization of the bovine homolog of this integrin is dependent on the cysteine-rich repeat region of the bovine beta 3 subunit. In this study we have examined the role of the cytoplasmic domains of the alpha v and beta 3 subunits in FMDV infection. We have found that truncations or extensions of these domains of either subunit, including deletions removing almost all of the cytoplasmic domains, had little or no effect on the ability of the integrin to function as a receptor for FMDV. The lysosomotropic agent monensin inhibited viral replication in cells transfected with either intact or cytoplasmic domain-truncated alpha vbeta 3. In addition, viral replication in transfected cells was inhibited by an alpha vbeta 3 function-blocking antibody but not by function-blocking antibodies to three other RGD-directed integrins, suggesting that these integrins are not involved in the infectious process. These results indicate that alterations to the cytoplasmic domains of either subunit, which lead to the inability of the integrin receptor to function normally, do not abolish the ability of the integrin to bind and internalize this viral ligand.


    TEXT
Top
Abstract
Text
References

Integrins are heterodimeric cell surface receptors consisting of alpha  and beta  subunits that are involved in binding extracellular matrix proteins, cell-cell interactions, and signal transduction (20, 23). The two subunits interact noncovalently at the cell surface to bind their natural ligands via a ligand-binding region which is made up of elements of both subunits (16). Integrin subunits are type I membrane proteins consisting of a large N-terminal extracellular domain and smaller transmembrane and cytoplasmic domains. The cytoplasmic domains of the alpha  and beta  integrin subunits, specifically certain sequence motifs within those domains, have been shown to be involved in inside-out and outside-in signal transduction, integrin activation, and conformational changes leading to alterations in ligand-binding affinities and connections to the cytoskeleton (6, 7, 18, 22, 27, 37, 38, 41, 44).

Foot-and-mouth disease virus (FMDV), an aphthovirus in the family Picornaviridae, utilizes the integrin alpha vbeta 3 as a receptor in cultured cells (4, 35, 36). We have recently molecularly cloned the bovine homolog of this integrin and shown that the high-efficiency utilization of the bovine integrin as a receptor for FMDV is dependent on sequences found within the cysteine-rich repeat region of the bovine beta 3 subunit extracellular domain (35). As part of an ongoing study of the roles that the various functional domains within the integrin subunits play in FMDV infection, we have examined subunits with altered cytoplasmic domains for their ability to retain viral receptor function.

Generation of bovine alpha v and beta 3 subunits with altered cytoplasmic domains. We generated two truncation mutants and one extension mutant for each of the subunits, as shown in Fig. 1, utilizing the plasmids pBovalpha vZEO and pBovbeta 3ZEO, which encode the bovine alpha v and beta 3 integrin subunits, respectively (35). pBovalpha vZEO was used as the template for a 20-cycle PCR with the N-terminal PCR primer 5'GGAAGGTGCCTACGAAGCTGAG3' and the following C-terminal primers: for alpha vDelta 30, 5'GGAATTCCTTACATCCTGTACATTACAA3'; for alpha vDelta 20, 5'GGAATTCCTTATTGAGGTGGCCGTACACG3'; and for alpha vX29, 5'GGAATTCCTTAGTTTCAGAGTTTCCTTCGCC3'. Plasmids encoding the altered alpha v subunits were created utilizing BstEII and EcoRI sites shared by pBovalpha vZEO and the PCR products. pBovbeta 3ZEO was also used as the template for a 20-cycle PCR using the N-terminal PCR primer 5'CCACGCGTGGTGTGAGCTCCTG3' and the following C-terminal primers: for beta 3Delta 39, 5'CGGGATCCTTAGTCATGGATGGTGATGAG3'; for beta 3Delta 31, 5'CGGGATCCTTAGGCTCTGGCTCTCTCTTC3'; and for beta 3X32, 5'CGGGATCC T TAAG TGCCCCGG TACG TGATAT TG3 '. Plasmids encoding the altered beta 3 subunits were created utilizing MluI and BamHI sites shared by pBovbeta 3ZEO and the PCR products. All of the plasmid constructs were sequenced through the region that was subcloned.


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1.   Predicted amino acid sequences of wild-type and altered integrin subunit cytoplasmic domains. The sequences of the cytoplasmic domains are in uppercase letters. The last four residues of the transmembrane domains are in lowercase letters. Functionally important sequence motifs, as noted in the text, are italicized and underlined.

The amino acid sequences of the cytoplasmic domains of the wild-type and altered subunits are shown in Fig. 1. There is some question as to where the exact borders between the transmembrane and cytoplasmic domains occur in the integrin subunits. We have marked the border as lying at the YR junction for the alpha v subunit (Fig. 1a) and the WK junction for the beta 3 subunit (Fig. 1b). A recent study suggests that the first five residues of the alpha v subunit (RMGFF) and the first six residues of the beta 3 subunit (KLLITI) cytoplasmic domains, as we have represented them, are located within the cell membrane in the absence of interactions with intracellular proteins and become exposed to the cytoplasm upon binding to intracellular proteins, resulting in conformational changes leading to integrin activation and signaling (1). The mutant alpha v subunits are shown in Fig. 1a. The first, alpha vDelta 30, retains only two cytoplasmic domain amino acids and is truncated before the GFFKR motif, which is conserved among all alpha  subunits. This motif maintains integrins in a low-affinity state (8, 37, 49) and has been reported to be necessary for stabilization of the integrin alpha beta complex (48). This mutant is also lacking the PPQ(L)EE(DD) motif, which defines a beta -turn in the alpha  subunit cytoplasmic domain and is found in seven other alpha  subunits. A human alpha vbeta 3 heterodimer with a truncated alpha  subunit cytoplasmic domain lacking this motif cannot bind to either vitronectin or fibronectin (18). The second mutant, alpha vDelta 20, contains the GFFKR motif and the five amino acids downstream of it but is truncated at the last residue of the PPQEE motif. The final mutant, alpha vX29, contains the complete cytoplasmic domain of the alpha v subunit with an additional 29 amino acids added to the C terminus.

The mutant beta 3 subunits are shown in Fig. 1b. The first of these, beta 3Delta 39, retains only 8 amino acids while beta 3Delta 31 retains 16 amino acids of the beta 3 cytoplasmic domain. Neither of these two constructs contain the NPL(X)Y or the NI(X)T(X)Y motifs that have been shown to be important for signal transduction, integrin affinity states, and interaction with cytoplasmic integrin-associated proteins (7, 9, 10, 13, 15, 17, 25, 28, 31, 32, 44, 46, 54). Both of these truncations, however, still retain the membrane-proximal region of the subunit cytoplasmic domain, which has also been reported to control ligand-binding affinity and to regulate signal transduction (21, 22). The third beta 3 subunit mutant, beta 3X32, retains both the NPLY and NITY motifs along with an additional 32 amino acids added to the C terminus of the cytoplasmic domain. Additions to the cytoplasmic domains of both the alpha  and beta  subunits were made because the specific conformations of these domains appear to play a role in the way they control ligand affinity and signal transduction (21).

Analysis of integrins with altered cytoplasmic domains. Coupled in vitro transcription-translations were performed to check that the mutant-encoding plasmids that were generated were encoding proteins of the expected sizes. In all cases, the relative sizes of the resulting altered integrin subunits compared to the corresponding wild-type subunits were as expected (not shown).

To analyze whether integrin subunits with truncated or extended cytoplasmic domains could still function as receptors for FMDV, we utilized a previously described transient-expression assay system in COS-1 cells (35). Cells were plated at a density of 105 cells/well on six-well plates the day prior to transfection. Transfections were performed with 2.0 µg of each integrin-encoding plasmid utilizing the transfection reagent FuGENE 6 (Roche Molecular Biochemicals) according to the manufacturer's instructions. Twenty-four hours after transfection, the cells in each well were trypsinized and replated onto two wells of a 24-well plate. After a further 18 h of incubation, one well for each transfected condition was infected with FMDV type A12, strain 119ab, at a multiplicity of infection (MOI) of 10 PFU/cell and labeled between 4 and 18 h after infection with [35S]methionine. The other well was fixed with acetone-methanol (50:50) and analyzed by immunohistochemistry for integrin expression using the anti-alpha vbeta 3 monoclonal antibody (MAb) LM609 (MAB1976; Chemicon International) as previously described (35). Only transfections in which equal amounts of immunostaining were detected in all experimental conditions were used to analyze the results of viral infection (35). To evaluate FMDV replication in the infected-radiolabeled cultures, cell lysates were prepared in 1% Triton X-100. Equal amounts of trichloroacetic acid-precipitable counts per minute were immunoprecipitated (IP), using a virus-specific MAb, and proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using a 10% polyacrylamide gel as described (35).

The results in Fig. 2 are representative of one such transfection. Viral replication is evident in cells transfected with both wild-type bovine alpha v- and beta 3-expressing plasmids, as evidenced by the synthesis of viral proteins which are not present in nontransfected-infected cells. When cells are transfected with a wild-type alpha v subunit and any of the altered beta 3 subunits, viral replication appears to be unaffected. Similarly, when any of the three altered alpha v subunits are transfected with the wild-type beta 3 subunit, levels of infection reach those seen when both wild-type subunits are present. Viral replication was also unaffected when the two subunits with the shortest cytoplasmic domains (alpha vDelta 30 and beta 3Delta 39) were expressed together.


View larger version (91K):
[in this window]
[in a new window]
 
FIG. 2.   Analysis of viral protein synthesis in COS-1 cells transfected with integrin subunit cDNAs. Cells were transfected with plasmids encoding integrin subunits as shown. Transfected cells were infected with FMDV type A12 at an MOI of 10 PFU/cell and labeled between 4 and 18 h with [35S]methionine. Cell extracts were analyzed by IP and SDS-10% PAGE as described in the text. The locations of viral structural proteins IP from infected and labeled BHK-21 cells (lane M) are shown on the left. con, nontransfected-infected cells (control).

Viral replication mediated by integrins with truncated cytoplasmic domains in the presence of monensin. We have previously shown that the lysosomotropic ionophore monensin inhibited the replication of representative strains of all seven serotypes of FMDV (2). Monensin interferes with proton and pH gradients and raises the pH of endocytic vesicles (33, 40). In the presence of monensin, the virus adsorbed to cells normally; however, it was unable to undergo the initial alteration of the 140S virion to 12S pentameric subunits, which probably occurs within acidified endocytic vesicles and results in the release of the genome RNA (2, 3). To examine whether virus utilizing expressed integrins with truncated cytoplasmic domains as receptors infected cells through an eclipse mechanism similar to that of virus utilizing intact receptors, we transfected cells with intact and cytoplasmic domain-truncated integrin subunits, followed by infection in the presence or absence of monensin.

Cells were cotransfected with either alpha v and beta 3 subunits or alpha vDelta 30 and beta 3Delta 39 subunits. Forty-eight hours after transfection, cultures were incubated in the presence or absence of 50 µM monensin for 30 min prior to infection with FMDV type A12. Viral replication was determined by pulse-labeling cells with [35S]methionine between 5 and 6 h postinfection and analyzing cell extracts by IP and SDS-PAGE. The results are shown in Fig. 3. Cells cotransfected with intact integrin subunits and infected in the presence of monensin failed to synthesize viral proteins, indicating that the drug interfered with viral replication. Interestingly, cells cotransfected with cytoplasmic domain-truncated integrin subunits and infected in the presence of monensin also failed to synthesize viral proteins. In contrast, cells cotransfected with either intact or truncated integrins synthesized normal amounts of viral proteins when monensin was added at 2 h after infection, indicating that monensin inhibited an early event in viral replication, probably at the eclipse phase, as we have shown previously (2). Therefore, complete integrin subunit cytoplasmic domains are not necessary for internalization of virions into endocytic vesicles.


View larger version (74K):
[in this window]
[in a new window]
 
FIG. 3.   Analysis of transfected COS-1 cells infected in the presence of monensin. Cells were cotransfected with integrin subunits containing intact cytoplasmic domains or alpha vDelta 30 and beta 3Delta 39 as shown. Thirty minutes prior to infection, the medium was removed from some wells and replaced with medium containing 50 µM monensin (lanes mon -30min). Cells were infected in either the presence or absence (con) of monensin as noted. At 2 h after infection, the medium was removed from other wells and replaced with medium containing 50 µM monensin (lanes mon +2hr). At 4.5 h after infection, all cultures were incubated in minimal essential medium without L-methionine, with or without monensin, for 30 min. [35S]methionine (75 µCi) was added, and cells were labeled for 1 h. Cell extracts were prepared, and analysis of viral proteins by IP and SDS-10% PAGE was done as described in the text. The locations of marker FMDV structural proteins (lane M) are shown on the left.

Thus, bovine alpha vbeta 3 is able to function as a receptor for FMDV in the absence of motifs that are known to be required for the normal function of integrins in the context of their natural ligands. The truncations of the cytoplasmic domains of either the alpha v or beta 3 subunits and the addition of random amino acids to the subunits' cytoplasmic domains did not affect the ability of integrins to serve as receptors for FMDV, and the results show that when utilized as receptors, integrins altered in this manner were utilized as well as intact integrins.

Effect of integrin function-blocking antibodies on viral infection in transfected cells. The internalization of natural integrin ligands has not been extensively studied. The NPXY motif, found in the cytoplasmic domains of all beta  subunits and other transmembrane receptors, has been reported to be required for internalization of bacteria mediated by beta 1 integrins (47), internalization mediated by the nonintegrin low-density lipoprotein receptor (12), and a signal for clathrin complex assembly (11). More recent results have shown that sequences surrounding the NPXY motif are important in association of the alpha vbeta 5 receptor with clathrin-coated pits via the beta 5 cytoplasmic domain (13). The internalization of vitronectin by alpha vbeta 3, however, appears to require a signal as a result of the ligation of the alpha 5beta 1 integrin (39). This cross talk between the alpha vbeta 3 and alpha 5beta 1 integrins requires the beta 3 cytoplasmic domain (5). Our results would rule out a cross talk mechanism of viral internalization, since important cytoplasmic domain motifs have been deleted from some of the subunit constructs. The results, however, might indicate that other cell surface molecules are acting as coreceptors for viral infection or that the expression of alpha vbeta 3 in COS cells is activating another receptor and the integrin itself is not involved in viral binding or internalization. Although, at this time, we have no evidence that a coreceptor, either integrin or nonintegrin, is required for infection, we examined the possibility that other RGD-directed integrins might be involved in the infectious process in alpha vbeta 3-transfected COS cells.

Cells were transfected with alpha vbeta 3 cDNAs, as described, and 30 min prior to infection with FMDV type A12, they were incubated with function-blocking antibodies to alpha vbeta 3, alpha vbeta 5, alpha vbeta 6, alpha 5, or beta 1. All of these integrins interact with their natural ligands through an RGD sequence (42), and the alpha vbeta 6 integrin has recently been shown to be a receptor for FMDV (24), a result we have confirmed in our laboratory (not shown). In this experiment, we measured productive viral replication by determining the plaque titer of infectious virus immediately following a 45-min adsorption period and after 24 h of incubation. As a control, to determine the level of FMDV replication in COS cell cultures, a nontransfected culture was infected with an FMDV type O1 Campos variant containing a heparin-binding site in VP3 (43), which we have previously shown to require only the presence of cell surface heparan sulfate (HS), and not alpha vbeta 3, to infect cells (36). The results of this experiment are shown in Fig. 4.


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4.   Effect of anti-integrin function-blocking MAbs on viral replication in transfected COS-1 cells. Cells were cotransfected with alpha vbeta 3-encoding plasmids as described in the text. Thirty minutes prior to infection, paired transfected cell cultures were incubated at room temperature with the following function-blocking anti-integrin MAbs at a concentration of 25 µg/ml (all antibodies were from Chemicon International Inc): anti-alpha vbeta 3 (clone LM609; MAB1976), anti-alpha vbeta 5 (clone P1F6; MAB1961), anti-alpha vbeta 6 (clone 10D5; MAB2077Z), anti-alpha 5 (clone CLB-705; MAB1986), and anti-beta 1 (clone 6S6; MAB2253). Transfected and nontransfected cultures were infected in pairs with type A12 at an MOI of 1 PFU/cell in the presence of the antibodies. One nontransfected culture pair was infected with the HS-binding O1 Campos variant vCRM4 (43) at an MOI of 1 PFU/cell. After an adsorption period of 45 min at 37°C, all cultures were washed with a low-pH buffer (25 mM MES [morpholineethanesulfonic acid, pH 5.5], 140 mM NaCl) to inactivate any nonadsorbed or noninternalized virus. After the addition of medium, one of the infected pairs was immediately frozen at -70°C to determine viral infectivity remaining at the end of the adsorption period (shaded bars). The other pair was incubated for 24 h at 37°C (solid bars) and then placed at -70°C. After thawing, cell debris was removed by centrifugation, and plaque titer was determined on BHK-21 cells.

In nontransfected COS cells, there was no increase in titer of type A12 at 24 h, indicating that viral replication did not take place in these cells, as we have previously shown in experiments utilizing detection of radioactively labeled viral proteins (35) (Fig. 2). In contrast, the heparin-binding type O1 variant showed an increase in titer of about 10-fold after 24 h in nontransfected cells, also confirming previously reported results (36). In alpha vbeta 3-transfected COS cells, the type A12 virus titer increased about 10-fold, again confirming results obtained by detection of viral proteins in infected cells (35) (Fig. 2). When transfected cells were treated with integrin function-blocking antibodies, only the antibody to alpha vbeta 3 and not those against any of the other integrins was capable of inhibiting viral replication (Fig. 4). The same experiment performed in cells transfected with the alpha vDelta 30 and beta 3Delta 39 cDNAs yielded nearly identical results (not shown). These results indicate that, in this transfection system, the alpha vbeta 3 integrin is absolutely required for productive viral infection and at least three other RGD-directed integrins (alpha vbeta 5, alpha vbeta 6, and alpha 5beta 1) do not appear to be involved in this process. In addition, since the anti-beta 1 antibody has been shown to inhibit the function of at least two other beta 1 integrins (alpha 2beta 1 and alpha 4beta 1) (19), other integrins of this subclass are also probably not involved in viral infection. At this time, however, we cannot rule out a role for other cell surface molecules as coreceptors for either FMDV adsorption or internalization. We can, however, rule out HS as a coreceptor for type A12, as we have previously shown that this virus can replicate in alpha vbeta 3 cDNA-transfected HS-deficient CHO cells (36).

These results are similar to those reported for three other picornaviruses (poliovirus, rhinovirus 14, and coxsackievirus B3), all of whose single-subunit receptors appear to function normally in the absence of cytoplasmic domains (26, 45, 52). Human adenovirus (Ad) requires interaction with the integrin alpha vbeta 5 or alpha vbeta 3 for internalization into cells through a clathrin-coated pit pathway requiring dynamin (51, 53). We have not yet examined the role of dynamin in FMDV internalization, but in studies with two other picornaviruses, human rhinovirus 14 required dynamin for productive infection while poliovirus did not (14). Recently it has been shown that Ad internalization requires signaling through the focal adhesion kinase pathway involving phosphoinositide-3-OH kinase and GTP-binding proteins, all of which are activated following binding of integrins to their natural ligands (29, 30). In addition, the cytoplasmic domain of the beta 5 subunit of the alpha vbeta 5 integrin is essential for Ad-mediated gene delivery via host cell membrane penetration from endosomes (50). However, truncations of the beta 5 cytoplasmic domain, which still retains the NPXY motif, and do not allow Ad-mediated gene delivery do not abolish alpha vbeta 5-mediated Ad internalization (50). At least two picornavirus receptors, the coxsackievirus and adenovirus receptors, and ICAM-1 also do not require their transmembrane domains for receptor function (45, 52). Soluble human alpha vbeta 3 lacking both the transmembrane and cytoplasmic domains of both subunits can still bind to its natural ligands with high affinity (34); however, we have not examined either soluble or glycosylphosphatidylinositol-anchored alpha vbeta 3 for virus binding or the ability to act as a functional receptor.

The results we have presented, however, indicate that deletions of any of the important cytoplasmic domain motifs had little or no effect on receptor utilization by FMDV. In fact, the results showing that monensin still inhibited infection mediated by cytoplasmic domain-truncated alpha vbeta 3 suggest that these receptors are internalizing FMDV through the same mechanism as complete integrins. In addition, we have also shown that three other RGD-directed integrins do not appear to play any role in productive viral infection. Further studies will be necessary to delineate the exact mechanism by which intact and altered integrin subunits internalize virus.


    ACKNOWLEDGMENTS

We thank Michael LaRocco for excellent technical assistance.


    FOOTNOTES

* Corresponding author. Mailing address: USDA, ARS, Plum Island Animal Disease Center, P.O. Box 848, Greenport, NY 11944-0848. Phone: (631) 323-3354. Fax: (631) 323-2507. E-mail: bbaxt{at}piadc.ars.usda.gov.


    REFERENCES
Top
Abstract
Text
References

1. Armulik, A., I. Nilsson, G. von Heijne, and S. Johansson. 1999. Determination of the border between the transmembrane and cytoplasmic domains of human integrin subunits. J. Biol. Chem. 274:37030-37034[Abstract/Free Full Text].
2. Baxt, B. 1987. Effect of lysosomotropic compounds on early events in foot-and-mouth disease virus replication. Virus Res. 7:257-271[CrossRef][Medline].
3. Baxt, B., and H. L. Bachrach. 1980. Early interactions of foot-and-mouth disease virus with cultured cells. Virology 104:42-55[CrossRef][Medline].
4. Berinstein, A., M. Roivainen, T. Hovi, P. W. Mason, and B. Baxt. 1995. Antibodies to the vitronectin receptor (integrin alpha vbeta 3) inhibit binding and infection of foot-and-mouth disease virus to cultured cells. J. Virol. 69:2664-2666[Abstract].
5. Blystone, S. D., F. P. Lindberg, S. E. LaFlamme, and E. J. Brown. 1995. Integrin beta 3 cytoplasmic tail is necessary and sufficient for regulation of alpha 5beta 1 phagocytosis by alpha vbeta 3 and integrin-associated protein. J. Cell Biol. 130:745-754[Abstract/Free Full Text].
6. Blystone, S. D., F. P. Lindberg, M. P. Williams, K. McHugh, and E. J. Brown. 1996. Inducible tyrosine phosphorylation of the beta 3 integrin requires the alpha v integrin cytoplasmic tail. J. Biol. Chem. 271:31458-31462[Abstract/Free Full Text].
7. Blystone, S. D., M. P. Williams, S. E. Slater, and E. J. Brown. 1997. Requirement of integrin beta 3 tyrosine 747 for beta 3 tyrosine phosphorylation and regulation of alpha vbeta 3 avidity. J. Biol. Chem. 272:28757-28761[Abstract/Free Full Text].
8. Briesewitz, R., A. Kern, L. B. Smilenov, F. S. David, and E. E. Marcantonio. 1996. The membrane-cytoplasm interface of integrin alpha  subunits is critical for receptor latency. Mol. Biol. Cell 7:1499-1509[Abstract].
9. Calderwood, D. A., R. Zent, R. Grant, D. Jasper, G. Rees, R. O. Hynes, and M. H. Ginsberg. 1999. The talin head domain binds to integrin beta  subunit cytoplasmic tails and regulates integrin activation. J. Biol. Chem. 274:28071-28074[Abstract/Free Full Text].
10. Chang, D. D., C. Wong, H. Smith, and J. Liu. 1997. ICAP-1, a novel beta 1 integrin cytoplasmic domain-associated protein, binds to a conserved and functionally important NPXY sequence motif of beta 1 integrin. J. Cell Biol. 138:1149-1157[Abstract/Free Full Text].
11. Chen, W. J., J. L. Goldstein, and M. S. Brown. 1990. NPXY, a sequence often found in cytoplasmic tails, is required for coated pit-mediated internalization of the low density lipoprotein receptor. J. Biol. Chem. 265:3116-3123[Abstract/Free Full Text].
12. Davis, C. G., J. L. Goldstein, T. C. Sudhof, R. G. W. Amderson, D. W. Russell, and M. S. Brown. 1987. Acid-dependent ligand dissociation and recycling of LDL receptor mediated by growth factor homology region. Nature 320:760-765.
13. De Deyne, P. G., A. O'Neill, W. G. Resneck, G. M. Dmytrenko, D. W. Pumplin, and R. J. Bloch. 1998. The vitronectin receptor associates with clathrin-coated membrane domains via the cytoplasmic domain of its beta 5 subunit. J. Cell Sci. 111:2729-2740[Abstract].
14. De Tulleo, L., and T. Kirchhausen. 1998. The clathrin endocytic pathway in viral infection. EMBO J. 17:4585-4593[CrossRef][Medline].
15. Eigenthaler, M., L. Höfferer, S. J. Shattil, and M. H. Ginsberg. 1997. A conserved sequence motif in the integrin beta 3 cytoplasmic domain is required for its specific interaction with beta 3-endonexin. J. Biol. Chem. 272:7693-7698[Abstract/Free Full Text].
16. Fernández, C., K. Clark, L. Burrows, N. R. Schofield, and M. J. Humphries. 1998. Regulation of the extracellular ligand binding activity of integrins. Front. Biosci. 3:684-700.
17. Filardo, E. J., P. C. Brooks, S. L. Deming, C. Damsky, and D. A. Cheresh. 1995. Requirement of the NPXY motif in the integrin beta 3 subunit cytoplasmic tail for melanoma cell migration in vitro and in vivo. J. Cell Biol. 130:441-450[Abstract/Free Full Text].
18. Filardo, E. J., and D. A. Cheresh. 1994. A beta  turn in the cytoplasmic tail of the integrin alpha v subunit influences conformation and ligand binding of alpha vbeta 3. J. Biol. Chem. 269:4641-4647[Abstract/Free Full Text].
19. Gao, J. X., J. Wilkins, and A. C. Issekutz. 1995. Migration of human polymorphonuclear leukocytes through a synovial fibroblast barrier is mediated by both beta 2 (CD11/CD18) integrins and the beta 1 (CD29) integrins VLA-5 and VLA-6. Cell. Immunol. 163:178-186[CrossRef][Medline].
20. González-Amaro, R., and F. Sánchez-Madrid. 1999. Cell adhesion molecules: selectins and integrins. Crit. Rev. Immunol. 19:389-429[Medline].
21. Haas, T. A., and E. F. Plow. 1997. Development of a structural model for the cytoplasmic domain of an integrin. Protein Eng. 10:1395-1405[Abstract/Free Full Text].
22. Hughes, P. E., T. E. O'Toole, J. Ylänne, S. J. Shattil, and M. H. Ginsberg. 1995. The conserved membrane-proximal region of an integrin cytoplasmic domain specifies ligand binding affinity. J. Biol. Chem. 270:12411-12417[Abstract/Free Full Text].
23. Hynes, R. O. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69:11-25[CrossRef][Medline].
24. Jackson, T., D. Sheppard, M. Denyer, W. Blakemore, and A. M. Q. King. 2000. The epithelial integrin alpha vbeta 6 is a receptor for foot-and-mouth disease virus. J. Virol. 74:4949-4956[Abstract/Free Full Text].
25. Jenkins, A. L., L. Nannizzi-Alaimo, D. Silver, J. R. Sellers, M. H. Ginsberg, D. A. Law, and D. R. Phillips. 1998. Tyrosine phosphorylation of the beta 3 cytoplasmic domain mediates integrin-cytoskeletal interactions. J. Biol. Chem. 273:13878-13885[Abstract/Free Full Text].
26. Koike, S., I. Ise, and A. Nomoto. 1991. Functional domains of the poliovirus receptor. Proc. Natl. Acad. Sci. USA 88:4104-4108[Abstract/Free Full Text].
27. Law, D. A., F. R. DeGuzman, P. Heiser, K. Ministri-Madrid, N. Kileen, and D. R. Phillips. 1999. Integrin cytoplasmic tyrosine motif is required for outside-in alpha IIbbeta 3 signaling and platelet function. Nature 401:808-811[CrossRef][Medline].
28. Lerea, K. M., K. P. Cordero, K. S. Sakariassen, R. I. Kirk, and V. A. Fried. 1999. Phosphorylation sites in the integrin beta 3 cytoplasmic domain in intact platelets. J. Biol. Chem. 274:1914-1919[Abstract/Free Full Text].
29. Li, E., D. Stupack, G. M. Bokoch, and G. R. Nemerow. 1998. Adenovirus endocytosis requires actin cytoskeleton reorganization mediated by rho family GTPases. J. Virol. 72:8806-8812[Abstract/Free Full Text].
30. Li, E., D. Stupack, R. Klemke, D. A. Cheresh, and G. R. Nemerow. 1998. Adenovirus endocytosis via alpha v integrins requires phosphoinositide-3-OH kinase. J. Virol. 72:2055-2061[Abstract/Free Full Text].
31. Liu, H.-Y., S. A. Timmons, Y.-Z. Lin, and J. Hawieger. 1996. Identification of a functionally important sequence in the cytoplasmic tail of integrin beta 3 by using cell-permeable peptide analogs. Proc. Natl. Acad. Sci. USA 93:11819-11824[Abstract/Free Full Text].
32. Mastrangelo, A. M., S. H. Homan, M. J. Humphries, and S. E. LaFlamme. 1999. Amino acid motifs required for isolated beta  cytoplasmic domains to regulate "in trans" beta 1 integrin conformation and function in cell attachment. J. Cell Sci. 112:217-229[Abstract].
33. Maxfield, F. R. 1982. Weak bases and ionophores rapidly and reversibly raise the pH of endocytic vesicles in cultured mouse fibroblasts. J. Cell Biol. 95:676-681[Abstract/Free Full Text].
34. Mehta, R. J., B. Diefenbach, A. Brown, E. Cullen, A. Jonczyk, D. Gussow, G. A. Luckenbach, and S. L. Goodman. 1998. Transmembrane-truncated alpha vbeta 3 integrin retains high affinity for ligand binding: evidence for an "inside-out" suppressor? Biochem. J. 330:861-869.
35. Neff, S., P. W. Mason, and B. Baxt. 2000. High-efficiency utilization of the bovine integrin alpha vbeta 3 as a receptor for foot-and-mouth disease virus is dependent on the bovine beta 3 subunit. J. Virol. 74:7298-7306[Abstract/Free Full Text].
36. Neff, S., D. Sá- Carvalho, E. Rieder, P. W. Mason, S. D. Blystone, E. J. Brown, and B. Baxt. 1998. Foot-and-mouth disease virus virulent for cattle utilizes the integrin alpha vbeta 3 as its receptor. J. Virol. 72:3587-3594[Abstract/Free Full Text].
37. O'Toole, T. E., Y. Katagiri, R. J. Faull, K. Peter, R. Tamura, V. Quaranta, J. C. Loftus, S. J. Shattil, and M. H. Ginsberg. 1994. Integrin cytoplasmic domains mediate inside-out signal transduction. J. Cell Biol. 124:1047-1059[Abstract/Free Full Text].
38. Pfaff, M., S. Liu, D. J. Erie, and M. H. Ginsberg. 1998. Integrin beta  cytoplasmic domains differentially bind to cytoskeletal proteins. J. Biol. Chem. 273:6104-6109[Abstract/Free Full Text].
39. Pijuan-Thompson, V., and C. L. Gladson. 1997. Ligation of integrin alpha 5beta 1 is required for internalization of vitronectin by integrin alpha vbeta 3. J. Biol. Chem. 272:2736-2743[Abstract/Free Full Text].
40. Pressman, B. C. 1976. Biological applications of ionophores. Annu. Rev. Biochem. 45:501-530[CrossRef][Medline].
41. Puzon-McLaughlin, W., T. A. Yednock, and Y. Takada. 1996. Regulation of conformation and ligand binding function of integrin alpha 5beta 1 by the beta 1 cytoplasmic domain. J. Biol. Chem. 271:16580-16585[Abstract/Free Full Text].
42. Ruoslahti, E. 1996. RGD and other recognition sequences for integrins. Annu. Rev. Cell Dev. Biol. 12:697-715[CrossRef][Medline].
43. Sá-Carvalho, D., E. Rieder, B. Baxt, R. Rodarte, A. Tanuri, and P. W. Mason. 1997. Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. J. Virol. 71:5115-5123[Abstract].
44. Schaffner-Reckinger, E., V. Gouon, C. Melchior, S. Plançon, and N. Kieffer. 1998. Distinct involvement of beta 3 integrin cytoplasmic domain tyrosine residues 747 and 759 in integrin-mediated cytoskeletal assembly and phosphotyrosine signaling. J. Biol. Chem. 273:12623-12632[Abstract/Free Full Text].
45. Staunton, D. E., A. Gaur, P. Y. Chan, and T. A. Springer. 1992. Internalization of a major group human rhinovirus does not require cytoplasmic or transmembrane domains of ICAM-1. J. Immunol. 148:3271-3274[Abstract].
46. Tahiliani, P. D., L. Singh, K. L. Auer, and S. E. LaFlamme. 1997. The role of conserved amino acid motifs within the integrin beta 3 cytoplasmic domain in triggering focal adhesion kinase phosphorylation. J. Biol. Chem. 272:7892-7898[Abstract/Free Full Text].
47. Tran Van Nhieu, G., E. S. Krukonis, A. A. Reszka, A. F. Horwitz, and R. R. Isberg. 1996. Mutations in the cytoplasmic domain of the integrin beta  chain indicate a role for endocytosis factors in bacterial internalization. J. Biol. Chem. 271:7665-7672[Abstract/Free Full Text].
48. Vallar, L., C. Melchior, S. Plançon, H. Drobecq, G. Lippens, V. Regnault, and N. Kieffer. 1999. Divalent cations differentially regulate integrin alpha IIb cytoplasmic tail binding to beta 3 and to calcium- and integrin-binding protein. J. Biol. Chem. 274:17257-17266[Abstract/Free Full Text].
49. Vinogradova, O., T. Haas, E. F. Plow, and J. Qin. 2000. A structural basis for integrin activation by the cytoplasmic tail of the alpha IIb-subunit. Proc. Natl. Acad. Sci. USA 97:1450-1455[Abstract/Free Full Text].
50. Wang, K., T. Guan, D. A. Cheresh, and G. R. Nemerow. 2000. Regulation of adenovirus membrane penetration by the cytoplasmic tail of integrin beta 5. J. Virol. 74:2731-2739[Abstract/Free Full Text].
51. Wang, K., S. Huang, A. Kapoor-Munshi, and G. Nemerow. 1998. Adenovirus internalization and infection require dynamin. J. Virol. 72:3455-3458[Abstract/Free Full Text].
52. Wang, X., and J. M. Bergelson. 1999. Coxsackievirus and adenovirus receptor cytoplasmic and transmembrane domains are not essential for coxsackievirus and adenovirus infection. J. Virol. 73:2559-2562[Abstract/Free Full Text].
53. Wickham, T. J., P. Mathias, D. A. Cheresh, and G. R. Nemerow. 1993. Integrins alpha vbeta 3 and alpha vbeta 5 promote adenovirus internalization but not virus attachment. Cell 73:309-319[CrossRef][Medline].
54. Ylänne, J. 1998. Conserved functions of the cytoplasmic domains of integrin beta subunits. Front. Biosci. 3:877-886.


Journal of Virology, January 2001, p. 527-532, Vol. 75, No. 1
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.1.527-532.2001



This article has been cited by other articles:

  • Gulbahar, M. Y., Davis, W. C., Guvenc, T., Yarim, M., Parlak, U., Kabak, Y. B. (2007). Myocarditis Associated with Foot-and-Mouth Disease Virus Type O in Lambs. Vet Pathol 44: 589-599 [Abstract] [Full Text]  
  • O'Donnell, V., LaRocco, M., Duque, H., Baxt, B. (2005). Analysis of Foot-and-Mouth Disease Virus Internalization Events in Cultured Cells. J. Virol. 79: 8506-8518 [Abstract] [Full Text]  
  • Monaghan, P., Simpson, J., Murphy, C., Durand, S., Quan, M., Alexandersen, S. (2005). Use of Confocal Immunofluorescence Microscopy To Localize Viral Nonstructural Proteins and Potential Sites of Replication in Pigs Experimentally Infected with Foot-and-Mouth Disease Virus. J. Virol. 79: 6410-6418 [Abstract] [Full Text]  
  • Duque, H., LaRocco, M., Golde, W. T., Baxt, B. (2004). Interactions of Foot-and-Mouth Disease Virus with Soluble Bovine {alpha}V{beta}3 and {alpha}V{beta}6 Integrins. J. Virol. 78: 9773-9781 [Abstract] [Full Text]  
  • Jackson, T., Clark, S., Berryman, S., Burman, A., Cambier, S., Mu, D., Nishimura, S., King, A. M. Q. (2004). Integrin {alpha}v{beta}8 Functions as a Receptor for Foot-and-Mouth Disease Virus: Role of the {beta}-Chain Cytodomain in Integrin-Mediated Infection. J. Virol. 78: 4533-4540 [Abstract] [Full Text]  
  • Grubman, M. J., Baxt, B. (2004). Foot-and-Mouth Disease. Clin. Microbiol. Rev. 17: 465-493 [Abstract] [Full Text]  
  • Duque, H., Baxt, B. (2003). Foot-and-Mouth Disease Virus Receptors: Comparison of Bovine {alpha}V Integrin Utilization by Type A and O Viruses. J. Virol. 77: 2500-2511 [Abstract] [Full Text]  
  • Miller, L. C., Blakemore, W., Sheppard, D., Atakilit, A., King, A. M. Q., Jackson, T. (2001). Role of the Cytoplasmic Domain of the {beta}-Subunit of Integrin {alpha}v{beta}6 in Infection by Foot-and-Mouth Disease Virus. J. Virol. 75: 4158-4164 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neff, S.
Right arrow Articles by Baxt, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neff, S.
Right arrow Articles by Baxt, B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*MONENSIN