Previous Article | Next Article 
Journal of Virology, January 2001, p. 292-302, Vol. 75, No. 1
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.1.292-302.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The E1 Initiator Recognizes Multiple Overlapping
Sites in the Papillomavirus Origin of DNA Replication
Grace
Chen1,2 and
Arne
Stenlund1,*
Cold Spring Harbor Laboratory, Cold Spring
Harbor, New York 11724,1 and Graduate
Program in Genetics, State University of New York at Stony Brook,
Stony Brook, New York 117942
Received 11 July 2000/Accepted 3 October 2000
 |
ABSTRACT |
A common feature of replicator sequences from a variety of
organisms is multiple binding sites for an initiator protein. By binding to the replicator, initiators mark the site and contribute to
melting or distortion of the DNA. We have defined the recognition sequence for the papillomavirus E1 initiator and determined the arrangement of binding sites in the viral origin of replication. We
show that E1 recognizes a hexanucleotide sequence which is present in
overlapping arrays in virtually all papillomavirus replicators. Binding
of the initiator to these sites would result in the formation of a
closely packed array of E1 molecules that wrap around the double helix.
 |
INTRODUCTION |
Initiation of DNA replication
requires the recognition of the replicator, or origin of replication
(ori), by an initiator protein. Initiator proteins, as the name
implies, function by promoting initiation of DNA replication and can
perform this function in several ways. In addition to ori recognition,
initiators interact with components of the replication machinery, such
as DNA polymerases, thereby acting as "landing pads" for the
binding of replication factors to the ori. Binding of initiator
proteins frequently results in the structural distortion of the ori
which may promote local ori melting and subsequent DNA unwinding. In
some cases, viral initiators have intrinsic helicase activity and are
capable of unwinding DNA without the assistance of other factors.
This latter class of initiator proteins, the T antigens from viruses
such as simian virus 40 (SV40) and polyomavirus and the E1 proteins
from papillomaviruses can perform all of the functions that are
required for unwinding (for reviews about these proteins, see
references 10 and 43). These
proteins share many features, although the two types of viruses are
only distantly related. Both proteins have common domains, such as a
DNA-binding domain (DBD) and nuclear localization signal in the
N-terminal half of the protein and ATP-binding and helicase domains in
the C-terminal half (4, 5, 10, 19, 20, 25, 31, 44).
Interestingly, the structures of the DBDs are very similar in spite of
a lack of significant sequence homology (9, 22),
indicating that the two proteins overall may be more similar than
expected from the low degree of sequence similarity. Upon binding, both
proteins form oligomeric structures which are capable of locally
melting the ori (2, 3, 12, 29, 30, 40). The
helicase-active form of both proteins is a hexamer, which unwinds DNA
strand specifically (11, 34, 38, 40, 48, 50).
Bidirectional unwinding is likely made possible by the formation of two
hexamers at the site of unwound DNA, which has been observed for T
antigen (26, 39, 48).
How an oligomeric helicase forms from these monomeric ori-binding
initiator proteins has resisted elucidation. The relationship between the number of binding sites and the oligomeric forms of the
proteins is not obvious. In the case of the well-characterized T
antigen, four pentanucleotide repeats with the sequence GAGGC are found
in the SV40 ori and are bound with high sequence specificity by T
antigen (7, 8, 45). However, only a subset of these sites
seem to be required for both local ori distortion and double-hexamer formation (18). Despite the occupation of only a subset of
sites by the double hexamer, all four sites are required for extensive unwinding of the DNA (18). Thus, how T antigen utilizes
its binding sites to assemble an active oligomeric initiator complex that can distort the ori and subsequently form a helicase has yet to be determined.
The structural and functional homology between SV40 T antigen and
papillomavirus E1 proteins suggests that common mechanisms are used by
these viruses in the assembly of active initiator complexes. Like T
antigen, the E1 protein recognizes and binds to multiple sites within
the ori (16, 17, 27, 35, 37, 47, 49). However, in contrast
to SV40, a second viral protein, the transcription factor E2, is
utilized in combination with E1. Through cooperative interaction with
E2, E1 binding to the ori is stimulated, and the specificity with which
E1 binds to the ori is also greatly increased (1, 23, 28, 32, 37,
46, 49). E1 therefore requires E2 as a loading factor which
confers specificity (24, 30). Several E1-containing ori
complexes have been isolated and characterized, lending insight into
the steps which occur during the assembly of an active initiator
complex capable of DNA unwinding. The cooperative binding of E1 and E2 to the ori results in the formation of the E1E2-ori complex, which is
capable of highly sequence-specific DNA binding and ori recognition (32). The E1E2-ori complex is a direct precursor of an
E1-ori complex, which contains no E2 and has a greater number of E1
monomers bound to the ori compared to the E1E2-ori complex and which is active for local ori melting (24, 30). The progression
from the E1E2-ori complex to the E1-ori complex through the loading of
additional E1 monomers onto the ori suggests that the formation of even
larger forms of E1 may involve, similarly, the stepwise binding of
additional E1 molecules to preexisting ori-bound E1 complexes.
We have previously characterized the DNA-binding properties of the
bovine papillomavirus (BPV) E1 DBD (4). We have also demonstrated that the E1 palindrome contains at least two binding sites
for E1 and that these binding sites are used in the formation of the
E1E2-ori complex. Here, we have used the E1 DBD to further characterize
the E1 binding site. We demonstrate that E1 recognizes variants of the
hexanucleotide sequence AACAAT which is present in six
copies in the E1 binding site. These sites, which are conserved in both
sequence and position in other papillomavirus ori's, are arranged in
an overlapping array. The occupation of six potential E1 binding sites
within the ori suggests a mechanism for the generation of oligomeric E1
complexes, ultimately resulting in E1 hexamers with DNA helicase activity.
 |
MATERIALS AND METHODS |
Protein expression and purification.
The expression and
purification of the E1 and E2 DBDs have been described previously
(4).
Plasmid constructs.
All BPV ori constructs and mutants were
generated from a plasmid containing the BPV minimal ori (sequences
between nucleotides 7914 and 27 in the BPV genome) cloned between the
XbaI and HindIII restriction sites in pUC19
but with a high-affinity E2 binding site, E2 BS9 (21).
Xho probes.
Ori constructs containing an 8-bp
XhoI linker flanking half of the E1 palindrome and the BS9
E2 binding site were generated by PCR using a primer containing the
XhoI linker for the top strand (GGTCTAGACCTCGAGGAACAAT) and a primer containing
the E2 binding site for the bottom strand. The template was an ori
containing an XhoI linker inserted into the HpaI
restriction site in the center of the E1 palindrome. All point
mutations in the E1 binding site in this context were generated by PCR
using top-strand primers containing the desired mutation. Xho probes
containing inosine substitutions were generated using primers
containing the inosine in either the top or the bottom strand depending
on the location of the purine to be substituted. The +3 and the B42+3
ori's containing a three-nucleotide insertion between the E1 and E2
binding sites (see Fig. 5) were generated by PCR using a primer
containing the high-affinity E2 binding site 9 and a three-nucleotide
insertion (CAC) between the E1 palindrome and the beginning of the E2
binding site. The template used was either the wild-type (wt) BPV
minimal ori (+3) or an ori containing a single point mutation in
nucleotide position 7942 of the BPV sequence (B42+3) (35).
DEPC analysis.
Diethyl pyrocarbonate (DEPC) interference
experiments were performed as described previously (4,
42).
Electrophoretic mobility shift assay (EMSA).
Probe (5,000 cpm/reaction) was mixed with E1 and/or the E2 DBD together with 20 ng
of nonspecific competitor DNA (pUC119) in binding buffer (20 mM
potassium phosphate [pH 7.4], 0.1 M NaCl, 1 mM EDTA, 0.1% NP-40, 3 mM dithiothreitol, 0.7 mg of bovine serum albumin/ml, 10% glycerol).
Binding reactions were performed in a total volume of 10 µl. After
incubation for 30 min at room temperature, the samples were loaded on
6% 40:1 (acrylamide-bisacrylamide) polyacrylamide gels and subjected
to electrophoresis in 0.5× Tris-borate-EDTA. Quantitation was
performed using a Fuji BAS 1000 imaging system.
 |
RESULTS |
The recognition sequence for E1 consists of the hexanucleotide
AACAAT.
Mutational analysis of the 18-bp E1 palindrome
has indicated that mutations in all positions affect the binding of E1
(17, 35). However, the binding of E1 in multiple different
complexes has made it difficult to unambiguously assign the specific
sequence that E1 recognizes. To define an E1 recognition sequence, we
constructed an ori template which contains one-half of the E1
palindrome, together with the E2 binding site, flanked by an
XhoI linker (Xho probe, Fig.
1A). We have previously shown that E2 can
stimulate binding of one monomer of E1 to the half of the E1 palindrome proximal to the E2 binding site when either the distal half is mutated
or the two halves of the palindrome are separated by an 8-bp linker
insertion (4). These results strongly suggested that a
recognition sequence for binding of an E1 monomer was contained within
one-half of the palindrome. We measured E1 binding in the presence of
E2, since the complex containing only the E1 monomer has low stability.




View larger version (160K):
[in this window]
[in a new window]
|
FIG. 1.
The E1 protein binds to the hexanucleotide sequence
AACAAT. (A) A probe containing an 8-bp XhoI
linker flanking half of the E1 palindrome with the E2 binding site in
its natural position was used in EMSA with E1 and E2 DBDs. Under these
conditions, a monomer of the E1 DBD binds cooperatively with E2 DBD to
the probe. Transversion mutations were generated in the XhoI
linker (B), the central 6 bp (C), and the right flank (D) and then
tested by EMSA. The results are shown in graphical form in panel E. (B)
Two transversion mutations in the XhoI linker (M1, lanes 9 to 16, and M2, lanes 17 to 24) were generated and compared to the wt
probe for E1 binding. Three fourfold dilutions of E1 DBD in the absence
(lanes 1 to 3, 9 to 11, and 17 to 19) or presence (lanes 4 to 6, 12 to
14, and 20 to 22) of the E2 DBD were used. Lanes 7, 15, and 23 contained E2 DBD alone; lanes 8, 16, and 24 contained probe alone. The
position of the combined E1 and E2 DBD complexes and the E2 DBD complex
are indicated by arrows. (C) Six transversion mutations were generated
in the E1 half-palindrome and tested for E1 binding as described in
panel B. Mutations C3 to G (lanes 6 to 10), A4 to T (lanes 11 to 15),
and A5 to T (lanes 16 to 20) are shown in comparison to the wt (lanes 1 to 5). Only binding in the presence of E2 is shown. Lanes 1 to 3, 6 to
8, 11 to 13, and 16 to 18 contained both E1 and E2 DBDs. Lanes 4, 9, 14, and 19 contained E2 DBD alone; lanes 5, 10, 15, and 20 contained
probe alone. (D) Three transversion mutations were generated in the
right flank in positions 7 to 9 and tested for binding of E1 DBD as
described above. Mutations A7 to T (lanes 6 to 10), A8 to T (lanes 11 to 15), and T9 to A (lanes 16 to 20) are shown in comparison with the
wt (lanes 1 to 5). Lanes 1 to 3, 6 to 8, 11 to 13, and 16 to 18 contained both E1 and E2 DBDs; lanes 4, 9, 15, and 19 contained E2 DBD
alone; lanes 5, 10, 15, and 20 contain probe alone. (E) Summary of the
results of transversion mutations in E1 binding site. The effects of
mutations is shown in a bar graph. The level of E1 binding to the wt
sequence is set at 1.0.
|
|
Figure
1 shows EMSA results in which mutations were generated in the
left flank (the Xho linker, panel B), the central hexanucleotide
sequence (panel C), and the right flank (panel D), and the results
are
summarized in the graph in Fig.
1E. In the presence of E1
alone, little
complex formation is observed (Fig.
1B, lanes 1
to 3). In the presence
of E2 DBD alone, a single complex is formed
(Fig.
1B, lane 7). In the
presence of both the E1 and E2 DBDs,
two major complexes form (Fig.
1B,
lanes 4 to 6). The faster-migrating
complex contains only the E2 DBD.
The second, slower-migrating
complex contains a monomer of the E1 DBD
bound cooperatively with
the E2 DBD. The identity of this complex was
verified by DEPC
interference analysis (data not shown). The
interference pattern
produced by this complex was virtually identical
to that observed
for a complex that was formed on a probe containing a
mutation
in the half of the E1 palindrome distal to the E2 binding site
which we previously have shown contains a monomer of the E1 DBD
together with the E2 DBD (
4). The more slowly migrating
complex
observed at the highest concentration of E1 DBD is of unknown
origin but likely corresponds to nonspecific binding of an additional
E1 molecule to the
XhoI linker sequence to form an E1 dimer
since
digestion of the probe with
XhoI results in loss of
the larger
complex (data not shown). The two mutations in the
XhoI linker,
C-to-G transitions (lanes 9 to 16 and 17 to 24)
had little or
no effect on E1 binding, as
expected.
Mutations in the central six nucleotides all had significant effects on
E1 binding (see Fig.
1C for specific examples and
Fig.
1E for a
summary). For example, a change from a C to a G
in the third position
of the half-palindrome reduced the formation
of the complex containing
a monomer of E1 bound together with
E2 by >10-fold (Fig.
1C, lanes 6 to 8). Similarly, a transversion
mutation in the fifth position, A5 to
T, also resulted in a severe
reduction in the level of E1 binding to
the probe together with
E2 (lanes 16 to 18). An A-to-T transversion in
the fourth position,
however, affected E1 binding only slightly (lanes
11 to 13). In
contrast, transversion mutations on the right flank (Fig.
1D),
namely, A to T at position 7 (lanes 6 to 10), A to T at position
8 (lanes 11 to 15), and T to A at position 9 (lanes 16 to 20),
had small
effects on E1 binding, indicating that the sequences
important for E1
binding are contained within positions 1 to 6.
This is consistent with
the minor effects of mutations at positions
7 and 8 observed for E1
monomer binding in the absence of E2 (
13).
The effects of single mutations on E1 binding are summarized in Fig.
1E. Transversion mutations in any of the first six nucleotides,
except
the fourth, significantly reduced E1 binding. However,
mutations
outside of this hexanucleotide sequence, namely, in
positions 7 to 9, only slightly impaired E1 binding to the Xho
probe in the presence of
E2. Mutations within the
XhoI linker
insertion also did not
affect E1 binding. This suggests that the
sequence AACAAT
constitutes the recognition sequence for binding
of a monomer of
E1 DBD. This is consistent with previous results
which show strong DEPC
interference within this sequence produced
by the complex containing a
single monomer of the E1 DBD together
with the E2 DBD (
4).
The effects of these mutations are also
very similar to the effects of
transversion mutations on the formation
of the full-length cross-linked
E1E2-ori complex (
35). Importantly,
in that study the E2
proximal and distal E1 binding sites (2 and
4) were affected virtually
identically by mutations, indicating
that the proximity to E2 and the
interaction with the E2 DBD does
not alter sequence recognition by E1
significantly. Thus, although
these binding experiments were performed
in the presence of E2
DBD, the results are likely a reflection of the
sequence specificity
of
E1.
We subsequently performed a complete mutagenesis of this hexanucleotide
sequence to determine the effects of both transition
and transversion
mutations. The effects of all of the single-point
mutations are shown
in the graph in Fig.
2. Transversion
mutations
within the hexanucleotide recognition sequence, namely, in
positions
1, 2, and 3, have significant effects on E1 binding and are
more
severe than the corresponding transition mutations. Mutations
of
the remaining three positions, 4, 5, and 6, showed a more complex
pattern. In position 4 of the binding site, mutating the A into
either
a C or a T had little effect on E1 binding, whereas the
single
transition mutation into a G has a severe effect, suggesting
that
features specific to a G/C base pair are inhibitory for E1
binding. In
position 5, any base pair other than an A/T base pair
nearly abolishes
E1 binding, suggesting that a specific determinant
in the A/T base pair
is important for E1 binding. In position
6, T-to-G or T-to-C mutations
have modest effects on binding,
while a T-to-A transversion has the
most severe effect of any
single point mutation (>20-fold reduction in
binding), indicating
that an A/T base pair at this position is
particularly deleterious
for binding.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Summary of the effects of mutations in all positions on
E1 binding. The six positions which showed significant effects on E1
binding in Fig. 1 were chosen for a complete mutagenesis, wherein the
bases at all positions were changed into the three possible
alternatives. The mutants were tested for binding of E1 DBD as shown in
Fig. 1, and the results were quantitated and are shown as a bar
graph.
|
|
The E1 palindrome contains six nested E1 binding sites.
Cooperative binding of E1 and E2 to the wt probe results in binding of
E1 to the sequence AACAAT and an identical sequence in the
other half of the palindrome and binding of E2 to the E2 binding site,
based on interference and mutational analysis (E1 BS 2 and 4, Fig.
3A). Inspection of the E1 palindrome
indicated that a second pair of putative E1 binding sites are present
(E1 BS 1 and 3). Binding sites 2 and 4 both have the sequence
AACAAT. Binding sites 1 and 3 have the sequences AACAAC
and AATAAT, respectively. The differences between
these sites and binding sites 2 and 4 is a single change in either the
sixth or the third position in sites 1 and 3, respectively. These
changes are in positions where transition mutations have modest effects
on E1 binding (Fig. 2). Further inspection of the E1 palindrome reveals
that there are two additional hexanucleotide sequences which are
similar to sites 1 to 4 and overlap sites 1 and 4. Binding sites 5 and
6 have the sequences AATCAC and AATTAT,
respectively. Both contain a transition at position 3 and a
transversion at position 4, each of which should not seriously impair
E1 binding (Fig. 2). Binding site 5 also has a C/G base pair instead of
an T/A base pair in the sixth position which, according to the
mutagenesis results in Fig. 2, is predicted to have only minor effects
on E1 binding. Thus, it is conceivable that these other sites can be
bound by E1.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
(A) The information from the mutagenesis experiments was
used to identify other potential E1 recognition sequences in the ori
based on sequence homology. These new putative sites, 1, 3, 5, and 6, are shown together with the known sites 2 and 4 as shaded boxes. (B)
Sites 1, 3, 5, and 6 were inserted into the Xho probe, and binding was
measured by EMSA in the presence of E2 DBD as described for Fig. 1. The
results are summarized in the bar graph.
|
|
To determine whether these flanking sequences could indeed serve as E1
binding sites, we utilized the assay depicted in Fig.
1, which allows
us to isolate and measure binding to an individual
E1 binding site. We
replaced the wt site with sequences comprising
the other putative sites
and tested the affinity of E1 to binding
to these sites in the presence
of the E2 DBD. The level of E1
binding observed when site 1, 3, 5, or 6 was substituted for site
2 in the Xho ori construct is shown as a bar
graph in Fig.
3B.
Binding to all four sites was very similar; sites 3 and 6 showed
an approximately threefold reduction compared to site 2, and sites
1 and 5 showed an approximately fivefold reduction compared
to
site
2.
A second pair of recognition sequences for E1 is present in the E1
binding site.
We previously hypothesized, based on our earlier
analysis of E1 complexes formed with the full-length E1 protein, that
two different complexes with overlapping binding sites could form on
the ori (35). In addition to the paired binding sites 2 and 4, mutagenesis and interference analysis indicated that a second pair of E1 binding sites was present partially overlapping the first
pair but shifted by 3 bp. To determine directly whether this second
pair of recognition sequences corresponded to sites 1 and 3, we
constructed an ori template containing a 3 bp insertion between the E2
binding site and the E1 palindrome (+3 ori). On the wt ori, the E2 DBD
can stimulate binding of the E1 DBD specifically to sites 2 and 4. Sites 1 and 3 are shifted by three nucleotides relative to binding
sites 2 and 4. Thus, it may be possible to stimulate binding of the E1
DBD to sites 1 and 3 if the E2 binding site is also moved by three
nucleotides, which would place the E2 DBD in register with the putative
binding sites 1 and 3. We compared complex formation using the wt probe
and the +3 ori in EMSA. We also included the probe B42+3. This probe
has a point mutation in E1 binding site 4 which prevents the formation
of the E1 dimer complex on sites 2 and 4. The results are shown in Fig.
4A.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
E1 DBD binds to binding sites 1 and 3 when the E2
binding site is moved by 3 bp. (A) EMSA was performed to determine the
ability of the E1 DBD to bind to the ori in combination with the E2 DBD
by using a probe with the E2 binding site in the wt position (wt, lanes
1 to 8) or when the E2 binding sites was moved 3 bp through an
insertion of 3 bp between the E1 and E2 binding sites (+3, lanes 9 to
16) or with a probe containing the +3 insertion and a point mutation in
binding site 4 (B42+3, lanes 17 to 24). Lanes 1 to 3, 9 to 11, and 16 to 18 contained three twofold dilutions of E1 DBD alone. Lanes 4 to 6, 12 to 14, and 19 to 21 contained the same dilutions of E1 DBD in the
presence of E2 DBD. Lanes 7, 14, and 23 contained E2 DBD alone; lanes
8, 15, and 24 contained probe alone. The arrows indicate the migration
of the respective complexes. (B) DEPC interference analysis was
performed on both strands of the B42+3 probe. The probes were modified
with DEPC, and the complexes formed in the presence of E2 DBD alone
(lanes 1 and 4) and both E1 and E2 DBDs (lanes 2 and 5) were isolated
and subjected to cleavage with piperidine and analyzed on a sequencing
gel. The positions of interference on both strands are indicated by
filled circles. (C) Diagram of the positions of interference in the wt
and +3 ori templates. The DEPC interference produced by binding of a
dimer of E1 DBD in the presence of E2 DBD on the B42+3 probe is shown
in comparison with the interference obtained for a complex formed on a
wt probe (4). The B42 mutation is shown in boldface.
|
|
In the absence of the E2 DBD, the E1 DBD forms a predominant complex
with the wt ori, and we know from previous studies that
this complex
contains two monomers of the E1 DBD bound to sites
2 and 4 (Fig.
4A,
lanes 1 to 3). At the highest concentration
of E1 DBD, a second,
slower-migrating complex can form, and this
probably represents the
binding of additional molecules of E1
either specifically or
nonspecifically to the ori (lane 1). In
the presence of the E2 DBD,
binding by the E1 DBD to sites 2 and
4 is stimulated through the
formation of the E1 DBD-E2 DBD-ori
complex (compare lanes 4 to 6 with
lanes 1 to
3).
Using the +3 probe, similar levels of binding were observed using the
E1 DBD alone, indicating that the three-nucleotide insertion
does not
affect E1 binding as expected (compare Fig.
4A, lanes
9 to 11, with
Fig.
4A, lanes 1 to 3). Since the sequence of the
E1 palindrome is
unchanged, the E1 DBD-DNA complex most likely
contains two E1 monomers
bound to sites 2 and 4, which are the
preferred sites of E1 binding.
This is consistent with the very
low level of binding observed with the
B42+3 probe, where the
E1 binding site 4 has been mutated (lanes 17 to
19). In the presence
of both the E1 and the E2 DBD, we observed two
complexes that
do not form in the presence of the E2 DBD alone (lanes
11 to 13).
The lower complex migrates in the same position as that
formed
in the presence of the E1 DBD alone and, therefore, is likely
to
contain two E1 DBD monomers bound to the preferred sites 2
and 4. The
upper complex migrates slower and likely corresponds
to binding of two
E1 DBD monomers together with the E2 DBD. Since
this complex is
unaffected by the B42 mutation (lanes 20 to 22),
E1 is unlikely to be
bound to sites 2 and 4, and the ability of
this complex to form on the
B42+3 probe would be consistent with
binding to sites 1 and
3.
A peculiarity is that the mobility of this complex is significantly
greater than for the complex formed on the wt ori. We
have shown that
cooperative binding of the E1 and E2 DBDs induces
a sharp bend in the
DNA (
13). The differences in mobility can
be explained by
the position of the E1 and E2 binding sites relative
to the ends of the
probes. The +3 ori probes that were used in
this experiment contain
less sequence flanking the E2 binding
site. Consequently, the sharp
bend induced by cooperative binding
of E1 and E2 is close to the end of
the probe which results in
a faster-migrating complex compared to when
the bend is closer
to the center of the probe, as in the wt
probe.
To determine whether E1 was bound to sites 1 and 3 in the complex
formed on the +3 ori, we performed DEPC interference analysis
on the E1
DBD-E2 DBD-ori complex formed on the B42+3 ori. probe.
We used the
B42+3 ori in order to simplify the isolation of the
complex away from
the E1 dimer complex that forms on sites 2 and
4 in the +3 probe. An
EMSA was performed using the B42+3 ori probe
treated with DEPC, which
modifies A and G residues. The complex
was extracted from the gel,
cleaved with piperidine, and analyzed
on a sequencing gel. The results
for both strands are shown in
Fig.
4B. On both the bottom and the top
strands we observed strong
interferences over both halves of the E1
palindrome (compare lanes
2 and 3 and lanes 5 and 6). E2 DBD alone gave
rise to interferences
over the E2 binding site as expected (lane 4 for
the top strand
and data not shown for the bottom
strand).
The interference data is summarized in Fig.
4C. The interference
pattern produced by binding of E1 DBD, together with E2 DBD
on the
B42+3 probe, is virtually identical to that observed for
the E1E2-ori
complex formed on the wt ori (
4) except that the
interference pattern on the B42+3 probe is shifted downstream
by three
nucleotides. The strongest interferences are now located
primarily over
E1 binding sites 1 and 3 instead of E1 binding
sites 2 and 4, a result
consistent with E1 binding to these sites.
Thus, the DEPC interference
analysis provides evidence that the
second pair of binding sites (E1
binding sites 1 and 3) are functional
E1 binding
sites.
E1 recognizes determinants in the major groove at some positions in
the binding site.
Our previous DEPC interference assays indicated
that E1 recognizes the major groove in DNA, since the main site of
modification is the N7 position of A and G which protrudes
into the major groove (4, 35). To determine whether E1
binds to specific base determinants in the major groove, we performed
inosine substitutions within the hexanucleotide E1 recognition sequence
as described previously (41). Inosine specifically base
pairs with C. The pattern of hydrogen bond acceptors and donors present
in an I/C base pair is identical to that of a G/C base pair in the
major groove and to that of an A/T base pair in the minor groove. The
mutational analysis of the E1 binding site allowed us to compare the
effects of I/C base-pair substitutions with those of either G/C or A/T base pairs at each position in the E1 binding site. The Xho ori was
used in EMSAs to measure the level of E1 binding in the presence of
single inosine substitutions at each purine position in site (AACAAT) on both the top and the bottom strands. The results
are summarized in Fig. 5C.


View larger version (104K):
[in this window]
[in a new window]
|
FIG. 5.
Inosine substitutions indicate that E1 recognizes the
major groove. Inosine substitutions were generated at the six positions
corresponding to the E1 recognition sequence and tested for binding as
described above. (A) I/C base pairs were generated at positions 1 (lanes 11 to 15), 2 (lanes 21 to 25), and 3 (lanes 26 to 30) on the top
strand. Probes containing G/C base pairs at positions 1 and 2 (lanes 6 to 10 and 16 to 20, respectively) are shown for comparison. Lanes 1 to
3, 6 to 8, 11 to 13, 16 to 18, 21 to 23, and 26 to 28 contained both E1
and E2 DBDs. Lanes 4, 9, 14, 19, 24, and 29 contained E2 DBD alone;
lanes 5, 10, 15, 20, 25, and 30 contained probe alone. (B) I/C base
pairs were generated at positions 4 (lanes 11 to 15), 5 (lanes 21 to
25), and 6 (lanes 31 to 35) on the top strand. Probes with G/C base
pairs at the corresponding positions are shown for comparison (lanes 6 to 10, 16 to 20, and 26 to 30, respectively). Lanes 1 to 3, 6 to 8, 11 to 13, 16 to 18, 21 to 23, 26 to 28, and 31 to 33 contained E1 and E2
DBDs. Lanes 4, 9, 14, 19, 24, 29, and 34 contained E2 DBD alone; lanes
5, 10, 15, 20, 25, 30, and 35 contained probe alone. (C) Summary of the
results from inosine substitutions. The wt level of binding is set to
1.0.
|
|
If recognition is in the minor groove an I/C base pair can substitute
for an A/T base pair but a G/C base pair can not. If
recognition is in
the major groove, then an I/C base pair can
substitute for a G/C base
pair, but an A/T base pair cannot. Replacing
the A/T base pair in
either of the first two positions of the
E1 binding site with an I/C
base pair will have minor effects
on the E1 binding (Fig.
5A, lanes 11 to 15 and 21 to 25). However,
a G/C base pair in those positions also
does not significantly
impair E1 binding (Fig.
5A, lanes 6 to 10 and 16 to 20). This
suggests that at these two positions, determinants other
than
groove recognition are important for E1 binding. In the same way,
at the third and sixth positions of the E1 binding site, the effects
of
inosine substitutions are ambiguous. When an I/C substitution
is made
at position 3 (Fig.
5A, lanes 26 to 30), the level of
E1 binding is
severely reduced, which is also observed when a
G/C substitution is
made at the same position (Fig.
2). However,
an A/T substitution at
position 3 also inhibits E1 binding and
therefore, whether the inosine
substitution on the top strand
at position three disrupted major or
minor groove contacts cannot
be discriminated. Making a C/I base-pair
substitution at the third
position results in approximately twofold
reduction in E1 binding
(Fig.
5C and data not shown). Compared to a T/A
substitution at
this position, where E1 binding is reduced
approximately threefold,
the C/I substitution at this position appears
to allow E1 to bind
slightly better. It is therefore difficult to
determine unequivocally
whether the determinants of E1 binding at this
position are within
the major or minor groove. Indeed, E1 may recognize
both major
and minor groove determinants. Because of the lack of
severity
of transition mutations in this position, it is also possible
that DNA structure plays a greater role than base-specific
contacts.
An I/C base pair at position six of the E1 binding site results in a
level of E1 binding greater than that observed with an
A/T base pair,
which nearly abolishes E1 binding (Fig.
5B, lanes
31 to 35). This
suggests that a major groove element may influence
E1 binding.
However, a C/I base-pair substitution at the sixth
position results in
only a slight impairment of E1 binding, with
a level of binding
intermediate between wt (T/A) and a G/C base
pair (Fig.
5C and data not
shown). The ambiguity of these results
may reflect that, at this sixth
position of the E1 binding site,
there are determinants for E1 binding
that are not simply base-specific
structures within the major or minor
grooves. Alternatively, both
major and minor groove-specific
determinants are involved in E1
recognition at this
position.
However, in positions 4 and 5, the effects of inosine
substitutions are more meaningful. Changing the wt A/T base pair to
a
G/C base pair in position 4 results in a nearly fivefold decrease
in
the level of E1 binding (Fig.
2). Binding of the E1 DBD to
the site
when the A/T base pair is replaced by an I/C base pair
is inhibited to
the same degree as with a G/C mutation, suggesting
that a major
groove-specific determinant affects E1 binding (Fig.
5B, compare lanes
6 to 10 and 11 to 15 to lanes 1 to 5). In position
5, the effect of
replacing the wt A/T base pair with an I/C base
pair resulted in a
virtually complete loss of E1 binding (Fig.
5B, lanes 21 to 25). This
effect is similar to that produced by
a G/C base pair at that position
(Fig.
5B, lanes 16 to 20), also
suggesting a major groove interaction.
Together, these results
indicate that in both positions 4 and 5, E1
recognizes determinants
in the major groove. Whether E1 also recognizes
the major groove
at the other positions in the E1 binding site cannot
be determined
by inosine
substitutions.
 |
DISCUSSION |
The E1 protein is capable of binding to the ori in various forms.
E1 binds as a dimer together with a dimer of E2, forming the E1E2-ori
complex, which most likely functions for initial recognition and
tethering of E1 to the ori. This is clearly one of the functions of the
E1 binding site and also the function that traditionally is associated
with sequence-specific DNA binding. Using the E1 DBD, we have
determined which sequences E1 recognizes. E1 binds to a recognition
sequence consisting of the hexanucleotide sequence AACNAT, with relaxed
specificity for transition changes in positions 1 to 3 and with N being
any base except G. Sequence recognition is at least partly in the major
groove since DEPC modifications in the N7 position of
either A or G produce strong interference. Inosine substitutions at
several positions within the E1 binding site are also consistent with
major groove binding, although the inosine substitutions yielded
unexpectedly ambiguous results, perhaps due to structural determinants
which may be important for E1 binding.
Arrangement of the E1 binding sites.
Previous mutagenesis of
the E1 palindrome has shown that E1 binding sites 2 and 4 are required
for formation of the full-length E1E2-ori complex (35).
Furthermore, the same study indicated that additional sequences which
overlap sites 2 and 4 by three nucleotides are required for the
formation of the larger E1-ori complex. In the present study, we have
confirmed the existence of a second pair of sites, which we refer to as
E1 binding sites 1 and 3. The binding of two E1 DBD molecules to these
sites was stimulated in the presence of the E2 DBD when the E2 binding
site was moved in phase with these sites. Using the information
regarding the sequence preference of E1, we have also identified two
additional putative E1 binding sites, 5 and 6, which have an affinity
for E1 similar to that of binding sites 1 and 3. These results indicate that six E1 binding sites may be present in the E1 palindrome of the
BPV ori, although we have so far been unable to demonstrate binding of
the E1 DBD to the putative sites 5 or 6 in the context of the wt ori.
DNA binding for tethering and for complex assembly.
As
discussed above, binding of E1 to ori seems to serve a tethering role
when E1 is bound to sites 2 and 4 in the presence of E2. This tethering
appears to be completed after the formation of the E1E2-ori complex,
and the binding of additional E1 molecules likely represents a function
other than ori recognition. Sequence-specific binding to multiple sites
could serve to arrange the E1 molecules in a particular configuration
that is necessary for biochemical activity. If this is the case, the
arrangement of binding sites in the DNA can be viewed as a blueprint
for how larger E1 complexes are assembled. Such a mechanism would
prevent formation of these complexes in the absence of the correct DNA
sequence and thus contribute to the specificity of assembly. By
decoding the arrangement of the binding sites we may be able to deduce
and understand the architecture of the E1 complexes.
The different affinities of E1 for the E1 binding sites may promote a
stepwise assembly of initiator complexes. Sites 2 and
4 with the
consensus binding site sequence AACAAT are the preferred
sites for the binding of the first two E1 monomers to the ori
through
the cooperative interaction with E2. The E1E2-ori complex,
having no
other apparent replication-related activity, therefore
represents the
first step in the assembly of a replication-competent
initiator
complex. The initially loaded E1 dimer can subsequently
act as a seed
for the binding of additional E1 molecules to weaker
E1 binding sites.
Thus, formation of the E1E2-ori complex facilitates
the formation of
the E1-ori complex, which involves binding of
two additional molecules
to the weaker sites 1 and 3 (
30). The
low affinity of
sites 1 and 3 compared to sites 2 and 4 may require
that
protein-protein interactions between bound E1 molecules play
a greater
role in stable complex formation than specific DNA binding.
Thus, we
conclude that binding of E1 to four overlapping sites
results in the
formation of the E1-ori complex, which has activity
for distortion of
the
ori.
The most distinctive feature of the arrangement of the E1 binding sites
is that the sites are overlapping and that 3 bp are
shared between any
two overlapping sites. In fact, if E1 were
to bind to the six E1
recognition sequences this would represent
a rather remarkable close
packing; the 24 bp that constitute the
E1 binding site would bind six
molecules of E1, each of which
requires a recognition sequence of 6 bp.
Although we do not directly
demonstrate here that the E1 DBD can bind
simultaneously to overlapping
sites, the interference and mutational
analysis using full-length
E1 (
30,
35) can now be
interpreted in light of the results
presented here and clearly
indicates that in the cross-linked
E1-ori complex, E1 is bound to the
overlapping sites 1 to 4. Thus,
the DNA binding results obtained with
the E1 DBD are consistent
with the results obtained for the full-length
E1
protein.
It may seem that the overlapping arrangement of the E1 binding sites
presents an obstacle to simultaneous occupancy. However,
taking the
structure of the DNA into account clarifies how binding
is
accomplished. Our model for binding of E1 is shown in Fig.
6 and is based on hydroxy radical
footprinting (
33) and ethylation
interference
(
30), as well as DEPC interference and mutational
analysis
reported here and elsewhere (
4,
35). Hydroxy radical
footprinting of the E1E2-ori complex where an E1 dimer is bound
to
sites 2 and 4 places the E1 protections on one face of the
helix.
Binding of a second pair of E1 molecules to sites 1 and
3 produces a
precise duplication of the dimer footprint representing
a shift by 3 bp
or approximately one-third of a full turn, indicating
that if the first
dimer is bound on the top of the helix, the
second dimer is bound on
the side face of the helix consistent
with binding of E1 to sites 1 to
4 (Fig.
6C). Ethylation interference
(
30) results in a
similar conclusion; the interference pattern
observed with the E1E2-ori
complex is precisely duplicated in
the E1-ori complex, a result
consistent with a transition from
binding of one E1 dimer to binding of
two E1 dimers.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
Arrangement of the E1 binding sites in the BPV core ori.
(A) Stereo diagram of the BPV ori DNA containing the E1 binding sites.
E1 binding sites 1 to 4 are indicated by arrows. The first three bases
on the top and bottom strands for each binding site are colored as
shown in panel B. Binding sites 2 and 4 are shown in red, binding sites
1 and 3 are shown in blue, and the putative sites 5 and 6 are shown in
green. (B) DNA sequence of the E1 binding region. The positions of
binding sites 1 to 4 are indicated by solid arrows, and the positions
of the putative sites 5 and 6 are indicated by stippled arrows. The
three first bases on the top and bottom strands of each E1 binding site
are color coded. E1 binding sites 2 and 4 are indicated in red, and E1
binding sites 1 and 3 are indicated in blue. The putative sites 5 and 6 are shown in green. Above the sequence is shown the positions of ethylation interference (30) with a dimer of E1
(E1E2-ori complex, filled circles) and two dimers of E1 (E1-ori
complex, open circles). (C) Schematic diagram of the arrangement of the
E1 molecules on the ori with the different E1 binding site
arrangements. Binding of E1 to the binding sites 1-4 is indicated by
filled symbols. Binding to the putative binding sites 5 and 6 is
indicated by open symbols.
|
|
The overlap between the binding sites can be accommodated based on the
repeated sequence of the site. When projected onto
a B-DNA helix the
three first bases of the site on the top strand
and the last three
bases on the bottom strand are positioned on
opposite sides of the
major groove, as indicated in the stereo
drawing in Fig.
6A. Thus, if
the first three bases of the site
are recognized on the top strand and
the second three are recognized
on the bottom strand, an overlap can be
accomplished since an
overlapping site could utilize the complement on
the other strand
for recognition. For site 2, for example, 5'-AAC-3'
would be recognized
on the top strand and 5'-ATT-3' would be recognized
on the bottom
strand (shown in red in Fig.
6A and B). The overlapping
site 1,
shown in blue, is positioned on a different face of the helix,
with no obvious steric clashes, although part of E1 binding site
1 is
base paired with part of binding site 2 (Fig.
6A). This mode
of binding
is consistent with the positions of ethylation interference
on the
phosphate backbone, which occur on both sides of the major
groove
flanking the recognition sequence as indicated in Fig.
6B. This model
is also consistent with the positions of DEPC
interference.
An interesting question is how E1 complexes that are larger than the
two dimers can be assembled. We have previously observed
that after
glutaraldehyde cross-linking, full-length E1 becomes
topologically
linked to a plasmid carrying the viral ori but can
be released after
linearization of the DNA, indicating that E1
encircles the DNA. We also
showed that under these conditions
a cross-linked oligomer
corresponding to a trimer of E1 could
be detected by Western blot
analysis (
33). Using the information
that we have
regarding binding of the two E1 dimers, there are
two obvious ways that
trimers could be generated from the two
dimers. One is that two
additional E1 molecules bind to the putative
sites 5 and 6 (see Fig.
6C). This would generate a symmetrical
dimer of trimers wherein each
trimer encircles the DNA. The putative
sites 5 and 6 have similar
affinities for E1 compared to sites
1 and 3; however, sites 5 and 6 differ in that they are not paired
like the other four sites and
therefore cannot benefit from the
increase in affinity that
dimerization confers on binding of E1
(
4). Other
arrangements are also possible; for example, a third
dimer could be
bound on the third, unoccupied face of the DNA
helix. Binding of E1 to
the putative site 6 would place a dimer
partner in the center of the E1
palindrome. The sequence here
is GGTAAC which, although it
overlaps with both sites 2 and 3,
is available for binding (Fig.
6).
This sequence, however, is
a very poor E1 binding site (data not
shown). Thus, with either
model, factors other than DNA contacts are
likely to be required
for higher-order complex
formation.
From the scenario discussed above, it can be envisioned how the
existence of multiple binding sites for E1, with different
affinities,
could facilitate the progression from the E1E2-ori
complex to the
formation of an E1 hexamer. Simultaneous binding
to all sites would
allow six molecules of E1 to assemble on the
ori. How such a complex
would be related to an active helicase
is unclear. However, an
interesting possibility is that each of
the two trimers eventually give
rise to an E1 hexamer. It has
been demonstrated that for T antigen,
preformed hexamers are incapable
of forming double hexamers on the ori,
whereas monomeric ATP-bound
T antigen is the preferred substrate for
double-hexamer formation
(
6,
36). This suggests that, like
E1, the T-antigen hexamer
most likely arises from the sequential
binding of monomeric T-antigen
molecules. Four of the six binding sites
in the E1 palindrome
are arranged in a fashion similar to that of the
T-antigen binding
sites in the SV40 ori, indicating that a similar
assembly process
is utilized for T antigen. The stepwise assembly of a
helicase
through the successive binding of monomeric proteins, as
inferred
from our data, would allow multiple points which could be
regulated
during initiation of DNA
replication.
Comparison to other papillomaviruses.
Although a general
sequence similarity is observed between the ori sequences that are
believed to bind E1 in different papillomaviruses, it has been
difficult to assess exactly how similar these E1 binding regions are.
Utilizing the binding site sequence that we have identified and
allowing variations as revealed by the mutational analysis (see Fig.
2), it is clear that papillomaviruses in general appear to have the
same organization of E1 binding sites. However, the number of
recognizable high-affinity sites varies, indicating either that the E1
proteins from different papillomaviruses have differences in sequence
recognition or that contribution from other factors such as
protein-protein interactions vary in different viral types. The overall
high degree of homology in the E1 DBDs and especially in regions
involved in DNA recognition argues that differences in sequence
recognition are probably subtle (9, 14).
As shown in Fig.
7, certain
papillomaviruses such as HPV-1 appear to have a larger number of
high-affinity sites than does
BPV. Furthermore, the presence of
high-affinity sites in positions
corresponding to sites 5 and 6 in BPV
lends some credence to the
functionality of the putative sites 5 and 6 in the BPV ori. It
is interesting that the HPV-1 ori is unique in that
transient
DNA replication in vivo can be achieved with overexpression
of
E1 in the absence of E2, a finding that may be indicative of
higher-affinity
E1 binding (
15). A further interesting
observation is that some
HPVs, such as HPV-31 and HPV-32, have three
high-affinity sites
in one-half of the palindrome, while the sites in
the other half
are low-affinity sites. This may indicate that the E1
dimer interaction
contributes more to complex formation in these
viruses than it
does for BPV E1 binding.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
Comparison of the E1 binding site arrangement in select
papillomavirus origins of replication. The stippled arrows indicate
putative E1 binding sites with significantly lower affinity based on
the lack of conservation at positions that are important for binding of
BPV E1.
|
|
 |
ACKNOWLEDGMENT |
This work was supported by Public Health Service grant CA13106
from the National Cancer Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Cold Spring
Harbor Laboratory, P.O. Box 100, 1 Bungtown Rd., Cold Spring Harbor, NY 11724. Phone: (516) 367-8407. Fax: (516) 367-8454. E-mail:
stenlund{at}cshl.org.
 |
REFERENCES |
| 1.
|
Blitz, I. L., and L. Laiminis.
1991.
The 68-kilodalton E1 protein of bovine papillomavirus is a DNA binding phosphoprotein which associates with the E2 transcriptional activator in vitro.
J. Virol.
65:649-656[Abstract/Free Full Text].
|
| 2.
|
Borowiec, J. A., and J. Hurwitz.
1988.
Localized melting and structural changes in the SV40 origin of DNA replication induced by T-antigen.
EMBO J.
7:3149-3158[Medline].
|
| 3.
|
Borowiec, J. A.,
F. B. Dean,
P. A. Bullock, and J. Hurwitz.
1990.
Binding and unwinding how T-antigen engages the SV40 origin of DNA replication.
Cell
60:181-184[CrossRef][Medline].
|
| 4.
|
Chen, G., and A. Stenlund.
1998.
Characterization of the DNA-binding domain of the bovine papillomavirus replication initiator E1.
J. Virol.
72:2567-2576[Abstract/Free Full Text].
|
| 5.
|
Clertant, P., and I. Seif.
1984.
A common function for polyoma virus large-T and papillomavirus E1 proteins?
Nature (London)
311:276-279[CrossRef][Medline].
|
| 6.
|
Dean, F. B.,
J. A. Borowiec,
T. Eki, and J. Hurwitz.
1992.
The simian virus 40 T-antigen double hexamer assembles around the DNA at the replication origin.
J. Biol. Chem.
267:14129-14137[Abstract/Free Full Text].
|
| 7.
|
Deb, S.,
S. Tsui,
A. Koff,
A. L. DeLucia,
R. Parsons, and P. Tegtmeyer.
1987.
The T-antigen binding domain of the simian virus 40 core origin of replication.
J. Virol.
61:2143-2149[Abstract/Free Full Text].
|
| 8.
|
DeLucia, A. L.,
S. Deb,
K. Partin, and P. Tegtmeyer.
1986.
Functional interactions of the simian virus 40 core origin of replication with flanking regulatory sequences.
J. Virol.
57:138-144[Abstract/Free Full Text].
|
| 9.
|
Enemark, E. J.,
G. Chen,
D. E. Vaughn,
A. Stenlund, and L. Joshua-Tor.
2000.
Crystal structure of the DNA binding domain of the replication initiation protein E1 from papillomavirus.
Mol. Cell.
6:149-158[CrossRef][Medline].
|
| 10.
|
Fanning, E., and R. Knippers.
1992.
Structure and function of simian virus 40 large tumor antigen.
Annu. Rev. Biochem.
61:55-85[CrossRef][Medline].
|
| 11.
|
Fouts, E. T.,
X. Yu,
E. H. Egelman, and M. R. Botchan.
1999.
Biochemical and electron microscopic image analysis of the hexameric E1 helicase.
J. Biol. Chem.
274:4447-4458[Abstract/Free Full Text].
|
| 12.
|
Gillette, T. G.,
M. Lusky, and J. A. Borowiec.
1994.
Induction of structural changes in the bovine papillomavirus type 1 origin of replication by the viral E1 and E2 proteins.
Proc. Natl. Acad. Sci. USA
91:8846-8850[Abstract/Free Full Text].
|
| 13.
|
Gillitzer, E.,
G. Chen, and A. Stenlund.
2000.
Separate domains in E1 and E2 proteins serve architectural and productive roles for cooperative DNA binding.
EMBO J.
19:3069-3079[CrossRef][Medline].
|
| 14.
|
Gonzalez, A.,
C. Bazaldua-Hernandez,
M. West,
K. Wotek, and V. G. Wilson.
2000.
Identification of a short, hydrophilic amino acid sequence critical for origin recognition by the bovine papillomavirus E1 protein.
J. Virol.
74:245-253[Abstract/Free Full Text].
|
| 15.
|
Gopalakrishnan, V., and S. A. Khan.
1994.
E1 protein of human papillomavirus type 1a is sufficient for initiation of viral DNA replication.
Proc. Natl. Acad. Sci. USA
91:9597-9601[Abstract/Free Full Text].
|
| 16.
|
Holt, S. E.,
G. Schuller, and V. G. Wilson.
1993.
DNA binding specificity of the bovine papillomvirus E1 protein is determined by the sequences contained within an 18-base-pair inverted repeat element at the origin of replication.
J. Virol.
68:1094-1102[Abstract/Free Full Text].
|
| 17.
|
Holt, S. E., and V. G. Wilson.
1995.
Mutational analysis of the 18-base-pair inverted repeat element at the bovine papillomavirus origin of replication: identification of critical sequences for E1 binding and in vivo replication.
J. Virol.
69:6525-6532[Abstract].
|
| 18.
|
Joo, W. S.,
H. Y. Kim,
J. D. Purviance,
K. R. Sreekumarr, and P. A. Bullock.
1998.
Assembly of T-antigen double hexamers on the simian virus 40 core origin requires only a subset of the available binding sites.
Mol. Cell. Biol.
18:2677-2687[Abstract/Free Full Text].
|
| 19.
|
Leng, X.,
J. H. Ludes-Meyers, and V. G. Wilson.
1997.
Isolation of an amino-terminal region of bovine papillomavirus type 1 E1 protein that retains origin binding and E2 interaction capacity.
J. Virol.
71:848-852[Abstract].
|
| 20.
|
Lentz, M. R.,
D. Pak,
I. Mohr, and M. R. Botchan.
1993.
The E1 replication protein of bovine papillomavirus type 1 contains an extended nuclear localization signal that includes a p34cdc2 phosphorylation site.
J. Virol.
67:1414-1423[Abstract/Free Full Text].
|
| 21.
|
Li, R.,
J. Knight,
G. Bream,
A. Stenlund, and M. Botchan.
1989.
Specific recognition nucleotides and their DNA context determine the affinity of E2 protein for 17 binding sites in the BPV genome.
Genes Dev.
3:510-526[Abstract/Free Full Text].
|
| 22.
|
Luo, X.,
D. G. Sanford,
P. A. Bullock, and W. W. Bachovchin.
1996.
Solution structure of the origin DNA-binding domain of SV40 T-antigen.
Nat. Struct. Biol.
12:1034-1039.
|
| 23.
|
Lusky, M.,
J. Hurwitz, and Y. S. Seo.
1993.
Cooperative assembly of the bovine papilloma virus E1 and E2 proteins on the replication origin requires an intact E2 binding site.
J. Biol. Chem.
268:15795-15803[Abstract/Free Full Text].
|
| 24.
|
Lusky, M.,
J. Hurwitz, and Y. S. Seo.
1994.
The bovine papillomavirus E2 protein modulates the assembly of but is not stably maintained in a replication-competent multimeric E1-replication origin complex.
Proc. Natl. Acad. Sci. USA
91:8895-8899[Abstract/Free Full Text].
|
| 25.
|
Mansky, K. C.,
A. Batiza, and P. F. Lambert.
1997.
Bovine papillomavirus type 1 E1 and simian virus 40 large T-antigen share regions of sequence similarity required for multiple functions.
J. Virol.
71:7600-7608[Abstract].
|
| 26.
|
Mastrangelo, I. A.,
P. V. C. Hough,
J. S. Wall,
M. Dodson,
F. B. Dean, and J. Hurwitz.
1989.
ATP-dependent assembly of soluble hexamers of SV40 T antigen at the viral origin of DNA replication.
Nature
338:658-662[CrossRef][Medline].
|
| 27.
|
Mendoza, R.,
L. Gandhi, and M. R. Botchan.
1995.
E1 recognition sequences in the bovine papillomavirus type 1 origin of DNA repliction: interaction between half-sites of the inverted repeats.
J. Virol.
69:3789-3798[Abstract].
|
| 28.
|
Mohr, I. J.,
R. Clark,
S. Sun,
E. J. Androphy,
P. MacPherson, and M. R. Botchan.
1990.
Targeting the E1 replication protein to the papillomavirus origin of replication by complex formation with the E2 transactivator.
Science
250:1694-1699[Abstract/Free Full Text].
|
| 29.
|
Parsons, R.,
M. E. Anderson, and P. Tegtmeyer.
1990.
Three domains in the simian virus 40 core origin orchestrate the binding, melting, and DNA helicase activities of T antigen.
J. Virol.
64:509-518[Abstract/Free Full Text].
|
| 30.
|
Sanders, C. M., and A. Stenlund.
1998.
Recruitment and loading of the E1 initiator protein: an ATP-dependent process catalysed by a transcription factor.
EMBO J.
17:7044-7055[CrossRef][Medline].
|
| 31.
|
Sarafi, T. R., and A. A. McBride.
1995.
Domains of the BPV-1 E1 replication protein required for origin-specific DNA-binding and interaction with the E2 transactivator.
Virology
211:385-396[CrossRef][Medline].
|
| 32.
|
Sedman, J., and A. Stenlund.
1995.
Co-operative interaction between the initiator E1 and the transcriptional activator E2 is required for replicator specific DNA replication of bovine papillomavirus in vivo and in vitro.
EMBO J.
14:6218-6228[Medline].
|
| 33.
|
Sedman, J., and A. Stenlund.
1996.
The initiator protein E1 binds to the bovine papillomavirus origin of replication as a trimeric ring-like structure.
EMBO J.
15:5085-5092[Medline].
|
| 34.
|
Sedman, J., and A. Stenlund.
1998.
The papillomavirus E1 protein forms a DNA-dependent hexameric complex with ATPase and DNA helicase activities.
J. Virol.
72:6893-6897[Abstract/Free Full Text].
|
| 35.
|
Sedman, T.,
J. Sedman, and A. Stenlund.
1997.
Binding of the E1 and E2 proteins to the origin of replication of bovine papillomavirus.
J. Virol.
71:2887-2896[Abstract].
|
| 36.
|
SenGupta, D. J., and J. A. Borowiec.
1992.
Strand-specific recognition of a synthetic DNA replication fork by the SV40 large tumor antigen.
Science
256:1656-1661[Abstract/Free Full Text].
|
| 37.
|
Seo, Y. S.,
F. Muller,
M. Lusky,
E. Gibbs,
H. Y. Kim,
B. Phillips, and J. Hurwitz.
1993.
Bovine papillomavirus (BPV)-encoded E2 protein enhances binding of E1 protein to the BPV replication origin.
Proc. Natl. Acad. Sci. USA
90:2865-2869[Abstract/Free Full Text].
|
| 38.
|
Seo, Y. S.,
F. Muller,
M. Lusky, and J. Hurwitz.
1993.
Bovine papillomavirus (BPV)-encoded E1 protein contains multiple activities required for BPV DNA replication.
Proc. Natl. Acad. Sci. USA
90:702-706[Abstract/Free Full Text].
|
| 39.
|
Smelkova, N. V., and J. A. Borowiec.
1998.
Synthetic DNA replication bubbles bound and unwound with twofold symmetry by a simian virus 40 T-antigen double hexamer.
J. Virol.
72:8676-8681[Abstract/Free Full Text].
|
| 40.
|
Stahl, H.,
P. Droge, and R. Knippers.
1986.
DNA helicase activity of SV40 large tumor antigen.
EMBO J.
5:1939-1944[Medline].
|
| 41.
|
Starr, D. B., and D. K. Hawley.
1991.
TFIID binds in the minor groove of the TATA box.
Cell
67:1231-1240[CrossRef][Medline].
|
| 42.
|
Sturm, R.,
T. Baumruker,
B. R. Franza, Jr., and W. Herr.
1987.
A 100-kD HeLa cell octamer binding protein (OBP 100) interacts differently with two separate octamer-related sequences within the SV40 enhancer.
Genes. Dev.
1:1147-1160[Abstract/Free Full Text].
|
| 43.
|
Sverdrup, F., and G. Myers.
1997.
The E1 proteins, p. 37-53.
In
G. Myers, C. Baker, K. Munger, F. Sverdrup, A. McBride, and H.-U. Bernard (ed.), Human papillomaviruses. Los Alamos National Laboratory, Los Alamos, N.Mex.
|
| 44.
|
Thorner, L. K.,
D. A. Kim, and M. R. Botchan.
1993.
DNA-binding domain of bovine papillomavirus type 1 E1 helicase: structural and functional aspects.
J. Virol.
67:6000-6014[Abstract/Free Full Text].
|
| 45.
|
Tjian, R.
1978.
The binding site of SV40 DNA for a T-antigen-related protein.
Cell
13:165-179[CrossRef][Medline].
|
| 46.
|
Ustav, E.,
M. Ustav,
P. Szymanski, and A. Stenlund.
1993.
The bovine papillomavirus origin of replication requires a binding site for the E2 transcriptional activator.
Proc. Natl. Acad. Sci. USA
90:898-902[Abstract/Free Full Text].
|
| 47.
|
Ustav, M.,
E. Ustav,
P. Szymanski, and A. Stenlund.
1991.
Identification of the origin of replication of bovine papillomavirus and characterization of the viral origin recognition factor E1.
EMBO J.
10:4321-4329[Medline].
|
| 48.
|
Wessel, R.,
J. Schweizer, and H. Stahl.
1992.
Simian virus 40 T-antigen DNA helicase is a hexamer which forms a binary complex during bidirectional unwinding from the viral origin of DNA replication.
J. Virol.
66:804-815[Abstract/Free Full Text].
|
| 49.
|
Yang, L.,
R. Li,
I. J. Mohr,
R. Clark, and M. R. Botchan.
1991.
Activation of BPV-1 replication in vitro by the transcription factor E2.
Nature
353:628-632[CrossRef][Medline].
|
| 50.
|
Yang, L.,
I. Mohr,
E. Fouts,
D. A. Lim,
M. Nohaile, and M. Botchan.
1993.
The E1 protein of bovine papillomavirus 1 is an ATP dependent DNA helicase.
Proc. Natl. Acad. Sci. USA
90:5086-5090[Abstract/Free Full Text].
|
Journal of Virology, January 2001, p. 292-302, Vol. 75, No. 1
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.1.292-302.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Schuck, S., Stenlund, A.
(2007). ATP-Dependent Minor Groove Recognition of TA Base Pairs Is Required for Template Melting by the E1 Initiator Protein. J. Virol.
81: 3293-3302
[Abstract]
[Full Text]
-
Schuck, S., Stenlund, A.
(2006). Surface mutagenesis of the bovine papillomavirus e1 DNA binding domain reveals residues required for multiple functions related to DNA replication.. J. Virol.
80: 7491-7499
[Abstract]
[Full Text]
-
Schuck, S., Stenlund, A.
(2005). Role of Papillomavirus E1 Initiator Dimerization in DNA Replication. J. Virol.
79: 8661-8664
[Abstract]
[Full Text]
-
Auster, A. S., Joshua-Tor, L.
(2004). The DNA-binding Domain of Human Papillomavirus Type 18 E1: CRYSTAL STRUCTURE, DIMERIZATION, AND DNA BINDING. J. Biol. Chem.
279: 3733-3742
[Abstract]
[Full Text]
-
Titolo, S., Brault, K., Majewski, J., White, P. W., Archambault, J.
(2003). Characterization of the Minimal DNA Binding Domain of the Human Papillomavirus E1 Helicase: Fluorescence Anisotropy Studies and Characterization of a Dimerization-Defective Mutant Protein. J. Virol.
77: 5178-5191
[Abstract]
[Full Text]
-
Titolo, S., Welchner, E., White, P. W., Archambault, J.
(2003). Characterization of the DNA-Binding Properties of the Origin-Binding Domain of Simian Virus 40 Large T Antigen by Fluorescence Anisotropy. J. Virol.
77: 5512-5518
[Abstract]
[Full Text]
-
Sheikh, S., Van Horn, G., Naqvi, A., Sheahan, L., Khan, S. A.
(2003). Purification and biochemical characterization of the E1 replication initiation protein of the cutaneous human papillomavirus type 1. J. Gen. Virol.
84: 277-285
[Abstract]
[Full Text]
-
Chen, G., Stenlund, A.
(2002). Sequential and Ordered Assembly of E1 Initiator Complexes on the Papillomavirus Origin of DNA Replication Generates Progressive Structural Changes Related to Melting. Mol. Cell. Biol.
22: 7712-7720
[Abstract]
[Full Text]