This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Czauderna, F.
Right arrow Articles by Tönjes, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Czauderna, F.
Right arrow Articles by Tönjes, R. R.

 Previous Article  |  Next Article 

Journal of Virology, May 2000, p. 4028-4038, Vol. 74, No. 9
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Establishment and Characterization of Molecular Clones of Porcine Endogenous Retroviruses Replicating on Human Cells

Frank Czauderna,dagger Nicole Fischer, Klaus Boller, Reinhard Kurth,Dagger and Ralf R. Tönjes*

Paul-Ehrlich-Institut, D-63225 Langen, Germany

Received 29 November 1999/Accepted 8 February 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The use of pig xenografts is being considered to alleviate the shortage of allogeneic organs for transplantation. In addition to the problems overcoming immunological and physiological barriers, the existence of numerous porcine microorganisms poses the risk of initiating a xenozoonosis. Recently, different classes of type C porcine endogenous retoviruses (PERV) which are infectious for human cells in vitro have been partially described. We therefore examined whether completely intact proviruses exist that produce infectious and replication-competent virions. Several proviral PERV sequences were cloned and characterized. One molecular PERV class B clone, PERV-B(43), generated infectious particles after transfection into human 293 cells. A second clone, PERV-B(33), which was highly homologous to PERV-B(43), showed a G-to-A mutation in the first start codon (Met to Ile) of the env gene, preventing this provirus from replicating. However, a genetic recombinant, PERV-B(33)/ATG, carrying a restored env start codon, became infectious and could be serially passaged on 293 cells similar to virus clone PERV-B(43). PERV protein expression was detected 24 to 48 h posttransfection (p.t.) using cross-reacting antiserum, and reverse transcriptase activity was found at 12 to 14 days p.t. The transcriptional start and stop sites as well as the splice donor and splice acceptor sites of PERV mRNA were mapped, yielding a subgenomic env transcript of 3.1 kb. PERV-B(33) and PERV-B(43) differ in the number of copies of a 39-bp segment in the U3 region of the long terminal repeat. Strategies to identify and to specifically suppress or eliminate those proviruses from the pig genome might help in the production of PERV-free animals.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Xenotransplantation, i.e., the therapeutic use of live cells, tissues, and organs from nonhuman animals, offers the chance to alleviate the shortage of human donor organs. Clinical trials for testing the general applicability of pig cells or tissues as an alternative to allogeneic source materials are ongoing. Those trials include the infusion or implantation of (encapsulated) pancreatic islet cells as a treatment for insulin-dependent diabetes mellitus (31), the implantation of fetal neuronal tissue as a therapy for Parkinson's disease (17), extracorporeal kidney perfusion (9), and perfusion through or the implantation of whole liver preparations as a treatment for hepatic failure (12, 16).

The possibility of introducing infectious agents from the animal into the individual xenograft recipient and ultimately to the public, leading to xenozoonosis, also termed xenosis, has raised numerous concerns (2, 24, 46, 62). As several pathogenic agents, including immunodeficiency viruses, have been transmitted from nonhuman primates to humans (27, 34), and as human immunodeficiency virus type 1 began as a zoonosis, probably from chimpanzees (26), nonhuman primates are considered inappropriate organ donors for xenotransplantation (10, 11; U.S. Department of Health and Human Services, Food and Drug Administration, Center for Biologics Evaluation and Research (CBER), Public health issues posed by the use of nonhuman primate xenografts in humans, April 1999, http://www.fda.gov/cber/gdlns/xenoprim.pdf), even though their tissues and organs more closely resemble those of humans than those of phylogenetically more distant animals such as pigs and are therefore less susceptible to rejection.

Pig organs are preferred for transplants (23), particularly since different strategies have been developed to overcome the major obstacle of hyperacute rejection. Enzymatic modifications of the carbohydrate surface of xenogeneic cells significantly reduce human antibody binding and complement-mediated cytolysis (4, 55, 58). In addition, affinity isolation of xenoreactive human natural antibodies of the immunoglobulin M class, of which a major fraction is directed against the terminal alpha -galactose determinants on porcine endothelial cells, was used to lower the natural humoral immunologic barrier to xenotransplantation (50). Inhibition of the second element responsible for hyperacute rejection, complement activation, is being pursued mainly by the use of transgenic pigs whose organs partially overcome xenograft rejection by constantly expressing human regulators of complement activation (15, 25, 42) but also by administration of complement-inhibitory therapeutics (53). As an alternative, attempts have been undertaken to establish host-specific transplantation tolerance to pig organ grafts (30). The possibility that human pathogens could be transmitted more easily by use of transgenic pigs, however, has been proposed (69).

Breeding and keeping pigs under specific-pathogen-free or qualified-pathogen-free conditions is generally assumed to reduce the potential risk of transmitting exogenous viral, bacterial, fungal, and parasitic agents by xenotransplantation. However, the remaining microbiologic obstacles include pathogens such as those which can infect fetuses congenitally or which can be stably transmitted in the germ line and other unknown or less characterized agents, e.g., porcine herpesviruses (22).

Retroviruses that reside in the pig genome (porcine endogenous retroviruses [PERV]) and show similarities to C-type viruses of other species were described almost 30 years ago (3, 7, 8, 38). Recent studies have shown that PERV released from porcine kidney cell lines (PK15) (52), from mitogenically activated porcine peripheral blood mononuclear cells (PBMC) (72), or from porcine aortic endothelial cells (41) are capable of infecting human cells in vitro. Approximately 50 proviral integration sites exist in the genome of different pig breeds (1, 37, 52), and at least three subtypes of PERV are known to exist (37, 63). Those PERV display very high homologies in the gag and pol genes but differ in their env genes; especially in the areas encoding the VRA, VRB, and PRO regions of the gp70 protein (1, 37). These regions are known to determine the host range specificities (5, 6). Although a full-length PERV cDNA has been generated from miniature swine lymphocytes (1), the designated sequence PERV-MSL is barely infectious for human cell lines in comparison with PERV class A and class B, as judged from pseudotype assays using the appropriate env genes (63).

Initial retrospective studies on patients who had been transplanted with porcine tissues revealed no detectable transmission of PERV (33, 51). Likewise, in a cohort of 160 patients who had been treated with various living pig tissues, no conclusive evidence of pig-to-human transmission of PERV was found, although persistent microchimerism was observed in 23 patients for up to 8.5 years (49). The treatment of the patients included short-term extracorporeal liver, kidney, and splenic perfusions, bioartificial liver perfusion, implantation with pancreatic islet cells, and transplantation of skin. The detection methods employed were based on both DNA- and RNA-dependent PCR with PERV-specific primers and on Western blot-based serological assays to detect antibody responses to PERV. As only 4 of the 23 samples showing microchimerism were PERV positive, the question of PCR contamination was raised (70). Basically, these studies suggest that PERV will not show the very high levels of transmission associated with some viruses (60). As only clinical trials will enable long-term xenograft survival and function to be tested, and as retroviruses have extended clinical latency periods following infection and therefore are difficult to identify in the absence of demonstrable disease, upcoming studies must be conducted in a well-coordinated, prospective, and stepwise manner, making use of the recently developed assays to monitor putative PERV infection and transmission to contacts.

In this communication, we report the cloning of pig-specific, polytropic proviruses isolated from the human embryonal kidney cell line 293 infected with PERV. Complete sequencing of PERV class B has been performed. Two proviral clones produced infectious and replication-competent particles after transfection into human 293 cells.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell lines, transfection, and replication studies. The cell lines PK15 and 293 and a 293 cell line productively infected with PERV derived from PK15 cells, 293 PERV-PK, were kindly provided by R. Weiss (London). HeLa cells were obtained from the American Type Culture Collection (CCL-2). Plasmid DNA (1 to 10 µg) prepared with the EndoFree system (Qiagen, Hilden, Germany) was transfected into cells using lipofectamine (Life Technologies, Karlsruhe, Germany). Virus replication was detected by reverse transcription-PCR (RT-PCR), immunofluorescence microscopy with cross-reacting feline leukemia virus (FeLV) Gag antiserum, or by reverse transcriptase (RT) assays. Infectivity was confirmed by placing virions derived from cell-free supernatants of producer cells after filtration through 0.45-µm-pore-size membranes (Sartorius, Göttingen, Germany) on semiconfluent 293 or HeLa cells.

RT assay. Cell-free supernatants filtered through membranes (0.45-µm pore size) were analyzed for RT activity using the C-type RT activity assay (Cavidi Tech AB, Uppsala, Sweden) according to the instructions of the manufacturer (protocol B).

Immunofluorescence microscopy. 293 and HeLa cell lines transfected with recombinant plasmid DNA were fixed 24 to 48 h posttransfection (p.t.). Indirect immunofluorescence analysis was performed with a laser scan microscope as described previously (64). Polyclonal cross-reacting goat anti-FeLV p27 (CA) antiserum (Biodesign International) was used for detection of PERV Gag in a 1:500 dilution. Secondary goat antibodies conjugated with Cy3 (Indocarbocyanin) (Dianova, Hamburg, Germany) were employed.

Electron microscopy. Electron microscopy was performed according to standard procedures as described previously (65).

Immunoblotting. Sucrose gradient-purified PERV particles were analyzed by sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis (SDS-10% PAGE) (36) and Western blotting (67) with polyvinylidene difluoride membranes (Millipore, Eschborn, Germany). Blots were incubated with a 1:5,000 dilution of goat anti-FeLV CA antiserum (Biodesign International) for 1 h or overnight, followed by a 1:10,000 dilution of protein G-conjugated horseradish peroxidase (Bio-Rad, Munich, Germany) for 1 h. Immunoreactive proteins on membranes were detected with the enhanced chemiluminescence system and exposure for 15 to 20 s on hyperfilm ECL (Amersham-Pharmacia, Freiburg, Germany).

Preparation of genomic DNA. Preparation of high-molecular-weight DNA from PBMC of different species and from cell lines was performed according to standard protocols (54).

Southern blot hybridization. Genomic cellular DNA was digested with different restriction endonucleases (10 to 40 U/µg of DNA; New England Biolabs, Frankfurt, Germany), separated in 0.7% TAE (Tris-acetate-EDTA)-agarose gels and alkali blotted onto Porablot NY Amp nylon membranes (Macherey-Nagel, Düren, Germany). Hybridization was performed with a radiolabeled pro/pol 753-bp PERV cDNA overnight at 65°C. The probe was generated by RT-PCR from mRNA of PK15 cells. Primers PK1 (TTGACTTGGGAGTGGGACGGGTAAC, nucleotides [nt] 2927 to 2949) and PK6 (GAGGGTCACCTGAGGGTGTTGGAT, nt 3739 to 3716) in a first PCR and primers PK2 (GGTAACCCACTCGTTTTCTGGTCA, nt 2944 to 2966) and PK5 (CTGTGTAGGGCTTCGTCAAAGATG, 3696 to 3673) in a nested PCR were derived from a published sequence (accession no. U77599). Nucleotide sequence assignments in this publication are based on the PERV-B(33) sequence (accession no. AJ133816) (see below). Filters were washed several times under stringent conditions with 2× SSC (0.15 M NaCl, 0.015 M sodium citrate)-0.1% SDS at ambient temperature and with 0.2× SSC-0.1% SDS at 65°C. Autoradiography was done for 48 to 96 h. For rehybridizations, filters were stripped and incubated with a radiolabeled 2.4-kb NarI-BamHI fragment of the single-copy human H1o histone gene harboring the H1o coding and 3'-flanking sequence (HSHIS10G; accession no. X03473 [20]) to reveal equal loading of DNA samples. Probes were labeled with the Multiprime DNA labeling system (Amersham-Pharmacia) with [alpha -32P]dCTP (3,000 Ci/mmol; Amersham-Pharmacia) as the radionucleotide.

RNA isolations. Total RNA was isolated with Trizol reagent (Life Technologies) according to the instructions of the manufacturer. Polyadenylated RNA was isolated from total cellular RNA using a PolyATract mRNA isolation kit (Promega, Mannheim, Germany).

Northern blot hybridization. For analysis of PERV mRNA expression in virus-producing cells, RNA was denatured in glyoxal according to standard techniques (54). Polyadenylated RNA (0.5 to 2.0 µg) was separated in 1% agarose-sodium phosphate (pH 6.8) gels. After capillary transfer onto nylon membranes, UV cross-linking, and additional baking of membranes for 2 h at 80°C, hybridization was done at 65°C overnight. In contrast to the Southern blot analysis, the first-stringency washing steps were performed at 42°C. A PERV long terminal repeat (LTR) U5 sequence was amplified with primers U5-for (GTGACGCACAGGCTTTGTTG, nt 489 to 508) and U5-rev (GTAAAAGAACAATCCCCCTCGTC, nt 697 to 675). The radiolabeled U5 209-bp amplificate and the pro/pol 753-bp PERV cDNA were used as hybridization probes.

RT-PCR. Oligo(dT)-primed cDNA was synthesized employing the SuperScript preamplification system (Life Technologies) and total RNA or mRNA as the template. After RNase H treatment, 1/10 of the cDNA reaction volume was used for PCR with gene-specific primers.

Determination of splice donor and splice acceptor sites. PCR was performed with cDNA generated from 293 PERV-PK mRNA with primers PERV-PBS (GTTGGCCGGGAAATCCTGCG, nt 716 to 735) and env-R (GAGTAAGGAACCACGCGATGGAG, nt 6291 to 6269). The PCR profile included an initial denaturation at 94°C for 10 min, 30 cycles of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C, and a final elongation for 10 min at 72°C. A 20-pmol amount of each primer and 2.5 U of AmpliTaq Gold (Perkin-Elmer Cetus, Norwalk, Conn.) were used. The elongation steps for 1 min were chosen for preferentially generating amplification products derived from subgenomic transcripts. The PCR product was cloned into pGEM-T Easy (Promega) and sequenced.

5'RACE. The Marathon cDNA amplification kit (Clontech, Heidelberg, Germany) was used for 5' rapid amplification of cDNA ends (5'RACE) experiments according to the manufacturer's instructions with mRNA as the template. The 5'RACE products generated with anchor primer 1 in combination with PERV-specific primer PK26 (ACGCACAAGACAAAGACACACGAA, nt 1134 to 1111) were cloned into pCRII-Topo (Invitrogen, Groningen, The Netherlands) and sequenced.

Primer extension. Oligonucleotide PK-REV-PE (5'-GCAAACAGCAAGAGGATTTTTATTCCAAGCGCGCTG-3', nt 623 to 588), which hybridizes in the LTR close to the anticipated transcriptional start site, was 5'-end labeled. In a 20-µl reaction volume containing 1× One-Phor-All buffer (Amersham-Pharmacia), 100 µCi of [gamma -32P]dATP, and 20 U of FPLCpure T4 polynucleotide kinase (Amersham-Pharmacia), 50 pmol of 5' termini was incubated for 30 min at 37°C. The radiolabeled primer was used in a first-strand synthesis for RT-PCR. After RNase H treatment, the RT-PCR product was separated on a 6% polyacrylamide sequencing gel and compared with the results of Sanger sequencing reactions with unlabeled oligonucleotide PK-REV-PE as the primer and the cloned 5' LTR (pPERV-PK26/34) as the template. Sequencing reactions were carried out with the T7 sequencing kit (Amersham-Pharmacia).

PCR amplification of PERV DNA sequences. Genomic sequences containing proviral segments were initially cloned by PCR techniques. First, inverse PCR as described before (66) was performed. In brief, genomic DNA from 293 cells infected with PK15-derived PERV was digested with different restriction endonucleases (NEB), generating blunt ends. After heat inactivation and alcohol precipitation, 1 to 5 µg of DNA was self-ligated overnight in a 300-µl volume. After alcohol precipitation, circularized DNA fragments were resuspended in 50 µl of water, of which 2.5 µl served as the template for PCR with inverse-oriented oligonucleotides. PCR was carried out starting with an initial denaturation step at 94°C for 10 min, followed by 35 cycles of 45 s at 94°C, 45 s at 61°C, and 6 min at 72°C. An additional six cycles with an annealing temperature of 58°C were performed. The final extension was done for 10 min at 72°C. Each PCR mixture contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.01% (wt/vol) gelatin, a 0.2 mM concentration of each deoxynucleoside triphosphate, 20 pmol of each primer, and 2.5 U of AmpliTaq Gold (Perkin Elmer Cetus). The primers PK7 (CCCACCCATCACCCAGGATTTTTT, nt 2884 to 2861) and PK9 (AGGGTTCAAGAACTCCCCGACCAT, nt 3651 to 3675) were used to generate 3-kb SmaI- and 2-kb PvuII-religated DNA amplificates, respectively. A nested PCR with PK3 (CATCTTTGACGAAGCCCTACACAG, nt 3673 to 3696) and PK8 (TTCCTAATGGTTGTAGCAGCACTG, nt 2849 to 2826) in a second amplification generated a 3.5-kb product using self-ligated NaeI-digested DNA as the template. Two more inverse PCR products, a 2.2-kb PvuII and a 0.6-kb RsaI amplificate, were obtained using primers PK10 (AGGCGCTCACTGGGAAGTGGACTT, nt 5434 to 5457) plus PK12 (GGTGGCTTCCCCTTAGTCTCTTTC, nt 5432 to 5409) and PK20 (TGGTCGGTTATACCGATAGTCATA, nt 7559 to 7536) plus PK22 (AAAGAGAACCCGTATCCCTTACCC, nt 7561 to 7584), respectively. Amplification products were gel purified, cloned into pGEM-T Easy (Promega) or pCRII-Topo (Invitrogen), and partially sequenced.

Based on this sequence information, the entire PERV gag-pol-env gene cassette was directly amplified using the Expand long-template PCR system (Boehringer, Mannheim, Germany). PCR was performed in a 50-µl volume containing 50 mM Tris-HCl (pH 9.2), 16 mM (NH4)2SO4, 1.75 mM MgCl2, a 0.2 mM concentration of each deoxynucleoside triphosphate, 20 pmol each of primers PK29 (5'-ATCAGCAGACGTGCTAGGAGGATC-3', nt 895 to 918) and PK28 (5'-CCACGCAGGGGTAGAGGACTGCGG-3', nt 8781 to 8758), 100 ng of genomic DNA from PERV-infected 293 cells, and 2.5 U of enzyme mix, according to the instructions of the manufacturer. Cycle conditions included an initial denaturation at 94°C for 2 min and 10 cycles of 30 s at 94°C, 45 s at 65°C, and 9 min at 68°C. The following 25 cycles had an increment of 10 s in the elongation step. The final extension was done for 30 min at 72°C.

Likewise, primers PK34 (AAAGGATGAAAATGCAACCTAACC, nt 3 to 26) and PK26 (see above) were used for direct amplification of a PERV 5' LTR sequence. Amplification products were gel purified and cloned into pGEM-T Easy (Promega). The resulting clones, pPERV-PK28/PK29 and pPERV-PK26/PK34, containing 7.8 and 1.0 kb of PERV sequences, respectively, were further characterized.

Detection of integrated PERV by PCR. PERV pro-pol sequences were PCR amplified from cellular DNA after transfection with primers PK44 (CTGGAATTGTCTGACCTAG, nt 3815 to 3833) and PK46 (GCCATCCTCTTACCTTCCAC, nt 4689 to 4670) in a first PCR and primers PK45 (GCTAAGAAGGCCCAGATTTGC, nt 3848 to 3868) and PK47 (CTTCCGTCAGTGAACCAGGTTAG, nt 4659 to 4637) for nested PCR. PERV env sequences were amplified with primers PK17 (GCTAATCTTCCAGAATACCTCCAG, nt 5384 to 5408) and PK19 (CCCTAATCCGAGCATTACAGCTAG, nt 7607 to 7584).

Generation of a human lambda  bacteriophage library. For the construction of a genomic DNA library, high-molecular-weight DNA from 293 PERV-PK cells was partially digested with Sau3AI and cloned into the lambda Fix II/XhoI partial fill-in vector (Stratagene, Amsterdam, The Netherlands). Phage particles were generated according to the manufacturer's instructions using Gigapack XL packaging extract (Stratagene). The bacteriophage library, after one round of amplification, was screened with the 32P-labeled pro-pol probe (see above). Recombinant lambda  clones were purified to homogeneity, and bacteriophage DNA was prepared using the Nucleobond AX ready-to-use system (Macherey-Nagel).

Subcloning. DNA from lambda  bacteriophage clones was digested with NotI (10 U/µg of DNA; NEB) and separated on standard 0.7% TAE-agarose gels. Inserts were gel purified using the JETsorb DNA extraction kit (Genomed, Bad Oeyenhausen, Germany), ligated into the NotI site of pBS-KS (Stratagene), and transformed into Escherichia coli DH10B.

Plasmid pPERV-B(33)/ATG is a derivative of pPERV-B(33) which showed a G-to-A mutation at nt 6191 in the first start codon of the env open reading frame (ORF). Basically, pPERV-B(33)/ATG was generated by replacing a BsrGI restriction fragment (nt 5920 to 7245) from pPERV-B(33) with the cognate fragment from pPERV-PK28/PK29. The replacement of the 1,326-bp restriction fragment was performed in a plasmid containing an EcoRV-SphI fragment (nt 2321 to 7410) of pPERV-B(33) subcloned into pGEM-5 (Promega). Finally, an NdeI-SphI fragment (nt 5199 to 7410) of the resulting plasmid, pGEM-5-EcoRV-PERV-B(33)-SphI-ATG, containing the ATG triplet was ligated into appropriately digested pPERV-B(33).

Sequence analysis. The DNA sequences of both strands were determined by primer walking with the double-stranded dideoxy chain termination method using Thermo Sequenase fluorescent dye terminator cycle sequencing and precipitation kits according to the instructions of the manufacturer (Amersham-Pharmacia). Sequencing reactions were performed in a Vistra DNA Labstation 625 (Molecular Dynamics, Krefeld, Germany) and cycle sequenced on an ABI 373A or 377 DNA sequencing system (Applied Biosystems, Weiterstadt, Germany) at the Paul Ehrlich Institute or by Agowa GmbH, Berlin, Germany. All primers were commercially purchased (Eurogentec, Seraing, Belgium; ARK Scientific, Damnstadt, Germany).

Nucleotide sequence accession numbers. The complete nucleotide sequences of pPERV-PK28/29 (Y17013), pPERV-PK26/34 (Y17012), PERV-B(33) (AJ133816), and PERV-B(43) (AJ133818) have been deposited in GenBank.

The sequences used for homology studies are PERV-MSL (AF038600) (1), Tsukuba-1 (AF038599) (1), PK-15 ERV (AF038601) (1), Moloney murine leukemia virus (MoMLV) (J02255, J02256, and J02257) (59), gibbon ape leukemia virus (GaLV) (M26927) (18), baboon endogenous virus (BaEV) (D10032, D00088, and N00088) (35), FeLV (M18247 and M19392) (21), and human endogenous retrovirus ERV3 pol-env 3' LTR (M12140) (14).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Porcine type C retroviruses are released from productively infected human 293 cells. The human kidney cell line 293, which had been originally infected with PERV virions derived from porcine kidney cell line PK15 (293 PERV-PK [52]) and which permanently releases particles, was used in our studies. Virions produced by 293 PERV-PK cells were serially passaged on 293 cells using RT assays to monitor retroviral replication (data not shown). As revealed by ultrastructural analysis (Fig. 1), the morphology of the viruses produced by freshly infected human 293 cells is typical of a type C retrovirus, as reported for pig kidney cell lines (3). These infected human cells were employed for subsequent molecular characterization and cloning of PERV sequences.


View larger version (142K):
[in this window]
[in a new window]
 
FIG. 1.   Morphology of PERV. Ultrathin sections showing PERV particles budding from (a to c) and infecting (d to f) human kidney cells (293 line). Budding proceeds in a typical C-type manner, while virus entry follows the pathway of receptor-mediated endocytosis via coated pits (d and arrow in g) and coated vesicles (e) towards endosomes (f). The diameter of the particles is approximately 110 nm. The arrow points to a virus particle during cell entry. The bar in panel g represents 200 nm. 293 cells were infected with originally PK15-derived PERV particles, which can be passaged on 293 cells.

PERV sequences are specific to pigs. A PERV 753-bp pro-pol probe was generated by RT-PCR with mRNA from 293 PERV-PK cells. A variety of animal DNA samples were investigated in a genomic Southern blot analysis, demonstrating that PERV sequences could only be detected in DNA of porcine origin, such as PBMC and PK15 cells (Fig. 2, lanes 3 and 7), but not in mouse, dog, sheep, goat, bovine, or human DNA (Fig. 2) even though (endogenous) murine leukemia virus (MLV) pol sequences show up to 64% homology to PERV sequences (see below). This result indicated that proviral PERV sequences exist in several integration sites in the cell line 293 PERV-PK. The intensity of a ~2.1-kb EcoRI-hybridizing marker fragment in 293 PERV-PK DNA (Fig. 2, lane 9) was as strong as in porcine PBMC or PK15 DNA (Fig. 2, lanes 3 and 7). At least two more hybridizing fragments were detected in 293 PERV-PK DNA but at lower intensities (Fig. 2, lane 9). A rehybridization analysis with a probe derived from the single-copy histone H1o gene, which is well conserved throughout evolution (20), demonstrated equal loading of DNA (data not shown), suggesting that at least five integrated proviral copies of PERV exist in the cell line 293 PERV-PK. This estimation was confirmed by a Southern blot analysis with different restriction enzymes for 293 PERV-PK DNA. EcoRV, HpaI, and ScaI were identified as single cutters in the PERV sequence by computer analysis in relation to the pro-pol probe, which served as a proviral landmark and revealed numerous more or less distinct hybridizing bands (data not shown). Distinct single bands generated by DraI, NaeI, PvuII, and SmaI indicated the existence of at least two internal recognition sites in the proviral PERV sequence (data not shown). Some of those fragments formed the basis for inverse PCR-mediated cloning techniques after religation.


View larger version (39K):
[in this window]
[in a new window]
 
FIG. 2.   Presence of PERV sequences in different genomes and restriction enzyme analysis of PERV-infected 293 cell line. Southern blot analyses of EcoRI-digested genomic DNA samples from different species using a PERV pro-pol probe. Lane 1, mouse; lane 2, dog; lane 3, pig PBMC; lane 4, sheep; lane 5, goat; lane 6, bovine; lane 7, pig (PK15 cell line); lane 8, human 293 cell line; lane 9, human cells infected with PERV (293 cell line infected with PK15-derived PERV); lane 10, human teratocarcinoma cell line GH. A 753-bp pro-pol fragment served as the hybridization probe. The sizes of HindIII-digested lambda  are given.

Cloning of PERV sequences by inverse and long PCR techniques. Partial sequences were obtained after cloning of SmaI (nt 943 to 4024), PvuII (nt 1925 to 3999), NaeI (nt 804 to 5470), PvuII (5372 to 7633), and RsaI (nt 7502 to 8109) DNA fragments, which were amplified by inverse PCR using DNA from 293 cells infected with PERV after restriction enzyme digestion and religation. With oligonucleotides PK28 and PK29, derived from these sequences, the PERV coding region comprising a 7.8-kb gag-pol-env gene cassette was amplified, producing clone pPERV-PK28/29. In addition, a 5' LTR was amplified using primers PK 26 and PK34, generating pPERV-PK26/34. Both retroviral clones were fully sequenced, and pPERV-PK28/29 was characterized as PERV-B. This sequence, ranging from nt 895 to 8781 based on the PERV-B(33) standard sequence (see below), exhibits gag (nt 1154 to 2728) and env (nt 6189 to 8162) ORFs and demonstrates homologies of 94.0 to 99.2% to the gag and pol genes of PERV-MSL, Tsukuba-1, and PK-15 ERV (1), respectively, using the BLASTN program (National Center of Biotechnology Information genetic databases). PK-15 ERV is a partially (in pol) deleted PERV cDNA sequence isolated from PK15 cells. The env gene of PERV-PK28/29 is almost identical (99.8%) to a PERV-B sequence described previously (accession no. Y12239) (37). Thus, pPERV-PK28/29 belongs to class B of PERV sequences. A single-nucleotide deletion (A, nt 5573) leads to a truncated pol ORF (nt 2729 to 6316) in pPERV-PK28/29.

As this PCR strategy was not optimal to fully clone and characterize different complete proviral PERV sequences which potentially could be replication competent, particularly as several copies exist in the infected human cell line 293 PERV-PK, genomic cloning was performed.

Generation and screening of a gene library. For the cloning of complete proviral PERV genomes, including both LTRs, a lambda  bacteriophage library of 293 PERV-PK DNA was generated. A total of 1.5 × 106 independent primary clones were obtained and screened with the PERV pro-pol probe. After three rounds of screening, six clones were purified to homogeneity. Restriction enzyme analyses of subcloned NotI inserts into pBS-KS revealed two identical clones [pPERV-B(34) and pPERV-B(41)]. A third and unclassified clone, pPERV-(46), was excluded from further analysis because of a truncated pol gene detected by PCR (not shown). Two of the four remaining clones, pPERV-B(33) and pPERV-B(43), were characterized in detail. Clone PERV-B(34) demonstrated a truncation in the env gene, and clone PERV-A(42), encompassing an env class A gene, has not yet been fully characterized.

Analysis of full-length PERV sequences and ORFs. The retroviral portions of pPERV-B(33) and pPERV-B(43) were sequenced and compared. PERV-B(33) and PERV-B(43) display proviral sequences of 8,918 and 8,750 bp, respectively (Fig. 3A). Only minor differences are evident throughout the retroviral genes, which show nucleotide and amino acid homologies of 99.8% (three nucleotide exchanges) and 99.8% (one amino acid exchange) for gag, 99.9% (five nucleotide exchanges) and 99.6% (five amino acid exchanges) for pro-pol, and 99.7% (five nucleotide exchanges) and 99.2% (five amino acid exchanges) for env (Table 1). According to their env sequences, both proviruses belong to PERV class B (37). PERV-B(33) and PERV-B(43) sequences show ORFs for all retroviral proteins in a type C-specific manner except for env in the case of PERV-B(33), in which the first putative start codon is mutated at nt 6191 from G to A (Fig. 3A). The nucleotide and amino acid homologies of PCR clone pPERV-PK28/29 and of genomic clone pPERV-B(33) are 99.6% (six nucleotide exchanges) and 99.0% (five amino acid exchanges) for gag, 99.8% (six nucleotide exchanges, one nucleotide deletion) and 99.7% (two amino acid exchanges, one frameshift) for pro-pol, and 99.7% (five nucleotide exchanges) and 99.2% (five amino acid exchanges) for env (Table 1). The env ORFs of pPERV-B(43) and pPERV-PK28/29 differ in only one codon (nt 8091, A to G, Ser versus Pro).


View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3.   Proviral organization of clones PERV-B(33) and PERV-B(43). (A) Proviral sequences are 8,918 and 8,760 bp long for PERV-B(33) and PERV-B(43), respectively. Genes and ORFs are shown as open boxes; the numbers indicate the first and last nucleotide in the PERV-B(33) and PERV-B(43) (in parentheses) sequences. A 39-bp repeat is found four times in the U3 element of the PERV-B(33) LTRs, whereas the PERV-B(43) LTRs harbor two 39-bp repeat elements. Cap, transcriptional start site; PBS, primer binding site (tRNAGly4); SD, splice donor; SA, splice acceptor; ppt, polypurine tract; p(A), poly(A) addition site. (B) Two mRNA species are expressed from proviral PERV. A full-length (8.3 kb) and a subgenomic (3.1 kb) env mRNA are indicated.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Comparison of nucleotide and amino acid sequences of PERV-B(33) and PERV-B(43) gag, pro-pol, and env ORFs with other viral genomesa

The existence of short ORFs preceding the gag gene, such as the one at nt 839 to 895, is known for several retroviruses (13). The ATG of the PERV-B(33) gag ORF is located at position 1154 (Fig. 3A). The entire encoded Gag sequence shows closest amino acid homology to the Gag of PERV-MSL (1) and of GaLV (18), 94.5 and 63.0%, respectively (Table 1). The sequence Asn1-Met1-Gly2-Gln3-Thr4 is identical to that of MoMLV (59) and PERV-MSL (1). Some highly conserved amino acid motifs for mammalian type C retroviruses are present in the Gag-Pol polyproteins of PERV-B(33) and PERV-B(43). Identical to the situation in PERV-MSL (1) and similar to other type C retroviruses, including GaLV (18) and BaEV (35), the consensus sequence for the N terminus of p30 starts at nt 1736 with a proline (48), and the C-terminal end is located at nt 2501 to 2512 (Thr-Lys-Ile-Leu). Amino acid comparisons with the p30 and p27 capsid proteins of other retroviruses revealed scores of 96.1% (PERV-MSL), 75.7% (GaLV), 68.2% (BaEV), 61.7% (FeLV), and 61.1% (MoMLV). A zinc finger motif consisting of the Cys-His box (Cys-Xaa2-Cys-Xaa4-His-Xaa4-Cys) located at nt 2630 to 2671 is a hallmark of the nucleic acid-binding protein (nucleocapsid, p10) of other type C retroviruses (29, 45).

The pro region encodes the protease, which cleaves the gag and pol polyproteins. The stop codon at position 2728 that separates the gag-pro-pol precursor is suppressed by a tRNA accepting glutamine and accounting for a readthrough (32). A highly conserved amino acid motif characteristic of aspartyl proteases is located at nt 2801 to 2824 (Leu-Val-Asp-Thr-Gly-Ala-Glu-His), demonstrating a six-of-eight amino acid match to the consensus sequence (13).

The tetrapeptide motif located at positions 3746 to 3757, YVDD, is highly conserved in many retroviruses, and the two aspartate residues of the common YXDD motif are invariant among all the RNA-dependent DNA and RNA polymerases (74). The PERV-B(33) Pro-Pol polyprotein shows closest homology with PERV-MSL (96.9%) and GaLV (68%), whereas MLV displays scores of 64% at the nucleotide and 62% at the amino acid level (Table 1). The 3' end of the pol ORF coding for RT and integrase (nt 6316) overlaps the 5' coding region of the env gene starting at nt 6189.

The cleavage site between the surface protein gp70 and the transmembrane protein p15E predicted by Le Tissier et al. (37) is located downstream of the Arg-Pro-Lys-Arg sequence at nt 7565 in pPERV-B(33). The env gene is followed by a polypurine tract (nt 8199 to 8211) upstream of the 3' LTR (Fig. 3A). The results of comparisons of PERV-B(33) sequences with the genes of other retroviruses are summarized in Table 1.

No significant homologies of PERV with human endogenous retroviral (HERV) type C-like sequences were found. With regard to putative recombination events, however, partial homologies of PERV-B(33) env (nt 6157 to 6196) with ERV-3 (HERV-R) pol-env sequences (nt 293 to 332) (accession no. M12140) (14) are noteworthy.

PERV LTRs. The LTRs of pPERV-B(33) and pPERV-B(43) are limited by the inverted repeat sequence TGAAAGG/CCTTTCA. The LTRs differ in the length of the U3 element. A 39-bp sequence motif exists four times in the PERV-B(33) LTR (nt 331 to 369, 370 to 408, 409 to 447, and 448 to 486) and two times in the PERV-B(43) LTR (Fig. 3A). Part of this repeated sequence consists of an 18-bp segment which precedes the quadruplex/duplex stretch at nt 313 to 330. A comparison with the PERV-MSL LTR (1) reveals, after reconstitution of the appropriate cDNA portions, an overall homology of 70%. However, in the PERV-MSL LTR, only one copy of the 39-bp motif (five nt exchanges) exists, which is flanked on each side by a single 18-bp segment. Extensive homology is also found downstream of this sequence in the PERV-MSL U3 element. A retroviral TATA box demonstrating a sequence context homologous to other promoters (28) is present at nt 517. The R region is located at nt 546 to 624, followed by the U5 element (nt 625 to 707) in the PERV-B(33) LTR. These elements show extended or partial homologies with the corresponding sequences of the PERV-MSL and GaLV LTRs. A MatInspector analysis (Genomatix, Munich, Germany) revealed a primer binding site at nt 710 to 727 that is complementary to the last 18 nt at the 3' end of a tRNAGly4. By contrast, PERV-MSL encompasses a tRNAPro sequence (1). A polyadenylation signal consensus sequence (AATAAA) is located at nt 8811 to 8816 in PERV-B(33) (Fig. 3A).

RNA expression pattern of PERV. Total RNA and mRNA from uninfected 293, 293 PERV-PK, PK15, and GH (a human teratocarcinoma cell line) cells were hybridized in a Northern blot analysis with different probes. Full-length transcripts of ~8.3 kb were found with the pro-pol probe for the 293 PERV-PK and the PK15 cell lines (Fig. 4A). According to the beta -actin control hybridization, mRNA steady-state levels of (polytropic) PERV expressed in 293 cells are higher than those in PK15 cells (Fig. 4A). With a U5-specific probe, a genomic RNA of ~8.3 kb and a subgenomic transcript of ~3.1 kb were found in 293 PERV-PK and at lower steady-state levels in PK15 cells (Fig. 4B). The specificity of the probes used was confirmed by the absence of hybridizing RNAs in uninfected 293 cells and GH cells (Fig. 4).


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 4.   PERV RNA expression pattern. Northern blot analysis of total RNA (A) and oligo(dT)-selected RNA (B) from different cell lines. Equal amounts of RNA were separated on sodium phosphate-agarose gels, transferred to nylon membranes, and hybridized with a radiolabeled pro-pol probe (A) and with a U5 probe (B). A beta -actin probe served as a control (lower panels). Lane 1, human kidney cell line 293; lane 2, 293 cells infected with PERV; lane 3, porcine kidney cell line PK15; lane 4, human teratocarcinoma cell line GH. A full-length transcript of about 8.3 kb is indicated (arrows). A subgenomic env transcript of ~3.1 kb hybridizes with the U5 probe (arrowhead in panel B). RNA prepared from uninfected 293 cells and the human teratocarcinoma cell line GH served as negative controls.

Identification of the transcription start site. To map the cap site of PERV mRNA, a combination of two RT-PCR-based methods was performed. The 5'RACE products generated with an anchor primer in combination with the gene-specific primer PK26-R were cloned and sequenced. The 5'RACE product ended at position 569 (not shown). For the exact determination of the transcriptional start site, a primer extension analysis was carried out. An RT-PCR was performed with the oligonucleotide PK-REV-PE, derived from the 5'RACE sequence. The same primer was used in a regular Sanger sequencing reaction. As shown in Fig. 5, the RT-PCR product identified the cap site at nt 545 (see also Fig. 3A).


View larger version (62K):
[in this window]
[in a new window]
 
FIG. 5.   Identification of the transcription initiation site of PERV mRNA. Polyadenylated RNA prepared from the cell line 293 PERV-PK was reverse transcribed using the 32P-end-labeled oligonucleotide PERV-PK-REV. The cDNA was separated by SDS-6% PAGE together with a four-lane Sanger sequencing reaction performed with the same unlabeled primer and the cloned 5' LTR (pPERV-PK26/34) as the template. Two to three end-labeled transcripts were detected on the autroradiograph. The cap site was assigned to nt 545 (C) in the PERV-B(33) LTR (arrows). The lower-strand sequence is given on the left side.

Identification of splice donor and acceptor sites. The splice donor and splice acceptor sites which trigger the expression of the subgenomic PERV env mRNA were experimentally determined. A PCR with an elongation step of 60 s preferentially amplified subgenomic transcripts using 293 PERV-PK cDNA with the primers PERV-PBS and env-R. After sequencing a ~390-bp product, a junction of CTTGGAGCCTCT was revealed, demonstrating that the splice donor and the corresponding splice acceptor sites are located at nt 766 (A) and at nt 5950 (G), respectively (data not shown). All mapping results are summarized in Fig. 3A. Based on these analyses, the theoretical size of the env transcript of 3.1 kb corresponded to the experimentally defined subgenomic mRNA (Fig. 3 and 4B).

Transfection and infection studies. To functionally characterize proviral sequences, plasmids pPERV-B(33), pPERV-B(33)/ATG, and pPERV-B(43) were repeatedly transfected in triplicate into 1 × 105 to 3 × 105 293 cells. Plasmid pPERV-B(33)/ATG, harboring a restored env start codon at nt 6189, was constructed to investigate potential differences in retroviral replication, since the first ATG in the env gene of pPERV-B(33) is located at position 6693, whereas the env start codon in PERV-PK28/29 and in the previously published PERV-B env sequence (37) is located 504 bp upstream at nt 6189, similar to PERV-B(43).

The replacement of the 1,325-bp BsrGI fragment (nt 5920 to 7245) derived from pPERV-PK28/29 introduced four nucleotide and amino acid exchanges in the env ORF of PERV-B(33), at nt 6191 (Ile to Met), nt 6562 (Asp to Gly), nt 6568 (Gly to Glu), and nt 7005 (Ser to Pro).

As an initial marker of PERV expression, retroviral Gag proteins were detected by indirect immunofluorescence with cross-reacting FeLV CA antiserum. At 24 to 48 h p.t., 20 to 50% of cells transfected with pPERV-B(33), pPERV-B(33)/ATG, and pPERV-B(43) demonstrated Gag staining (not shown). In parallel cultures, 293 cells transfected with pPERV-B(43) and pPERV-B(33)/ATG showed RT activities in cell-free supernatants after 12 to 14 days (not shown). Those cultures were maintained and analyzed at regular time points. At 6 to 12 weeks p.t., all cells transfected with pPERV-B(43) and pPERV-B(33)/ATG stained positive for Gag (Fig. 6A). These PERV-expressing cells released virion-bound RT at levels of 600 to 900 mU/ml (Fig. 6B). The 293 PERV-PK cells used as a positive control gave RT activities of 1,800 mU/ml in cell-free supernatants (Fig. 6B). Purified virus particles from those cultures were positive for the capsid protein (p30) by immunoblotting with FeLV CA antiserum (Fig. 6C). PCR analyses revealed integration of proviral DNA as demonstrated for pol (Fig. 6D) and env sequences (not shown). Cell-free supernatants from those particle-producing cultures were used to transfer PERV to fresh 293 cells. Similar to the transfection experiments, indirect immunofluorescence analysis showed Gag expression 24 to 48 h postinfection, and RT assays became positive at 10 to 14 days postinfection (not shown), demonstrating that pPERV-B(43) and pPERV-B(33)/ATG encode infectious retroviruses. Those virus transfers were continued serially on 293 cells every 4 weeks for up to 6 months (not shown). On the other hand, weak RT activities in pPERV-B(33) Gag-expressing cultures were found only transiently after transfection (not shown), and virions could not be transmitted to fresh 293 cells.


View larger version (52K):
[in this window]
[in a new window]
 
FIG. 6.   Analysis of retrovirus expression after transfection of molecular clones PERV-B(33) and PERV-B(43). (A) Indirect immunofluorescence analysis of PERV Gag expression 12 weeks p.t. using cross-reacting FeLV CA antiserum. Molecular clones PERV-B(33)/ATG and PERV-B(43) in 293 cells were used at 12 weeks p.t.; uninfected 293 cells and 293 cells productively infected with PERV derived from PK15 (293 PERV-PK) served as controls. Expression of Gag from PERV-B(33)/ATG and PERV-B(43) was detected as early as 24 h p.t. in 20 to 50% of cells (not shown). (B) RT activities in cell-free supernatants 12 weeks p.t. RT produced by PERV-B(33)/ATG and PERV-B(43) was detected as early as 12 to 14 days p.t. (not shown). The controls were the same as in A. (C) Immunoblot analysis of PERV Gag proteins. Sucrose gradient-purified particles from PERV-producing cells [PERV-B(33)/ATG and PERV-B(43) at 12 weeks p.t.] were separated by SDS-PAGE. The p30 capsid protein (arrow) cross-reacts with FeLV CA antiserum. Lane 1, PERV-B(33)/ATG; lane 2, PERV-B(43); lane 3, 293 cell line; lane 4, 293 PERV-PK cell line. The positions of molecular mass markers are indicated (in kilodaltons). (D) DNA PCR of PERV pro-pol sequences demonstrating integration of proviral PERV sequences. Lane 1, PERV-B(33)/ATG; lane 2, PERV-B(43); lane 3, 293 cell line; lane 4, 293 PERV-PK cell line. The arrow marks an 812-bp amplification product obtained with primers PK45 and PK47. Lane M, molecular size markers (1-kb ladder; Life Technologies).

In addition, HeLa cells were transfected with the three recombinant PERV plasmids. Retroviral Gag expression was seen in 10 to 20% of cells 24 to 48 h p.t. However, even over longer periods of cultivation, no RT activity was found, and the number of Gag-expressing cells decreased even though integration of proviral PERV sequences was found (not shown).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

As demonstrated by the almost complete cloning of a PERV-C proviral sequence (PERV-MSL [1]), the pig genome harbors intact copies of PERV. Those elements are not merely pig endogenous retroviral sequences, as suggested earlier (57), for some of those endogenous retroviral sequences encode replication-competent retroviruses similar to those present in normal chickens, cats, baboons, and several strains of mice (71).

PERV-B sequences encode infectious particles. This report presents the first structural and functional description of complete PERV-B sequences with replicative capacities. Both proviruses [PERV-B(33) and PERV-B(43)] were isolated from a human 293 cell line productively infected with PERV-PK which harbors at least four additional PERV sequences isolated by genomic and PCR cloning.

The capacity of PERV-B(43) to produce infectious viral particles was directly shown after transfection of cloned proviral sequences into human cells and subsequent serial passaging on human 293 cells (Fig. 6). The second proviral genome, PERV-B(33), was presumed to be defective due to a point mutation in the env start codon, generating a Met-to-Ile mutation. For this reason, the codon was genetically restored by replacement with a homologous sequence derived from the PCR clone PERV-PK28/29. After transfection of this proviral construct, PERV-B(33)/ATG was able to produce infectious particles which were serially passaged on human 293 cells. On the other hand, no infectious and replication-competent virus was found after transfection of PERV-B(33). It should be mentioned, however, that in addition to the introduction of ATG, there are four predicted amino acid differences between the two molecular clones, and the contribution of any or all of these changes to the defective nature of PERV-B(33) and rescue by exchange of the fragment from pPERV-PK28/29 was not evaluated.

For endogenous MLVs, four classes of sequences have been described (61). The MLV env sequence of the prototype polytropic proviral clone MX27 exhibits the same methionine-to-isoleucine mutation of the start codon as PERV-B(33). Those sequences and members of the modified polytropic endogenous MLV class, however, can contribute their env genes to the observed recombinant viruses derived from distinct parental MLV (61). Therefore, given the fact that PERV-B(33) preexisted in this form in the pig genome, it is conceivable that this sequence is involved in recombination events of PERV sequences and/or that gene mutations can lead to expression of replication-competent pig retroviruses. It seems likely, however, that PERV-B(33), in addition to the defective clones PERV-PK28/29, PERV-B(34), and PERV-(46), which was not further classified, was integrated into the 293 host genome via cross-packaging of viral RNA derived from PK-15 cells and subsequent RT after infection of 293 cells by PERV particles. In this context, it cannot be completely excluded that the single-nucleotide deletion in pol of the amplified sequence of clone PERV-PK28/29 was generated by a PCR artifact, even though we used polymerases with proofreading activity.

PERV host range. The host range and cell tropism of retroviruses mainly depend on the env gene. Two of three distinct PERV can infect some human cells in culture (37, 52, 63, 72). However, these reports did not address the entire genetic context of proviral PERV, and the main conclusions were drawn from pseudotype experiments with PERV type A, B, and C env genes cloned into MLV-based retroviral backbones (63, 73). These data suggest that different receptors exist on susceptible cells (37, 63), although the receptors have not yet been identified on cells from nonhuman primates, suggesting that primate xenotransplantation models may not be appropriate for the study of PERV zoonosis (60, 63). In this study, we have shown that two full-length molecular clones of the PERV-B class can replicate on human cells. So far, we do not know whether PERV-A viruses which demonstrate the same functional properties exist. Our preliminary investigations of one isolated clone [PERV-A(42)], based on sequence analysis, however, suggest a similar potential (not shown).

In addition, the promoter activity of LTRs and other regulatory factors is important for the host range. The use of defined LTRs from functional PERV in reporter gene studies will allow analysis of cell and tissue specificities in addition to the host range and interference studies (63). The U3 regions of the PERV-B(33) and PERV-B(43) LTRs differ in the numbers of a 39-bp repeat that are present. Our first studies indicate significantly different promoter activities of these LTRs in human cells. As no steroid hormone-responsive element or NF-kappa B sites could be found in the PERV-B(33) or PERV-B(43) LTRs, it remains to be shown whether immunosuppressive drugs such prednisolone and cyclosporin A have a direct or indirect effect on LTR activities.

Putative impact of replication-competent PERV in xenotransplantation. The different pig breeds studied so far harbor different sets and distinct numbers of PERV copies in their genomes (1, 37). For miniature swine inbred for major histocompatibility complex loci, it was shown that PERV-MSL exists in multiple copies but that some individuals apparently harbor additional proviral loci (1), a phenomenon which could be explained by new infections, genetic recombination, or retrotransposition of transcriptionally active PERV in the minipig genome. Furthermore, mRNA expression of PERV in different porcine tissues has been reported (1, 52). Significant steady-state levels have been shown for PBMC, spleen, thymus, lymph node, and lung, where full-length and subgenomic RNAs were found (1). These patterns of expression are identical to those observed in PK15 and in 293 PERV-PK cells (1) (Fig. 4).

In recent retrospective analyses of xenotransplanted human patients, no evidence was found for expression, infection, and replication of PERV in the human host (33, 49, 51). Even though these reports are somewhat reassuring with regard to safety, particularly as PERV replicates even in permissive tissue culture cells to relatively low titers (63), it has to be stated that (i) no long-term xenotransplantation of physiologically functional pig tissues has been achieved so far and (ii) no vascularized pig organs have been successfully used in human patients. Therefore, although these studies found no evidence of a risk, they do not rule out that a risk exists (70). An additional level of risk has been pointed out which arises from the presence of HERV in human transplant recipients and the subsequent chance of recombination with PERV yielding viruses with new properties (70). It has to be stated that no HERV with replicative capacities has been identified so far (39). For instance, in the HERV-K family, which comes closest of all known HERV to encoding infectious virus, no corresponding replication-competent virus could be found in the human genome (66). Nevertheless, expression of types B and D HERV-K full-length mRNAs was observed in numerous tissues (40). As PERV belong to the C-type retroviruses, related HERV sequences might offer targets for recombination. ERV-3 (HERV-R) is a defective C-type provirus that is selectively expressed during differentiation of placental syncytiotrophoblasts and elicits mass production of a nonglycosylated and unprocessed 65-kDa ENV protein in this tissue (68), a phenotype which seems to be dispensable in humans (19). Thus, even if genetic recombination occurred, based on the limited sequence homologies in env, a resulting recombinant PERV-HERV might not gain any advantageous functions.

The aim of establishing long-term xenotransplantation and the presence of infectious PERV and other unknown agents make it necessary to closely monitor animal donors, human recipients, and their contacts in prospective xenotransplantation trials. This will enable a comprehensive evaluation of the risks of cross-species transmission of microorganisms, as suggested previously (47, 60). Even though PERV do not replicate as efficiently as polytropic murine and feline ERV in human cells (37, 52), the possibility remains that PERV or recombined viruses could infect xenograft recipients (70) and, like their closest viral relatives MLV, FeLV, and GaLV, cause leukemic diseases. Besides PERV, other new horizontally transmissible viruses of swine, including hepatitis viruses and herpesviruses, have recently been discovered (22, 43, 44), adding to the list of putative human pathogens. Therefore, regulatory frameworks similar to those set up by the U.S. Food and Drug Administration (U.S. Department of Health and Human Services, Public Health Service guideline on infectious disease issues in xenotransplantation, Fed. Register vol. 61, no. 185, 23 September 1996, p. 49920-49949, http://www.fda.gov/cber/xeno.pdf) and the United Kingdom Xenotransplantation Interim Regulatory Authority (U.K. Xenotransplantation Interim Regulatory Authority, Draft report of the infection surveillance steering group, 7 July 1999, http://www.open.gov.uk/doh/ukxira.htm) are needed to help to provide pathogen-free pigs for xenotransplantation.

Specific tools for detection of PERV expression and replication have been established, including nucleic acid and immunologic assays (33, 49, 51). We have generated PERV-specific antisera and have expressed recombinant PERV proteins in order to unequivocally distinguish those viruses from other agents (U. Krach, N. Fischer, F. Czauderna, R. Kurth, and R. R. Tönjes, submitted for publication).

Should methods such as knock-out technology become available for pigs in the future, inherited genes, including vertically transmitted PERV, could be eliminated. Functional characterization and genetic mapping of replication-competent endogenous retroviruses, including those PERV presented here, will help eliminate functional proviruses from transplant donor animals or at least allow the expression of these PERV classes to be controlled.


    ACKNOWLEDGMENTS

This study was supported by a grant from the German Ministry of Health (Bundesministerium für Gesundheit), Bonn, Germany.

The technical assistance of Gundula Braun is gratefully acknowledged. We thank Joachim Denner and Steve Norley for helpful discussions and review of the manuscript.


    FOOTNOTES

* Corresponding author. Mailing address: Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, D-63225 Langen, Germany. Phone: 49 6103 775304. Fax: 49 6103 771255. E-mail: toera{at}pei.de.

dagger Present address: Atugen Biotechnology AG, D-13125 Berlin, Germany.

Dagger Present address: Robert-Koch-Institut, D-13353 Berlin, Germany.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Akiyoshi, D. E., M. Denaro, H. Zhu, J. L. Greenstein, P. T. Banerjee, and J. A. Fishman. 1998. Identification of a full-length cDNA for an endogenous retrovirus of minature swine. J. Virol. 72:4503-4507[Abstract/Free Full Text].
2. Allan, J. S. 1996. Xenotransplantation at a crossroads: prevention versus progress. Nat. Med. 2:18-21[CrossRef][Medline].
3. Armstrong, J. A., J. S. Porterfield, and A. T. D. Madrid. 1971. C-type virus particles in pig kidney cell lines. J. Gen. Virol. 10:195-198[Abstract/Free Full Text].
4. Bach, F. H., S. C. Robson, H. Winkler, C. Ferran, K. M. Stuhlmeier, C. J. Wrighton, and W. W. Hancock. 1995. Barriers to xenotransplantation. Nat. Med. 1:869-873[CrossRef][Medline].
5. Battini, J. L., O. Danos, and J. M. Heard. 1995. Receptor-binding domain of murine leukemia virus envelope glycoproteins. J. Virol. 69:713-719[Abstract/Free Full Text].
6. Battini, J. L., J. M. Heard, and O. Danos. 1992. Receptor choice determinants in the envelope glycoproteins of amphotropic, xenotropic, and polytropic murine leukemia viruses. J. Virol. 66:1468-1475[Abstract/Free Full Text].
7. Benveniste, R. E., and G. J. Todaro. 1973. Homology between type-C viruses of various species as determined by molecular hybridization. Proc. Natl. Acad. Sci. USA 70:3316-3320[Abstract/Free Full Text].
8. Breese, S. S., Jr. 1970. Virus-like particles occurring in cultures of stable pig kidney cell lines. Arch. Gesamte Virusforsch. 30:401-404[CrossRef][Medline].
9. Breimer, M. E., E. Björck, C. T. Svalander, A. Bengtsson, L. Rydberg, K. Lie-Karlsen, P.-O. Attman, M. Aurell, and B. E. Samuelsson. 1996. Extracorporeal ("ex vivo") connection of pig kidneys to humans. I. Clinical data and studies of platelet destruction. Xenotransplantation 3:328-339.
10. Butler, D. 1999. FDA warns on primate xenotransplants. Nature 398:549[Medline].
11. Chapman, L. E., T. M. Folk, D. R. Salomon, A. P. Patterson, T. E. Eggerman, and P. D. Noguchi. 1995. Xenotransplantation and xenogeneic infections. N. Engl. J. Med. 333:1498-1501[Free Full Text].
12. Chari, R. S., B. H. Collins, J. C. Magee, J. M. DiMaio, A. D. Kirk, R. C. Harland, R. L. McCann, J. L. Platt, and W. C. Meyers. 1994. Treatment of hepatic failure with ex vivo pig-liver perfusion followed by liver transplantation. N. Engl. J. Med. 331:234-237[Free Full Text].
13. Coffin, J. 1996. Retroviridae: the viruses and their replication, p. 1767-1847. In B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Hagerstown, Md.
14. Cohen, M., M. D. Power, C. O'Connell, and N. Kato. 1985. The nucleotide sequence of the env gene from the human provirus ERV3 and isolation and characterization of an ERV3-specific cDNA. Virology 147:449-458[CrossRef][Medline].
15. Cozzi, E., and D. J. G. White. 1995. The generation of transgenic pigs as potential organ donors for humans. Nat. Med. 1:964-966[CrossRef][Medline].
16. Cramer, D. V. 1995. The use of xenografts for acute hepatic failure. Transplant. Proc. 27:80-82[Medline].
17. Deacon, T., J. Schumacher, J. Dinsmore, C. Thomas, P. Palmer, S. Kott, A. Edge, D. Penny, S Kassissieh, P. Dempsey, and O. Isacson. 1997. Histological evidence of fetal pig neural cell survival after transplantation into a patient with Parkinson's disease. Nat. Med. 3:350-353[CrossRef][Medline].
18. Delassus, S., P. Sonigo, and S. Wain-Hobson. 1989. Genetic organization of gibbon ape leukemia virus. Virology 173:205-213[CrossRef][Medline].
19. De Parseval, N., and T. Heidmann. 1998. Physiological knockout of the envelope gene of the single-copy ERV-3 human endogenous retrovirus in a fraction of the caucasian population. J. Virol. 72:3442-3445[Abstract/Free Full Text].
20. Doenecke, D., and R. Tönjes. 1986. Differential distribution of lysine and arginine residues in the closely related histones H1o and H5: analysis of a human H1o gene. J. Mol. Biol. 187:461-464[CrossRef][Medline].
21. Donahue, P. R., E. A. Hoover, G. A. Beltz, N. Riedel, V. M. Hirsch, J. Overbaugh, and J. I. Mullins. 1988. Strong sequence conservation among horizontally transmissible, minimally pathogenic feline leukemia viruses. J. Virol. 62:722-731[Abstract/Free Full Text].
22. Ehlers, B., S. Ulrich, and M. Goltz. 1999. Detection of two novel porcine herpesviruses with high similarity to gammaherpesviruses. J. Gen. Virol. 80:971-978[Abstract].
23. Fishman, J. A. 1994. Miniature swine as organ donors for man: strategies for prevention of xenotransplant-associated infectiuons. Xenotransplantation 1:47-57.
24. Fishman, J. A. 1997. Xenosis and xenotransplantation: addressing the infectious risks posed by an emerging technology. Kidney Int. 51(Suppl. 58):S41-S45.
25. Fodor, W. L., B. L. Williams, L. A. Matis, J. A. Madri, S. A. Rollins, J. W. Knight, W. Velander, and S. P. Squinto. 1994. Expression of a human complement inhibitor in a transgenic pig as a model for the prevention of xenogeneic hyperacute rejection. Proc. Natl. Acad. Sci. USA 91:11153-11157[Abstract/Free Full Text].
26. Gao, F., E. Bailes, D. L. Robertson, Y. Chen, C. M. Rodenburg, S. F. Michael, L. B. Cummins, L. O. Arthur, M. Peeters, G. M. Shaw, P. M. Sharp, and B. H. Hahn. 1999. Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes. Nature 397:436-441[CrossRef][Medline].
27. Gao, F., L. Yue, A. T. White, P. G. Pappas, J. Barchue, A. P. Hanson, B. M. Greene, P. M. Sharp, G. M. Shaw, and B. H. Hahn. 1992. Human infection by genetically diverse SIVSM-related HIV-2 in west Africa. Nature 358:495-499[CrossRef][Medline].
28. Golemis, E. A., N. A. Speck, and N. Hopkins. 1990. Alignment of U3 region sequences of mammalian type C viruses: identification of highly conserved motifs and implications for enhancer design. J. Virol. 64:534-542[Abstract/Free Full Text].
29. Green, L. M., and J. M. Berg. 1989. A retroviral Cys-Xaa2-Cys-Xaa4-His-Xaa4-Cys peptide binds metal ions: spectroscope studies and a proposed three-dimensional structure. Proc. Natl. Acad. Sci. USA 86:4047-4051[Abstract/Free Full Text].
30. Greenstein, J. L., and D. H. Sachs. 1997. The use of tolerance for transplantation across xenogeneic barriers. Nat. Biotechnol. 15:235-238[CrossRef][Medline].
31. Groth, C. G., O. Korsgren, A. Tibell, J. Tollemar, E. Möller, J. Bolinder, J. Östman, F. P. Reinholt, C. Hellerström, and A. Andersson. 1994. Transplantation of porcine fetal pancreas to diabetic patients. Lancet 344:1402-1404[CrossRef][Medline].
32. Harada, F., G. G. Peters, and J. E. Dahlberg. 1979. The primer tRNA for Moloney leukemia virus DNA synthesis. J. Biol. Chem. 254:10979-10985[Abstract/Free Full Text].
33. Heneine, W., A. Tibell, W. M. Switzer, P. Sandstrom, G. V. Rosales, A. Mathews, O. Korsgen, L. E. Chapman, T. M. Folks, and C. G. Roth. 1998. No evidence of infection with porcine endogenous retrovirus in recipients of porcine islet-cell xenografts. Lancet 352:695-699[CrossRef][Medline].
34. Holmes, G. P., L. E. Chapman, J. A. Steward, S. E. Straus, J. K. Hilliard, and D. S. Davenport. 1995. The B virus working group: guidelines for the prevention and treatment of B-virus in exposed persons. Clin. Infect. Dis. 20:412-439.
35. Kato, S., K. Matsuo, N. Nishimura, N. Takahashi, and T. Takano. 1987. The entire nucleotide sequence of baboon endogenous virus DNA: a chimeric genome structure of murine type C and simian type D retroviruses. Jpn. J. Genet. 62:127-137.
36. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685[CrossRef][Medline].
37. Le Tissier, P., J. P. Stoye, Y. Takeuchi, C. Patience, and R. A. Weiss. 1997. Two sets of human-tropic pig retroviruses. Nature 389:681-682[CrossRef][Medline].
38. Lieber, M. M., C. J. Scherr, R. E. Benveniste, and G. J. Todaro. 1975. Biologic and immunologic properties of porcine type C viruses. Virology 66:616-619[CrossRef][Medline].
39. Löwer, R., J. Löwer, and R. Kurth. 1996. The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences. Proc. Natl. Acad. Sci. USA 93:5177-5184[Abstract/Free Full Text].
40. Löwer, R., R. R. Tönjes, K. Boller, J. Denner, B. Kaiser, R. C. Phelps, J. Löwer, R. Kurth, K. Badenhoop, H. Donner, K. H. Usadel, T. Miethke, M. Lapatschek, and H. Wagner. 1998. Development of insulin-dependent diabetes mellitus does not depend on specific expression of the human endogenous retrovirus HERV-K. Cell 95:11-14[CrossRef][Medline].
41. Martin, U., V. Kiessi, J. H. Blusch, A. Haverich, K. von der Helm, T. Herden, and G. Steinhoff. 1998. Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet 352:692-694[CrossRef][Medline].
42. McCurry, K. R., D. L. Kooyman, C. G. Alvarado, A. H. Cotterell, M. J. Martin, J. S. Logan, and J. L. Platt. 1995. Human complement regulatory proteins protect swine-to-primate cardiac xenografts from humoral injury. Nat. Med. 1:423-427[CrossRef][Medline].
43. Meng, X.-J., R. H. Purcell, P. G. Halbur, J. R. Lehman, D. M. Webb, T. S. Tsareva, J. S. Haynes, B. J. Thacker, and S. U. Emerson. 1997. A novel virus in swine is closely related to the human hepatitis E virus. Proc. Natl. Acad. Sci. USA 94:9860-9865[Abstract/Free Full Text].
44. Meng, X.-J., P. G. Halbur, M. S. Shapiro, S. Govindarajan, J. D. Bruna, I. K. Mushahwar, R. H. Purcell, and S. U. Emerson. 1998. Genetic and experimental evidence for cross-species infection by swine hepatitis E virus. J. Virol. 72:9714-9721[Abstract/Free Full Text].
45. Meric, C., and S. P. Goff. 1989. Characterization of Moloney murine leukemia virus mutants with single-amino-acid substitutions in the Cys-His box of the nucleocapsid protein. J. Virol. 63:1558-1568[Abstract/Free Full Text].
46. Michaels, M. G., and R. L. Simmons. 1994. Xenotranplant-associated zoonoses. Transplantation 57:1-7[Medline].
47. Onions, D., D. Hart, C. Mahoney, D. Galbraith, and K. Smith. 1998. Endogenous retroviruses and the safety of porcine xenotransplantation. Trends Microbiol. 6:430-431[CrossRef].
48. Oroszlan, S., T. D. Copeland, R. V. Gilden, and G. J. Todaro. 1981. Structural homology of the major internal proteins of endogenous type C viruses of two distantly related species of Old World monkeys, Macaca arctoides and Colobos polykomos. Virology 115:262-271[CrossRef][Medline].
49. Paradis, K., G. Langford, Z. Long, W. Heneine, P. Sandstrom, W. M. Switzer, L. E. Chapman, C. Lockey, D. Onions, The XEN 111 Study Group, and E. Otto. 1999. Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue. Science 285:1236-1241[Abstract/Free Full Text].
50. Parker, W., D. Bruno, Z. E. Holzknecht, and J. L. Platt. 1994. Characterization and affinity isolation of xenoreactive human natural antibodies. J. Immunol. 153:3791-3803[Abstract].
51. Patience, C., G. S. Patton, Y. Takeuchi, R. A. Weiss, M. O. McClure, L. Rydberg, and M. E. Breimer. 1998. No evidence of pig DNA or retroviral infection in patients with short-term extracorporal connection to pig kidneys. Lancet 352:699-701[CrossRef][Medline].
52. Patience, C., Y. Takeuchi, and R. A. Weiss. 1997. Infection of human cells by an endogenous retrovirus of pigs. Nat. Med. 3:282-286[CrossRef][Medline].
53. Ryan, U. S. 1995. Complement inhibitory therapeutics and xenotransplantation. Nat. Med. 1:967-968[CrossRef][Medline].
54. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
55. Sandrin, M. S., W. L. Fodor, E. Mouhtouris, N. Osman, S. Cohney, S. A. Rollins, E. R. Guilmette, E. Setter, S. P. Squinto, and I. F. McKenzie. 1995. Enzymatic remodelling of the carbohydrate surface of a xenogeneic cell substantially reduces human antibody binding and complement mediated cytolysis. Nat. Med. 1:1261-1267[CrossRef][Medline].
56. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].
57. Schumacher, J. M., and O. Isaacson. 1997. Neuronal xenotransplantation in Parkinson's disease. Nat. Med. 3:474-475.
58. Sharma, A., J. Okabe, P. Birch, S. B. McClellan, M. J. Martin, J. L. Platt, and J. S. Logan. 1996. Reduction in the level of Gal (alpha1,3) Gal in transgenic mice and pigs by the expression of an alpha (1,2) fucosyltransferase. Proc. Natl. Acad. Sci. USA 93:7190-7195[Abstract/Free Full Text].
59. Shinnick, T. M., R. A. Lerner, and J. G. Sutcliff. 1981. Nucleotide sequence of Moloney murine leukemia virus. Nature 293:543-548[CrossRef][Medline].
60. Stoye, J. P. 1998. No clear answers on safety of pigs as tissue donor source. Lancet 352:666-667[CrossRef][Medline].
61. Stoye, J. P., and J. M. Coffin. 1987. The four classes of endogenous murine leukemia virus: structural relationships and potential for recombination. J. Virol. 61:2659-2669[Abstract/Free Full Text].
62. Stoye, J. P., and J. M. Coffin. 1995. The dangers of xenotransplantation. Nat. Med. 1:1100[Medline].
63. Takeuchi, Y., C. Patience, S. Magre, R. A. Weiss, P. T. Banerjee, P. Le Tissier, and J. P. Stoye. 1998. Host range and interference studies of three classes of pig endogenous retrovirus. J. Virol. 72:9986-9991[Abstract/Free Full Text].
64. Tönjes, R. R., C. Limbach, R. Löwer, and R. Kurth. 1997. Expression of human endogenous retrovirus type K envelope glycoprotein in insect and mammalian cells. J. Virol. 71:2747-2756[Abstract/Free Full Text].
65. Tönjes, R. R., K. Boller, C. Limbach, R. Lugert, and R. Kurth. 1997. Characterization of human endogenous retrovirus type K virus-like particles generated from recombinant baculoviruses. Virology 233:280-291[CrossRef][Medline].
66. Tönjes, R. R., F. Czauderna, and R. Kurth. 1999. Genome wide screening, cloning, chromosomal assignment and expression of full-length human endogenous retrovirus type K (HERV-K). J. Virol. 73:9187-9195[Abstract/Free Full Text].
67. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354[Abstract/Free Full Text].
68. Venables, P. J. W., S. M. Brookes, D. Griffiths, R. A. Weiss, and M. T. Boyd. 1995. Abundance of an endogenous retroviral envelope protein in placental trophoblasts suggests a biological function. Virology 211:589-592[CrossRef][Medline].
69. Weiss, R. A. 1998. Transgenic pigs and virus adaptation. Nature 391:327-328[CrossRef][Medline].
70. Weiss, R. A. 1999. Xenograft and retroviruses. Science 285:1221-1222[Free Full Text].
71. Weiss, R. A., N. M. Teich, H. E. Varmus, and J. Coffin (ed.). 1985. RNA tumor viruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
72. Wilson, C. A., S. Wong, J. Muller, C. E. Davidson, T. M. Rose, and P. Burd. 1998. Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. J. Virol. 72:3082-3087[Abstract/Free Full Text].
73. Wilson, C. A., S. Wong, M. van Brocklin, and M. J. Federspiel. 2000. Extended analysis of the in vitro tropism of porcine endogenous retrovirus. J. Virol. 74:49-56[Abstract/Free Full Text].
74. Xiong, Y., and T. H. Eickbush. 1990. Origin and evolution of retroelements based upon their reverse transcriptase sequences. EMBO J. 9:3353-3362[Medline].


Journal of Virology, May 2000, p. 4028-4038, Vol. 74, No. 9
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Moalic, Y., Blanchard, Y., Felix, H., Jestin, A. (2006). Porcine Endogenous Retrovirus Integration Sites in the Human Genome: Features in Common with Those of Murine Leukemia Virus. J. Virol. 80: 10980-10988 [Abstract] [Full Text]  
  • Niebert, M., Tonjes, R. R. (2005). Evolutionary Spread and Recombination of Porcine Endogenous Retroviruses in the Suiformes. J. Virol. 79: 649-654 [Abstract] [Full Text]  
  • Bartosch, B., Stefanidis, D., Myers, R., Weiss, R., Patience, C., Takeuchi, Y. (2004). Evidence and Consequence of Porcine Endogenous Retrovirus Recombination. J. Virol. 78: 13880-13890 [Abstract] [Full Text]  
  • Misseri, Y., Cerutti, M., Devauchelle, G., Bucheton, A., Terzian, C. (2004). Analysis of the Drosophila gypsy endogenous retrovirus envelope glycoprotein. J. Gen. Virol. 85: 3325-3331 [Abstract] [Full Text]  
  • Scobie, L., Taylor, S., Logan, N. A., Meikle, S., Onions, D., Patience, C., Quinn, G. (2004). Characterization of germline porcine endogenous retroviruses from Large White pig. J. Gen. Virol. 85: 2421-2428 [Abstract] [Full Text]  
  • Scobie, L., Taylor, S., Wood, J. C., Suling, K. M., Quinn, G., Meikle, S., Patience, C., Schuurman, H.-J., Onions, D. E. (2004). Absence of Replication-Competent Human-Tropic Porcine Endogenous Retroviruses in the Germ Line DNA of Inbred Miniature Swine. J. Virol. 78: 2502-2509 [Abstract] [Full Text]  
  • Dekker, S., Toussaint, W., Panayotou, G., de Wit, T., Visser, P., Grosveld, F., Drabek, D. (2003). Intracellularly Expressed Single-Domain Antibody against p15 Matrix Protein Prevents the Production of Porcine Retroviruses. J. Virol. 77: 12132-12139 [Abstract] [Full Text]  
  • Tonjes, R. R., Niebert, M. (2003). Relative Age of Proviral Porcine Endogenous Retrovirus Sequences in Sus scrofa Based on the Molecular Clock Hypothesis. J. Virol. 77: 12363-12368 [Abstract] [Full Text]  
  • Klymiuk, N., Muller, M., Brem, G., Aigner, B. (2003). Recombination analysis of human-tropic porcine endogenous retroviruses. J. Gen. Virol. 84: 2729-2734 [Abstract] [Full Text]  
  • Scheef, G., Fischer, N., Flory, E., Schmitt, I., Tonjes, R. R. (2002). Transcriptional Regulation of Porcine Endogenous Retroviruses Released from Porcine and Infected Human Cells by Heterotrimeric Protein Complex NF-Y and Impact of Immunosuppressive Drugs. J. Virol. 76: 12553-12563 [Abstract] [Full Text]  
  • Bartosch, B., Weiss, R. A., Takeuchi, Y. (2002). PCR-based cloning and immunocytological titration of infectious porcine endogenous retrovirus subgroup A and B. J. Gen. Virol. 83: 2231-2240 [Abstract] [Full Text]  
  • Bobkova, M., Stitz, J., Engelstadter, M., Cichutek, K., Buchholz, C. J. (2002). Identification of R-peptides in envelope proteins of C-type retroviruses. J. Gen. Virol. 83: 2241-2246 [Abstract] [Full Text]  
  • Blusch, J. H., Seelmeir, S., von der Helm, K. (2002). Molecular and Enzymatic Characterization of the Porcine Endogenous Retrovirus Protease. J. Virol. 76: 7913-7917 [Abstract] [Full Text]  
  • Niebert, M., Rogel-Gaillard, C., Chardon, P., Tonjes, R. R. (2002). Characterization of Chromosomally Assigned Replication-Competent Gamma Porcine Endogenous Retroviruses Derived from a Large White Pig and Expression in Human Cells. J. Virol. 76: 2714-2720 [Abstract] [Full Text]  
  • Oldmixon, B. A., Wood, J. C., Ericsson, T. A., Wilson, C. A., White-Scharf, M. E., Andersson, G., Greenstein, J. L., Schuurman, H.-J., Patience, C. (2002). Porcine Endogenous Retrovirus Transmission Characteristics of an Inbred Herd of Miniature Swine. J. Virol. 76: 3045-3048 [Abstract] [Full Text]  
  • Mang, R., Maas, J., Chen, X., Goudsmit, J., van der Kuyl, A. C. (2001). Identification of a novel type C porcine endogenous retrovirus: evidence that copy number of endogenous retroviruses increases during host inbreeding. J. Gen. Virol. 82: 1829-1834 [Abstract] [Full Text]  
  • Scheef, G., Fischer, N., Krach, U., Tonjes, R. R. (2001). The Number of a U3 Repeat Box Acting as an Enhancer in Long Terminal Repeats of Polytropic Replication-Competent Porcine Endogenous Retroviruses Dynamically Fluctuates during Serial Virus Passages in Human Cells. J. Virol. 75: 6933-6940 [Abstract] [Full Text]  
  • Krach, U., Fischer, N., Czauderna, F., Tonjes, R. R. (2001). Comparison of Replication-Competent Molecular Clones of Porcine Endogenous Retrovirus Class A and Class B Derived from Pig and Human Cells. J. Virol. 75: 5465-5472 [Abstract] [Full Text]  
  • Takefman, D. M., Wong, S., Maudru, T., Peden, K., Wilson, C. A. (2001). Detection and Characterization of Porcine Endogenous Retrovirus in Porcine Plasma and Porcine Factor VIII. J. Virol. 75: 4551-4557 [Abstract] [Full Text]  
  • Specke, V., Tacke, S. J., Boller, K., Schwendemann, J., Denner, J. (2001). Porcine endogenous retroviruses: in vitro host range and attempts to establish small animal models. J. Gen. Virol. 82: 837-844 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Czauderna, F.
Right arrow Articles by Tönjes, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Czauderna, F.
Right arrow Articles by Tönjes, R. R.