Previous Article | Next Article ![]()
Journal of Virology, May 2000, p. 4028-4038, Vol. 74, No. 9
Paul-Ehrlich-Institut, D-63225 Langen,
Germany
Received 29 November 1999/Accepted 8 February 2000
The use of pig xenografts is being considered to alleviate the
shortage of allogeneic organs for transplantation. In addition to the
problems overcoming immunological and physiological barriers, the
existence of numerous porcine microorganisms poses the
risk of initiating a xenozoonosis. Recently, different classes of type C porcine endogenous retoviruses (PERV) which are infectious for human
cells in vitro have been partially described. We therefore examined
whether completely intact proviruses exist that produce infectious
and replication-competent virions. Several proviral PERV
sequences were cloned and characterized. One molecular PERV class B
clone, PERV-B(43), generated infectious particles after transfection
into human 293 cells. A second clone, PERV-B(33), which
was highly homologous to PERV-B(43), showed a G-to-A mutation in the
first start codon (Met to Ile) of the env gene,
preventing this provirus from replicating. However, a genetic
recombinant, PERV-B(33)/ATG, carrying a restored
env start codon, became infectious and could be
serially passaged on 293 cells similar to virus clone PERV-B(43). PERV
protein expression was detected 24 to 48 h
posttransfection (p.t.) using cross-reacting antiserum, and reverse
transcriptase activity was found at 12 to 14 days p.t. The
transcriptional start and stop sites as well as the splice donor
and splice acceptor sites of PERV mRNA were mapped, yielding a
subgenomic env transcript of 3.1 kb. PERV-B(33) and
PERV-B(43) differ in the number of copies of a 39-bp segment in
the U3 region of the long terminal repeat. Strategies to identify and
to specifically suppress or eliminate those proviruses from the pig
genome might help in the production of PERV-free animals.
Xenotransplantation, i.e., the
therapeutic use of live cells, tissues, and organs from nonhuman
animals, offers the chance to alleviate the shortage of human donor
organs. Clinical trials for testing the general applicability of pig
cells or tissues as an alternative to allogeneic source materials are
ongoing. Those trials include the infusion or implantation of
(encapsulated) pancreatic islet cells as a treatment for
insulin-dependent diabetes mellitus (31), the implantation
of fetal neuronal tissue as a therapy for Parkinson's disease
(17), extracorporeal kidney perfusion (9), and
perfusion through or the implantation of whole liver preparations as a
treatment for hepatic failure (12, 16).
The possibility of introducing infectious agents from the animal into
the individual xenograft recipient and ultimately to the public,
leading to xenozoonosis, also termed xenosis, has raised numerous
concerns (2, 24, 46, 62). As several pathogenic agents,
including immunodeficiency viruses, have been transmitted from nonhuman
primates to humans (27, 34), and as human immunodeficiency
virus type 1 began as a zoonosis, probably from chimpanzees
(26), nonhuman primates are considered inappropriate organ
donors for xenotransplantation (10, 11; U.S.
Department of Health and Human Services, Food and Drug Administration,
Center for Biologics Evaluation and Research (CBER), Public health
issues posed by the use of nonhuman primate xenografts in humans, April 1999, http://www.fda.gov/cber/gdlns/xenoprim.pdf), even though their
tissues and organs more closely resemble those of humans than those of
phylogenetically more distant animals such as pigs and are therefore
less susceptible to rejection.
Pig organs are preferred for transplants (23), particularly
since different strategies have been developed to overcome the major obstacle of hyperacute rejection. Enzymatic modifications of the carbohydrate surface of xenogeneic cells significantly reduce
human antibody binding and complement-mediated cytolysis (4, 55,
58). In addition, affinity isolation of xenoreactive human
natural antibodies of the immunoglobulin M class, of which a
major fraction is directed against the terminal Breeding and keeping pigs under specific-pathogen-free or
qualified-pathogen-free conditions is generally assumed to reduce the
potential risk of transmitting exogenous viral, bacterial, fungal, and
parasitic agents by xenotransplantation. However, the remaining
microbiologic obstacles include pathogens such as those which can
infect fetuses congenitally or which can be stably transmitted in the
germ line and other unknown or less characterized agents, e.g., porcine
herpesviruses (22).
Retroviruses that reside in the pig genome (porcine endogenous
retroviruses [PERV]) and show similarities to C-type viruses of other
species were described almost 30 years ago (3, 7, 8, 38).
Recent studies have shown that PERV released from porcine kidney cell
lines (PK15) (52), from mitogenically activated porcine
peripheral blood mononuclear cells (PBMC) (72), or from porcine aortic endothelial cells (41) are capable of
infecting human cells in vitro. Approximately 50 proviral integration
sites exist in the genome of different pig breeds (1, 37,
52), and at least three subtypes of PERV are known to exist
(37, 63). Those PERV display very high homologies in the
gag and pol genes but differ in their
env genes; especially in the areas encoding the VRA, VRB,
and PRO regions of the gp70 protein (1, 37). These regions
are known to determine the host range specificities (5, 6).
Although a full-length PERV cDNA has been generated from miniature
swine lymphocytes (1), the designated sequence PERV-MSL is
barely infectious for human cell lines in comparison with PERV class A
and class B, as judged from pseudotype assays using the appropriate
env genes (63).
Initial retrospective studies on patients who had been transplanted
with porcine tissues revealed no detectable transmission of PERV
(33, 51). Likewise, in a cohort of 160 patients who had been
treated with various living pig tissues, no conclusive evidence of
pig-to-human transmission of PERV was found, although persistent
microchimerism was observed in 23 patients for up to 8.5 years
(49). The treatment of the patients included short-term extracorporeal liver, kidney, and splenic perfusions, bioartificial liver perfusion, implantation with pancreatic islet cells, and transplantation of skin. The detection methods employed were based on
both DNA- and RNA-dependent PCR with PERV-specific primers and on
Western blot-based serological assays to detect antibody responses to
PERV. As only 4 of the 23 samples showing microchimerism were PERV
positive, the question of PCR contamination was raised (70).
Basically, these studies suggest that PERV will not show the very high
levels of transmission associated with some viruses (60). As
only clinical trials will enable long-term xenograft survival and
function to be tested, and as retroviruses have extended clinical
latency periods following infection and therefore are difficult to
identify in the absence of demonstrable disease, upcoming studies must
be conducted in a well-coordinated, prospective, and stepwise manner,
making use of the recently developed assays to monitor putative PERV
infection and transmission to contacts.
In this communication, we report the cloning of pig-specific,
polytropic proviruses isolated from the human embryonal kidney cell
line 293 infected with PERV. Complete sequencing of PERV class B has
been performed. Two proviral clones produced infectious and
replication-competent particles after transfection into human 293 cells.
Cell lines, transfection, and replication studies.
The cell
lines PK15 and 293 and a 293 cell line productively infected with PERV
derived from PK15 cells, 293 PERV-PK, were kindly provided by R. Weiss
(London). HeLa cells were obtained from the American Type Culture
Collection (CCL-2). Plasmid DNA (1 to 10 µg) prepared with the
EndoFree system (Qiagen, Hilden, Germany) was transfected into cells
using lipofectamine (Life Technologies, Karlsruhe, Germany). Virus
replication was detected by reverse transcription-PCR (RT-PCR),
immunofluorescence microscopy with cross-reacting feline leukemia virus
(FeLV) Gag antiserum, or by reverse transcriptase (RT) assays.
Infectivity was confirmed by placing virions derived from cell-free
supernatants of producer cells after filtration through
0.45-µm-pore-size membranes (Sartorius, Göttingen, Germany) on
semiconfluent 293 or HeLa cells.
RT assay.
Cell-free supernatants filtered through membranes
(0.45-µm pore size) were analyzed for RT activity using the C-type RT
activity assay (Cavidi Tech AB, Uppsala, Sweden) according to the
instructions of the manufacturer (protocol B).
Immunofluorescence microscopy.
293 and HeLa cell lines
transfected with recombinant plasmid DNA were fixed 24 to 48 h
posttransfection (p.t.). Indirect immunofluorescence analysis was
performed with a laser scan microscope as described previously
(64). Polyclonal cross-reacting goat anti-FeLV p27 (CA)
antiserum (Biodesign International) was used for detection of PERV Gag
in a 1:500 dilution. Secondary goat antibodies conjugated with Cy3
(Indocarbocyanin) (Dianova, Hamburg, Germany) were employed.
Electron microscopy.
Electron microscopy was performed
according to standard procedures as described previously
(65).
Immunoblotting.
Sucrose gradient-purified PERV particles
were analyzed by sodium dodecyl sulfate-10% polyacrylamide gel
electrophoresis (SDS-10% PAGE) (36) and Western blotting
(67) with polyvinylidene difluoride membranes (Millipore,
Eschborn, Germany). Blots were incubated with a 1:5,000 dilution of
goat anti-FeLV CA antiserum (Biodesign International) for 1 h or
overnight, followed by a 1:10,000 dilution of protein G-conjugated
horseradish peroxidase (Bio-Rad, Munich, Germany) for 1 h.
Immunoreactive proteins on membranes were detected with the enhanced
chemiluminescence system and exposure for 15 to 20 s on hyperfilm
ECL (Amersham-Pharmacia, Freiburg, Germany).
Preparation of genomic DNA.
Preparation of
high-molecular-weight DNA from PBMC of different species and from cell
lines was performed according to standard protocols (54).
Southern blot hybridization.
Genomic cellular DNA was
digested with different restriction endonucleases (10 to 40 U/µg of
DNA; New England Biolabs, Frankfurt, Germany), separated in 0.7% TAE
(Tris-acetate-EDTA)-agarose gels and alkali blotted onto Porablot NY
Amp nylon membranes (Macherey-Nagel, Düren, Germany).
Hybridization was performed with a radiolabeled pro/pol
753-bp PERV cDNA overnight at 65°C. The probe was generated by RT-PCR
from mRNA of PK15 cells. Primers PK1 (TTGACTTGGGAGTGGGACGGGTAAC, nucleotides [nt] 2927 to 2949) and PK6
(GAGGGTCACCTGAGGGTGTTGGAT, nt 3739 to 3716) in a first PCR
and primers PK2 (GGTAACCCACTCGTTTTCTGGTCA, nt 2944 to 2966)
and PK5 (CTGTGTAGGGCTTCGTCAAAGATG, 3696 to 3673) in a nested
PCR were derived from a published sequence (accession no. U77599).
Nucleotide sequence assignments in this publication are based on the
PERV-B(33) sequence (accession no. AJ133816) (see below). Filters were
washed several times under stringent conditions with 2× SSC (0.15 M
NaCl, 0.015 M sodium citrate)-0.1% SDS at ambient temperature and
with 0.2× SSC-0.1% SDS at 65°C. Autoradiography was done for 48 to
96 h. For rehybridizations, filters were stripped and incubated
with a radiolabeled 2.4-kb NarI-BamHI fragment of
the single-copy human H1o histone gene harboring the
H1o coding and 3'-flanking sequence (HSHIS10G; accession
no. X03473 [20]) to reveal equal loading of DNA
samples. Probes were labeled with the Multiprime DNA labeling system
(Amersham-Pharmacia) with [ RNA isolations.
Total RNA was isolated with Trizol reagent
(Life Technologies) according to the instructions of the manufacturer.
Polyadenylated RNA was isolated from total cellular RNA using a
PolyATract mRNA isolation kit (Promega, Mannheim, Germany).
Northern blot hybridization.
For analysis of PERV mRNA
expression in virus-producing cells, RNA was denatured in glyoxal
according to standard techniques (54). Polyadenylated RNA
(0.5 to 2.0 µg) was separated in 1% agarose-sodium phosphate (pH
6.8) gels. After capillary transfer onto nylon membranes, UV
cross-linking, and additional baking of membranes for 2 h at
80°C, hybridization was done at 65°C overnight. In contrast to the
Southern blot analysis, the first-stringency washing steps were
performed at 42°C. A PERV long terminal repeat (LTR) U5 sequence was
amplified with primers U5-for (GTGACGCACAGGCTTTGTTG, nt 489 to 508) and U5-rev (GTAAAAGAACAATCCCCCTCGTC, nt 697 to 675).
The radiolabeled U5 209-bp amplificate and the pro/pol
753-bp PERV cDNA were used as hybridization probes.
RT-PCR.
Oligo(dT)-primed cDNA was synthesized employing the
SuperScript preamplification system (Life Technologies) and total RNA or mRNA as the template. After RNase H treatment, 1/10 of the cDNA
reaction volume was used for PCR with gene-specific primers.
Determination of splice donor and splice acceptor sites.
PCR
was performed with cDNA generated from 293 PERV-PK mRNA with primers
PERV-PBS (GTTGGCCGGGAAATCCTGCG, nt 716 to 735) and env-R
(GAGTAAGGAACCACGCGATGGAG, nt 6291 to 6269). The PCR profile included an initial denaturation at 94°C for 10 min, 30 cycles of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C, and a final elongation for 10 min at 72°C. A 20-pmol amount of each primer and
2.5 U of AmpliTaq Gold (Perkin-Elmer Cetus, Norwalk, Conn.) were used.
The elongation steps for 1 min were chosen for preferentially generating amplification products derived from subgenomic
transcripts. The PCR product was cloned into pGEM-T Easy (Promega) and sequenced.
5'RACE.
The Marathon cDNA amplification kit (Clontech,
Heidelberg, Germany) was used for 5' rapid amplification of cDNA ends
(5'RACE) experiments according to the manufacturer's instructions with mRNA as the template. The 5'RACE products generated with anchor primer
1 in combination with PERV-specific primer PK26
(ACGCACAAGACAAAGACACACGAA, nt 1134 to 1111) were cloned into
pCRII-Topo (Invitrogen, Groningen, The Netherlands) and sequenced.
Primer extension.
Oligonucleotide PK-REV-PE
(5'-GCAAACAGCAAGAGGATTTTTATTCCAAGCGCGCTG-3', nt 623 to 588),
which hybridizes in the LTR close to the anticipated transcriptional
start site, was 5'-end labeled. In a 20-µl reaction volume containing
1× One-Phor-All buffer (Amersham-Pharmacia), 100 µCi of
[ PCR amplification of PERV DNA sequences.
Genomic sequences
containing proviral segments were initially cloned by PCR techniques.
First, inverse PCR as described before (66) was performed.
In brief, genomic DNA from 293 cells infected with PK15-derived
PERV was digested with different restriction endonucleases (NEB),
generating blunt ends. After heat inactivation and alcohol
precipitation, 1 to 5 µg of DNA was self-ligated overnight in a
300-µl volume. After alcohol precipitation, circularized DNA
fragments were resuspended in 50 µl of water, of which 2.5 µl
served as the template for PCR with inverse-oriented oligonucleotides. PCR was carried out starting with an initial denaturation step at
94°C for 10 min, followed by 35 cycles of 45 s at 94°C,
45 s at 61°C, and 6 min at 72°C. An additional six cycles with
an annealing temperature of 58°C were performed. The final extension was done for 10 min at 72°C. Each PCR mixture contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.01% (wt/vol)
gelatin, a 0.2 mM concentration of each deoxynucleoside triphosphate,
20 pmol of each primer, and 2.5 U of AmpliTaq Gold (Perkin Elmer Cetus). The primers PK7 (CCCACCCATCACCCAGGATTTTTT, nt 2884 to 2861) and PK9 (AGGGTTCAAGAACTCCCCGACCAT, nt 3651 to 3675)
were used to generate 3-kb SmaI- and 2-kb
PvuII-religated DNA amplificates, respectively. A nested PCR
with PK3 (CATCTTTGACGAAGCCCTACACAG, nt 3673 to 3696) and PK8
(TTCCTAATGGTTGTAGCAGCACTG, nt 2849 to 2826) in a second
amplification generated a 3.5-kb product using self-ligated
NaeI-digested DNA as the template. Two more inverse PCR
products, a 2.2-kb PvuII and a 0.6-kb RsaI
amplificate, were obtained using primers PK10
(AGGCGCTCACTGGGAAGTGGACTT, nt 5434 to 5457) plus PK12
(GGTGGCTTCCCCTTAGTCTCTTTC, nt 5432 to 5409) and PK20
(TGGTCGGTTATACCGATAGTCATA, nt 7559 to 7536) plus PK22 (AAAGAGAACCCGTATCCCTTACCC, nt 7561 to 7584), respectively.
Amplification products were gel purified, cloned into pGEM-T Easy
(Promega) or pCRII-Topo (Invitrogen), and partially sequenced.
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Establishment and Characterization of Molecular Clones of Porcine
Endogenous Retroviruses Replicating on Human Cells

and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactose determinants on porcine endothelial cells, was used to lower the natural humoral immunologic barrier to xenotransplantation
(50). Inhibition of the second element responsible for
hyperacute rejection, complement activation, is being pursued mainly by
the use of transgenic pigs whose organs partially overcome xenograft
rejection by constantly expressing human regulators of complement
activation (15, 25, 42) but also by administration of
complement-inhibitory therapeutics (53). As an alternative,
attempts have been undertaken to establish host-specific
transplantation tolerance to pig organ grafts (30). The
possibility that human pathogens could be transmitted more easily by
use of transgenic pigs, however, has been proposed (69).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-32P]dCTP (3,000 Ci/mmol;
Amersham-Pharmacia) as the radionucleotide.
-32P]dATP, and 20 U of FPLCpure T4
polynucleotide kinase (Amersham-Pharmacia), 50 pmol of 5' termini was
incubated for 30 min at 37°C. The radiolabeled primer was used in a
first-strand synthesis for RT-PCR. After RNase H treatment, the RT-PCR
product was separated on a 6% polyacrylamide sequencing gel and
compared with the results of Sanger sequencing reactions with unlabeled
oligonucleotide PK-REV-PE as the primer and the cloned 5' LTR
(pPERV-PK26/34) as the template. Sequencing reactions were carried out
with the T7 sequencing kit (Amersham-Pharmacia).
Detection of integrated PERV by PCR. PERV pro-pol sequences were PCR amplified from cellular DNA after transfection with primers PK44 (CTGGAATTGTCTGACCTAG, nt 3815 to 3833) and PK46 (GCCATCCTCTTACCTTCCAC, nt 4689 to 4670) in a first PCR and primers PK45 (GCTAAGAAGGCCCAGATTTGC, nt 3848 to 3868) and PK47 (CTTCCGTCAGTGAACCAGGTTAG, nt 4659 to 4637) for nested PCR. PERV env sequences were amplified with primers PK17 (GCTAATCTTCCAGAATACCTCCAG, nt 5384 to 5408) and PK19 (CCCTAATCCGAGCATTACAGCTAG, nt 7607 to 7584).
Generation of a human
bacteriophage library.
For the
construction of a genomic DNA library, high-molecular-weight
DNA from 293 PERV-PK cells was partially digested with Sau3AI and cloned into the lambda Fix II/XhoI
partial fill-in vector (Stratagene, Amsterdam, The Netherlands). Phage
particles were generated according to the manufacturer's instructions
using Gigapack XL packaging extract (Stratagene). The bacteriophage library, after one round of amplification, was screened with the 32P-labeled pro-pol probe (see above).
Recombinant
clones were purified to homogeneity, and bacteriophage
DNA was prepared using the Nucleobond AX ready-to-use system
(Macherey-Nagel).
Subcloning.
DNA from
bacteriophage clones was digested
with NotI (10 U/µg of DNA; NEB) and separated on standard
0.7% TAE-agarose gels. Inserts were gel purified using the JETsorb
DNA extraction kit (Genomed, Bad Oeyenhausen, Germany), ligated into
the NotI site of pBS-KS (Stratagene), and transformed into
Escherichia coli DH10B.
Sequence analysis. The DNA sequences of both strands were determined by primer walking with the double-stranded dideoxy chain termination method using Thermo Sequenase fluorescent dye terminator cycle sequencing and precipitation kits according to the instructions of the manufacturer (Amersham-Pharmacia). Sequencing reactions were performed in a Vistra DNA Labstation 625 (Molecular Dynamics, Krefeld, Germany) and cycle sequenced on an ABI 373A or 377 DNA sequencing system (Applied Biosystems, Weiterstadt, Germany) at the Paul Ehrlich Institute or by Agowa GmbH, Berlin, Germany. All primers were commercially purchased (Eurogentec, Seraing, Belgium; ARK Scientific, Damnstadt, Germany).
Nucleotide sequence accession numbers. The complete nucleotide sequences of pPERV-PK28/29 (Y17013), pPERV-PK26/34 (Y17012), PERV-B(33) (AJ133816), and PERV-B(43) (AJ133818) have been deposited in GenBank.
The sequences used for homology studies are PERV-MSL (AF038600) (1), Tsukuba-1 (AF038599) (1), PK-15 ERV (AF038601) (1), Moloney murine leukemia virus (MoMLV) (J02255, J02256, and J02257) (59), gibbon ape leukemia virus (GaLV) (M26927) (18), baboon endogenous virus (BaEV) (D10032, D00088, and N00088) (35), FeLV (M18247 and M19392) (21), and human endogenous retrovirus ERV3 pol-env 3' LTR (M12140) (14).| |
RESULTS |
|---|
|
|
|---|
Porcine type C retroviruses are released from productively infected
human 293 cells.
The human kidney cell line 293, which had been
originally infected with PERV virions derived from porcine kidney cell
line PK15 (293 PERV-PK [52]) and which permanently
releases particles, was used in our studies. Virions produced by 293 PERV-PK cells were serially passaged on 293 cells using RT assays to
monitor retroviral replication (data not shown). As revealed by
ultrastructural analysis (Fig. 1), the
morphology of the viruses produced by freshly infected human 293 cells
is typical of a type C retrovirus, as reported for pig kidney cell
lines (3). These infected human cells were employed for
subsequent molecular characterization and cloning of PERV sequences.
|
PERV sequences are specific to pigs.
A PERV 753-bp
pro-pol probe was generated by RT-PCR with mRNA from 293 PERV-PK cells. A variety of animal DNA samples were investigated in a
genomic Southern blot analysis, demonstrating that PERV sequences could
only be detected in DNA of porcine origin, such as PBMC and PK15 cells
(Fig. 2, lanes 3 and 7), but not in mouse, dog, sheep, goat, bovine, or human DNA (Fig. 2) even though (endogenous) murine leukemia virus (MLV) pol sequences show
up to 64% homology to PERV sequences (see below). This result
indicated that proviral PERV sequences exist in several integration
sites in the cell line 293 PERV-PK. The intensity of a ~2.1-kb
EcoRI-hybridizing marker fragment in 293 PERV-PK DNA (Fig.
2, lane 9) was as strong as in porcine PBMC or PK15 DNA (Fig. 2, lanes
3 and 7). At least two more hybridizing fragments were detected in 293 PERV-PK DNA but at lower intensities (Fig. 2, lane 9). A
rehybridization analysis with a probe derived from the
single-copy histone H1o gene, which is well conserved
throughout evolution (20), demonstrated equal loading
of DNA (data not shown), suggesting that at least five integrated
proviral copies of PERV exist in the cell line 293 PERV-PK. This
estimation was confirmed by a Southern blot analysis with different
restriction enzymes for 293 PERV-PK DNA. EcoRV,
HpaI, and ScaI were identified as single
cutters in the PERV sequence by computer analysis in relation to
the pro-pol probe, which served as a proviral landmark
and revealed numerous more or less distinct hybridizing bands (data not
shown). Distinct single bands generated by DraI,
NaeI, PvuII, and SmaI indicated the
existence of at least two internal recognition sites in the proviral
PERV sequence (data not shown). Some of those fragments formed
the basis for inverse PCR-mediated cloning techniques after religation.
|
Cloning of PERV sequences by inverse and long PCR techniques. Partial sequences were obtained after cloning of SmaI (nt 943 to 4024), PvuII (nt 1925 to 3999), NaeI (nt 804 to 5470), PvuII (5372 to 7633), and RsaI (nt 7502 to 8109) DNA fragments, which were amplified by inverse PCR using DNA from 293 cells infected with PERV after restriction enzyme digestion and religation. With oligonucleotides PK28 and PK29, derived from these sequences, the PERV coding region comprising a 7.8-kb gag-pol-env gene cassette was amplified, producing clone pPERV-PK28/29. In addition, a 5' LTR was amplified using primers PK 26 and PK34, generating pPERV-PK26/34. Both retroviral clones were fully sequenced, and pPERV-PK28/29 was characterized as PERV-B. This sequence, ranging from nt 895 to 8781 based on the PERV-B(33) standard sequence (see below), exhibits gag (nt 1154 to 2728) and env (nt 6189 to 8162) ORFs and demonstrates homologies of 94.0 to 99.2% to the gag and pol genes of PERV-MSL, Tsukuba-1, and PK-15 ERV (1), respectively, using the BLASTN program (National Center of Biotechnology Information genetic databases). PK-15 ERV is a partially (in pol) deleted PERV cDNA sequence isolated from PK15 cells. The env gene of PERV-PK28/29 is almost identical (99.8%) to a PERV-B sequence described previously (accession no. Y12239) (37). Thus, pPERV-PK28/29 belongs to class B of PERV sequences. A single-nucleotide deletion (A, nt 5573) leads to a truncated pol ORF (nt 2729 to 6316) in pPERV-PK28/29.
As this PCR strategy was not optimal to fully clone and characterize different complete proviral PERV sequences which potentially could be replication competent, particularly as several copies exist in the infected human cell line 293 PERV-PK, genomic cloning was performed.Generation and screening of a gene library.
For the cloning of
complete proviral PERV genomes, including both LTRs, a
bacteriophage library of 293 PERV-PK DNA was generated. A total of
1.5 × 106 independent primary clones were obtained
and screened with the PERV pro-pol probe. After three rounds
of screening, six clones were purified to homogeneity. Restriction
enzyme analyses of subcloned NotI inserts into pBS-KS
revealed two identical clones [pPERV-B(34) and pPERV-B(41)]. A third
and unclassified clone, pPERV-(46), was excluded from further analysis
because of a truncated pol gene detected by PCR (not shown).
Two of the four remaining clones, pPERV-B(33) and pPERV-B(43),
were characterized in detail. Clone PERV-B(34) demonstrated a
truncation in the env gene, and clone PERV-A(42),
encompassing an env class A gene, has not yet been fully characterized.
Analysis of full-length PERV sequences and ORFs.
The
retroviral portions of pPERV-B(33) and pPERV-B(43) were sequenced
and compared. PERV-B(33) and PERV-B(43) display proviral sequences of
8,918 and 8,750 bp, respectively (Fig.
3A). Only minor differences are evident
throughout the retroviral genes, which show nucleotide and amino
acid homologies of 99.8% (three nucleotide exchanges) and 99.8% (one
amino acid exchange) for gag, 99.9% (five nucleotide
exchanges) and 99.6% (five amino acid exchanges) for
pro-pol, and 99.7% (five nucleotide exchanges) and 99.2%
(five amino acid exchanges) for env (Table
1). According to their env
sequences, both proviruses belong to PERV class B (37).
PERV-B(33) and PERV-B(43) sequences show ORFs for all retroviral
proteins in a type C-specific manner except for env in the
case of PERV-B(33), in which the first putative start codon is
mutated at nt 6191 from G to A (Fig. 3A). The nucleotide and amino acid
homologies of PCR clone pPERV-PK28/29 and of genomic clone
pPERV-B(33) are 99.6% (six nucleotide exchanges) and 99.0% (five
amino acid exchanges) for gag, 99.8% (six nucleotide
exchanges, one nucleotide deletion) and 99.7% (two amino acid
exchanges, one frameshift) for pro-pol, and 99.7% (five
nucleotide exchanges) and 99.2% (five amino acid exchanges) for
env (Table 1). The env ORFs of pPERV-B(43) and
pPERV-PK28/29 differ in only one codon (nt 8091, A to G, Ser versus
Pro).
|
|
PERV LTRs. The LTRs of pPERV-B(33) and pPERV-B(43) are limited by the inverted repeat sequence TGAAAGG/CCTTTCA. The LTRs differ in the length of the U3 element. A 39-bp sequence motif exists four times in the PERV-B(33) LTR (nt 331 to 369, 370 to 408, 409 to 447, and 448 to 486) and two times in the PERV-B(43) LTR (Fig. 3A). Part of this repeated sequence consists of an 18-bp segment which precedes the quadruplex/duplex stretch at nt 313 to 330. A comparison with the PERV-MSL LTR (1) reveals, after reconstitution of the appropriate cDNA portions, an overall homology of 70%. However, in the PERV-MSL LTR, only one copy of the 39-bp motif (five nt exchanges) exists, which is flanked on each side by a single 18-bp segment. Extensive homology is also found downstream of this sequence in the PERV-MSL U3 element. A retroviral TATA box demonstrating a sequence context homologous to other promoters (28) is present at nt 517. The R region is located at nt 546 to 624, followed by the U5 element (nt 625 to 707) in the PERV-B(33) LTR. These elements show extended or partial homologies with the corresponding sequences of the PERV-MSL and GaLV LTRs. A MatInspector analysis (Genomatix, Munich, Germany) revealed a primer binding site at nt 710 to 727 that is complementary to the last 18 nt at the 3' end of a tRNAGly4. By contrast, PERV-MSL encompasses a tRNAPro sequence (1). A polyadenylation signal consensus sequence (AATAAA) is located at nt 8811 to 8816 in PERV-B(33) (Fig. 3A).
RNA expression pattern of PERV.
Total RNA and mRNA from
uninfected 293, 293 PERV-PK, PK15, and GH (a human teratocarcinoma cell
line) cells were hybridized in a Northern blot analysis with
different probes. Full-length transcripts of ~8.3 kb were found with
the pro-pol probe for the 293 PERV-PK and the PK15
cell lines (Fig. 4A). According to the
-actin control hybridization, mRNA steady-state levels of
(polytropic) PERV expressed in 293 cells are higher than those in PK15
cells (Fig. 4A). With a U5-specific probe, a genomic RNA of
~8.3 kb and a subgenomic transcript of ~3.1 kb were found
in 293 PERV-PK and at lower steady-state levels in PK15 cells (Fig.
4B). The specificity of the probes used was confirmed by the absence of hybridizing RNAs in uninfected 293 cells and GH cells (Fig. 4).
|
Identification of the transcription start site.
To map the cap
site of PERV mRNA, a combination of two RT-PCR-based methods was
performed. The 5'RACE products generated with an anchor primer in
combination with the gene-specific primer PK26-R were cloned and
sequenced. The 5'RACE product ended at position 569 (not shown). For
the exact determination of the transcriptional start site, a
primer extension analysis was carried out. An RT-PCR was performed with
the oligonucleotide PK-REV-PE, derived from the 5'RACE sequence. The
same primer was used in a regular Sanger sequencing reaction. As shown
in Fig. 5, the RT-PCR product identified the cap site at nt 545 (see also Fig. 3A).
|
Identification of splice donor and acceptor sites. The splice donor and splice acceptor sites which trigger the expression of the subgenomic PERV env mRNA were experimentally determined. A PCR with an elongation step of 60 s preferentially amplified subgenomic transcripts using 293 PERV-PK cDNA with the primers PERV-PBS and env-R. After sequencing a ~390-bp product, a junction of CTTGGAGCCTCT was revealed, demonstrating that the splice donor and the corresponding splice acceptor sites are located at nt 766 (A) and at nt 5950 (G), respectively (data not shown). All mapping results are summarized in Fig. 3A. Based on these analyses, the theoretical size of the env transcript of 3.1 kb corresponded to the experimentally defined subgenomic mRNA (Fig. 3 and 4B).
Transfection and infection studies. To functionally characterize proviral sequences, plasmids pPERV-B(33), pPERV-B(33)/ATG, and pPERV-B(43) were repeatedly transfected in triplicate into 1 × 105 to 3 × 105 293 cells. Plasmid pPERV-B(33)/ATG, harboring a restored env start codon at nt 6189, was constructed to investigate potential differences in retroviral replication, since the first ATG in the env gene of pPERV-B(33) is located at position 6693, whereas the env start codon in PERV-PK28/29 and in the previously published PERV-B env sequence (37) is located 504 bp upstream at nt 6189, similar to PERV-B(43).
The replacement of the 1,325-bp BsrGI fragment (nt 5920 to 7245) derived from pPERV-PK28/29 introduced four nucleotide and amino acid exchanges in the env ORF of PERV-B(33), at nt 6191 (Ile to Met), nt 6562 (Asp to Gly), nt 6568 (Gly to Glu), and nt 7005 (Ser to Pro). As an initial marker of PERV expression, retroviral Gag proteins were detected by indirect immunofluorescence with cross-reacting FeLV CA antiserum. At 24 to 48 h p.t., 20 to 50% of cells transfected with pPERV-B(33), pPERV-B(33)/ATG, and pPERV-B(43) demonstrated Gag staining (not shown). In parallel cultures, 293 cells transfected with pPERV-B(43) and pPERV-B(33)/ATG showed RT activities in cell-free supernatants after 12 to 14 days (not shown). Those cultures were maintained and analyzed at regular time points. At 6 to 12 weeks p.t., all cells transfected with pPERV-B(43) and pPERV-B(33)/ATG stained positive for Gag (Fig. 6A). These PERV-expressing cells released virion-bound RT at levels of 600 to 900 mU/ml (Fig. 6B). The 293 PERV-PK cells used as a positive control gave RT activities of 1,800 mU/ml in cell-free supernatants (Fig. 6B). Purified virus particles from those cultures were positive for the capsid protein (p30) by immunoblotting with FeLV CA antiserum (Fig. 6C). PCR analyses revealed integration of proviral DNA as demonstrated for pol (Fig. 6D) and env sequences (not shown). Cell-free supernatants from those particle-producing cultures were used to transfer PERV to fresh 293 cells. Similar to the transfection experiments, indirect immunofluorescence analysis showed Gag expression 24 to 48 h postinfection, and RT assays became positive at 10 to 14 days postinfection (not shown), demonstrating that pPERV-B(43) and pPERV-B(33)/ATG encode infectious retroviruses. Those virus transfers were continued serially on 293 cells every 4 weeks for up to 6 months (not shown). On the other hand, weak RT activities in pPERV-B(33) Gag-expressing cultures were found only transiently after transfection (not shown), and virions could not be transmitted to fresh 293 cells.
|
| |
DISCUSSION |
|---|
|
|
|---|
As demonstrated by the almost complete cloning of a PERV-C proviral sequence (PERV-MSL [1]), the pig genome harbors intact copies of PERV. Those elements are not merely pig endogenous retroviral sequences, as suggested earlier (57), for some of those endogenous retroviral sequences encode replication-competent retroviruses similar to those present in normal chickens, cats, baboons, and several strains of mice (71).
PERV-B sequences encode infectious particles. This report presents the first structural and functional description of complete PERV-B sequences with replicative capacities. Both proviruses [PERV-B(33) and PERV-B(43)] were isolated from a human 293 cell line productively infected with PERV-PK which harbors at least four additional PERV sequences isolated by genomic and PCR cloning.
The capacity of PERV-B(43) to produce infectious viral particles was directly shown after transfection of cloned proviral sequences into human cells and subsequent serial passaging on human 293 cells (Fig. 6). The second proviral genome, PERV-B(33), was presumed to be defective due to a point mutation in the env start codon, generating a Met-to-Ile mutation. For this reason, the codon was genetically restored by replacement with a homologous sequence derived from the PCR clone PERV-PK28/29. After transfection of this proviral construct, PERV-B(33)/ATG was able to produce infectious particles which were serially passaged on human 293 cells. On the other hand, no infectious and replication-competent virus was found after transfection of PERV-B(33). It should be mentioned, however, that in addition to the introduction of ATG, there are four predicted amino acid differences between the two molecular clones, and the contribution of any or all of these changes to the defective nature of PERV-B(33) and rescue by exchange of the fragment from pPERV-PK28/29 was not evaluated. For endogenous MLVs, four classes of sequences have been described (61). The MLV env sequence of the prototype polytropic proviral clone MX27 exhibits the same methionine-to-isoleucine mutation of the start codon as PERV-B(33). Those sequences and members of the modified polytropic endogenous MLV class, however, can contribute their env genes to the observed recombinant viruses derived from distinct parental MLV (61). Therefore, given the fact that PERV-B(33) preexisted in this form in the pig genome, it is conceivable that this sequence is involved in recombination events of PERV sequences and/or that gene mutations can lead to expression of replication-competent pig retroviruses. It seems likely, however, that PERV-B(33), in addition to the defective clones PERV-PK28/29, PERV-B(34), and PERV-(46), which was not further classified, was integrated into the 293 host genome via cross-packaging of viral RNA derived from PK-15 cells and subsequent RT after infection of 293 cells by PERV particles. In this context, it cannot be completely excluded that the single-nucleotide deletion in pol of the amplified sequence of clone PERV-PK28/29 was generated by a PCR artifact, even though we used polymerases with proofreading activity.PERV host range. The host range and cell tropism of retroviruses mainly depend on the env gene. Two of three distinct PERV can infect some human cells in culture (37, 52, 63, 72). However, these reports did not address the entire genetic context of proviral PERV, and the main conclusions were drawn from pseudotype experiments with PERV type A, B, and C env genes cloned into MLV-based retroviral backbones (63, 73). These data suggest that different receptors exist on susceptible cells (37, 63), although the receptors have not yet been identified on cells from nonhuman primates, suggesting that primate xenotransplantation models may not be appropriate for the study of PERV zoonosis (60, 63). In this study, we have shown that two full-length molecular clones of the PERV-B class can replicate on human cells. So far, we do not know whether PERV-A viruses which demonstrate the same functional properties exist. Our preliminary investigations of one isolated clone [PERV-A(42)], based on sequence analysis, however, suggest a similar potential (not shown).
In addition, the promoter activity of LTRs and other regulatory factors is important for the host range. The use of defined LTRs from functional PERV in reporter gene studies will allow analysis of cell and tissue specificities in addition to the host range and interference studies (63). The U3 regions of the PERV-B(33) and PERV-B(43) LTRs differ in the numbers of a 39-bp repeat that are present. Our first studies indicate significantly different promoter activities of these LTRs in human cells. As no steroid hormone-responsive element or NF-
B sites could be found in the PERV-B(33) or PERV-B(43) LTRs, it remains to be shown whether immunosuppressive drugs such prednisolone and cyclosporin A have a
direct or indirect effect on LTR activities.
Putative impact of replication-competent PERV in xenotransplantation. The different pig breeds studied so far harbor different sets and distinct numbers of PERV copies in their genomes (1, 37). For miniature swine inbred for major histocompatibility complex loci, it was shown that PERV-MSL exists in multiple copies but that some individuals apparently harbor additional proviral loci (1), a phenomenon which could be explained by new infections, genetic recombination, or retrotransposition of transcriptionally active PERV in the minipig genome. Furthermore, mRNA expression of PERV in different porcine tissues has been reported (1, 52). Significant steady-state levels have been shown for PBMC, spleen, thymus, lymph node, and lung, where full-length and subgenomic RNAs were found (1). These patterns of expression are identical to those observed in PK15 and in 293 PERV-PK cells (1) (Fig. 4).
In recent retrospective analyses of xenotransplanted human patients, no evidence was found for expression, infection, and replication of PERV in the human host (33, 49, 51). Even though these reports are somewhat reassuring with regard to safety, particularly as PERV replicates even in permissive tissue culture cells to relatively low titers (63), it has to be stated that (i) no long-term xenotransplantation of physiologically functional pig tissues has been achieved so far and (ii) no vascularized pig organs have been successfully used in human patients. Therefore, although these studies found no evidence of a risk, they do not rule out that a risk exists (70). An additional level of risk has been pointed out which arises from the presence of HERV in human transplant recipients and the subsequent chance of recombination with PERV yielding viruses with new properties (70). It has to be stated that no HERV with replicative capacities has been identified so far (39). For instance, in the HERV-K family, which comes closest of all known HERV to encoding infectious virus, no corresponding replication-competent virus could be found in the human genome (66). Nevertheless, expression of types B and D HERV-K full-length mRNAs was observed in numerous tissues (40). As PERV belong to the C-type retroviruses, related HERV sequences might offer targets for recombination. ERV-3 (HERV-R) is a defective C-type provirus that is selectively expressed during differentiation of placental syncytiotrophoblasts and elicits mass production of a nonglycosylated and unprocessed 65-kDa ENV protein in this tissue (68), a phenotype which seems to be dispensable in humans (19). Thus, even if genetic recombination occurred, based on the limited sequence homologies in env, a resulting recombinant PERV-HERV might not gain any advantageous functions. The aim of establishing long-term xenotransplantation and the presence of infectious PERV and other unknown agents make it necessary to closely monitor animal donors, human recipients, and their contacts in prospective xenotransplantation trials. This will enable a comprehensive evaluation of the risks of cross-species transmission of microorganisms, as suggested previously (47, 60). Even though PERV do not replicate as efficiently as polytropic murine and feline ERV in human cells (37, 52), the possibility remains that PERV or recombined viruses could infect xenograft recipients (70) and, like their closest viral relatives MLV, FeLV, and GaLV, cause leukemic diseases. Besides PERV, other new horizontally transmissible viruses of swine, including hepatitis viruses and herpesviruses, have recently been discovered (22, 43, 44), adding to the list of putative human pathogens. Therefore, regulatory frameworks similar to those set up by the U.S. Food and Drug Administration (U.S. Department of Health and Human Services, Public Health Service guideline on infectious disease issues in xenotransplantation, Fed. Register vol. 61, no. 185, 23 September 1996, p. 49920-49949, http://www.fda.gov/cber/xeno.pdf) and the United Kingdom Xenotransplantation Interim Regulatory Authority (U.K. Xenotransplantation Interim Regulatory Authority, Draft report of the infection surveillance steering group, 7 July 1999, http://www.open.gov.uk/doh/ukxira.htm) are needed to help to provide pathogen-free pigs for xenotransplantation. Specific tools for detection of PERV expression and replication have been established, including nucleic acid and immunologic assays (33, 49, 51). We have generated PERV-specific antisera and have expressed recombinant PERV proteins in order to unequivocally distinguish those viruses from other agents (U. Krach, N. Fischer, F. Czauderna, R. Kurth, and R. R. Tönjes, submitted for publication). Should methods such as knock-out technology become available for pigs in the future, inherited genes, including vertically transmitted PERV, could be eliminated. Functional characterization and genetic mapping of replication-competent endogenous retroviruses, including those PERV presented here, will help eliminate functional proviruses from transplant donor animals or at least allow the expression of these PERV classes to be controlled.| |
ACKNOWLEDGMENTS |
|---|
This study was supported by a grant from the German Ministry of Health (Bundesministerium für Gesundheit), Bonn, Germany.
The technical assistance of Gundula Braun is gratefully acknowledged. We thank Joachim Denner and Steve Norley for helpful discussions and review of the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, D-63225 Langen, Germany. Phone: 49 6103 775304. Fax: 49 6103 771255. E-mail: toera{at}pei.de.
Present address: Atugen Biotechnology AG, D-13125 Berlin, Germany.
Present address: Robert-Koch-Institut, D-13353 Berlin, Germany.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Akiyoshi, D. E.,
M. Denaro,
H. Zhu,
J. L. Greenstein,
P. T. Banerjee, and J. A. Fishman.
1998.
Identification of a full-length cDNA for an endogenous retrovirus of minature swine.
J. Virol.
72:4503-4507 |
| 2. | Allan, J. S. 1996. Xenotransplantation at a crossroads: prevention versus progress. Nat. Med. 2:18-21[CrossRef][Medline]. |
| 3. |
Armstrong, J. A.,
J. S. Porterfield, and A. T. D. Madrid.
1971.
C-type virus particles in pig kidney cell lines.
J. Gen. Virol.
10:195-198 |
| 4. | Bach, F. H., S. C. Robson, H. Winkler, C. Ferran, K. M. Stuhlmeier, C. J. Wrighton, and W. W. Hancock. 1995. Barriers to xenotransplantation. Nat. Med. 1:869-873[CrossRef][Medline]. |
| 5. | Battini, J. L., O. Danos, and J. M. Heard. 1995. Receptor-binding domain of murine leukemia virus envelope glycoproteins. J. Virol. 69:713-719[Abstract]. |
| 6. |
Battini, J. L.,
J. M. Heard, and O. Danos.
1992.
Receptor choice determinants in the envelope glycoproteins of amphotropic, xenotropic, and polytropic murine leukemia viruses.
J. Virol.
66:1468-1475 |
| 7. |
Benveniste, R. E., and G. J. Todaro.
1973.
Homology between type-C viruses of various species as determined by molecular hybridization.
Proc. Natl. Acad. Sci. USA
70:3316-3320 |
| 8. | Breese, S. S., Jr. 1970. Virus-like particles occurring in cultures of stable pig kidney cell lines. Arch. Gesamte Virusforsch. 30:401-404[CrossRef][Medline]. |
| 9. | Breimer, M. E., E. Björck, C. T. Svalander, A. Bengtsson, L. Rydberg, K. Lie-Karlsen, P.-O. Attman, M. Aurell, and B. E. Samuelsson. 1996. Extracorporeal ("ex vivo") connection of pig kidneys to humans. I. Clinical data and studies of platelet destruction. Xenotransplantation 3:328-339. |
| 10. | Butler, D. 1999. FDA warns on primate xenotransplants. Nature 398:549[Medline]. |
| 11. |
Chapman, L. E.,
T. M. Folk,
D. R. Salomon,
A. P. Patterson,
T. E. Eggerman, and P. D. Noguchi.
1995.
Xenotransplantation and xenogeneic infections.
N. Engl. J. Med.
333:1498-1501 |
| 12. |
Chari, R. S.,
B. H. Collins,
J. C. Magee,
J. M. DiMaio,
A. D. Kirk,
R. C. Harland,
R. L. McCann,
J. L. Platt, and W. C. Meyers.
1994.
Treatment of hepatic failure with ex vivo pig-liver perfusion followed by liver transplantation.
N. Engl. J. Med.
331:234-237 |
| 13. | Coffin, J. 1996. Retroviridae: the viruses and their replication, p. 1767-1847. In B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Hagerstown, Md. |
| 14. | Cohen, M., M. D. Power, C. O'Connell, and N. Kato. 1985. The nucleotide sequence of the env gene from the human provirus ERV3 and isolation and characterization of an ERV3-specific cDNA. Virology 147:449-458[CrossRef][Medline]. |
| 15. | Cozzi, E., and D. J. G. White. 1995. The generation of transgenic pigs as potential organ donors for humans. Nat. Med. 1:964-966[CrossRef][Medline]. |
| 16. | Cramer, D. V. 1995. The use of xenografts for acute hepatic failure. Transplant. Proc. 27:80-82[Medline]. |
| 17. | Deacon, T., J. Schumacher, J. Dinsmore, C. Thomas, P. Palmer, S. Kott, A. Edge, D. Penny, S Kassissieh, P. Dempsey, and O. Isacson. 1997. Histological evidence of fetal pig neural cell survival after transplantation into a patient with Parkinson's disease. Nat. Med. 3:350-353[CrossRef][Medline]. |
| 18. | Delassus, S., P. Sonigo, and S. Wain-Hobson. 1989. Genetic organization of gibbon ape leukemia virus. Virology 173:205-213[CrossRef][Medline]. |
| 19. |
De Parseval, N., and T. Heidmann.
1998.
Physiological knockout of the envelope gene of the single-copy ERV-3 human endogenous retrovirus in a fraction of the caucasian population.
J. Virol.
72:3442-3445 |
| 20. | Doenecke, D., and R. Tönjes. 1986. Differential distribution of lysine and arginine residues in the closely related histones H1o and H5: analysis of a human H1o gene. J. Mol. Biol. 187:461-464[CrossRef][Medline]. |
| 21. |
Donahue, P. R.,
E. A. Hoover,
G. A. Beltz,
N. Riedel,
V. M. Hirsch,
J. Overbaugh, and J. I. Mullins.
1988.
Strong sequence conservation among horizontally transmissible, minimally pathogenic feline leukemia viruses.
J. Virol.
62:722-731 |
| 22. | Ehlers, B., S. Ulrich, and M. Goltz. 1999. Detection of two novel porcine herpesviruses with high similarity to gammaherpesviruses. J. Gen. Virol. 80:971-978[Abstract]. |
| 23. | Fishman, J. A. 1994. Miniature swine as organ donors for man: strategies for prevention of xenotransplant-associated infectiuons. Xenotransplantation 1:47-57. |
| 24. | Fishman, J. A. 1997. Xenosis and xenotransplantation: addressing the infectious risks posed by an emerging technology. Kidney Int. 51(Suppl. 58):S41-S45. |
| 25. |
Fodor, W. L.,
B. L. Williams,
L. A. Matis,
J. A. Madri,
S. A. Rollins,
J. W. Knight,
W. Velander, and S. P. Squinto.
1994.
Expression of a human complement inhibitor in a transgenic pig as a model for the prevention of xenogeneic hyperacute rejection.
Proc. Natl. Acad. Sci. USA
91:11153-11157 |
| 26. | Gao, F., E. Bailes, D. L. Robertson, Y. Chen, C. M. Rodenburg, S. F. Michael, L. B. Cummins, L. O. Arthur, M. Peeters, G. M. Shaw, P. M. Sharp, and B. H. Hahn. 1999. Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes. Nature 397:436-441[CrossRef][Medline]. |
| 27. | Gao, F., L. Yue, A. T. White, P. G. Pappas, J. Barchue, A. P. Hanson, B. M. Greene, P. M. Sharp, G. M. Shaw, and B. H. Hahn. 1992. Human infection by genetically diverse SIVSM-related HIV-2 in west Africa. Nature 358:495-499[CrossRef][Medline]. |
| 28. |
Golemis, E. A.,
N. A. Speck, and N. Hopkins.
1990.
Alignment of U3 region sequences of mammalian type C viruses: identification of highly conserved motifs and implications for enhancer design.
J. Virol.
64:534-542 |
| 29. |
Green, L. M., and J. M. Berg.
1989.
A retroviral Cys-Xaa2-Cys-Xaa4-His-Xaa4-Cys peptide binds metal ions: spectroscope studies and a proposed three-dimensional structure.
Proc. Natl. Acad. Sci. USA
86:4047-4051 |
| 30. | Greenstein, J. L., and D. H. Sachs. 1997. The use of tolerance for transplantation across xenogeneic barriers. Nat. Biotechnol. 15:235-238[CrossRef][Medline]. |
| 31. | Groth, C. G., O. Korsgren, A. Tibell, J. Tollemar, E. Möller, J. Bolinder, J. Östman, F. P. Reinholt, C. Hellerström, and A. Andersson. 1994. Transplantation of porcine fetal pancreas to diabetic patients. Lancet 344:1402-1404[CrossRef][Medline]. |
| 32. |
Harada, F.,
G. G. Peters, and J. E. Dahlberg.
1979.
The primer tRNA for Moloney leukemia virus DNA synthesis.
J. Biol. Chem.
254:10979-10985 |
| 33. | Heneine, W., A. Tibell, W. M. Switzer, P. Sandstrom, G. V. Rosales, A. Mathews, O. Korsgen, L. E. Chapman, T. M. Folks, and C. G. Roth. 1998. No evidence of infection with porcine endogenous retrovirus in recipients of porcine islet-cell xenografts. Lancet 352:695-699[CrossRef][Medline]. |
| 34. | Holmes, G. P., L. E. Chapman, J. A. Steward, S. E. Straus, J. K. Hilliard, and D. S. Davenport. 1995. The B virus working group: guidelines for the prevention and treatment of B-virus in exposed persons. Clin. Infect. Dis. 20:412-439. |
| 35. | Kato, S., K. Matsuo, N. Nishimura, N. Takahashi, and T. Takano. 1987. The entire nucleotide sequence of baboon endogenous virus DNA: a chimeric genome structure of murine type C and simian type D retroviruses. Jpn. J. Genet. 62:127-137. |
| 36. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685[CrossRef][Medline]. |
| 37. | Le Tissier, P., J. P. Stoye, Y. Takeuchi, C. Patience, and R. A. Weiss. 1997. Two sets of human-tropic pig retroviruses. Nature 389:681-682[CrossRef][Medline]. |
| 38. | Lieber, M. M., C. J. Scherr, R. E. Benveniste, and G. J. Todaro. 1975. Biologic and immunologic properties of porcine type C viruses. Virology 66:616-619[CrossRef][Medline]. |
| 39. |
Löwer, R.,
J. Löwer, and R. Kurth.
1996.
The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences.
Proc. Natl. Acad. Sci. USA
93:5177-5184 |
| 40. | Löwer, R., R. R. Tönjes, K. Boller, J. Denner, B. Kaiser, R. C. Phelps, J. Löwer, R. Kurth, K. Badenhoop, H. Donner, K. H. Usadel, T. Miethke, M. Lapatschek, and H. Wagner. 1998. Development of insulin-dependent diabetes mellitus does not depend on specific expression of the human endogenous retrovirus HERV-K. Cell 95:11-14[CrossRef][Medline]. |
| 41. | Martin, U., V. Kiessi, J. H. Blusch, A. Haverich, K. von der Helm, T. Herden, and G. Steinhoff. 1998. Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet 352:692-694[CrossRef][Medline]. |
| 42. | McCurry, K. R., D. L. Kooyman, C. G. Alvarado, A. H. Cotterell, M. J. Martin, J. S. Logan, and J. L. Platt. 1995. Human complement regulatory proteins protect swine-to-primate cardiac xenografts from humoral injury. Nat. Med. 1:423-427[CrossRef][Medline]. |
| 43. |
Meng, X.-J.,
R. H. Purcell,
P. G. Halbur,
J. R. Lehman,
D. M. Webb,
T. S. Tsareva,
J. S. Haynes,
B. J. Thacker, and S. U. Emerson.
1997.
A novel virus in swine is closely related to the human hepatitis E virus.
Proc. Natl. Acad. Sci. USA
94:9860-9865 |
| 44. |
Meng, X.-J.,
P. G. Halbur,
M. S. Shapiro,
S. Govindarajan,
J. D. Bruna,
I. K. Mushahwar,
R. H. Purcell, and S. U. Emerson.
1998.
Genetic and experimental evidence for cross-species infection by swine hepatitis E virus.
J. Virol.
72:9714-9721 |
| 45. |
Meric, C., and S. P. Goff.
1989.
Characterization of Moloney murine leukemia virus mutants with single-amino-acid substitutions in the Cys-His box of the nucleocapsid protein.
J. Virol.
63:1558-1568 |
| 46. | Michaels, M. G., and R. L. Simmons. 1994. Xenotranplant-associated zoonoses. Transplantation 57:1-7[Medline]. |
| 47. | Onions, D., D. Hart, C. Mahoney, D. Galbraith, and K. Smith. 1998. Endogenous retroviruses and the safety of porcine xenotransplantation. Trends Microbiol. 6:430-431[CrossRef]. |
| 48. | Oroszlan, S., T. D. Copeland, R. V. Gilden, and G. J. Todaro. 1981. Structural homology of the major internal proteins of endogenous type C viruses of two distantly related species of Old World monkeys, Macaca arctoides and Colobos polykomos. Virology 115:262-271[CrossRef][Medline]. |
| 49. |
Paradis, K.,
G. Langford,
Z. Long,
W. Heneine,
P. Sandstrom,
W. M. Switzer,
L. E. Chapman,
C. Lockey,
D. Onions,
The XEN 111 Study Group, and E. Otto.
1999.
Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue.
Science
285:1236-1241 |
| 50. | Parker, W., D. Bruno, Z. E. Holzknecht, and J. L. Platt. 1994. Characterization and affinity isolation of xenoreactive human natural antibodies. J. Immunol. 153:3791-3803[Abstract]. |
| 51. | Patience, C., G. S. Patton, Y. Takeuchi, R. A. Weiss, M. O. McClure, L. Rydberg, and M. E. Breimer. 1998. No evidence of pig DNA or retroviral infection in patients with short-term extracorporal connection to pig kidneys. Lancet 352:699-701[CrossRef][Medline]. |
| 52. | Patience, C., Y. Takeuchi, and R. A. Weiss. 1997. Infection of human cells by an endogenous retrovirus of pigs. Nat. Med. 3:282-286[CrossRef][Medline]. |
| 53. | Ryan, U. S. 1995. Complement inhibitory therapeutics and xenotransplantation. Nat. Med. 1:967-968[CrossRef][Medline]. |
| 54. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 55. | Sandrin, M. S., W. L. Fodor, E. Mouhtouris, N. Osman, S. Cohney, S. A. Rollins, E. R. Guilmette, E. Setter, S. P. Squinto, and I. F. McKenzie. 1995. Enzymatic remodelling of the carbohydrate surface of a xenogeneic cell substantially reduces human antibody binding and complement mediated cytolysis. Nat. Med. 1:1261-1267[CrossRef][Medline]. |
| 56. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 57. | Schumacher, J. M., and O. Isaacson. 1997. Neuronal xenotransplantation in Parkinson's disease. Nat. Med. 3:474-475. |
| 58. |
Sharma, A.,
J. Okabe,
P. Birch,
S. B. McClellan,
M. J. Martin,
J. L. Platt, and J. S. Logan.
1996.
Reduction in the level of Gal (alpha1,3) Gal in transgenic mice and pigs by the expression of an alpha (1,2) fucosyltransferase.
Proc. Natl. Acad. Sci. USA
93:7190-7195 |
| 59. | Shinnick, T. M., R. A. Lerner, and J. G. Sutcliff. 1981. Nucleotide sequence of Moloney murine leukemia virus. Nature 293:543-548[CrossRef][Medline]. |
| 60. | Stoye, J. P. 1998. No clear answers on safety of pigs as tissue donor source. Lancet 352:666-667[CrossRef][Medline]. |
| 61. |
Stoye, J. P., and J. M. Coffin.
1987.
The four classes of endogenous murine leukemia virus: structural relationships and potential for recombination.
J. Virol.
61:2659-2669 |
| 62. | Stoye, J. P., and J. M. Coffin. 1995. The dangers of xenotransplantation. Nat. Med. 1:1100[Medline]. |
| 63. |
Takeuchi, Y.,
C. Patience,
S. Magre,
R. A. Weiss,
P. T. Banerjee,
P. Le Tissier, and J. P. Stoye.
1998.
Host range and interference studies of three classes of pig endogenous retrovirus.
J. Virol.
72:9986-9991 |
| 64. | Tönjes, R. R., C. Limbach, R. Löwer, and R. Kurth. 1997. Expression of human endogenous retrovirus type K envelope glycoprotein in insect and mammalian cells. J. Virol. 71:2747-2756[Abstract]. |
| 65. | Tönjes, R. R., K. Boller, C. Limbach, R. Lugert, and R. Kurth. 1997. Characterization of human endogenous retrovirus type K virus-like particles generated from recombinant baculoviruses. Virology 233:280-291[CrossRef][Medline]. |
| 66. |
Tönjes, R. R.,
F. Czauderna, and R. Kurth.
1999.
Genome wide screening, cloning, chromosomal assignment and expression of full-length human endogenous retrovirus type K (HERV-K).
J. Virol.
73:9187-9195 |
| 67. |
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354 |
| 68. | Venables, P. J. W., S. M. Brookes, D. Griffiths, R. A. Weiss, and M. T. Boyd. 1995. Abundance of an endogenous retroviral envelope protein in placental trophoblasts suggests a biological function. Virology 211:589-592[CrossRef][Medline]. |
| 69. | Weiss, R. A. 1998. Transgenic pigs and virus adaptation. Nature 391:327-328[CrossRef][Medline]. |
| 70. |
Weiss, R. A.
1999.
Xenograft and retroviruses.
Science
285:1221-1222 |
| 71. | Weiss, R. A., N. M. Teich, H. E. Varmus, and J. Coffin (ed.). 1985. RNA tumor viruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 72. |
Wilson, C. A.,
S. Wong,
J. Muller,
C. E. Davidson,
T. M. Rose, and P. Burd.
1998.
Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells.
J. Virol.
72:3082-3087 |
| 73. |
Wilson, C. A.,
S. Wong,
M. van Brocklin, and M. J. Federspiel.
2000.
Extended analysis of the in vitro tropism of porcine endogenous retrovirus.
J. Virol.
74:49-56 |
| 74. | Xiong, Y., and T. H. Eickbush. 1990. Origin and evolution of retroelements based upon their reverse transcriptase sequences. EMBO J. 9:3353-3362[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»