Previous Article | Next Article 
Journal of Virology, January 2001, p. 527-532, Vol. 75, No. 1
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.1.527-532.2001
The Ability of Integrin
v
3 To Function as a Receptor for
Foot-and-Mouth Disease Virus Is Not Dependent on the Presence of
Complete Subunit Cytoplasmic Domains
Sherry
Neff and
Barry
Baxt*
Foot-and-Mouth Disease Research Unit, United
States Department of Agriculture, Agricultural Research Service,
Plum Island Animal Disease Center, Greenport, New York 11944
Received 26 April 2000/Accepted 29 September 2000
 |
ABSTRACT |
The integrin 
v
3 has been shown to
function as one of the integrin receptors on cultured cells for
foot-and-mouth disease virus (FMDV), and high-efficiency utilization of
the bovine homolog of this integrin is dependent on the cysteine-rich
repeat region of the bovine 3 subunit. In this study we
have examined the role of the cytoplasmic domains of the
v and 3 subunits in FMDV infection. We
have found that truncations or extensions of these domains of either
subunit, including deletions removing almost all of the cytoplasmic
domains, had little or no effect on the ability of the integrin to
function as a receptor for FMDV. The lysosomotropic agent monensin
inhibited viral replication in cells transfected with either intact or
cytoplasmic domain-truncated v3. In
addition, viral replication in transfected cells was inhibited by an
v3 function-blocking antibody but not by
function-blocking antibodies to three other RGD-directed integrins,
suggesting that these integrins are not involved in the infectious
process. These results indicate that alterations to the cytoplasmic
domains of either subunit, which lead to the inability of the integrin
receptor to function normally, do not abolish the ability of the
integrin to bind and internalize this viral ligand.
| |
TEXT |
Integrins are heterodimeric cell
surface receptors consisting of and subunits that are involved
in binding extracellular matrix proteins, cell-cell interactions, and
signal transduction (20, 23). The two subunits interact
noncovalently at the cell surface to bind their natural ligands via a
ligand-binding region which is made up of elements of both subunits
(16). Integrin subunits are type I membrane proteins
consisting of a large N-terminal extracellular domain and smaller
transmembrane and cytoplasmic domains. The cytoplasmic domains of the
and integrin subunits, specifically certain sequence motifs
within those domains, have been shown to be involved in inside-out and
outside-in signal transduction, integrin activation, and conformational
changes leading to alterations in ligand-binding affinities and
connections to the cytoskeleton (6, 7, 18, 22, 27, 37, 38, 41,
44).
Foot-and-mouth disease virus (FMDV), an aphthovirus in the family
Picornaviridae, utilizes the integrin
v3 as a receptor in cultured cells
(4, 35, 36). We have recently molecularly cloned the
bovine homolog of this integrin and shown that the high-efficiency
utilization of the bovine integrin as a receptor for FMDV is dependent
on sequences found within the cysteine-rich repeat region of the bovine
3 subunit extracellular domain (35). As
part of an ongoing study of the roles that the various functional domains within the integrin subunits play in FMDV infection, we have
examined subunits with altered cytoplasmic domains for their ability to
retain viral receptor function.
Generation of bovine v and 3 subunits
with altered cytoplasmic domains.
We generated two truncation
mutants and one extension mutant for each of the subunits, as shown in
Fig. 1, utilizing the plasmids pBovvZEO and pBov3ZEO, which encode the
bovine v and 3 integrin subunits,
respectively (35). pBovvZEO was used as the
template for a 20-cycle PCR with the N-terminal PCR primer
5'GGAAGGTGCCTACGAAGCTGAG3' and the following C-terminal
primers: for v
30,
5'GGAATTCCTTACATCCTGTACATTACAA3'; for v20,
5'GGAATTCCTTATTGAGGTGGCCGTACACG3'; and for
vX29, 5'GGAATTCCTTAGTTTCAGAGTTTCCTTCGCC3'. Plasmids encoding the altered v subunits
were created utilizing BstEII and EcoRI sites
shared by pBovvZEO and the PCR products. pBov3ZEO was also used as the template for a 20-cycle
PCR using the N-terminal PCR primer 5'CCACGCGTGGTGTGAGCTCCTG3'
and the following C-terminal primers: for 339,
5'CGGGATCCTTAGTCATGGATGGTGATGAG3'; for
331, 5'CGGGATCCTTAGGCTCTGGCTCTCTCTTC3';
and for 3X32,
5'CGGGATCC T TAAG TGCCCCGG TACG TGATAT TG3 '.
Plasmids encoding the altered 3 subunits were
created utilizing MluI and BamHI sites shared by
pBov3ZEO and the PCR products. All of the plasmid
constructs were sequenced through the region that was subcloned.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Predicted amino acid sequences of wild-type and altered
integrin subunit cytoplasmic domains. The sequences of the cytoplasmic
domains are in uppercase letters. The last four residues of the
transmembrane domains are in lowercase letters. Functionally important
sequence motifs, as noted in the text, are italicized and underlined.
|
|
The amino acid sequences of the cytoplasmic domains of the wild-type
and altered subunits are shown in Fig.
1. There is some
question as to
where the exact borders between the transmembrane
and cytoplasmic
domains occur in the integrin subunits. We have
marked the border as
lying at the YR junction for the
v subunit
(Fig.
1a) and
the WK junction for the
3 subunit (Fig.
1b). A
recent
study suggests that the first five residues of the
v
subunit
(RMGFF) and the first six residues of the
3
subunit (KLLITI)
cytoplasmic domains, as we have represented them, are
located
within the cell membrane in the absence of interactions with
intracellular
proteins and become exposed to the cytoplasm upon binding
to intracellular
proteins, resulting in conformational changes leading
to integrin
activation and signaling (
1). The mutant
v subunits are shown
in Fig.
1a. The first,
v30, retains only two cytoplasmic domain
amino acids
and is truncated before the GFFKR motif, which is
conserved among all
subunits. This motif maintains integrins
in a low-affinity state
(
8,
37,
49) and has been reported
to be necessary
for stabilization of the integrin
complex (
48).
This mutant is also lacking the PPQ(L)EE(DD) motif, which defines
a
-turn in the
subunit cytoplasmic domain and is found in seven
other
subunits. A human
v3
heterodimer with a truncated
subunit cytoplasmic domain lacking
this motif cannot bind to either
vitronectin or fibronectin
(
18). The second mutant,
v20, contains
the GFFKR motif and the five amino acids downstream of it but
is
truncated at the last residue of the PPQEE motif. The final
mutant,
vX29, contains the complete cytoplasmic domain of the
v subunit with an additional 29 amino acids added to the
C
terminus.
The mutant
3 subunits are shown in Fig.
1b. The first of
these,
339, retains only 8 amino acids while
331 retains 16
amino acids of the
3
cytoplasmic domain. Neither of these two
constructs contain the NPL(X)Y
or the NI(X)T(X)Y motifs that have
been shown to be important for
signal transduction, integrin affinity
states, and interaction with
cytoplasmic integrin-associated proteins
(
7,
9,
10,
13,
15,
17,
25,
28,
31,
32,
44,
46,
54). Both of these truncations, however,
still retain
the membrane-proximal region of the subunit cytoplasmic
domain,
which has also been reported to control ligand-binding affinity
and to regulate signal transduction (
21,
22). The third
3 subunit mutant,
3X32, retains both the
NPLY and NITY motifs along
with an additional 32 amino acids added to
the C terminus of the
cytoplasmic domain. Additions to the cytoplasmic
domains of both
the
and
subunits were made because the specific
conformations
of these domains appear to play a role in the way they
control
ligand affinity and signal transduction (
21).
Analysis of integrins with altered cytoplasmic domains.
Coupled in vitro transcription-translations were performed to check
that the mutant-encoding plasmids that were generated were encoding
proteins of the expected sizes. In all cases, the relative sizes of the
resulting altered integrin subunits compared to the corresponding
wild-type subunits were as expected (not shown).
To analyze whether integrin subunits with truncated or extended
cytoplasmic domains could still function as receptors for
FMDV, we
utilized a previously described transient-expression
assay system in
COS-1 cells (
35). Cells were plated at a density
of
10
5 cells/well on six-well plates the day prior to
transfection.
Transfections were performed with 2.0 µg of each
integrin-encoding
plasmid utilizing the transfection reagent FuGENE 6 (Roche Molecular
Biochemicals) according to the manufacturer's
instructions. Twenty-four
hours after transfection, the cells in each
well were trypsinized
and replated onto two wells of a 24-well plate.
After a further
18 h of incubation, one well for each transfected
condition was
infected with FMDV type A
12, strain 119ab, at
a multiplicity of
infection (MOI) of 10 PFU/cell and labeled between 4 and 18 h
after infection with [
35S]methionine. The
other well was fixed with acetone-methanol (50:50)
and analyzed by
immunohistochemistry for integrin expression using
the
anti-
v3 monoclonal antibody (MAb) LM609
(MAB1976; Chemicon
International) as previously described
(
35). Only transfections
in which equal amounts of
immunostaining were detected in all
experimental conditions were used
to analyze the results of viral
infection (
35). To
evaluate FMDV replication in the infected-radiolabeled
cultures, cell
lysates were prepared in 1% Triton X-100. Equal
amounts of
trichloroacetic acid-precipitable counts per minute
were
immunoprecipitated (IP), using a virus-specific MAb, and
proteins were
analyzed by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis
(SDS-PAGE) using a 10% polyacrylamide gel
as described
(
35).
The results in Fig.
2 are representative
of one such transfection. Viral replication is evident in cells
transfected with
both wild-type bovine
v- and
3-expressing plasmids, as evidenced
by the synthesis of
viral proteins which are not present in nontransfected-infected
cells.
When cells are transfected with a wild-type
v subunit
and any of the altered
3 subunits, viral replication
appears
to be unaffected. Similarly, when any of the three altered
v subunits are transfected with the wild-type
3 subunit, levels
of infection reach those seen when
both wild-type subunits are
present. Viral replication was also
unaffected when the two subunits
with the shortest cytoplasmic domains
(
v30 and
339) were expressed
together.
View larger version (91K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of viral protein synthesis in COS-1 cells
transfected with integrin subunit cDNAs. Cells were transfected with
plasmids encoding integrin subunits as shown. Transfected cells were
infected with FMDV type A12 at an MOI of 10 PFU/cell and
labeled between 4 and 18 h with [35S]methionine.
Cell extracts were analyzed by IP and SDS-10% PAGE as described in
the text. The locations of viral structural proteins IP from infected
and labeled BHK-21 cells (lane M) are shown on the left. con,
nontransfected-infected cells (control).
|
|
Viral replication mediated by integrins with truncated cytoplasmic
domains in the presence of monensin.
We have previously shown that
the lysosomotropic ionophore monensin inhibited the replication of
representative strains of all seven serotypes of FMDV (2).
Monensin interferes with proton and pH gradients and raises the pH of
endocytic vesicles (33, 40). In the presence of monensin,
the virus adsorbed to cells normally; however, it was unable to undergo
the initial alteration of the 140S virion to 12S pentameric subunits,
which probably occurs within acidified endocytic vesicles and results
in the release of the genome RNA (2, 3). To examine
whether virus utilizing expressed integrins with truncated cytoplasmic
domains as receptors infected cells through an eclipse mechanism
similar to that of virus utilizing intact receptors, we transfected
cells with intact and cytoplasmic domain-truncated integrin subunits, followed by infection in the presence or absence of monensin.
Cells were cotransfected with either
v and
3 subunits or
v30 and
339 subunits. Forty-eight hours after transfection,
cultures were incubated in the presence or absence of 50 µM monensin
for 30 min prior to infection with FMDV type A
12. Viral
replication
was determined by pulse-labeling cells with
[
35S]methionine between 5 and 6 h postinfection and
analyzing cell
extracts by IP and SDS-PAGE. The results are shown in
Fig.
3.
Cells cotransfected with intact
integrin subunits and infected
in the presence of monensin failed to
synthesize viral proteins,
indicating that the drug interfered with
viral replication. Interestingly,
cells cotransfected with cytoplasmic
domain-truncated integrin
subunits and infected in the presence of
monensin also failed
to synthesize viral proteins. In contrast, cells
cotransfected
with either intact or truncated integrins synthesized
normal amounts
of viral proteins when monensin was added at 2 h
after infection,
indicating that monensin inhibited an early event in
viral replication,
probably at the eclipse phase, as we have shown
previously (
2).
Therefore, complete integrin subunit
cytoplasmic domains are not
necessary for internalization of virions
into endocytic vesicles.
View larger version (74K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of transfected COS-1 cells infected in the
presence of monensin. Cells were cotransfected with integrin subunits
containing intact cytoplasmic domains or v30 and
339 as shown. Thirty minutes prior to infection, the
medium was removed from some wells and replaced with medium containing
50 µM monensin (lanes mon  30min). Cells were infected in either the
presence or absence (con) of monensin as noted. At 2 h after
infection, the medium was removed from other wells and replaced with
medium containing 50 µM monensin (lanes mon +2hr). At 4.5 h
after infection, all cultures were incubated in minimal essential
medium without L-methionine, with or without monensin, for
30 min. [35S]methionine (75 µCi) was added, and cells
were labeled for 1 h. Cell extracts were prepared, and analysis of
viral proteins by IP and SDS-10% PAGE was done as described in the
text. The locations of marker FMDV structural proteins (lane M) are
shown on the left.
|
|
Thus, bovine
v3 is able to function as a
receptor for FMDV in the absence of motifs that are known to be
required for the
normal function of integrins in the context of their
natural ligands.
The truncations of the cytoplasmic domains of either
the
v or
3 subunits and the addition of
random amino acids to the subunits'
cytoplasmic domains did not affect
the ability of integrins to
serve as receptors for FMDV, and the
results show that when utilized
as receptors, integrins altered in this
manner were utilized as
well as intact
integrins.
Effect of integrin function-blocking antibodies on viral infection
in transfected cells.
The internalization of natural integrin
ligands has not been extensively studied. The NPXY motif, found in the
cytoplasmic domains of all subunits and other transmembrane
receptors, has been reported to be required for internalization of
bacteria mediated by 1 integrins (47),
internalization mediated by the nonintegrin low-density lipoprotein
receptor (12), and a signal for clathrin complex assembly
(11). More recent results have shown that sequences surrounding the NPXY motif are important in association of the v5 receptor with clathrin-coated pits via
the 5 cytoplasmic domain (13). The
internalization of vitronectin by v3,
however, appears to require a signal as a result of the ligation of the 51 integrin (39). This cross
talk between the v3 and
51 integrins requires the
3 cytoplasmic domain (5). Our results would
rule out a cross talk mechanism of viral internalization, since
important cytoplasmic domain motifs have been deleted from some of the
subunit constructs. The results, however, might indicate that other
cell surface molecules are acting as coreceptors for viral infection or
that the expression of v3 in COS cells is activating another receptor and the integrin itself is not involved in
viral binding or internalization. Although, at this time, we have no
evidence that a coreceptor, either integrin or nonintegrin, is required
for infection, we examined the possibility that other RGD-directed
integrins might be involved in the infectious process in
v3-transfected COS cells.
Cells were transfected with
v3 cDNAs, as
described, and 30 min prior to infection with FMDV type
A
12, they were incubated
with function-blocking antibodies
to
v3,
v5,
v6,
5, or
1. All of these integrins interact with their natural
ligands
through an RGD sequence (
42), and the
v6 integrin has recently
been shown to be
a receptor for FMDV (
24), a result we have
confirmed in
our laboratory (not shown). In this experiment, we
measured productive
viral replication by determining the plaque
titer of infectious virus
immediately following a 45-min adsorption
period and after 24 h of
incubation. As a control, to determine
the level of FMDV replication in
COS cell cultures, a nontransfected
culture was infected with an FMDV
type O
1 Campos variant containing
a heparin-binding site in
VP3 (
43), which we have previously
shown to require only
the presence of cell surface heparan sulfate
(HS), and not
v3, to infect cells (
36).
The results of this
experiment are shown in Fig.
4.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of anti-integrin function-blocking MAbs on viral
replication in transfected COS-1 cells. Cells were cotransfected with
v3-encoding plasmids as described in the
text. Thirty minutes prior to infection, paired transfected cell
cultures were incubated at room temperature with the following
function-blocking anti-integrin MAbs at a concentration of 25 µg/ml
(all antibodies were from Chemicon International Inc):
anti-v3 (clone LM609; MAB1976),
anti-v5 (clone P1F6; MAB1961),
anti-v6 (clone 10D5; MAB2077Z),
anti-5 (clone CLB-705; MAB1986), and
anti-1 (clone 6S6; MAB2253). Transfected and
nontransfected cultures were infected in pairs with type
A12 at an MOI of 1 PFU/cell in the presence of the
antibodies. One nontransfected culture pair was infected with the
HS-binding O1 Campos variant vCRM4 (43) at an
MOI of 1 PFU/cell. After an adsorption period of 45 min at 37°C, all
cultures were washed with a low-pH buffer (25 mM MES
[morpholineethanesulfonic acid, pH 5.5], 140 mM NaCl) to inactivate
any nonadsorbed or noninternalized virus. After the addition of medium,
one of the infected pairs was immediately frozen at 70°C to
determine viral infectivity remaining at the end of the adsorption
period (shaded bars). The other pair was incubated for 24 h at
37°C (solid bars) and then placed at 70°C. After thawing, cell
debris was removed by centrifugation, and plaque titer was determined
on BHK-21 cells.
|
|
In nontransfected COS cells, there was no increase in titer of type
A
12 at 24 h, indicating that viral replication did not
take place in these cells, as we have previously shown in experiments
utilizing detection of radioactively labeled viral proteins
(
35)
(Fig.
2). In contrast, the heparin-binding type
O
1 variant showed
an increase in titer of about 10-fold
after 24 h in nontransfected
cells, also confirming previously
reported results (
36). In
v3-transfected COS cells, the type
A
12 virus titer increased
about 10-fold, again confirming
results obtained by detection
of viral proteins in infected cells
(
35) (Fig.
2). When transfected
cells were treated with
integrin function-blocking antibodies,
only the antibody to
v3 and not those against any of the other
integrins was capable of inhibiting viral replication (Fig.
4).
The
same experiment performed in cells transfected with the
v30
and
339 cDNAs yielded nearly
identical results (not shown).
These results indicate that, in this
transfection system, the
v3 integrin is
absolutely required for productive viral infection
and at least three
other RGD-directed integrins (
v5,
v6, and
51)
do not appear to be involved in this process. In addition,
since the
anti-
1 antibody has been shown to inhibit the function
of at least two other
1 integrins
(
21 and
41)
(
19), other
integrins of this subclass are also probably
not involved in viral
infection. At this time, however, we cannot rule
out a role for
other cell surface molecules as coreceptors for either
FMDV adsorption
or internalization. We can, however, rule out HS as a
coreceptor
for type A
12, as we have previously shown that
this virus can
replicate in
v3
cDNA-transfected HS-deficient CHO cells (
36).
These results are similar to those reported for three other
picornaviruses (poliovirus, rhinovirus 14, and coxsackievirus
B3), all
of whose single-subunit receptors appear to function
normally in the
absence of cytoplasmic domains (
26,
45,
52).
Human
adenovirus (Ad) requires interaction with the integrin
v5 or
v3
for internalization into cells through a clathrin-coated
pit pathway
requiring dynamin (
51,
53). We have not yet examined
the
role of dynamin in FMDV internalization, but in studies with
two other
picornaviruses, human rhinovirus 14 required dynamin
for productive
infection while poliovirus did not (
14). Recently
it has
been shown that Ad internalization requires signaling through
the focal
adhesion kinase pathway involving phosphoinositide-3-OH
kinase and
GTP-binding proteins, all of which are activated following
binding of
integrins to their natural ligands (
29,
30). In
addition,
the cytoplasmic domain of the
5 subunit of the
v5 integrin is essential for Ad-mediated
gene delivery via host cell
membrane penetration from endosomes
(
50). However, truncations
of the
5
cytoplasmic domain, which still retains the NPXY motif,
and do not
allow Ad-mediated gene delivery do not abolish
v5-mediated
Ad internalization
(
50). At least two picornavirus receptors,
the
coxsackievirus and adenovirus receptors, and ICAM-1 also do
not require
their transmembrane domains for receptor function
(
45,
52). Soluble human
v3 lacking both
the transmembrane
and cytoplasmic domains of both subunits can still
bind to its
natural ligands with high affinity (
34);
however, we have not
examined either soluble or
glycosylphosphatidylinositol-anchored
v3
for virus binding or the ability to act as a functional
receptor.
The results we have presented, however, indicate that deletions of any
of the important cytoplasmic domain motifs had little
or no effect on
receptor utilization by FMDV. In fact, the results
showing that
monensin still inhibited infection mediated by cytoplasmic
domain-truncated
v3 suggest that these
receptors are internalizing
FMDV through the same mechanism as complete
integrins. In addition,
we have also shown that three other
RGD-directed integrins do
not appear to play any role in productive
viral infection. Further
studies will be necessary to delineate the
exact mechanism by
which intact and altered integrin subunits
internalize
virus.
| |
ACKNOWLEDGMENTS |
We thank Michael LaRocco for excellent technical assistance.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: USDA, ARS, Plum
Island Animal Disease Center, P.O. Box 848, Greenport, NY 11944-0848. Phone: (631) 323-3354. Fax: (631) 323-2507. E-mail:
bbaxt{at}piadc.ars.usda.gov.
| |
REFERENCES |
| 1.
|
Armulik, A.,
I. Nilsson,
G. von Heijne, and S. Johansson.
1999.
Determination of the border between the transmembrane and cytoplasmic domains of human integrin subunits.
J. Biol. Chem.
274:37030-37034[Abstract/Free Full Text].
|
| 2.
|
Baxt, B.
1987.
Effect of lysosomotropic compounds on early events in foot-and-mouth disease virus replication.
Virus Res.
7:257-271[CrossRef][Medline].
|
| 3.
|
Baxt, B., and H. L. Bachrach.
1980.
Early interactions of foot-and-mouth disease virus with cultured cells.
Virology
104:42-55[CrossRef][Medline].
|
| 4.
|
Berinstein, A.,
M. Roivainen,
T. Hovi,
P. W. Mason, and B. Baxt.
1995.
Antibodies to the vitronectin receptor (integrin v3) inhibit binding and infection of foot-and-mouth disease virus to cultured cells.
J. Virol.
69:2664-2666[Abstract].
|
| 5.
|
Blystone, S. D.,
F. P. Lindberg,
S. E. LaFlamme, and E. J. Brown.
1995.
Integrin 3 cytoplasmic tail is necessary and sufficient for regulation of 51 phagocytosis by v3 and integrin-associated protein.
J. Cell Biol.
130:745-754[Abstract/Free Full Text].
|
| 6.
|
Blystone, S. D.,
F. P. Lindberg,
M. P. Williams,
K. McHugh, and E. J. Brown.
1996.
Inducible tyrosine phosphorylation of the 3 integrin requires the v integrin cytoplasmic tail.
J. Biol. Chem.
271:31458-31462[Abstract/Free Full Text].
|
| 7.
|
Blystone, S. D.,
M. P. Williams,
S. E. Slater, and E. J. Brown.
1997.
Requirement of integrin 3 tyrosine 747 for 3 tyrosine phosphorylation and regulation of v3 avidity.
J. Biol. Chem.
272:28757-28761[Abstract/Free Full Text].
|
| 8.
|
Briesewitz, R.,
A. Kern,
L. B. Smilenov,
F. S. David, and E. E. Marcantonio.
1996.
The membrane-cytoplasm interface of integrin subunits is critical for receptor latency.
Mol. Biol. Cell
7:1499-1509[Abstract].
|
| 9.
|
Calderwood, D. A.,
R. Zent,
R. Grant,
D. Jasper,
G. Rees,
R. O. Hynes, and M. H. Ginsberg.
1999.
The talin head domain binds to integrin subunit cytoplasmic tails and regulates integrin activation.
J. Biol. Chem.
274:28071-28074[Abstract/Free Full Text].
|
| 10.
|
Chang, D. D.,
C. Wong,
H. Smith, and J. Liu.
1997.
ICAP-1, a novel 1 integrin cytoplasmic domain-associated protein, binds to a conserved and functionally important NPXY sequence motif of 1 integrin.
J. Cell Biol.
138:1149-1157[Abstract/Free Full Text].
|
| 11.
|
Chen, W. J.,
J. L. Goldstein, and M. S. Brown.
1990.
NPXY, a sequence often found in cytoplasmic tails, is required for coated pit-mediated internalization of the low density lipoprotein receptor.
J. Biol. Chem.
265:3116-3123[Abstract/Free Full Text].
|
| 12.
|
Davis, C. G.,
J. L. Goldstein,
T. C. Sudhof,
R. G. W. Amderson,
D. W. Russell, and M. S. Brown.
1987.
Acid-dependent ligand dissociation and recycling of LDL receptor mediated by growth factor homology region.
Nature
320:760-765.
|
| 13.
|
De Deyne, P. G.,
A. O'Neill,
W. G. Resneck,
G. M. Dmytrenko,
D. W. Pumplin, and R. J. Bloch.
1998.
The vitronectin receptor associates with clathrin-coated membrane domains via the cytoplasmic domain of its 5 subunit.
J. Cell Sci.
111:2729-2740[Abstract].
|
| 14.
|
De Tulleo, L., and T. Kirchhausen.
1998.
The clathrin endocytic pathway in viral infection.
EMBO J.
17:4585-4593[CrossRef][Medline].
|
| 15.
|
Eigenthaler, M.,
L. Höfferer,
S. J. Shattil, and M. H. Ginsberg.
1997.
A conserved sequence motif in the integrin 3 cytoplasmic domain is required for its specific interaction with 3-endonexin.
J. Biol. Chem.
272:7693-7698[Abstract/Free Full Text].
|
| 16.
|
Fernández, C.,
K. Clark,
L. Burrows,
N. R. Schofield, and M. J. Humphries.
1998.
Regulation of the extracellular ligand binding activity of integrins.
Front. Biosci.
3:684-700.
|
| 17.
|
Filardo, E. J.,
P. C. Brooks,
S. L. Deming,
C. Damsky, and D. A. Cheresh.
1995.
Requirement of the NPXY motif in the integrin 3 subunit cytoplasmic tail for melanoma cell migration in vitro and in vivo.
J. Cell Biol.
130:441-450[Abstract/Free Full Text].
|
| 18.
|
Filardo, E. J., and D. A. Cheresh.
1994.
A turn in the cytoplasmic tail of the integrin v subunit influences conformation and ligand binding of v3.
J. Biol. Chem.
269:4641-4647[Abstract/Free Full Text].
|
| 19.
|
Gao, J. X.,
J. Wilkins, and A. C. Issekutz.
1995.
Migration of human polymorphonuclear leukocytes through a synovial fibroblast barrier is mediated by both 2 (CD11/CD18) integrins and the 1 (CD29) integrins VLA-5 and VLA-6.
Cell. Immunol.
163:178-186[CrossRef][Medline].
|
| 20.
|
González-Amaro, R., and F. Sánchez-Madrid.
1999.
Cell adhesion molecules: selectins and integrins.
Crit. Rev. Immunol.
19:389-429[Medline].
|
| 21.
|
Haas, T. A., and E. F. Plow.
1997.
Development of a structural model for the cytoplasmic domain of an integrin.
Protein Eng.
10:1395-1405[Abstract/Free Full Text].
|
| 22.
|
Hughes, P. E.,
T. E. O'Toole,
J. Ylänne,
S. J. Shattil, and M. H. Ginsberg.
1995.
The conserved membrane-proximal region of an integrin cytoplasmic domain specifies ligand binding affinity.
J. Biol. Chem.
270:12411-12417[Abstract/Free Full Text].
|
| 23.
|
Hynes, R. O.
1992.
Integrins: versatility, modulation, and signaling in cell adhesion.
Cell
69:11-25[CrossRef][Medline].
|
| 24.
|
Jackson, T.,
D. Sheppard,
M. Denyer,
W. Blakemore, and A. M. Q. King.
2000.
The epithelial integrin v6 is a receptor for foot-and-mouth disease virus.
J. Virol.
74:4949-4956[Abstract/Free Full Text].
|
| 25.
|
Jenkins, A. L.,
L. Nannizzi-Alaimo,
D. Silver,
J. R. Sellers,
M. H. Ginsberg,
D. A. Law, and D. R. Phillips.
1998.
Tyrosine phosphorylation of the 3 cytoplasmic domain mediates integrin-cytoskeletal interactions.
J. Biol. Chem.
273:13878-13885[Abstract/Free Full Text].
|
| 26.
|
Koike, S.,
I. Ise, and A. Nomoto.
1991.
Functional domains of the poliovirus receptor.
Proc. Natl. Acad. Sci. USA
88:4104-4108[Abstract/Free Full Text].
|
| 27.
|
Law, D. A.,
F. R. DeGuzman,
P. Heiser,
K. Ministri-Madrid,
N. Kileen, and D. R. Phillips.
1999.
Integrin cytoplasmic tyrosine motif is required for outside-in IIb3 signaling and platelet function.
Nature
401:808-811[CrossRef][Medline].
|
| 28.
|
Lerea, K. M.,
K. P. Cordero,
K. S. Sakariassen,
R. I. Kirk, and V. A. Fried.
1999.
Phosphorylation sites in the integrin 3 cytoplasmic domain in intact platelets.
J. Biol. Chem.
274:1914-1919[Abstract/Free Full Text].
|
| 29.
|
Li, E.,
D. Stupack,
G. M. Bokoch, and G. R. Nemerow.
1998.
Adenovirus endocytosis requires actin cytoskeleton reorganization mediated by rho family GTPases.
J. Virol.
72:8806-8812[Abstract/Free Full Text].
|
| 30.
|
Li, E.,
D. Stupack,
R. Klemke,
D. A. Cheresh, and G. R. Nemerow.
1998.
Adenovirus endocytosis via v integrins requires phosphoinositide-3-OH kinase.
J. Virol.
72:2055-2061[Abstract/Free Full Text].
|
| 31.
|
Liu, H.-Y.,
S. A. Timmons,
Y.-Z. Lin, and J. Hawieger.
1996.
Identification of a functionally important sequence in the cytoplasmic tail of integrin 3 by using cell-permeable peptide analogs.
Proc. Natl. Acad. Sci. USA
93:11819-11824[Abstract/Free Full Text].
|
| 32.
|
Mastrangelo, A. M.,
S. H. Homan,
M. J. Humphries, and S. E. LaFlamme.
1999.
Amino acid motifs required for isolated cytoplasmic domains to regulate "in trans" 1 integrin conformation and function in cell attachment.
J. Cell Sci.
112:217-229[Abstract].
|
| 33.
|
Maxfield, F. R.
1982.
Weak bases and ionophores rapidly and reversibly raise the pH of endocytic vesicles in cultured mouse fibroblasts.
J. Cell Biol.
95:676-681[Abstract/Free Full Text].
|
| 34.
|
Mehta, R. J.,
B. Diefenbach,
A. Brown,
E. Cullen,
A. Jonczyk,
D. Gussow,
G. A. Luckenbach, and S. L. Goodman.
1998.
Transmembrane-truncated v3 integrin retains high affinity for ligand binding: evidence for an "inside-out" suppressor?
Biochem. J.
330:861-869.
|
| 35.
|
Neff, S.,
P. W. Mason, and B. Baxt.
2000.
High-efficiency utilization of the bovine integrin v3 as a receptor for foot-and-mouth disease virus is dependent on the bovine 3 subunit.
J. Virol.
74:7298-7306[Abstract/Free Full Text].
|
| 36.
|
Neff, S.,
D. Sá- Carvalho,
E. Rieder,
P. W. Mason,
S. D. Blystone,
E. J. Brown, and B. Baxt.
1998.
Foot-and-mouth disease virus virulent for cattle utilizes the integrin v3 as its receptor.
J. Virol.
72:3587-3594[Abstract/Free Full Text].
|
| 37.
|
O'Toole, T. E.,
Y. Katagiri,
R. J. Faull,
K. Peter,
R. Tamura,
V. Quaranta,
J. C. Loftus,
S. J. Shattil, and M. H. Ginsberg.
1994.
Integrin cytoplasmic domains mediate inside-out signal transduction.
J. Cell Biol.
124:1047-1059[Abstract/Free Full Text].
|
| 38.
|
Pfaff, M.,
S. Liu,
D. J. Erie, and M. H. Ginsberg.
1998.
Integrin cytoplasmic domains differentially bind to cytoskeletal proteins.
J. Biol. Chem.
273:6104-6109[Abstract/Free Full Text].
|
| 39.
|
Pijuan-Thompson, V., and C. L. Gladson.
1997.
Ligation of integrin 51 is required for internalization of vitronectin by integrin v3.
J. Biol. Chem.
272:2736-2743[Abstract/Free Full Text].
|
| 40.
|
Pressman, B. C.
1976.
Biological applications of ionophores.
Annu. Rev. Biochem.
45:501-530[CrossRef][Medline].
|
| 41.
|
Puzon-McLaughlin, W.,
T. A. Yednock, and Y. Takada.
1996.
Regulation of conformation and ligand binding function of integrin 51 by the 1 cytoplasmic domain.
J. Biol. Chem.
271:16580-16585[Abstract/Free Full Text].
|
| 42.
|
Ruoslahti, E.
1996.
RGD and other recognition sequences for integrins.
Annu. Rev. Cell Dev. Biol.
12:697-715[CrossRef][Medline].
|
| 43.
|
Sá-Carvalho, D.,
E. Rieder,
B. Baxt,
R. Rodarte,
A. Tanuri, and P. W. Mason.
1997.
Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle.
J. Virol.
71:5115-5123[Abstract].
|
| 44.
|
Schaffner-Reckinger, E.,
V. Gouon,
C. Melchior,
S. Plançon, and N. Kieffer.
1998.
Distinct involvement of 3 integrin cytoplasmic domain tyrosine residues 747 and 759 in integrin-mediated cytoskeletal assembly and phosphotyrosine signaling.
J. Biol. Chem.
273:12623-12632[Abstract/Free Full Text].
|
| 45.
|
Staunton, D. E.,
A. Gaur,
P. Y. Chan, and T. A. Springer.
1992.
Internalization of a major group human rhinovirus does not require cytoplasmic or transmembrane domains of ICAM-1.
J. Immunol.
148:3271-3274[Abstract].
|
| 46.
|
Tahiliani, P. D.,
L. Singh,
K. L. Auer, and S. E. LaFlamme.
1997.
The role of conserved amino acid motifs within the integrin 3 cytoplasmic domain in triggering focal adhesion kinase phosphorylation.
J. Biol. Chem.
272:7892-7898[Abstract/Free Full Text].
|
| 47.
|
Tran Van Nhieu, G.,
E. S. Krukonis,
A. A. Reszka,
A. F. Horwitz, and R. R. Isberg.
1996.
Mutations in the cytoplasmic domain of the integrin chain indicate a role for endocytosis factors in bacterial internalization.
J. Biol. Chem.
271:7665-7672[Abstract/Free Full Text].
|
| 48.
|
Vallar, L.,
C. Melchior,
S. Plançon,
H. Drobecq,
G. Lippens,
V. Regnault, and N. Kieffer.
1999.
Divalent cations differentially regulate integrin IIb cytoplasmic tail binding to 3 and to calcium- and integrin-binding protein.
J. Biol. Chem.
274:17257-17266[Abstract/Free Full Text].
|
| 49.
|
Vinogradova, O.,
T. Haas,
E. F. Plow, and J. Qin.
2000.
A structural basis for integrin activation by the cytoplasmic tail of the IIb-subunit.
Proc. Natl. Acad. Sci. USA
97:1450-1455[Abstract/Free Full Text].
|
| 50.
|
Wang, K.,
T. Guan,
D. A. Cheresh, and G. R. Nemerow.
2000.
Regulation of adenovirus membrane penetration by the cytoplasmic tail of integrin 5.
J. Virol.
74:2731-2739[Abstract/Free Full Text].
|
| 51.
|
Wang, K.,
S. Huang,
A. Kapoor-Munshi, and G. Nemerow.
1998.
Adenovirus internalization and infection require dynamin.
J. Virol.
72:3455-3458[Abstract/Free Full Text].
|
| 52.
|
Wang, X., and J. M. Bergelson.
1999.
Coxsackievirus and adenovirus receptor cytoplasmic and transmembrane domains are not essential for coxsackievirus and adenovirus infection.
J. Virol.
73:2559-2562[Abstract/Free Full Text].
|
| 53.
|
Wickham, T. J.,
P. Mathias,
D. A. Cheresh, and G. R. Nemerow.
1993.
Integrins v3 and v5 promote adenovirus internalization but not virus attachment.
Cell
73:309-319[CrossRef][Medline].
|
| 54.
|
Ylänne, J.
1998.
Conserved functions of the cytoplasmic domains of integrin beta subunits.
Front. Biosci.
3:877-886.
|
Journal of Virology, January 2001, p. 527-532, Vol. 75, No. 1
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.1.527-532.2001
This article has been cited by other articles:
-
Gulbahar, M. Y., Davis, W. C., Guvenc, T., Yarim, M., Parlak, U., Kabak, Y. B.
(2007). Myocarditis Associated with Foot-and-Mouth Disease Virus Type O in Lambs. Vet Pathol
44: 589-599
[Abstract]
[Full Text]
-
O'Donnell, V., LaRocco, M., Duque, H., Baxt, B.
(2005). Analysis of Foot-and-Mouth Disease Virus Internalization Events in Cultured Cells. J. Virol.
79: 8506-8518
[Abstract]
[Full Text]
-
Monaghan, P., Simpson, J., Murphy, C., Durand, S., Quan, M., Alexandersen, S.
(2005). Use of Confocal Immunofluorescence Microscopy To Localize Viral Nonstructural Proteins and Potential Sites of Replication in Pigs Experimentally Infected with Foot-and-Mouth Disease Virus. J. Virol.
79: 6410-6418
[Abstract]
[Full Text]
-
Duque, H., LaRocco, M., Golde, W. T., Baxt, B.
(2004). Interactions of Foot-and-Mouth Disease Virus with Soluble Bovine {alpha}V{beta}3 and {alpha}V{beta}6 Integrins. J. Virol.
78: 9773-9781
[Abstract]
[Full Text]
-
Jackson, T., Clark, S., Berryman, S., Burman, A., Cambier, S., Mu, D., Nishimura, S., King, A. M. Q.
(2004). Integrin {alpha}v{beta}8 Functions as a Receptor for Foot-and-Mouth Disease Virus: Role of the {beta}-Chain Cytodomain in Integrin-Mediated Infection. J. Virol.
78: 4533-4540
[Abstract]
[Full Text]
-
Grubman, M. J., Baxt, B.
(2004). Foot-and-Mouth Disease. Clin. Microbiol. Rev.
17: 465-493
[Abstract]
[Full Text]
-
Duque, H., Baxt, B.
(2003). Foot-and-Mouth Disease Virus Receptors: Comparison of Bovine {alpha}V Integrin Utilization by Type A and O Viruses. J. Virol.
77: 2500-2511
[Abstract]
[Full Text]
-
Miller, L. C., Blakemore, W., Sheppard, D., Atakilit, A., King, A. M. Q., Jackson, T.
(2001). Role of the Cytoplasmic Domain of the {beta}-Subunit of Integrin {alpha}v{beta}6 in Infection by Foot-and-Mouth Disease Virus. J. Virol.
75: 4158-4164
[Abstract]
[Full Text]
Top
Abstract
Text
