Previous Article | Next Article 
Journal of Virology, January 2001, p. 506-512, Vol. 75, No. 1
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.1.506-512.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The Coronavirus Infectious Bronchitis Virus
Nucleoprotein Localizes to the Nucleolus
Julian A.
Hiscox,1,*
Torsten
Wurm,1
Louise
Wilson,1
Paul
Britton,2
David
Cavanagh,2 and
Gavin
Brooks1
School of Animal and Microbial Sciences,
University of Reading, Reading, Berkshire RG6
6AJ,1 and Division of Molecular
Biology, Institute for Animal Health, Compton Laboratory, Compton,
Newbury, Berkshire RG20 7NN,2 United Kingdom
Received 26 July 2000/Accepted 2 October 2000
 |
ABSTRACT |
The coronavirus nucleoprotein (N) has been reported to be involved
in various aspects of virus replication. We examined by confocal
microscopy the subcellular localization of the avian infectious
bronchitis virus N protein both in the absence and in the context of an
infected cell and found that N protein localizes both to the
cytoplasmic and nucleolar compartments.
| |
TEXT |
Coronaviruses are enveloped viruses
with positive-stranded, capped and polyadenylated RNA genomes ranging
in size between 28 and 32 kb (15). The coronavirus family,
Coronaviridae, has been grouped together with the
arterivirus family, Arteriviridae, into the order
Nidovirales (5). The virus families have many similarities. The 5' two-thirds of the nidovirus genome encodes the
replicase gene producing two polyproteins, Rep1a and Rep1ab, the latter
resulting from a -1 frameshift. The remaining proteins are expressed
from a nested set of subgenomic mRNAs (sgRNAs) that are produced via a
discontinuous transcription mechanism. In the genus
Coronavirus, these proteins include the structural proteins, spike (S), envelope (E), membrane (M), and nucleoprotein (N), and
several other proteins of unknown function. In both virus families, the
virus replication complexes are thought to be membrane associated
(24, 28, 29, 35).
While gene function and distribution between the two families are
similar, there are some differences that might lead to subtle differences in replication strategies. Rowland et al. (26)
recently reported, following the use of confocal microscopy, that the
arterivirus porcine reproductive and respiratory syndrome virus (PRRSV)
N protein localizes to both the cytoplasm and nucleolus in infected cells. In contrast, the coronavirus N protein has previously been thought to localize only to the cytoplasm (17). Using
confocal microscopy, we decided to investigate the intracellular
localization of the coronavirus N protein in both the absence and
presence of other viral proteins.
Coronavirus N proteins vary from 377 to 455 amino acids in length, are
highly basic, and have a high (7 to 11%) serine content, which are
potential targets for phosphorylation. Sequence conservation of the N
proteins within the genus is low.
Three groups of coronaviruses have been identified. The N proteins of
the coronaviruses avian infectious bronchitis virus (IBV; group III)
and porcine transmissible gastroenteritis virus (group I) have only
29% identity with that of bovine coronavirus (group II). Within the
group II coronaviruses, the N proteins of murine hepatitis virus and
bovine coronavirus share only 70% identity (16). Based on
sequence comparisons, three structural domains have been identified in
the coronavirus N protein (23), of which the middle domain
was identified as a potential RNA binding domain (18, 21),
capable of binding both coronavirus- and non-coronavirus-derived RNA
sequences in vitro (18, 31). No functions have been
ascribed to the other two domains.
The coronavirus N protein is the most abundant virus-derived protein
produced throughout infection, probably because its template mRNA is
the most abundant sgRNA (11, 13) produced during
transcription (12). Several functions have been postulated
for the coronavirus N protein throughout the virus life cycle
(17). Primarily, it complexes with the coronavirus genomic
RNA to form a ribonucleocapsid structure (8), and it has
been observed, together with the M protein, to be a component of the
viral core (25). The N protein has been shown to associate
with the leader RNA sequence (2, 22) located at the 5' end
of the genomic RNA and/or to sequences at the 3' end of the genomic RNA
(41). As these regions are believed to be involved in
synthesis of coronavirus RNA, the N protein has been postulated to have
a role in replication of the genomic RNA (6, 7), in
transcription of coronavirus sgRNAs (2, 31), and in
translation from the sgRNAs (33). However, replication and
transcription have been shown to occur in the absence of N protein in
the arterivirus equine arteritis virus (20), although N
protein may still have some nonessential involvement in this process.
Expression of N protein in the absence of other viral
proteins.
To investigate the intracellular distribution of a
coronavirus N protein, the N gene of the Beaudette strain of the avian coronavirus IBV was inserted into the eukaryotic expression vector pCi-Neo (Promega) such that expression of the N gene was under the
control of a cytomegalovirus (CMV) polymerase II promoter. The IBV N
gene was produced by PCR, using Pfu polymerase (Stratagene), from a plasmid containing an authentic copy of the Beaudette N gene
(3). An oligonucleotide
(GTCATGGCAAGCGGTAAAGCAGC) corresponding to the 5' end
of the IBV N gene, which contained an optimal Kozak sequence
(14), and an oligonucleotide (TCAAAGTTCATTCTCTCCTA) complementary to the 3' end of the IBV N gene were used for the PCR. The resulting PCR product, corresponding to the IBV N gene, was
initially inserted into pTarget (Promega) that had been circularized and then digested with SmaI, creating pT-N. The IBV N gene
was excised from pT-N by digestion with XhoI and
NotI and directionally inserted into pCi-Neo (Promega), such
that transcription of the IBV N gene was under the control of the CMV
promoter, thus generating pCi-N; the sequence was confirmed.
Vero cells (105 per 9.6-cm2 dish) were
transfected with 2 µg of pCi-N and 50 µg of Lipofectamine
(GibcoBRL). Cells were grown on coverslips and fixed 24 h
posttransfection with 50% methanol-50% acetone for analysis by
indirect immunofluorescence using rabbit anti-IBV polyclonal sera
(19) followed by fluorescein isothiocyanate (FITC)-labeled
goat anti-rabbit antibody (Harlan Sera-Lab). The IBV N protein
expressed from pCi-N was observed to be distributed throughout the
cytoplasm (Fig. 1A and B) and to be
colocalized to a structure within the nucleus, tentatively identified
as the nucleolus (Fig. 1C). While the number of transfected cells
remained constant, the number of cells in which the N protein was
colocalized to the nucleus varied each time the experiment was
repeated. To confirm that the identified structure was the nucleolus
and that N protein colocalized with this structure, cells were stained with propidium iodide to visualize nuclear DNA and nucleoli.
Fluorescent images were obtained from the same 0.5-µm optical section
by using a confocal microscope (Leica) and the appropriate filters to
identify IBV N protein (Fig. 1D) and nuclear DNA (Fig. 1E). The images were digitally superimposed to depict the distribution of N protein and
nuclear DNA (Fig. 1F). Nucleoli were identified as distinct regions
within the nucleus in images from both optical sections, and
localization of the IBV N protein to the nucleolus was confirmed (Fig.
1D and E).
View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Vero cells were transfected with pCi-N, incubated for
24 h, fixed, and analyzed by indirect immunofluorescence using
rabbit anti-IBV sera and FITC-labeled goat anti-rabbit antibodies.
Additionally, cells were stained with propidium iodide (D to F) to
visualize nuclear DNA. For images A to C, the fluorescing protein
images were gathered from different 0.5-µm optical sections by using
a confocal microscope and the appropriate filter; for images D to F,
the differentially fluorescing IBV N protein (D) and nuclear DNA images
(E) were gathered separately from the same 0.5-µm optical section by
using a confocal microscope and appropriate filters. The two images
were digitally superimposed to depict the distribution of the IBV N
protein and nuclear DNA (E). Each arrow indicates the position of a
nucleolus. Magnification, ×63.
|
|
Expression of viral proteins in the context of an IBV-infected
cell.
Vero cells (105 per 9.6-cm2 dish)
were infected with a Vero-adapted strain of IBV at a multiplicity of
infection of 1 and fixed 24 h postinfection. The IBV-infected
fixed cells were stained with propidium iodide, to visualize nuclear
DNA, and analyzed by indirect immunofluorescence as before to determine
whether any of the IBV proteins were localized to the infected cell
nucleoli. Confocal images corresponding to the IBV proteins and nuclear DNA were gathered separately from the same 0.5-µm optical section. IBV proteins were observed to localize in only the cytoplasm (Fig. 2A) and in the cytoplasm and nucleolus
(Fig. 2B). A similar result was observed in cells infected with PRRSV,
up to 75% of which showed localization of the PRRSV N protein to the
nucleolus 24 h posttransfection (26). However, in
90% of the IBV-infected cells, no IBV protein was detected in the
nucleus. A possible reason for the observation that fewer IBV-infected
cells showed localization of an IBV protein(s) to the nucleolus is the
number of cells undergoing mitosis. Nucleoli are absent from mitotic cells (1). For example, cells in which no IBV protein was
observed in the nucleolus (Fig. 2A) contained two nuclei, indicating
that they were undergoing mitosis. In contrast, cells in which IBV protein was found to be localized to the nucleolus (Fig. 2B) contained only one nucleus, indicating that they were in interphase and that rRNA
synthesis and assembly were taking place as a consequence of the
presence of nucleoli.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Vero cells were infected with IBV Beaudette at an
multiplicity of infection of 1, incubated for 24 h, fixed, and
stained in propidium iodide to visualize nuclear DNA. Indirect
immunofluorescence using rabbit anti-IBV sera and FITC-labeled goat
anti-rabbit antibodies was used to detect IBV proteins. For each image,
the differentially fluorescing protein and nuclear DNA images were
gathered separately from the same 0.5-µm optical section by using a
confocal microscope and appropriate filters. The arrow indicates the
position of a nucleolus. Magnification, ×63.
|
|
Based on the expression profile of the IBV N protein from pCi-N, in the
absence of other IBV proteins, the most likely IBV
protein localizing
in the nucleoli of infected cells is N. The
other IBV structural
proteins, S, M, and E, all contain transmembrane
domains and are
localized to the virus envelope; they require
processing through the
endoplasmic reticulum pathway and are not
observed in the cytosol. In
confirmation, no nucleolar localization
of the IBV M protein was
observed following expression of the
M protein under the control of a
CMV promoter (data not shown).
The observation that an IBV protein,
presumably N, can localize
to the nucleolus in virus-infected cells
indicated that the nucleolar
localization of the IBV N protein
expressed from the CMV promoter
was not an artifact of the expression
system. Localization of
the N protein to the nucleoli is not a
phenomenon limited to coronaviruses.
The observation that in an
arterivirus, PRRSV (
26), and a coronavirus,
IBV, N protein
colocalizes to the nucleoli of infected cells is
a phenomenon probably
common to these two virus families and potentially
common to all
Nidovirales.
Targeting of an exogenous protein to the nucleolus.
To
investigate whether the IBV N protein could be used to transport an
exogenous protein to the nucleolus, a reporter gene was fused to the
carboxy terminus of the N protein. The IBV N gene was produced by PCR
as before except that the oligonucleotide (AAAGTTCATTCTCTCCTA)
complementary to the 3' end of the N gene contained a leucine
codon in place of IBV N gene translational stop codon. The resulting
PCR product was inserted into pcDNA3.1/CT-GFP-TOPO (Invitrogen); the
resulting plasmid, pN-GFP, consisted of a chimeric IBV N-green
fluorescent protein (GFP) gene in which GFP fluorescence was dependent
on translation of the N-GFP fusion protein.
Vero cells (10
5 per 9.6-cm
2 dish) were
transfected with 2 µg of pN-GFP and 50 µg of Lipofectamine,
incubated for 24 h, fixed,
and analyzed by indirect
immunofluorescence as before except that
rabbit anti-IBV antibodies
were detected using an anti-rabbit
Alexa Fluor 564 (Molecular Probes).
The differentially fluorescing
N protein (Fig.
3A) and GFP (Fig.
3B) images were
gathered separately
as before and then digitally superimposed to depict
the relative
distributions of the two proteins (Fig.
3C). To
investigate whether
GFP could localize to the nucleolus without being
fused to the
IBV N protein, Vero cells were transfected with a plasmid
expressing
GFP. No nucleolar localization of GFP was observed (Fig.
3E
and
F). These results demonstrated that the IBV N-GFP fusion protein
colocalized to both the cytoplasm and nucleolus, indicating that
the
IBV N protein moiety directed GFP to the nucleolus. In approximately
90% of the cells transfected with pN-GFP, the IBV N-GFP fusion
protein
did not colocalize to the nucleolus (Fig.
3D), a result
similar to that
observed when IBV N protein was expressed either
alone or in the
context of an IBV-infected cell. Expression of
a PRRSV N-GFP fusion
protein in transfected cells also led to
the colocalization of the
fusion protein to both the cytoplasm
and nucleolus, although the
distribution between the two regions
was not detailed
(
26).
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Vero cells were transfected with pN-GFP (A to D) or pGFP
(E and F) and incubated for 24 h; IBV N protein was detected by
indirect immunofluorescence using rabbit anti-IBV sera and anti-rabbit
Alexa Fluor 564. The differentially fluorescing IBV N protein (A) and
GFP (B) images were gathered separately from the same 0.5-µm section
and from different sections (D to F) by using a confocal microscope and
appropriate filters; the two images were digitally superimposed (C to
F). Each arrow indicates the position of a nucleolus. Magnification,
×63.
|
|
Murine hepatitis virus has been shown to replicate in enucleated cells
(
38), indicating that the nucleus is not required
for
coronavirus replication. However, our data have shown that
the IBV N
protein can localize to the nucleolus as well as to
the cytoplasm. In
each instance, N protein in IBV-infected cells,
expressed alone or as a
fusion protein with GFP, was localized
either in the cytoplasm but not
in the nucleoli or in both regions
of the cell. These results are in
accordance with those described
for the expression and colocalization
of the arterivirus PRRSV
N protein (
26). The number and
size of nucleoli in a cell varies
during the cell cycle
(
1): multiple nucleoli are present at
the beginning of
G
1 (Fig.
1F), and a single nucleolus is present
during the
later stages of G
1, S, and G
2 (e.g., Fig.
1C
and
3C).
Nucleoli are absent or dissociated from cells during mitosis,
which is consistent with the observation that localization of
the IBV N
protein to the nucleus of cells identified as undergoing
mitosis never
occurred (Fig.
2A). However, mitosis alone cannot
account for the
absence of N protein from the nucleoli in the
majority of transfected
or infected cells, which suggests that
localization of the IBV N
protein to the nucleoli might be dependent
on a particular event(s) or
phase of the cell cycle that the transfected
or infected cell was
in.
The mechanism by which the IBV N protein was transported to the
nucleolus was not elucidated in this study. However, the nucleolus
is
the site for rRNA synthesis and ribosome assembly, and as such
many
ribosomal proteins from the cytoplasm are transported to
this structure
(
4). Based on comparison with other virus nucleolar
localization signals (NuLSs) and deletion mutagenesis, Rowland
et al.
(
26) identified two separate domains within the N terminus
of PRRSV N protein that might target this protein to the nucleolus.
Furthermore, experimental evidence indicated that the second region
was
sufficient to target PRRSV N protein to the nucleolus
(
26).
Amino acid sequence comparison between the putative
NuLS of PRRSV
and IBV N protein indicated that the C-terminal region of
the
IBV N protein might contain the IBV homologue of the PRRSV N
protein
NuLS motif (Fig.
4A). Sequence
comparison indicated that the potential
NuLS core motif identified in
IBV strain Beaudette was conserved
in 10 other strains of IBV (GenBank
accession numbers are shown
in brackets): Ark99 [
M85244], DE072
[
AF203001], M41 [
M28566],
VicS [U528566], V5/90 [
U52595],
N2/75 [
U52598], N1/62 [
U52596],
N9/74 [
U52597], QXIBV
[
AF199412], and KB8523 [
M21515]
(
3,
27,
32,
39).
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Amino acid sequence alignments to identify a
potential NuLS and an RBS on the IBV Beaudette strain N protein, using
the PRRSV NuLS (26) and eastern equine encephalitis virus
(EEEV) RBS (37) as a basis for comparison. Locations of
the two potential motifs on the IBV N protein are also shown (B).
Similar amino acids are shown in boldface; the start position of the
appropriate amino acid on the full-length protein is indicated in
parentheses.
|
|
Many other RNA viruses contain RNA binding proteins. For example, the
alphavirus RNA binding protein (capsid protein) associates
with
alphavirus RNA and ribosomes to promote disassembly and assembly
of the
virus particle (
34,
36), and a ribosome binding site
(RBS)
has been identified (
37). Sequence comparison between
the
RBS of eastern equine encephalitis virus and the IBV N protein
identified a similar motif in N protein (Fig.
4A). Interestingly,
the
potential IBV RBS motif localizes to the same region as the
putative
NuLS (Fig.
4B), possibly because this is a lysine-rich
region. One can
speculate that the IBV N protein might associate
with ribosomal
proteins, possibly as part of a strategy to control
coronavirus
translation and/or as a by-product of a ribosome-mediated
uncoating of
the viral core
particle.
In coronavirus-infected cells, host cell translation has been reported
to be down-regulated (
9,
30), while translation
of
virus-encoded proteins is up-regulated (
33). This
multifactorial
regulation of translation during a coronavirus infection
could
be due to the coronavirus N protein. First, by localizing to the
nucleolus, the coronavirus N protein might interfere with host-cell
translation by disrupting the formation of new ribosomes and possibly
the cell cycle. Second, by binding to the 5' end of coronavirus-derived
RNA (
22), the N protein may be recruiting ribosomes for
translation
of viral
RNAs.
Alternatively, interaction of ribosomes with the coronavirus core could
cause destabilization and release of genomic RNA.
Similar processes
have been observed with virus proteins that
bind genomic RNA of
alphaviruses (
36), tobacco mosaic virus
(
40),
and nodaviruses (
10). The coronavirus N protein may
therefore traffic to the nucleolus in association with ribosomal
proteins resulting from disassembly of the coronavirus cores for
the
release of the genomic
RNA.
| |
ACKNOWLEDGMENTS |
This work was supported by a BBSRC program grant (45/S12883) and a
Royal Society research grant (21651) to J.A.H. and grant CT950064 of
the Fourth RTD Framework Program of the European Commission to D.C. and
P.B. T.W. was supported by a Reading Endowment Trust Fund awarded
to J.A.H.
We thank Steve Poutney for excellent assistance with the confocal microscope.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: School of Animal
and Microbial Sciences, University of Reading, Whiteknights, P.O. Box
228, Reading RG6 6AJ, England, United Kingdom. Phone: (0)118 931 8893. Fax: (0)118 931 0180. E-mail:
j.a.hiscox{at}reading.ac.uk.
| |
REFERENCES |
| 1.
|
Alberts, B.,
D. Bray,
J. Lewis,
M. Raff,
K. Roberts, and J. D. Watson.
1994.
Molecular biology of the cell, 3rd ed., p. 381-382.
Garland Publishing, New York, N.Y.
|
| 2.
|
Baric, R. S.,
G. W. Nelson,
J. O. Fleming,
R. J. Deans,
J. G. Keck,
N. Casteel, and S. A. Stohlman.
1988.
Interactions between coronavirus nucleocapsid protein and viral RNAs: implications for viral transcription.
J. Virol.
62:4280-4287[Abstract/Free Full Text].
|
| 3.
|
Boursnell, M. E. G.,
M. M. Binns,
I. J. Foulds, and T. D. K. Brown.
1985.
Sequence of the nucleocapsid genes from two strains of avian infectious bronchitis virus.
J. Gen. Virol.
66:573-580[Abstract/Free Full Text].
|
| 4.
|
Carmo-Fonseca, M.,
L. Mendes-Soares, and I. Campos.
2000.
To be or not to be in the nucleolus.
Nat. Cell Biol.
2:E107-E112[CrossRef][Medline].
|
| 5.
|
Cavanagh, D.
1997.
Nidovirales: a new order comprising Coronaviridae and Arteriviridae.
Arch. Virol.
142:629-633[Medline].
|
| 6.
|
Chang, R.-Y., and D. A. Brian.
1996.
cis requirement for N-specific protein sequence in bovine coronavirus defective interfering RNA replication.
J. Virol.
70:2201-2207[Abstract].
|
| 7.
|
Compton, J. R.,
D. B. Rogers,
K. V. Holmes,
D. Fertsch,
J. Remenick, and J. J. McGowan.
1987.
In vitro replication of mouse hepatitis virus strain A59.
J. Virol.
61:1814-1820[Abstract/Free Full Text].
|
| 8.
|
Davies, H. A.,
R. R. Dourmashkin, and R. MacNaughton.
1981.
Ribonucleoprotein of avian infectious bronchitis virus.
J. Gen. Virol.
53:67-74[Abstract/Free Full Text].
|
| 9.
|
Hilton, A.,
L. Mizzen,
G. Macintyre,
S. Cheley, and R. Anderson.
1986.
Translational control in murine hepatitis virus infection.
J. Gen. Virol.
67:923-932[Abstract/Free Full Text].
|
| 10.
|
Hiscox, J. A., and L. A. Ball.
1997.
Cotranslational disassembly of flock house virus in a cell-free system.
J. Virol.
71:7974-7977[Abstract].
|
| 11.
|
Hiscox, J. A.,
D. Cavanagh, and P. Britton.
1995.
Quantification of individual subgenomic mRNA species during replication of the coronavirus transmissible gastroenteritis virus.
Virus Res.
36:119-130[CrossRef][Medline].
|
| 12.
|
Hiscox, J. A.,
K. L. Mawditt,
D. Cavanagh, and P. Britton.
1995.
Investigation of the control of coronavirus subgenomic mRNA transcription by using T7-generated negative-sense RNA transcripts.
J. Virol.
69:6219-6227[Abstract].
|
| 13.
|
Keck, J. G.,
B. G. Hogue,
D. A. Brian, and M. M. C. Lai.
1988.
Temporal regulation of bovine coronavirus RNA synthesis.
Virus Res.
9:343-356[CrossRef][Medline].
|
| 14.
|
Kozak, M.
1991.
An analysis of vertebrate mRNA sequences: intimations of translational control.
J. Cell Biol.
115:887-903[Abstract/Free Full Text].
|
| 15.
|
Lai, M. M. C., and D. Cavanagh.
1997.
The molecular biology of coronaviruses.
Adv. Virus Res.
48:1-100.
|
| 16.
|
Lapps, W.,
B. G. Hogue, and D. A. Brian.
1987.
Sequence analysis of the bovine coronavirus nucleocapsid and matrix protein gene.
Virology
157:47-57[CrossRef][Medline].
|
| 17.
|
Laude, H., and P. S. Masters.
1995.
The coronavirus nucleocapsid protein, p. 141-163.
In
S. G. Siddell (ed.), The Coronaviridae. Plenum Press, New York, N.Y.
|
| 18.
|
Masters, P. S.
1992.
Localization of an RNA-binding domain in the nucleocapsid protein of the coronavirus mouse hepatitis virus.
Arch. Virol.
125:141-160[CrossRef][Medline].
|
| 19.
|
Mockett, A. P. A.
1985.
Envelope proteins of avian infectious bronchitis virus: purification and biological properties.
J. Virol. Methods
12:271-278[CrossRef][Medline].
|
| 20.
|
Molenkamp, R.,
H. van Tol,
B. C. D. Rozier,
Y. van der Meer,
W. J. M. Spaan, and E. J. Snijder.
2000.
The arterivirus replicase is the only viral protein required for genome replication and subgenomic mRNA transcription.
J. Gen. Virol.
81:2491-2496[Abstract/Free Full Text].
|
| 21.
|
Nelson, G. W., and S. A. Stohlman.
1993.
Localization of the RNA-binding domain of mouse hepatitis virus nucleocapsid protein.
J. Gen. Virol.
74:1975-1979[Abstract/Free Full Text].
|
| 22.
|
Nelson, G. W.,
S. A. Stohlman, and S. M. Tahara.
2000.
High affinity interaction between nucleocapsid protein and leader/intergenic sequence of mouse hepatitis virus RNA.
J. Gen. Virol.
81:181-188[Abstract/Free Full Text].
|
| 23.
|
Parker, M. M., and P. S. Masters.
1990.
Sequence comparison of the N genes of 5 strains of the coronavirus mouse hepatitis virus suggests a 3 domain-structure for the nucleocapsid protein.
Virology
179:463-468[CrossRef][Medline].
|
| 24.
|
Pedersen, K. W.,
Y. van der Meer,
N. Roos, and E. J. Snijder.
1999.
Open reading frame 1a-encoded subunits of the arterivirus replicase induce endoplasmic reticulum-derived double-membrane vesicles which carry the viral replication complex.
J. Virol.
73:2016-2026[Abstract/Free Full Text].
|
| 25.
|
Risco, C.,
I. M. Anton,
L. Enjuanes, and J. L. Carrascosa.
1996.
The transmissible gastroenteritis coronavirus contains a spherical core shell consisting of M and N proteins.
J. Virol.
70:4773-4777[Abstract].
|
| 26.
|
Rowland, R. R.,
R. Kerwin,
C. Kuckleburg,
A. Sperlich, and D. A. Benfield.
1999.
The localization of porcine reproductive and respiratory syndrome virus nucleocapsid protein to the nucleolus of infected cells and identification of a potential nucleolar localization signal sequence.
Virus Res.
64:1-12[CrossRef][Medline].
|
| 27.
|
Sapats, S. I.,
F. Ashton,
P. J. Wright, and J. Ignjatovic.
1996.
Novel variation in the N protein of avian infectious bronchitis virus.
Virology
226:412-417[CrossRef][Medline].
|
| 28.
|
Sethna, P. B., and D. A. Brian.
1997.
Coronavirus genomic and subgenomic minus-strand RNAs copartition in membrane-protected replication complexes.
J. Virol.
71:7744-7749[Abstract].
|
| 29.
|
Shi, S. T.,
J. J. Schiller,
A. Kanjanahaluethai,
S. C. Baker,
J. W. Oh, and M. M. C. Lai.
1999.
Colocalization and membrane association of murine hepatitis virus gene 1 products and de novo-synthesized viral RNA in infected cells.
J. Virol.
73:5957-5969[Abstract/Free Full Text].
|
| 30.
|
Siddell, S.,
H. Wege,
A. Barthel, and V. ter Meulen.
1981.
Intracellular protein synthesis and the in vitro translation of coronavirus JHM mRNA.
Adv. Exp. Med. Biol.
142:193-207[Medline].
|
| 31.
|
Stohlman, S. A.,
R. S. Baric,
G. N. Nelson,
L. H. Soe,
L. M. Welter, and R. J. Deans.
1988.
Specific interaction between coronavirus leader RNA and nucleocapsid protein.
J. Virol.
62:4288-4295[Abstract/Free Full Text].
|
| 32.
|
Sutou, S.,
S. Sato,
T. Okabe,
M. Nakai, and N. Sasaki.
1988.
Cloning and sequencing of genes encoding structural proteins of avian infectious bronchitis virus.
Virology
165:589-595[CrossRef][Medline].
|
| 33.
|
Tahara, S. M.,
T. A. Dietlin,
C. C. Bergmann,
G. W. Nelson,
S. Kyuwa,
R. P. Anthony, and S. A. Stohlman.
1994.
Coronavirus translational regulation: leader affects mRNA efficiency.
Virology
202:621-630[CrossRef][Medline].
|
| 34.
|
Ulmanen, I.,
H. Soderlund, and L. Kaarianen.
1976.
Semliki Forest virus capsid protein associates with 60S ribosomal subunit in infected cells.
J. Virol.
20:203-210[Abstract/Free Full Text].
|
| 35.
|
van der Meer, Y.,
E. J. Snijder,
J. C. Dobbe,
S. Schleich,
M. R. Denison,
W. J. M. Spaan, and J. K. Locker.
1999.
Localization of mouse hepatitis virus nonstructural proteins and RNA synthesis indicates a role for late endosomes in viral replication.
J. Virol.
73:7641-7657[Abstract/Free Full Text].
|
| 36.
|
Wengler, G., and G. Wengler.
1984.
Identification of a transfer of viral core protein to cellular ribosomes during the early stages of alphavirus infection.
Virology
134:435-442[CrossRef][Medline].
|
| 37.
|
Wengler, G.,
D. Wurkner, and G. Wengler.
1992.
Identification of a sequence element in the alphavirus core protein which mediates interaction of cores with ribosomes and the disassembly of cores.
Virology
191:880-888[CrossRef][Medline].
|
| 38.
|
Wilhelmsen, K. C.,
J. L. Leibowitz,
C. W. Bond, and J. A. Robb.
1981.
The replication of murine coronaviruses in enucleated cells.
Virology
110:225-230[CrossRef][Medline].
|
| 39.
|
Williams, A. K.,
L. Wang,
L. W. Sneed, and E. W. Collisson.
1992.
Comparative analyses of the nucleocapsid genes of several strains of infectious bronchitis virus and other viruses.
Virus Res.
25:213-222[CrossRef][Medline].
|
| 40.
|
Wilson, T. M. A.
1984.
Cotranslational disassembly of tobacco mosaic virus in vitro.
Virology
137:155-265.
|
| 41.
|
Zhou, M. L.,
A. K. Williams,
S. I. Chung,
L. Wang, and E. W. Collisson.
1996.
Infectious bronchitis virus nucleocapsid protein binds RNA sequences in the 3' terminus of the genome.
Virology
217:191-199[CrossRef][Medline].
|
Journal of Virology, January 2001, p. 506-512, Vol. 75, No. 1
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.1.506-512.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhou, B., Liu, J., Wang, Q., Liu, X., Li, X., Li, P., Ma, Q., Cao, C.
(2008). The Nucleocapsid Protein of Severe Acute Respiratory Syndrome Coronavirus Inhibits Cell Cytokinesis and Proliferation by Interacting with Translation Elongation Factor 1{alpha}. J. Virol.
82: 6962-6971
[Abstract]
[Full Text]
-
Reed, M. L., Howell, G., Harrison, S. M., Spencer, K.-A., Hiscox, J. A.
(2007). Characterization of the Nuclear Export Signal in the Coronavirus Infectious Bronchitis Virus Nucleocapsid Protein. J. Virol.
81: 4298-4304
[Abstract]
[Full Text]
-
Saikatendu, K. S., Joseph, J. S., Subramanian, V., Neuman, B. W., Buchmeier, M. J., Stevens, R. C., Kuhn, P.
(2007). Ribonucleocapsid Formation of Severe Acute Respiratory Syndrome Coronavirus through Molecular Action of the N-Terminal Domain of N Protein. J. Virol.
81: 3913-3921
[Abstract]
[Full Text]
-
Oh, W., Yang, M.-R., Lee, E.-W., Park, K.-m., Pyo, S., Yang, J.-s., Lee, H.-W., Song, J.
(2006). Jab1 Mediates Cytoplasmic Localization and Degradation of West Nile Virus Capsid Protein. J. Biol. Chem.
281: 30166-30174
[Abstract]
[Full Text]
-
Grieger, J. C., Snowdy, S., Samulski, R. J.
(2006). Separate Basic Region Motifs within the Adeno-Associated Virus Capsid Proteins Are Essential for Infectivity and Assembly.. J. Virol.
80: 5199-5210
[Abstract]
[Full Text]
-
Hodgson, T., Britton, P., Cavanagh, D.
(2006). Neither the RNA nor the Proteins of Open Reading Frames 3a and 3b of the Coronavirus Infectious Bronchitis Virus Are Essential for Replication. J. Virol.
80: 296-305
[Abstract]
[Full Text]
-
You, J., Dove, B. K., Enjuanes, L., DeDiego, M. L., Alvarez, E., Howell, G., Heinen, P., Zambon, M., Hiscox, J. A.
(2005). Subcellular localization of the severe acute respiratory syndrome coronavirus nucleocapsid protein. J. Gen. Virol.
86: 3303-3310
[Abstract]
[Full Text]
-
Rowland, R. R. R., Chauhan, V., Fang, Y., Pekosz, A., Kerrigan, M., Burton, M. D.
(2005). Intracellular Localization of the Severe Acute Respiratory Syndrome Coronavirus Nucleocapsid Protein: Absence of Nucleolar Accumulation during Infection and after Expression as a Recombinant Protein in Vero Cells. J. Virol.
79: 11507-11512
[Abstract]
[Full Text]
-
Jonassen, C. M., Kofstad, T., Larsen, I.-L., Lovland, A., Handeland, K., Follestad, A., Lillehaug, A.
(2005). Molecular identification and characterization of novel coronaviruses infecting graylag geese (Anser anser), feral pigeons (Columbia livia) and mallards (Anas platyrhynchos). J. Gen. Virol.
86: 1597-1607
[Abstract]
[Full Text]
-
Mori, Y., Okabayashi, T., Yamashita, T., Zhao, Z., Wakita, T., Yasui, K., Hasebe, F., Tadano, M., Konishi, E., Moriishi, K., Matsuura, Y.
(2005). Nuclear Localization of Japanese Encephalitis Virus Core Protein Enhances Viral Replication. J. Virol.
79: 3448-3458
[Abstract]
[Full Text]
-
Chen, H., Gill, A., Dove, B. K., Emmett, S. R., Kemp, C. F., Ritchie, M. A., Dee, M., Hiscox, J. A.
(2005). Mass Spectroscopic Characterization of the Coronavirus Infectious Bronchitis Virus Nucleoprotein and Elucidation of the Role of Phosphorylation in RNA Binding by Using Surface Plasmon Resonance. J. Virol.
79: 1164-1179
[Abstract]
[Full Text]
-
Yoo, D., Wootton, S. K., Li, G., Song, C., Rowland, R. R.
(2003). Colocalization and Interaction of the Porcine Arterivirus Nucleocapsid Protein with the Small Nucleolar RNA-Associated Protein Fibrillarin. J. Virol.
77: 12173-12183
[Abstract]
[Full Text]
-
Casais, R., Dove, B., Cavanagh, D., Britton, P.
(2003). Recombinant Avian Infectious Bronchitis Virus Expressing a Heterologous Spike Gene Demonstrates that the Spike Protein Is a Determinant of Cell Tropism. J. Virol.
77: 9084-9089
[Abstract]
[Full Text]
-
Chen, H., Wurm, T., Britton, P., Brooks, G., Hiscox, J. A.
(2002). Interaction of the Coronavirus Nucleoprotein with Nucleolar Antigens and the Host Cell. J. Virol.
76: 5233-5250
[Abstract]
[Full Text]
-
Tijms, M. A., van der Meer, Y., Snijder, E. J.
(2002). Nuclear localization of non-structural protein 1 and nucleocapsid protein of equine arteritis virus. J. Gen. Virol.
83: 795-800
[Abstract]
[Full Text]
-
Casais, R., Thiel, V., Siddell, S. G., Cavanagh, D., Britton, P.
(2001). Reverse Genetics System for the Avian Coronavirus Infectious Bronchitis Virus. J. Virol.
75: 12359-12369
[Abstract]
[Full Text]
-
Wurm, T., Chen, H., Hodgson, T., Britton, P., Brooks, G., Hiscox, J. A.
(2001). Localization to the Nucleolus Is a Common Feature of Coronavirus Nucleoproteins, and the Protein May Disrupt Host Cell Division. J. Virol.
75: 9345-9356
[Abstract]
[Full Text]
Top
Abstract
Text
