Previous Article | Next Article 
Journal of Virology, May 2000, p. 4085-4092, Vol. 74, No. 9
0022-538X/00/$04.00+0
The Vaccinia Virus A14.5L Gene Encodes a
Hydrophobic 53-Amino-Acid Virion Membrane Protein That Enhances
Virulence in Mice and Is Conserved among Vertebrate
Poxviruses
Tatiana
Betakova,
Elizabeth
J.
Wolffe, and
Bernard
Moss*
Laboratory of Viral Diseases, National
Institute of Allergy and Infectious Diseases, National Institutes
of Health, Bethesda, Maryland 20892-0445
Received 15 September 1999/Accepted 31 January 2000
 |
ABSTRACT |
A short sequence, located between the A14L and A15L open reading
frames (ORFs) of vaccinia virus, was predicted to encode a hydrophobic
protein of 53 amino acids that is conserved in orthopoxviruses, leporipoxviruses, yatapoxiruses, and molluscipoxviruses. We constructed a recombinant vaccinia virus with a 10-codon epitope tag appended to
the C terminus of the A14.5L ORF. Synthesis of the tagged protein occurred at late times and was blocked by an inhibitor of DNA replication, consistent with regulation by a predicted late promoter just upstream of the A14.5L ORF. Hydrophobicity of the protein was
demonstrated by extraction into the detergent phase of Triton X-114.
The protein was associated with purified vaccinia virus particles and
with membranes of immature and mature virions that were visualized by
electron microscopy of infected cells. Efficient release of the protein
from purified virions occurred after treatment with a nonionic
detergent and reducing agent. A mutant virus, in which the A14.5L ORF
was largely deleted, produced normal-size plaques in several cell
lines, and the yields of infectious intra- and extracellular viruses
were similar to those of the parent. In contrast, with a mouse model,
mutant viruses with the A14.5L ORF largely deleted were attenuated
relative to that of the parental virus or a mutant virus with a
restored A14.5L gene.
 |
INTRODUCTION |
The poxviruses, of which vaccinia
virus is the prototype, are large, enveloped, DNA viruses that
replicate in the cytoplasm of infected cells (19). Analysis
of the genome of vaccinia virus revealed approximately 200 largely
nonoverlapping open reading frames (ORFs) of at least 60 amino acids
(12). The lower limit for the number of amino acids,
however, was arbitrary, and some shorter ORFs may be significant. For
example, in the sequenced Copenhagen strain of vaccinia virus, the ORF
encoding one of the RNA polymerase subunits was less than 60 amino
acids, although it is 63 amino acids long in the WR strain
(2). More recently, an analysis of the genome of molluscum
contagiosum virus revealed two nonoverlapping ORFs that are conserved
in orthopoxviruses and are predicted to encode hydrophobic proteins of
less than 60 amino acids (24). In vaccinia virus, one of
these putative membrane proteins is 53 amino acids long and is located
between ORFs A14L and A15L. This short ORF, named A14.5L, is the
subject of the present study.
Poxviruses assemble two types of membranes that form the outer layers
of the intracellular mature virion (IMV) and the extracellular enveloped virion (EEV). Thus far, 11 vaccinia virus proteins have been
reported to be associated with the IMV membrane (16, 28), and 6 have been associated with the EEV membrane (8, 11, 13, 15,
21-23). Here, we demonstrated that the A14.5L ORF was expressed
at late times after vaccinia virus infection and the protein product
was incorporated into the IMV membrane. Although the protein was not
essential for vaccinia virus replication in tissue culture cells,
deletion of the ORF reduced the virulence of vaccinia virus in mice.
 |
MATERIALS AND METHODS |
Cells and viruses.
CV-1 (ATCC CCL-70) and BS-C-1 (ATCC
CCL-26) cells were grown in Earle's minimal essential medium (Quality
Biologicals, Inc.) containing 10% fetal bovine serum in a 5%
CO2 atmosphere at 37°C. Vaccinia virus strain WR (ATCC
VR-1354) and recombinant vaccinia virus vT7lacOI (1) were
propagated in HeLa cells as previously described (9).
Plasmids.
The A14.5L ORF, modified to contain an
NdeI restriction endonuclease site at the initiation codon
and the influenza virus hemagglutinin (HA) epitope tag sequence
YPYDVPDYAS followed by a termination signal and a BamHI
site, was generated by PCR with vaccinia virus genomic DNA and
oligonucleotide primers TB27
(GGGGGGGGGCATATGATAAGTAATTACGAGCCGTTGC) and TB15
(GGGGGATCCTTAAGATGCATAGTCAGGAACGTCATAAGGATAAATCGCCGAATGAACAAAG). The PCR product was cut with NdeI and BamHI
and inserted into the corresponding sites in plasmid pVOTE.2
(30) to produce plasmid pVote-27.
A 518-bp PCR product corresponding to the downstream-flanking region of
the A14.5L gene (right flank) was produced from viral genomic DNA with
primers TB17 (GGGACTAGTAACGTTAACTCTTTAGCGTTAAAAAATTCCCAAGCGG) and TB18 (GGGGTCGACCGGCTCGTAATTACTTATCATTTACTAGACG),
which contain SpeI and SalI sites,
respectively, at the 5' ends. The left end of the right flank was 21 bp
upstream of the A14.5L initiation codon and included the stop codon of
the A15L gene. This fragment was cloned into SpeI and
SalI sites of plasmid pZIPPY, which contains Escherichia coli neomycin resistance (neo) and
-glucuronidase (gus) genes regulated by vaccinia virus
promoters and flanked by multiple cloning sites (a gift of T. Shors),
producing plasmid pZIPPY-17.
A 586-bp PCR product corresponding to the region upstream of the A14.5L
gene (right flank) was produced from viral DNA by
using primers TB19
(GGGGAGCTCTTATATGGTTTATATTCCACTTTGTTCATTCGGC)
and TB20
(GGGCCGCGGAACTTGGTAT T T T T TGGT TCTGGAGGAGGCG),
which
contain
SstI and
SstII sites,
at their respective 5' ends. The
right end of this flank region started
57 bp upstream of the A14L
initiation codon and included the late
promoter sequences of the
A14L gene. This DNA was cloned into
pZIPPY-17, producing plasmid
pZIPPY-1719.
A 509-bp PCR product corresponding to the region downstream of the
A14.5L gene (right flank) was produced from viral DNA by
using primers
TB38 (GGGGGGACTAGTACATTGGTTGTAATATCTGTTATTTTC) and
TB67
(GGGGGGG TCGAC T TAAGATGCATAG TCAGGAACG TCATAAGGATAAATCGCCGAATGAACAAAGTGGAATATAAACC),
which contain
SpeI and
SalI sites,
respectively, at the 5' ends.
The left end of this region contained the
HA epitope sequence
followed by the stop codon of the A14.5L gene. This
DNA was inserted
into the
SpeI and
SalI regions
of the plasmid pZIPPY, producing
plasmid pZIPPY-67. The left flank
sequence, described above, was
cloned into
SstI and
SstII regions of the plasmid pZIPPY-67, producing
plasmid
pZIPPY-6719.
Construction of recombinant viruses.
Recombinant viruses
were made essentially as described previously, and the genome
modifications were confirmed by PCR (10). vT7lacOI-A14.5LHA
(code no. v27) was derived by infection of CV-1 cells with vT7lacOI,
transfection with pVOTE-27, and selection with mycophenolic acid.
vA14.5LHA (code no. v67) and vA14.5L
neo/gus (code no. v17) were
derived by infecting CV-1 cells with vaccinia virus strain WR and
transfecting them with pZIPPY-6719 and pZIPPY-1719, respectively,
selecting for two rounds of replication in the presence of 2 mg of
Geneticin (Gibco Life Technologies) per ml, and picking plaques that
stained blue with
5-bromo-4-chloro-3-indolyl-
-D-glucuronide (X-Glu).
vA14.5+ (code no. v207) was derived by infecting BS-C-1 cells with
vA14.5L
neo/gus, transfecting them with a 1,440-bp PCR product
containing the intact A14.5L gene obtained with primers TB149
(TCGATATAATCATCGTAACTGCTTCTAACGG) and TB152
(GTTACATGAGTGCACCGACGAATCTAG), and isolating plaques that
did not stain with X-Glu. vA14.5L
(code number v
10) was derived
by infecting BS-C-1 cells with vA14.5L
neo/gus and transfecting them
with a 1,327-bp PCR product obtained with primers TB149 and TB150
(CGTCTAGTAAATGATAAGTAATTTGGTTTATATTCCACTTTGTTC) and TB152
and TB151 (GAACAAAGTGGAATATAAACCAAATTACTTATCATTTACTAGACG) and then using both products for PCR with primers TB149 and TB152 and isolating plaques that did not stain with X-Glu.
SDS-PAGE and immunoblotting.
Sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (12.5%
polyacrylamide) was performed as described previously (17),
and proteins were electrophoretically transferred to a nitrocellulose
membrane. The blot was incubated in 5% nonfat milk in
phosphate-buffered saline (PBS) overnight at 4°C and then for 1 h with monoclonal antibody (MAb) 12CA5 to the HA epitope tag (Covance,
Richmond, Calif.) or with an antipeptide serum to the predicted
N-terminal amino acids of the mature A17L protein (4) in
PBS. The blot was washed three times in PBS before incubation for
1 h with secondary antibody (antirabbit or antimouse) coupled to
alkaline phosphatase (Sigma) or with 125I-labelled protein
A (Amersham Pharmacia). The blot was washed several times with PBS and
developed with the BCIP-NBT
(5-bromo-4-chloro-3-indolylphosphate-nitroblue tetrazolium)
phosphatase substrate system (Kirkegaard & Perry Laboratories, Inc.) or
exposed to Kodak Biomax MS film.
Analysis of virion extracts.
Vaccinia virus virions,
purified by sucrose gradient centrifugation (9) from cells
infected with vaccinia virus WR or vA14.5LHA, were incubated at 37°C
for 30 min in 10 mM Tris (pH 7.4) or in 1% NP-40 in 10 mM Tris (pH
7.4) in the presence or absence of 10 mM dithiothreitol. Soluble and
insoluble fractions were separated by centrifugation in a 42.2 Ti rotor
at 30,000 × g for 30 min and resuspended to equal
volumes in SDS-containing sample buffer. Equivalent amounts of each
fraction were loaded on a 12.5% polyacrylamide gel and subjected to
electrophoresis. The separated proteins were transferred to a
nitrocellulose membrane and analyzed by Western blotting with anti-HA
MAb 12CA5. The blot was washed and incubated with sheep anti-mouse
antiserum conjugated to horseradish peroxidase (Amersham Life Sciences)
followed by Supersignal West Pico chemiluminescent substrate (Pierce,
Rockford, Ill.). The signal was visualized by exposing the blot to
Biomax ML film (Kodak).
Electron microscopy.
BS-C-1 cells were grown in
60-mm-diameter dishes and infected with either vA14.5LHA or vaccinia
virus strain WR at a multiplicity of infection of 10. After 18 h,
the cells were fixed and prepared for freezing as previously described
(33). Ultrathin sections were cut with a Leica/Reichert
Ultracut FSC, collected on formvar-coated grids and stained using
standard protocols. The primary antibody used was mHA.11, a mouse
monoclonal immunoglobulin G1 (IgG1) to the HA tag (Covance). Grids were
subsequently incubated with a secondary antibody, rabbit IgG fraction
to whole mouse IgG (Cappel-ICN Pharmaceuticals, Aurora, Ohio), followed
by protein A conjugated to 10-nm-diameter colloidal gold particles
(Department of Cell Biology, Utrecht University School of Medicine,
Utrecht, The Netherlands). Immunostained sections were viewed with a
Philips CM100 transmission electron microscope.
Determination of virulence in mice.
The virulence of
vaccinia virus was determined essentially as described previously
(18, 29, 32). Groups (n = 4) of 5-week-old female BALB/c mice weighing between 15 and 20 g were anesthetized and inoculated intranasally with 103 to 106 PFU
of purified vaccinia virus strain WR or mutant viruses in 10 µl of 10 mM Tris-HCl (pH 9.0). Titers of aliquots of the viruses used for
infection were redetermined in order to confirm the doses administered.
Individual animals were weighed daily, and those that lost greater than
30% of their original body weight were terminated.
 |
RESULTS |
Expression of the A14.5L ORF.
The 53-amino-acid coding
sequence, located between the vaccinia virus A14L and A15L ORFs, was
designated A14.5L. Analysis of the DNA sequences of two isolates of
vaccinia virus (3, 12), two isolates of variola major virus
(26), and a variola minor virus isolate (27)
indicated the presence of ORFs of the same length and sequence
indicating a high degree of conservation among orthopoxviruses. In
addition closely related proteins were predicted to be encoded by
members of other Chordipoxvirus genera, including two
leporipoxviruses (6, 31), a yatapoxvirus (Medline accession
no. AB015885), and a molluscipoxvirus (25) (Fig. 1A). As indicated in Fig. 1B, the A14.5L
protein was predicted to be largely hydrophobic. Even though such
hydrophobic proteins are usually poorly immunogenic, peptides
corresponding to the N terminus, C terminus, or the short, central,
slightly hydrophilic region were conjugated to keyhole limpet
hemocyanin and used to immunize rabbits. Disappointingly, when blots
containing lysates of vaccinia virus-infected cells were probed with
the antisera, no protein of the expected size was detected. Therefore,
we tried another way to identify the putative A14.5L protein.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence homology and predicted hydrophobicity of the
A14.5L ORF. (A) The sequence of the vaccinia virus (Vac) A14.5L ORF and
the identical variola virus (Var) ORF is shown aligned with the
orthologous ORFs of Shope fibroma virus (SFV), myxoma virus (Myx),
molluscum contagiosum virus (MCV), and Yaba monkey tumor virus (Yaba).
The numbers correspond to the codons of the longest ORF. (B)
Hydrophilicity plot of the vaccinia virus A14.5L ORF.
|
|
Ten codons representing the influenza virus HA epitope tag were
inserted between the C-terminal and stop codons of the A14.5L
ORF so
that the protein product could be detected with an available
MAb. For
the initial experiment, an inducible vaccinia virus expression
system
(
30) was chosen to provide a high level of protein
synthesis,
permit the retention of the unmodified A14.5L ORF in case it
was
essential, and allow stringent regulation should the HA-tagged
version of the A14.5L protein exert a dominant-negative effect
on virus
replication. The HA-tagged A14.5L ORF was constructed
and amplified by
PCR and cloned into the pVOTE.2 transfer vector
(
30). The
gene was then inserted by homologous recombination
into vaccinia virus
vT7lacOI, which contains an inducible copy
of the T7 RNA polymerase
gene and the
E. coli lac repressor under
control of a
constitutive early/late promoter (
1). The recombinant
virus
vT7lacOI-A14.5LHA was isolated by selection with mycophenolic
acid and
repeatedly plaque purified. The genomes of the parental
vaccinia virus
strain WR and vT7lacOI-A14.5LHA are represented
in Fig.
2A and B, respectively.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Representations of parental and recombinant viral
genomes. (A) Parental vaccinia virus strain WR. (B) vT7lacOI-A14.5LHA.
(C) vA14.5LHA. (D) vA14.5L neo/gus. (E) vA14.5L . (F) vA14.5L+. The
vaccinia virus ORFs A14L, A14.5L, and A15L; the antibiotic selection
markers neo and gpt; and the reporter gene
gus are indicated above the bars. An arrow below the bar
indicates the direction of transcription of each ORF. The symbol //
signifies additional portions of the vaccinia virus genome.
vT7lacOI-A14.5LHA contains a T7 RNA polymerase gene, an E. coli
lac repressor gene, and a T7 promoter and lac operator
regulating expression of A14.5L-HA, which are not shown. VA14.5L+ is a
revertant of vA14.5L neo/gus and has the same gene arrangement as the
parental vaccinia virus.
|
|
Lysates of cells infected with vT7lacOI-A14.5LHA in the presence of
various concentrations of IPTG
(isopropyl-

-
D-thiogalactopyranoside)
were subjected to
SDS-PAGE and the proteins were transferred to
a membrane and probed
with an anti-HA MAb. An IPTG-inducible polypeptide
of 10 kDa was
detected, somewhat larger than the 7 kDa predicted
for the HA-tagged
protein (Fig.
3A). Maximal expression
occurred
at 100 to 200 mM IPTG. The mobility of the A14.5L-HA protein
was
unchanged by treatment with
endo-F-peptide-
N-glycosidase F (Oxford
Glycosystem,
Rosedale, N.Y.) for 3 h at 37°C in 1% NP-40, indicating
that
the potential N-glycosylation site (NFT, Fig.
1A) was not
utilized
(data not shown).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of the HA-tagged A14.5L ORF. (A) Expression
of the epitope-tagged A14.5L protein from an IPTG-inducible
bacteriophage T7 promoter. BS-C-1 cells, in a six-well plate, were
infected with 10 PFU of vT7lacOI-A14.5LHA per cell. After 1 h at
37°C, fresh medium containing 0 to 200 µM IPTG was added to each
monolayer. The cells were harvested at 18 h and lysed in 50 µl
of extraction buffer (4), and 20 µl of cleared supernatant
was analyzed by SDS-PAGE and Western blotting with MAb 12CA5 to the HA
epitope. (B) Expression of the epitope-tagged A14.5L protein from the
natural A14.5L promoter. A Western blot of lysates from BS-C-1 cells
harvested at 2 to 24 h after infection with vA14.5LHA is shown.
BS-C-1 cells were infected with vA14.5LHA, as in panel A, except that
no IPTG was added. At intervals from 2 to 24 h, cells from
duplicate wells were harvested and analyzed by Western blotting with
MAb 12CA5 or polyclonal antibody to the A17L protein. The positions and
masses of marker proteins are indicated to the left of each panel.
|
|
The results obtained thus far indicated that the A14.5L-HA protein
could be synthesized in a relatively stable and nontoxic
form from a
gene with a T7 promoter in vaccinia virus. The expression
of the ORF
under endogenous transcriptional signals, however,
remained to be
demonstrated. We noted a typical late promoter
sequence (
7)
just upstream of the A14.5L ORF. To determine
whether the A14.5L ORF
can be expressed under its natural promoter,
another recombinant
vaccinia virus was constructed in which the
HA tag was inserted between
the C-terminal and stop codons of
the endogenous A14.5L ORF so that the
gene remained under its
own transcriptional and translational
regulatory signals. The
transfer plasmid used to append the HA tag also
contained the
neo and
gus genes between the
A14.5L and A14L ORFs, as indicated
in Fig.
2C, to allow selection and
detection of the recombinant
virus vA14.5LHA. Positive plaques were
picked three times in succession,
and the presence of the HA tag was
demonstrated by PCR. When BS-C-1
cells were infected with vA14.5LHA,
the HA-tagged protein was
detected at 12 h and accumulated through
24 h, similar to that
of the previously described late
membrane protein A17L (Fig.
3B).
Synthesis of the A14.5L-HA
protein was not detected in the presence
of a 40-µg/ml
concentration of AraC, an inhibitor of DNA replication,
consistent with
late promoter regulation (data not shown). Because
the A14.5L protein
was predicted to contain multiple serines and
threonines, as well as
one tyrosine, we attempted to label it
with
32P
i; the results, however, were negative,
suggesting that the A14.5L
protein is not phosphorylated (data not
shown).
Partition of the A14.5L-HA protein in the Triton X-114 detergent
phase.
The potential of the A14.5L-HA protein to associate with
membranes was evaluated by Triton X-114 partitioning (5) of
extracts of cells infected with vA14.5LHA. After temperature-induced
phase separation, the location of the HA-tagged protein was determined by SDS-PAGE and immunoblotting. As a control, the blot was also probed
with antibody to the previously characterized A17L membrane protein.
Both proteins were detected exclusively in the detergent-rich phase,
indicating sufficient hydrophobicity for membrane association (Fig.
4).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Partition of the A14.5L-HA protein in the Triton X-114
detergent phase. BS-C-1 cells were infected with vA14.5LHA (10 PFU/cell). After 18 h, the cells were washed with PBS and
resuspended in 0.2 ml of 10 mM Tris-HCl, 0.15 M NaCl, and 1% (vol/vol)
Triton X-114 (pH 7.4). The phase separation was carried out as
described previously (14). Equal volumes of total extract
(T), the aqueous phase (A), and the detergent phase (D) were analyzed
by SDS-PAGE and Western blotting with MAb 12CA5 or polyclonal antibody
to the A17L protein. The positions and masses of marker proteins are
indicated to the left.
|
|
Association of the A14.5L-HA protein with purified virus
particles.
Virus particles, from the lysate and medium of cells
infected with vA14.5LHA, were purified by sedimentation through a
sucrose cushion followed by CsCl gradient centrifugation. Because of
additional membranes, the intracellular enveloped virions (IEV) and EEV
have a lower buoyant density than the IMV. Fractions were collected from the CsCl gradient and the fractions corresponding in density to
IMV and IEV or EEV were analyzed by Western blotting after SDS-PAGE.
Replicate samples were probed with antibodies to the HA tag, the A34R
EEV membrane protein, and the A17L IMV membrane protein. The A14.5L-HA
protein, like the A17L protein, was in both the IMV and IEV or EEV,
whereas the A34R protein was only in the latter (Fig.
5A). Since IMV proteins are also present
in EEV, these data suggested that the A14.5L protein is a component of
the IMV.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5.
Association of the A14L-HA protein with the membrane
fraction of virus particles. (A) BS-C-1 cells were mock infected or
infected with 10 PFU of vA14.5LHA per cell. After 18 h, the medium
was harvested, and the cells were disrupted with a Dounce homogenizer.
Virus particles were purified by sedimentation through a sucrose
cushion and CsCl centrifugation (23). The virus band was
diluted with Tris-HCl (pH 9), collected by centrifugation, and
resuspended in Tris buffer. The lysates of mock-infected cells (U) or
infected cells (I) were analyzed in parallel with CsCl gradient
fractions by SDS-PAGE and Western blotting with MAb 12CA5 ( -HA) or
polyclonal antibody to the A34R protein ( -A34R) or A17L protein
( -A17R). Fractions containing IMV and IEV or EEV are indicated.
Small differences in the electrophoretic mobilities of proteins from
lysates and CsCl gradients could be due to the ionic strengths. The
bands corresponding to A14.5L-HA, A34R, and A17L are indicated by
asterisks. The positions and masses of marker proteins are indicated to
the left. (B) Vaccinia virions, purified by sucrose gradient
centrifugation (9) from cells infected with vaccinia virus
WR or vA14.5LHA, were incubated with 10 mM Tris (pH 7.4) or 1% NP-40
in 10 mM Tris (pH 7.4) in the presence or absence of 10 mM
dithiothreitol. Soluble (S) and insoluble (P) fractions were separated
by centrifugation and resuspended to equal volumes in SDS-containing
sample buffer. An equivalent amount of each fraction was subjected to
electrophoresis, and the separated proteins were transferred to a
membrane and analyzed by Western blotting with anti-HA MAb 12CA5.
|
|
Membrane proteins can usually be extracted from purified vaccinia
virions with either a nonionic detergent or a combination
of detergent
and reducing agent. The A14.5L protein required dithiothreitol
in
addition to NP-40 for efficient release into the supernatant
fraction
(Fig.
5B).
Immunogold electron microscopy.
The localization of the
A14.5L-HA protein was further investigated by successively incubating
ultrathin sections of infected BS-C-1 cells with an anti-HA MAb, a
secondary antibody to mouse IgG, and protein A conjugated to colloidal
gold. As expected, clusters of immature virions were typically found in
virus factory areas near the nucleus, whereas IMV and IEV were in more
peripheral parts of the cytoplasm. The gold particles were associated
with the membranes of both the mature (Fig.
6A) and immature (Fig. 6B) virions. In
control cells infected with vaccinia virus lacking the HA-tagged A14.5L
ORF, only occasional, widely dispersed gold particles were detected
(data not shown).

View larger version (132K):
[in this window]
[in a new window]
|
FIG. 6.
Immunogold labeling of viral membranes with antibody to
the HA tag. BSC-1 cells that had been infected with vA14.5L-HA for
24 h were fixed in paraformaldehyde, cryosectioned, and incubated
with a mouse MAb to the HA tag, rabbit IgG to mouse IgG, and then with
10-nm-diameter gold particles conjugated to protein A. Electron
microscopic images are shown with a 500-nm marker. (A) Field containing
large numbers of IEV. (B) Field containing large numbers of immature
virons. Arrows point to examples of gold particles.
|
|
The A14.5L ORF is nonessential for replication in vitro.
To
determine whether the A14.5L ORF is essential for vaccinia virus
replication, a recombinant virus, vA14.5L
neo/gus, was constructed
(Fig. 2D). The A14.5L ORF was deleted, except for 23 and 47 bp at
either end, and replaced with the neo and gus genes. The recombinant virus was isolated by antibiotic selection and
detected by staining with X-Glu. Deletion of the A14.5L ORF was
confirmed by PCR analysis (data not shown).
The vA14.5L

neo/gus virus formed normal-size plaques in a variety of
cell lines (monkey BS-C-1 and CV-1, human TK

143B and
A549, rabbit kidney 13, and baby hamster kidney 21 cells).
Moreover,
the yields of intra- and extracellular vA14.5L

neo/gus
and the
parental strain WR virus were similar in BS-C-1 cells
(Fig.
7). Thus, the A14.5L protein is
nonessential for vaccinia
virus replication in those tissue culture
cells examined.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
Replication of an A14.5L deletion mutant. B-SC-1 cells
in a six-well plate were inoculated with 10 PFU of vaccinia virus
strain WR or vA14.5L neo/gus per cell for 1 h at 37°C. The
cells were then washed twice with medium. At appropriate times, the
medium was removed and saved, and the cells were harvested by scraping.
The media and cells were centrifuged, and the virus titers in the
supernatants of the former (dashed lines) and the pellets of the latter
(solid lines) were determined by plaque assay on BS-C-1 cells.
|
|
Effect of the A14.5L deletion on the virulence of vaccinia virus
for mice.
When administered intranasally, the WR strain of
vaccinia virus causes weight loss and death in BALB/c mice. Initial
experiments indicated that vA14.5L
neo/gus was significantly
attenuated in this respect. Although this finding suggested that the
A14.5L gene was required for virulence, we needed to rule out other
explanations. To eliminate the possibility that expression of the
neo and gus genes was attenuating, either because
of the gene products themselves or polar effects on expression of
neighboring genes, the neo and gus genes were
deleted from vA14.5L
neo/gus without restoring the A14.5L ORF.
Plaques that did not stain blue were purified, and the loss of the
neo and gus genes was confirmed by PCR. This mutant virus, called vA14.5L
, retained only 13 bp of the start and
37 bp of the end of the A14.5L ORF (Fig. 2E). Because of the large size
of the vaccinia virus genome, we also considered that vA14.5L
neo/gus
might have an unrelated attenuating mutation. To rule this out,
vA14.5L+ with a restored A14.5L ORF was constructed from
vA14.5L
neo/gus by recombination (Fig. 2F). Again, plaques that did
not stain blue were purified, and an intact A14.5L gene was confirmed
by PCR.
Groups of 5-week-old female BALB/c mice were anesthetized and
inoculated intranasally with diluent or with 10
3 to
10
6 PFU of vaccinia virus strain WR, vA14.5L

neo/gus,
vA14.5L

, or
vA14.5L+. Of these viruses, WR and vA14.5L+ contained
the A14.5L
gene whereas vA14.5L

neo/gus and vA14.5L

did not. The
virulence
of the different viruses was assessed by loss of weight and
death,
which occurred between 7 and 10 days after infection. With
viruses
containing A14.5L, deaths were noted at 10
4 PFU,
and a majority or all of the mice were deceased at 10
5 PFU
and above (Fig.
8A). With viruses lacking
A14.5L, deaths
were first noted at 10
6 PFU (Fig.
8A).
Correspondingly, more severe weight losses occurred
in mice infected
with viruses containing A14.5L than with viruses
lacking A14.5L. The
weight changes for the 10
3-PFU challenges, which were
nonlethal for all groups, are shown
in Fig.
8B. The gains in the mean
weights of the mice infected
with vA14.5L

neo/gus or vA14.5L

virus
were similar to those of
uninfected controls, whereas the mice infected
with intact A14.5L
genes suffered appreciable weight losses (Fig.
8B).
Although some
weight loss occurred when 10
4 or
10
5 PFU of the viruses lacking A14.5L was administered, by
day 12,
the weights had rebounded and approached or exceeded the levels
at the start of the experiment (data not shown).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 8.
Virulence of parental and mutant vaccinia viruses in
mice. Groups of four mice were inoculated intranasally with
103 to 106 PFU of purified vaccinia virus
strain WR, vA14.5L neo/gus, vA14.5L , and vA14.5L+. (A) Death of
animals. (B) Percentage of original weight of mice in each group
infected with 103 PFU.
|
|
 |
DISCUSSION |
Comparative genomics is useful for identifying short ORFs that can
be overlooked when analyzing a large poxvirus genome. Thus, the
potential significance of the A14.5L ORF of vaccinia virus and other
orthopoxviruses was first appreciated when a homologous ORF with
typical late promoter sequences was detected in a distantly related
poxvirus (25). Further analysis indicated that orthologous genes are present in all vertebrate poxviruses examined, including orthopoxviruses, leporipoxviruses, yatapxoviruses, and molluscipox viruses. Here, we have shown that the 53-amino-acid ORF was expressed under its natural promoter as a viral membrane protein and that deletion of the ORF attenuated the virulence of vaccinia virus for mice.
Our inability to generate an antibody to the extremely hydrophobic
A14.5L protein made it necessary to rely on a short epitope tag which
was added between the C-terminal and stop codons of the A14.5L ORF.
Since neither transcriptional nor translational signals were altered by
this addition and the ORF remained in its original location within the
genome, we are confident that the late expression of the epitope-tagged
protein accurately reflected the temporal expression of the unmodified
one. Moreover, the tagged protein was specifically incorporated into
virus particles.
The hydrophobic nature of the A14.5L protein was predicted from its
amino acid composition and confirmed by Triton X-114 phase partitioning. When infected cells were cryosectioned, immunostained, and examined by electron microscopy, the protein A-conjugated gold
particles were found in association with immature and mature virus
particles, usually on or adjacent to the membrane envelope. Although
there is an N-terminal hydrophobic segment, it was not predicted to be
a signal peptide (20), and further studies are needed to
determine the topology of the A14.5L protein.
The conservation of the A14.5L ORF among distantly related poxviruses,
its expression during vaccinia virus infection, and the association of
the protein with the membranes of virus particles suggested that it has
a significant role and is not a useless remnant of some longer
ancestral ORF. Nevertheless, deletion of the A14.5L ORF had no
discernible effect on plaque size or virus yield in tissue culture
cells. This result was not too surprising, because poxviruses have many
genes that are not essential in tissue culture. In some cases, however,
the gene deletions decrease virulence in animal models. Our initial
studies indicated that the deletion mutant vA14.5L
neo/gus was
attenuated, compared to the parental vaccinia virus strain WR, when
administered intranasally to mice. To be sure that the effect was due
to the deletion of the A14.5L gene, two additional recombinant viruses
were made: one had the neo and gus genes removed
from the site of the deletion, and the other had the A14.5L ORF fully
restored. The viruses WR and vA14.5L+ with the A14.5L gene present
caused significantly more weight loss and death than the viruses
vA14.5L
neo/gus and vA14.5L
with the A14.5L gene deleted. Whether
the A14.5L membrane protein enhances virus replication and
dissemination in vivo or protects the virus against innate or acquired
immune responses remains to be determined.
 |
ACKNOWLEDGMENTS |
We thank Norman Cooper for providing tissue culture cells, Jerry
Sisler for DNA sequencing, Andrea Weisberg for electron microscopy, and
Rafael Molina for help with the animal experiments.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 4 Center Dr.,
MSC 0445, National Institutes of Health, Bethesda, MD 20892-0445. Phone: (301) 496-9869. Fax: (301) 480-1147. E-mail:
bmoss{at}nih.gov.
Permanent address: Institute of Virology, Slovak Academy of
Sciences, Bratislava 842 46, Slovakia.
 |
REFERENCES |
| 1.
|
Alexander, W. A.,
B. Moss, and T. R. Fuerst.
1992.
Regulated expression of foreign genes in vaccinia virus under the control of bacteriophage T7 RNA polymerase and the Escherichia coli lac repressor.
J. Virol.
66:2934-2942[Abstract/Free Full Text].
|
| 2.
|
Amegadzie, B. Y.,
B.-Y. Ahn, and B. Moss.
1992.
Characterization of a 7-kilodalton subunit of vaccinia virus DNA-dependent RNA polymerase with structural similarities to the smallest subunit of eukaryotic RNA polymerase II.
J. Virol.
66:3003-3010[Abstract/Free Full Text].
|
| 3.
|
Antoine, G.,
F. Scheiflinger,
F. Dorner, and F. G. Falkner.
1998.
The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses.
Virology
244:365-396[CrossRef][Medline].
|
| 4.
|
Betakova, T.,
E. J. Wolffe, and B. Moss.
1999.
Regulation of vaccinia virus morphogenesis: phosphorylation of the A14L and A17L membrane proteins and C-terminal truncation of the A17L protein are dependent on the F10L protein kinase.
J. Virol.
73:3534-3543[Abstract/Free Full Text].
|
| 5.
|
Bordier, C.
1990.
Phase separation of integral membrane proteins in Triton X-114 solution.
J. Biol. Chem.
256:1604-1607[Abstract/Free Full Text].
|
| 6.
|
Cameron, C.,
S. Hota-Mitchell,
L. Chen,
J. Barrett,
J. X. Cao,
C. Macaulay,
D. Willer,
D. Evans, and G. McFadden.
1999.
The complete DNA sequence of myxoma virus.
Virology
264:298-318[CrossRef][Medline].
|
| 7.
|
Davison, A. J., and B. Moss.
1989.
The structure of vaccinia virus late promoters.
J. Mol. Biol.
210:771-784[CrossRef][Medline].
|
| 8.
|
Duncan, S. A., and G. L. Smith.
1992.
Identification and characterization of an extracellular envelope glycoprotein affecting vaccinia virus egress.
J. Virol.
66:1610-1621[Abstract/Free Full Text].
|
| 9.
|
Earl, P. L.,
N. Cooper,
S. Wyatt,
B. Moss, and M. W. Carroll.
1998.
Preparation of cell cultures and vaccinia virus stocks, p. 16.16-16.16.3.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology, vol. 2. John Wiley and Sons, New York, N.Y.
|
| 10.
|
Earl, P. L.,
B. Moss,
L. S. Wyatt, and M. W. Carroll.
1998.
Generation of recombinant vaccinia viruses, p. 16.17.1-16.17.19.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology, vol. 2. Greene Publishing Associates & Wiley Interscience, New York, N.Y.
|
| 11.
|
Engelstad, M.,
S. T. Howard, and G. L. Smith.
1992.
A constitutively expressed vaccinia gene encodes a 42-kDa glycoprotein related to complement control factors that forms part of the extracellular virus envelope.
Virology
188:801-810[CrossRef][Medline].
|
| 12.
|
Goebel, S. J.,
G. P. Johnson,
M. E. Perkus,
S. W. Davis,
J. P. Winslow, and E. Paoletti.
1990.
The complete DNA sequence of vaccinia virus.
Virology
179:247-266[CrossRef][Medline].
|
| 13.
|
Hirt, P.,
G. Hiller, and R. Wittek.
1986.
Localization and fine structure of a vaccinia virus gene encoding an envelope antigen.
J. Virol.
58:757-764[Abstract/Free Full Text].
|
| 14.
|
Hooper, N. M.
1992.
Identification of a glycosylphosphatidyl anchor on membrane proteins, p. 91-92.
In
N. M. Hooper, and A. J. Turner (ed.), Lipid modification of proteins. Oxford University Press, New York, N.Y.
|
| 15.
|
Isaacs, S. N.,
E. J. Wolffe,
L. G. Payne, and B. Moss.
1992.
Characterization of a vaccinia virus-encoded 42-kilodalton class I membrane glycoprotein component of the extracellular virus envelope.
J. Virol.
66:7217-7224[Abstract/Free Full Text].
|
| 16.
|
Jensen, O. N.,
T. Houthaeve,
A. Shevchenko,
S. Cudmore,
T. Ashford,
M. Mann,
G. Griffiths, and J. K. Locker.
1996.
Identification of the major membrane and core proteins of vaccinia virus by two-dimensional electrophoresis.
J. Virol.
70:7485-7497[Abstract].
|
| 17.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[CrossRef][Medline].
|
| 18.
|
Moore, J. B., and G. L. Smith.
1992.
Steroid hormone synthesis by a vaccinia enzyme a new type of virus virulence factor.
EMBO J.
11:1973-1980[Medline].
|
| 19.
|
Moss, B.
1996.
Poxviridae: the viruses and their replication, p. 2637-2671.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 20.
|
Nielsen, H.,
J. Engelbrecht,
S. Brunak, and G. von Heijne.
1997.
Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.
Protein Eng.
10:1-6[Abstract/Free Full Text].
|
| 21.
|
Parkinson, J. E., and G. L. Smith.
1994.
Vaccinia virus gene A36R encodes a Mr 43-50 K protein on the surface of extracellular enveloped virus.
Virology
204:376-390[CrossRef][Medline].
|
| 22.
|
Payne, L. G., and E. Norrby.
1976.
Presence of hemagglutinin in the envelope of extracellular vaccinia virus particles.
J. Gen. Virol.
32:63-72[Abstract/Free Full Text].
|
| 23.
|
Roper, R. L.,
L. G. Payne, and B. Moss.
1996.
Extracellular vaccinia virus envelope glycoprotein encoded by the A33R gene.
J. Virol.
70:3753-3762[Abstract].
|
| 24.
|
Senkevich, T. G.,
J. J. Bugert,
J. R. Sisler,
E. V. Koonin,
G. Darai, and B. Moss.
1996.
Genome sequence of a human tumorigenic poxvirus: prediction of specific host response-evasion genes.
Science
273:813-816[Abstract].
|
| 25.
|
Senkevich, T. G.,
E. V. Koonin,
J. J. Bugert,
G. Darai, and B. Moss.
1997.
The genome of molluscum contagiosum virus: analysis and comparison with other poxviruses.
Virology
233:19-42[CrossRef][Medline].
|
| 26.
|
Shchelkunov, S. N.,
R. F. Massung, and J. J. Esposito.
1995.
Comparison of the genome DNA sequences of Bangladesh-1975 and India-1967 variola viruses.
Virus Res.
36:107-118[CrossRef][Medline].
|
| 27.
|
Shchelkunov, S. N.,
A. V. Totmenin,
V. N. Loparev,
P. F. Safronov,
V. V. Gutorov,
V. E. Chizhikov,
J. C. Knight,
J. M. Parsons,
R. F. Massung, and J. J. Esposito.
2000.
Alastrim smallpox variola minor virus genome DNA sequences.
Virology
266:361-386[CrossRef][Medline].
|
| 28.
|
Takahashi, T.,
M. Oie, and Y. Ichihashi.
1994.
N-terminal amino acid sequences of vaccinia virus structural proteins.
Virology
202:844-852[CrossRef][Medline].
|
| 29.
|
Turner, G. S.
1967.
Respiratory infection of mice with vaccinia virus.
J. Gen. Virol.
1:399-402[Abstract/Free Full Text].
|
| 30.
|
Ward, G. A.,
C. K. Stover,
B. Moss, and T. R. Fuerst.
1995.
Stringent chemical and thermal regulation of recombinant gene expression by vaccinia virus vectors in mammalian cells.
Proc. Natl. Acad. Sci. USA
92:6773-6777[Abstract/Free Full Text].
|
| 31.
|
Willer, D. O.,
G. McFadden, and D. H. Evans.
1999.
The complete genome sequence of Shope (rabbit) fibroma virus.
Virology
264:319-343[CrossRef][Medline].
|
| 32.
|
Williamson, J. D.,
R. W. Reith,
L. J. Jeffrey,
J. R. Arrand, and M. Mackett.
1990.
Biological characterization of recombinant vaccinia viruses in mice infected by the respiratory route.
J. Gen. Virol.
71:2761-2767[Abstract/Free Full Text].
|
| 33.
|
Wolffe, E. J.,
D. M. Moore,
P. J. Peters, and B. Moss.
1996.
Vaccinia virus A17L open reading frame encodes an essential component of nascent viral membranes that is required to initiate morphogenesis.
J. Virol.
70:2797-2808[Abstract].
|
Journal of Virology, May 2000, p. 4085-4092, Vol. 74, No. 9
0022-538X/00/$04.00+0
This article has been cited by other articles:
-
Van Vliet, K., Mohamed, M. R., Zhang, L., Villa, N. Y., Werden, S. J., Liu, J., McFadden, G.
(2009). Poxvirus Proteomics and Virus-Host Protein Interactions. Microbiol. Mol. Biol. Rev.
73: 730-749
[Abstract]
[Full Text]
-
Sood, C. L., Ward, J. M., Moss, B.
(2008). Vaccinia Virus Encodes I5, a Small Hydrophobic Virion Membrane Protein That Enhances Replication and Virulence in Mice. J. Virol.
82: 10071-10078
[Abstract]
[Full Text]
-
Chung, C.-S., Chen, C.-H., Ho, M.-Y., Huang, C.-Y., Liao, C.-L., Chang, W.
(2006). Vaccinia Virus Proteome: Identification of Proteins in Vaccinia Virus Intracellular Mature Virion Particles. J. Virol.
80: 2127-2140
[Abstract]
[Full Text]
-
Zadori, Z., Szelei, J., Tijssen, P.
(2005). SAT: a Late NS Protein of Porcine Parvovirus. J. Virol.
79: 13129-13138
[Abstract]
[Full Text]
-
Laidlaw, S. M., Skinner, M. A.
(2004). Comparison of the genome sequence of FP9, an attenuated, tissue culture-adapted European strain of Fowlpox virus, with those of virulent American and European viruses. J. Gen. Virol.
85: 305-322
[Abstract]
[Full Text]
-
Upton, C., Slack, S., Hunter, A. L., Ehlers, A., Roper, R. L.
(2003). Poxvirus Orthologous Clusters: toward Defining the Minimum Essential Poxvirus Genome. J. Virol.
77: 7590-7600
[Abstract]
[Full Text]
-
Chiu, W.-L., Chang, W.
(2002). Vaccinia Virus J1R Protein: a Viral Membrane Protein That Is Essential for Virion Morphogenesis. J. Virol.
76: 9575-9587
[Abstract]
[Full Text]
-
Gubser, C., Smith, G. L.
(2002). The sequence of camelpox virus shows it is most closely related to variola virus, the cause of smallpox. J. Gen. Virol.
83: 855-872
[Abstract]
[Full Text]
-
Yeh, W. W., Moss, B., Wolffe, E. J.
(2000). The Vaccinia Virus A9L Gene Encodes a Membrane Protein Required for an Early Step in Virion Morphogenesis. J. Virol.
74: 9701-9711
[Abstract]
[Full Text]
-
da Fonseca, F. G., Wolffe, E. J., Weisberg, A., Moss, B.
(2000). Characterization of the Vaccinia Virus H3L Envelope Protein: Topology and Posttranslational Membrane Insertion via the C-Terminal Hydrophobic Tail. J. Virol.
74: 7508-7517
[Abstract]
[Full Text]