Previous Article | Next Article 
Journal of Virology, May 2000, p. 3975-3983, Vol. 74, No. 9
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Viral Nucleocapsid Protein of Transmissible Gastroenteritis
Coronavirus (TGEV) Is Cleaved by Caspase-6 and -7 during
TGEV-Induced Apoptosis
Jean-François
Eléouët,1,*
Elizabeth A.
Slee,2,
Françoise
Saurini,1
Nathalie
Castagné,1
Didier
Poncet,1
Carmen
Garrido,3
Eric
Solary,3 and
Seamus J.
Martin2,
Unité de Virologie et Immunologie
Moléculaires, Institut National de la Recherche Agronomique,
78350 Jouy-en-Josas,1 and U.F.R.
Médecine et Pharmacie, INSERM U517, 21000 Dijon,3 France, and Molecular Cell
Biology Laboratory, National University of Ireland, Maynooth, County
Kildare, Ireland2
Received 15 November 1999/Accepted 31 January 2000
 |
ABSTRACT |
The transmissible gastroenteritis coronavirus (TGEV), like many
other viruses, exerts much of its cytopathic effect through the
induction of apoptosis of its host cell. Apoptosis is coordinated by a
family of cysteine proteases, called caspases, that are activated during apoptosis and participate in dismantling the cell by cleaving key structural and regulatory proteins. We have explored the caspase activation events that are initiated upon infection of the human rectal
tumor cell line HRT18 with TGEV. We show that TGEV infection results in
the activation of caspase-3, -6, -7, -8, and -9 and cleavage of the
caspase substrates eIF4GI, gelsolin, and
-fodrin. Surprisingly, the
TGEV nucleoprotein (N) underwent proteolysis in parallel with the
activation of caspases within the host cell. Cleavage of the N protein
was inhibited by cell-permeative caspase inhibitors, suggesting that
this viral structural protein is a target for host cell caspases. We
show that the TGEV nucleoprotein is a substrate for both caspase-6 and
-7, and using site-directed mutagenesis, we have mapped the cleavage
site to VVPD359
. These data demonstrate that viral
proteins can be targeted for destruction by the host cell death machinery.
 |
INTRODUCTION |
Apoptosis is a physiological and
essential mechanism for controlling cell numbers in metazoan organisms
(reviewed in reference 24). Viruses have evolved
strategies to either inhibit or stimulate host cell apoptosis,
depending on the particular virus-host interaction. Many viruses, such
as herpesviruses, baculoviruses, and poxviruses, have developed
strategies to inhibit or delay apoptosis, which usually results in
increased virus production (23, 25, 31). Apoptosis of
infected cells may also be advantageous by facilitating virus
dissemination and limiting the host inflammatory response (31). In some situations, the death of virus-infected cells accounts for viral pathogenesis and related diseases. The capacity of
host cells to rapidly undergo cell death in response to virus infection
may be an important antiviral defense mechanism (23).
Transmissible gastroenteritis virus (TGEV) is a member of
the Coronaviridae family, a group of enveloped viruses
(33), and has a large, positive-stranded, capped and
polyadenylated RNA genome of 28.6 kb (9). This
enteropathogenic virus causes acute and fatal diarrhea in newborn
piglets. TGEV replicates in enterocytes and provokes villous atrophy,
is closely related to the human respiratory coronavirus HCoV-229E
(9), and can also infect the respiratory tract. Moreover,
some variant strains of TGEV, such as the porcine respiratory
coronavirus (PRCoV), have lost their intestinal tropism (11,
18). The Purdue-115 strain (10) and the Miller strain
(34) of TGEV have been shown to induce apoptosis in cell
lines expressing the porcine aminopeptidase N (APN), which is a
receptor for the virus (4). More recently, the murine
coronavirus MHV was also found to trigger apoptosis upon infection of
host cells (1).
Current evidence indicates that a family of proteases referred to as
caspases (cysteine aspartate-specific proteases) play a central role in
cell death by apoptosis. These proteases are synthesized as relatively
inactive proenzymes that are activated by proteolytic cleavage at the
onset of apoptosis (21, 32, 36, 41). The cleavage of
procaspases generates two subunits, which assemble as a heterotetramer.
Caspase activation involves a proteolytic cascade in which those with
long prodomains, such as procaspase-8, -9, or -10, are activated first.
In turn, these initiator caspases activate downstream proteases with
short prodomains, such as procaspase-3, -6, and -7. The proteolytic
cleavage of a limited number of essential cellular proteins by these
effector caspases is thought to be responsible for the phenotypic
changes that occur in cells undergoing apoptosis (21, 36,
41). The ability of the cell-permeative caspase inhibitor
N-benzyloxycarbonyl-Val-Ala-Asp-fluoro-methylketone (z-VAD.fmk) to inhibit TGEV-induced apoptosis in swine testis (ST)
cells suggests that caspases are involved in the cytopathic effect of
this virus (10).
The present study was undertaken to further explore the role of
caspases in apoptosis triggered by TGEV. Since porcine-specific caspase
antibodies were not available, we used the human rectal tumor
adenocarcinoma cell line HRT18, which was modified to express the
porcine APN (HRT18jap1). We observed that TGEV infection of HRT18jap1
cells resulted in the activation of caspase-3, -6, -7, -8, and -9, with
the activation of caspase-8 preceding that of other caspases. As
expected, TGEV-induced apoptosis was associated with caspase-mediated
cleavage of various cellular proteins, such as eIF4GI, gelsolin, and
-fodrin. Surprisingly, the TGEV nucleocapsid protein (N protein)
a
structural protein of the virus
also underwent caspase-mediated
proteolysis within the host cell. Further studies revealed that the
TGEV nucleocapsid protein could be cleaved by caspase-6 and -7 at a
site within the C terminus, which we have mapped to Asp359. These
results show that viral structural proteins are potential targets for
the host cell death machinery.
 |
MATERIALS AND METHODS |
Materials.
The broad-spectrum caspase inhibitor
z-VAD.fmk was purchased from Bachem (Bubendorf, Switzerland). The
caspase-8-selective inhibitor
N-benzyloxycarbonyl-Ile-Glu-Thr-Asp-fluoro-methylketone (z-IETD.fmk) and the cathepsin B inhibitor
N-benzyloxycarbonyl-Phe-Ala-fluoro-methylketone (z-FA.fmk)
were purchased from Calbiochem (Meudon, France). Anti-caspase-3, anti-caspase-7, and antigelsolin monoclonal antibodies were purchased from Transduction Laboratories (Lexington, Ky.), anti-caspase-6 polyclonal antibody was purchased from Upstate Biotechnology (Lake Placid, N.Y.), anti-caspase-8 monoclonal antibody was from Pharmingen (San Diego, Calif.), and anti-
-fodrin antibody was obtained from Chemicon International Inc. (Temecula, Calif.). Anti-caspase-9 antibody
was kindly provided by Doug Green (La Jolla Institute for Allergy and
Immunology, San Diego, Calif.), and purified recombinant caspase-3, -6, -7, and -8 were a gift from Guy Salvesen (The Burnham Institute, La
Jolla, Calif.). The anti-N antibodies 22.6, 5.1, and 19.1 have been
described previously (17). Rabbit antiserum against EIF4GII
(amino acids 1 to 480) was a gift of A. Gradi and N. Sonenberg (McGill
University, Montréal, Canada).
Plasmid constructions.
The N gene was derived from TGEV
strain Purdue-115 and was PCR amplified using the plasmid pTG2.18
(29) as a template with the following primers:
5'GAGGAGCATATGGCCAACCAGGGACAACGTGTC3'
5'GAGGAGCTCGAGGTTCGTTACCTCATCAATATTCTC3'. The
amplified DNA was cloned by insertion between the NdeI and XhoI sites in pET-25b(+) (Novagen) downstream of the T7
promoter sequence. The C-terminal-deletion mutants and D355E, D359E,
and D370E mutants were generated using the Pfu DNA
polymerase with the QuikChange site-directed mutagenesis kit
(Stratagene) according to the manufacturer's instructions, with the
following primers: N-20+ (5'CCT GAT GCA TTA ATA TAG AAT TCT ACA
GAT GTG TTT G3') and N-20
(5'CAA ACA CAT CTG TAG AAT TCT
ATA TTA ATG CAT CAG G3') for the N(1-362) mutant, N-41+
(5'GAA CAG AGA AAA TGA ATT CCT CGT TCT AAA TC3') and N-41
(5'GAT TTA GAA CGA GGA ATT CAT TTT CTC TGT TC3') for the
N(1-341) mutant, and N-63+ (5'GAT CCT AAG ACT TGA GAA TTC CTT CAG
CAG3') and N-63
(5'CTG CTG AAG GAA TTC TCA AGT CTT AGG
ATC3') for the N(1-319) mutant. To facilitate the screening of
recombinant plasmids, an EcoRI restriction site was
introduced downstream of the stop codons. The D355E, D359E, and D359A
mutations were done using the following primers: D355E+ (5'AGGTCAGAGCAAGAGGTAGTACCTGATGCA3'), D355E
(5'TGCATCAGGTACTACCTCTTGCTCTGACCT3'), D359E+
(5'GATGTGGTACCTGAGGCATTAATAGAA3'), D359E
(5'TTCTATTAATGCCTCAGGTACCACATC3'), D359A+
(5'GATGTGGTACCTGCAGCATTAATAGAA3'), and D359A
(5'TTCTATTAATGCTGCAGGTACCACATC3'). The D355E mutation
destroyed a KpnI restriction site; the D359A and D359E
mutations destroyed an NsiI restriction site. Sequence analysis was carried out to confirm the amino acid changes. Plasmids encoding each of the caspases have been described previously
(35).
Virus and cells.
The American high-cell-passage Purdue-115
strain of TGEV was used as a virus source and propagated on ST cells as
described previously (17). Cells were infected for 1 h
with TGEV, with the end of infection designated 0 h postinfection
(p.i.). The human rectal tumor cell line HRT18 stably expressing the
porcine APN (HRT18jap1) has been described previously (5).
ST and HRT18 cells were maintained as monolayer cultures in minimal
essential Eagle's medium and RPMI medium, respectively, containing
10% fetal calf serum, penicillin (100 IU/ml), and streptomycin (100 µg/ml).
DNA fragmentation assay.
At different times p.i.,
106 cells were collected, together with the floating cells
in the supernatant, and low-molecular-weight DNA was extracted as
described previously (10). DNA preparations were then
electrophoresed through 2% agarose gels and stained with ethidium bromide.
Fluorescence microscopy.
Cells (106) (including
floating cells) were collected and fixed in 70% ethanol for 1 h,
washed in phosphate-buffered saline, incubated for 15 min at 37°C
with 100 µM RNase A, and stained by propidium iodide as described
previously (10). Cells were centrifuged onto microscope
slides for 5 min at 100 × g using a Cytospin II
centrifuge (Shandon) and were then mounted with Glycergel (Dako).
Stained cell preparations were then observed by UV microscopy.
Cell fractionation and subcellular localization of cytochrome
c.
Mitochondrial and cytosolic (S100) fractions for
cytochrome c release studies were prepared and analyzed by
Western blotting as described previously (38).
SDS-PAGE and Western blot analysis.
For caspase activation
and N cleavage studies, 106 cells were mock or TGEV
infected using a multiplicity of infection (MOI) of 5. Floating and
adherent cells were lysed together in 100 µl of standard Laemmli
buffer. From each sample, 10 µl was subjected to standard sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under
reducing conditions and was transferred onto 0.45-µm reinforced
nitrocellulose membranes (Optitran BA-S85; Schleicher & Schuell, Inc.).
The membranes were blocked in PBS containing 5% nonfat dry milk powder
for 15 min before incubation with the appropriate antibodies described
in "Materials," above. Bound antibodies were detected using
appropriate peroxidase-coupled secondary antibodies (Amersham),
followed by detection using the Supersignal chemiluminescence system
(Pierce), as previously described (22, 35). Western blotting
using the EIF4GI antibody was done as described previously
(28).
Cell-free reactions.
[35S]methionine-labeled N
protein and caspase-7 were in vitro transcribed and translated using
the TNT kit (Promega). Reactions were done using 1 µg of plasmid in a
50-µl transcription/translation reaction mixture containing 2 µl of
translation grade [35S]methionine (1,000 µCi/ml; ICN).
Cell extracts were generated from Jurkat T lymphoblastoid cells as
previously described (35). Depletion of caspase-3 from cell
extracts was done as described previously (35), by
incubation with 50 µl of either anti-caspase-3 antibody or a control
(anti-RelA; Santa Cruz Biotechnology) rabbit polyclonal. For cell-free
reactions, 10 µl of cell extract (~5 mg/ml) and 1 µl of
transcription/translation reaction products were combined. In vitro
apoptosis was induced by the addition of bovine heart cytochrome
c to extracts at a final concentration of 50 µg/ml and the
addition of dATP to a final concentration of 1 mM.
[35S]methionine-labeled N was then incubated in cell
extracts at 37°C in the presence or absence of cytochrome
c and dATP for periods of up to 2 h. Reaction products
were removed at times indicated below and frozen at
70°C for the
subsequent SDS-PAGE and fluorographic determination of substrate
cleavage profiles or caspase activation.
In vitro cleavage by caspases of truncated or mutated N.
Truncations or point mutations of N were transcribed and translated in
vitro in the presence of [35S]methionine as described
above. One to two microliters of the transcription/translation reaction
products was incubated for 2 h at 37°C with or without purified
recombinant caspases, prepared as described previously (39),
in a total reaction volume of 10 µl. Reactions were carried out in
protease reaction buffer {20 mM
piperazine-N,N'-bis(2 ethanesulfonic acid)-KOH
(pH 7.2), 100 mM NaCl, 1 mM EDTA, 0.1%
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate, 10%
sucrose, 10 mM dithiothreitol}. Breakdown products were analyzed by
SDS-PAGE followed by fluorography.
 |
RESULTS |
TGEV triggers caspase-dependent apoptosis in human HRT18
cells expressing the TGEV receptor.
It has been previously shown
that HRT18jap1 cells are sensitive to TGEV infection, as demonstrated
by the synthesis of viral antigens and cytopathic effects, although
these cells do not produce significant amounts of infectious TGEV
virions (6). As observed with the porcine and canine cell
lines previously tested (10), HRT18jap1 cells infected by
TGEV (MOI, 5) showed typical features of apoptosis at 18 h p.i.
(Fig. 1A). As expected, the synthetic caspase inhibitor z-VAD.fmk or z-IETD.fmk inhibited TGEV-induced DNA
fragmentation in HRT18jap1 cells (Fig. 1B). As previously observed with
ST cells (10), treatment of HRT18jap1 cells with z-VAD.fmk
prior to infection also inhibited nuclear condensation and cell
shrinkage (Fig. 1A).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 1.
TGEV-induced apoptosis in HRT18 cells is caspase
dependent. Confluent cell monolayers were infected with TGEV at an MOI
of 5 and incubated for the indicated times at 38.5°C. (A)
Fluorescence microscopy of nuclei from HRT18 jap1 cells mock infected,
TGEV infected, and TGEV infected in the presence of z-VAD.fmk (100 µM), as indicated. Nuclei were stained with propidium iodide 24 h p.i. (magnification, ×500). (B) Time course of internucleosomal DNA
cleavage in HRT18jap1 cells. Low-molecular-weight DNA was extracted at
the indicated times p.i. from TGEV- or mock-infected cells either left
untreated or treated with 100 µM z-IETD.fmk and 100 µM z-VAD.fmk,
as indicated. DNA marker band sizes (lane m) are indicated in base
pairs.
|
|
TGEV triggers the processing of procaspase-3, -6, -7, -8, and -9 in
HRT18jap1 cells.
To explore the caspase activation events
initiated during TGEV-induced apoptosis, we prepared lysates from
TGEV-infected cells at different times p.i. Proteins from these lysates
were then probed with a panel of caspase-specific antibodies. Figure
2A shows that upon infection of the cells
with TGEV, caspase-3, -6, -7, -8, and -9 were processed, as assessed by
the disappearance of the proforms of these proteases and
depending on
the antibody used for immunoblotting
the appearance of breakdown
products corresponding to the sizes of their mature forms.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 2.
Processing of multiple caspases and proteolysis of
caspase substrates during TGEV-induced apoptosis of HRT18 cells. (A)
Time course analysis of caspase-3, -6, -7, -8, and -9 processing; (B)
kinetics of cleavage of the caspase substrates -fodrin, gelsolin,
and eIF4GI during TGEV-induced apoptosis. At the indicated times p.i.,
cell lysates (105 cell equivalents per lane) from mock- or
TGEV-infected cells were separated by SDS-PAGE and transferred to
nitrocellulose membranes by Western blotting, followed by probing for
the indicated proteins. Numbers at the right are molecular masses, in
kilodaltons.
|
|
Caspase-8 processing was consistently detected prior to that of the
other proteases, suggesting that caspase-8 was the most
proximally
activated caspase in this context. Caspase-6 processing,
as assessed by
the disappearance of the zymogen form of the protease
(the antibody
used did not detect the mature protease), was also
detected early in
response to TGEV infection (8 to 10 h p.i.),
followed by the
processing of caspase-3, -7, and -9. Maturation
of caspase-3 was
detected between 12 and 14 h p.i. and correlated
with the onset of
cleavage of eIF4GI, a well-characterized caspase-3
substrate (Fig.
2B).
Two other caspase-3 substrates, gelsolin
and

-fodrin, appeared to be
cleaved prior to appreciable processing
of caspase-3 (by 6 and 9 h
p.i., respectively) (Fig.
2B). This
suggests that processing of these
substrates may be partly mediated
by other caspases, such as caspase-6
or -8, or that biochemically
undetectable caspase-3 is already present
at these time
points.
TGEV infection induces the redistribution of cytochrome
c from mitochondria to the cytosol.
Cytochrome
c is known to translocate from the mitochondria to the
cytosol during apoptosis (15, 44), resulting in the activation of caspase-9 through the formation of a complex including cytochrome c, dATP, Apaf-1, and procaspase-9
(20). Because caspase-9 was activated upon TGEV infection,
we explored whether cytochrome c redistribution occurred
during this form of apoptosis. Figure 3
shows that cytochrome c was released from mitochondria
between 6 and 12 h p.i., preceding caspase-9 activation (Fig. 2A).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Redistribution of mitochondrial cytochrome c
accompanies TGEV-induced apoptosis in the human HRT18jap1 cell line. At
the indicated times, cell lysates were analyzed by Western blotting
with an anti-human cytochrome c antibody (Cyt. c) and, as a
control for mitochondrial localization, an anti-cytochrome oxidase
(COX) antibody. M, mitochondrial fraction; C, cytosolic fraction.
|
|
The TGEV nucleocapsid protein is cleaved during infection in a
caspase-dependent manner.
The nucleocapsid protein of
coronaviruses is believed to be the most abundant viral protein present
at all stages of infection (reviewed in reference
19). To confirm productive viral infection of the
cells used in this study, we examined the accumulation of the TGEV
nucleocapsid protein within the host cells. As shown in Fig.
4A, significant synthesis of N protein
was observed 4 h p.i. in ST cells and 6 h p.i. in HRT18jap1
cells. At later time points, we observed the appearance of a
faster-migrating band that cross-reacted with the anti-TGEV
nucleocapsid protein antibody. This N' band appeared around 8 h
p.i. in ST cells and slightly later in HRT18jap1 cells. The apparent
molecular masses of the faster-migrating form of N (41 kDa) were
identical in the two cell lines.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4.
The TGEV nucleocapsid protein is degraded during
infection in a caspase-dependent manner. (A) Kinetics of N synthesis
and subsequent degradation (N') in ST and HRT18jap1 cells. Cell lysates
were prepared at the indicated times p.i. and subsequently analyzed by
Western blotting using anti-N antibodies. Numbers at the right are
molecular masses, in kilodaltons. (B) Appearance of N' is inhibited by
the cell-permeative caspase inhibitor z-VAD.fmk but not by the
cathepsin B cell-permeative inhibitor z-FA.fmk. At 0 h p.i., cells
were treated either with 100 µM z-VAD.fmk or with 100 µM z-FA.fmk,
as indicated. Cells were lysed at 16 h p.i., followed by analysis
of N by Western blotting.
|
|
To determine whether the N' band could be the product of a
caspase-mediated TGEV nucleocapsid protein attack during apoptosis
of
the host cell, we used the cell-permeative caspase inhibitors
z-VAD.fmk
and z-IETD.fmk. As shown in Fig.
4B, the appearance
of the
faster-migrating form of N was abolished by z-VAD.fmk in
ST and
HRT18jap1 cells. The peptide z-IETD.fmk also inhibited
the appearance
of the N' band in HRT18jap1 cells (data not shown).
In contrast, the
cathepsin B inhibitor z-FA.fmk did not inhibit
the appearance of the N'
fragment. These data strongly suggested
that N' was a proteolytic
fragment of N generated by caspase-mediated
cleavage. Thus, cleavage of
N seemed to be a direct consequence
of the induction of apoptosis in
TGEV-infected cells, with the
viral nucleocapsid protein coming under
direct attack by the host
cell death machinery. The observation that N
was cleaved by caspases
during viral infection suggested that this
could be a strategy
adopted by the host cells for limiting virus
production. As a
preliminary approach to testing this possibility, we
treated TGEV-infected
cells with the caspase inhibitor z-VAD.fmk to
block caspase-mediated
cleavage of N. However, this approach did not
significantly enhance
viral yields by ST cells, nor did it restore
virus production
by HRT18jap1 cells (reference
10
and data not
shown).
Cleavage of TGEV nucleocapsid protein in cell extracts.
To
explore further the possibility that the TGEV nucleocapsid protein is a
caspase substrate, we used a cell model of apoptosis that recapitulates
the Apaf-1-caspase-9-driven caspase cascade (35). Members
of our group have previously shown that the addition of cytochrome
c and dATP to Jurkat T lymphoblastoid cell extracts is
sufficient to trigger the caspase-9-dependent activation of caspase-2,
-3, -6, -7, -8, and -10 (35). In this system, caspase-9 activates caspase-3 and -7, and caspase-3 then in turn activates caspase-2 and -6. Finally, caspase-6 drives the activation of caspase-8
and -10 (35).
Using this system, we explored whether N was cleaved during apoptosis
triggered by the addition of cytochrome
c and dATP to
Jurkat
cell extracts. Figure
5A shows that
35S-labeled N, prepared by in vitro transcription and
translation,
was cleaved in cell extracts where cytochrome
c
and dATP were
added but not in control extracts. Immunodepletion of
caspase-3
from the extracts

which also abolishes activation of
caspase-2,
-6, -8, and -10, which are downstream of caspase-3 in this
system
(
35), and partly abolishes the activation of
caspase-7

blocked
the cytochrome
c- and dATP-induced
cleavage of N (Fig.
5B). This
observation implicated caspase-3, or a
caspase activated downstream
of caspase-3 in this system, in the
cleavage of N.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
Cleavage of the TGEV N protein in Jurkat cell extracts
requires caspase-3. (A) 35S-labeled N, prepared by coupled
in vitro transcription/translation, was incubated for the indicated
times in Jurkat cell extracts in the presence or absence of cytochrome
c (Cyt c) (50 µg/ml) and dATP (1 mM) as indicated,
followed by analysis by SDS-PAGE and fluorography. (B) Immunodepletion
of caspase-3 from Jurkat extracts abolished proteolytic cleavage of the
TGEV N protein and partially inhibited caspase-7 activation. Ab,
antibody; Ctrl, control; Casp-3, anti-caspase-3. (C)
35S-labeled TGEV N was incubated for 2 h with the
indicated concentrations of purified recombinant caspase-3, -6, -7, or
-8, as described in Materials and Methods, and reaction products were
analyzed by SDS-PAGE and fluorography. Numbers at the right are
molecular masses, in kilodaltons.
|
|
TGEV N is cleaved by caspase-6 and -7 in vitro.
To explore the
nature of the caspase(s) that is capable of cleaving the N protein, we
exposed N to recombinant caspase-3, -6, -7, and -8 over a range of
concentrations. Figure 5C shows that caspase-6 and -7 were capable of
cleaving N very efficiently, whereas caspase-3 cleaved poorly and
caspase-8 failed to cleave at any of the concentrations tested.
Site-directed mutagenesis identifies the VVPD359
sequence as the caspase cleavage site within the N protein.
A
number of potential caspase cleavage motifs are present in the N and C
termini of the N protein (Fig. 6A). We
attempted to microsequence cleaved N but were unsuccessful, suggesting
that the N terminus of the protein was blocked and that cleavage
occurred at the C terminus (data not shown). We therefore constructed
three N deletion mutants lacking different portions of the C terminus by introducing stop codons at the positions corresponding to amino acids E363, R342, and G320. These mutants produced proteins that terminated at amino acids 362, 341, and 319, respectively (Fig. 6A).
The mutant N proteins were incubated with recombinant caspase-3, -6, and -7 to assess whether cleavage still occurred. As shown in Fig. 6B,
cleavage was detected with the wild-type protein N(1-382), and a small
downshift was observed with the N(1-362) deletion mutant but not with
the N(1-341) and N(1-319) mutants. This indicated that the caspase
cleavage site(s) was located between R342 and E363, implicating Asp
residues, D355 and D359, which are present in this region.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 6.
The TGEV N protein is cleaved by caspase-3, -6, and -7 between residues 342 and 363. (A) Schematic representation of wild-type
TGEV N and the potential caspase cleavage sites within the molecule,
along with the different C-terminal-deletion mutants generated by the
introduction of stop codons using site-directed mutagenesis. The
lengths of the wild-type and truncated proteins and the amino acid
positions of the potential caspase cleavage sites are indicated. (B)
35S-labeled wild-type N (WT) or the indicated N truncations
were incubated for 2 h either alone or with purified recombinant
caspase-3, -6, or -7 at final concentrations of 10 µg/ml. Reaction
products were analyzed by SDS-PAGE and fluorography. Numbers at the
right are molecular masses, in kilodaltons.
|
|
We then constructed a panel of point mutants containing amino acid
substitutions for Asp355, Asp359, or Asp370 and assessed
the cleavage
of these mutants by caspase-3, -6, and -7. Figure
7 shows that in all cases, the
replacement of Asp359 substantially
abolished the cleavage of N by the
three caspases tested, thereby
implicating the VVPD
359
motif as the major cleavage site. The mutation of Asp355 had
no effect
on the cleavage of N by caspase-6 or -7. The mutation
of Asp370 had no
inhibitory effect with any of the caspases. Although
the mutation of
Asp359 to Glu substantially inhibited caspase-7-mediated
N proteolysis,
some cleavage was consistently detected with this
mutant. This suggests
that caspase-7 also cleaves at another (non-Asp)
site within N or that
this protease can cleave after Glu to some
degree.

View larger version (92K):
[in this window]
[in a new window]
|
FIG. 7.
Mapping and identification of the caspase cleavage sites
within the TGEV N protein. The indicated 35S-labeled N
point mutants were incubated for 2 h either alone or with purified
recombinant caspase-3, -6, or -7 at final concentrations of 10 µg/ml.
Reaction products were analyzed by SDS-PAGE and fluorography.
|
|
 |
DISCUSSION |
Several viruses have been shown to encode proteins which inhibit
or activate the apoptotic process by interacting with various cellular
components (for review, see references 23, 25, and 31). Viral proteins that inhibit cell death could
facilitate virus replication, host cell transformation, or tumor
progression (16, 40). Virus-induced apoptosis of host cells
could either facilitate virus dissemination (7) or be part
of the host defense response invoked to counteract viral infection
(3). The present study adds a new dimension to the last
possibility by suggesting that infected cells could attack the virus
from within through caspase-mediated proteolysis of an essential
structural protein. During review of this report, Zhirnov et al. also
reported N-terminal cleavage of the influenza virus nucleocapsid
protein by caspases (45), indicating that many viruses might
be targeted by host cell caspases.
TGEV infection is shown to provoke apoptosis of HRT18 cells that have
been modified to express the porcine APN. Cell death has been
demonstrated to be triggered through caspase-dependent and
caspase-independent pathways (13, 42). TGEV induces cell death through a caspase-dependent mechanism that involves the processing of two initiator enzymes (caspase-8 and -9), as well as
three downstream effector caspases (caspase-3, -6, and -7). Processing
of caspase-8 was detected before that of the other caspases, and
treatment of cells with a caspase-8-selective inhibitor (z-IETD.fmk)
inhibited apoptosis-associated DNA cleavage, suggesting that caspase-8
might be the primary initiator caspase in this context. Caspase-8 has
been recently shown to be activated during the apoptosis of erythroid
cells infected with the human parvovirus B19 (37) as well as
during the death of cells infected with the Sendai virus
(2). Although caspase-8 is the first activated caspase in
CD95 ligand- and tumor necrosis factor alpha-mediated cell death, these
receptors were shown not to be required for caspase-8 activation in
cells infected by the latter virus (2).
The most striking finding of the present study is that a structural
protein of the virus
the TGEV nucleocapsid protein
is degraded during
the apoptosis of infected cells through caspase-mediated cleavage. This
cleavage was replicated in Jurkat cell extracts under conditions
designed to trigger caspase activation. The immunodepletion of
caspase-3 from the cell extracts abolished proteolytic cleavage of the
N protein, indicating that caspase-3, or a downstream protease activated by caspase-3, was required for N protein cleavage. Exploring this further, we found that TGEV N was efficiently cleaved in vitro by
recombinant caspase-6 and -7 and rather inefficiently cleaved by
caspase-3. Because caspase-6 was activated in TGEV-infected cells as
early as 8 h p.i., this caspase is likely to be responsible for N
cleavage in vivo, since cleavage was typically detected at 10 h
p.i. in TGEV-infected HRT18jap1 cells. The number of proteins identified as substrates for caspase-6 and caspase-7 remains limited (reviewed in reference 8). Using site-directed
mutagenesis, we identified the site of caspase-mediated cleavage in the
N protein as VVPD359. Interestingly, both caspase-6 and
caspase-7 cleave human protein MDM2 at a DVPD site (12).
This sequence is similar to the VVPD sequence of the TGEV nucleocapsid
protein that is cleaved by caspase-6 and caspase-7.
The appearance of a shorter form of the N protein late in infection has
been observed previously with a different strain of TGEV (FS772/70)
during infection of porcine LLC-PK1 cells (14). Degradation
of the nucleocapsid protein from 47 to 42 kDa was more marked in the
LLC-PK1 cells than in other cell lines, and this was correlated with a
102-fold reduction in virus production. In addition, other
groups have reported for the nucleocapsid protein one or more
intracellular polypeptides with lower molecular masses than expected
(~2 to 5 kDa less) in cells infected with murine (MHV), feline
(FIPV), bovine (BCV), and avian (IBV and TCV) coronaviruses (see
reference 19). The VVPD359 sequence that
is cleaved by caspases during TGEV infection is located 23 amino acid
residues upstream of the carboxy-terminal end of the N protein. This
VVPD sequence is also present in the C terminus of the MHV (residues
448 to 451) N protein and in the respiratory variant of TGEV called
PRCoV (residues 449 to 452). A perfect cleavage site (IETD) for group
III caspases, including caspase-6, is also present at the C terminus
(residues 385 to 388) of the human coronavirus HCoV-229E N protein.
These observations suggest that cleavage of viral nucleocapsid protein
by host cell caspases could be a general mechanism by which infected
cells eliminate coronaviruses.
Caspase-mediated cleavage of the N protein might preserve its RNA
binding domain, which is located in the central part of the protein
(19). Accordingly, the N' form of the MHV N protein was
shown to conserve its RNA binding properties (30). The
function of the acidic carboxy-terminal domain of coronavirus N protein remains unknown (19). There is a general agreement that only the full-length N protein is incorporated into coronavirus particles (19). This suggests that the cleaved form of N is unlikely
to be used to encapsidate RNA to form new virions. Thus, production of
virions might depend on the ability of the virus to replicate rapidly,
before the activation of caspases.
Other TGEV proteins contain potential cleavage sites for
caspases; e.g., the product of open reading frame 3a
(ORF3a)
the function of which is unknown
contains a DELD
sequence. This sequence has been identified as the cleavage site for
caspase-3 in D4-DGI, a regulator of the Rho family of GTPases that is
cleaved by caspase-3 in vitro (22, 26). Three (I/L/V)ExD
tetrapeptides are present in the ORF1a product beginning at residues
132 (IEGD), 1010 (VEED), and 1350 (LEPD), and one (VEPD) is present
beginning at residue 4806 of the predicted product of ORF1ab, in the
polymerase locus. These sequences correspond to the consensus VExD of
group III caspases (27, 43), including caspase-6 and
caspase-8, that are activated early during TGEV infection. Whether
these potential cleavage sites are targeted by caspases during host
cell apoptosis remains to be determined.
In conclusion, we have shown that TGEV triggers caspase activation
events during infection. A recent study performed with MHV indicated
that the E structural protein could be responsible for this activation,
whereas other MHV structural proteins, including the M protein, the N
protein, and the hemagglutinin-esterase protein, were not involved in
virus-induced cell death (1). Some of the caspases activated
by TGEV, most likely caspase-6 and/or caspase-7, cleave the viral
nucleocapsid protein. This event appears to have limited influence, if
any, on viral yields. Ongoing studies might determine whether
caspase-mediated N protein cleavage plays a role in viral
pathogenicity. Understanding of the mechanisms by which TGEV interacts
with host cell death machinery will lead to a better understanding of
viral pathogenicity and might also shed light on the cell death
machinery itself.
 |
ACKNOWLEDGMENTS |
We thank B. Delmas and E. Kut for providing the pET-N plasmid, A. Gradi and N. Sonenberg (McGill University) for kindly providing the
eIF4G antibody, L. Besnardeau, Nathalie Druesne, and Sonia Douzet for
technical help, Cynthia Jaeger for DNA sequencing, Philippe Marianneau
for helpful discussions, and Jean-Claude Huet for protein sequencing.
This work was supported by funding from the Institut National de la
Recherche Agronomique (INRA) (to J.F.E.) and from the Wellcome Trust
(to S.J.M.). S.J.M. is a Wellcome Trust Senior Fellow in Biomedical
Science (047580).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: INRA,
Unité de Virologie et Immunologie Moléculaires, 78352 Jouy-en-Josas Cedex, France. Phone: (33) 1 34 65 26 41. Fax: (33) 1 34 65 26 21. E-mail: eleouet{at}biotec.jouy.inra.fr.
Present address: Division of Molecular and Cell Biology, The
Smurfit Institute of Genetics, Trinity College, Dublin 2, Ireland.
 |
REFERENCES |
| 1.
|
An, S.,
C.-J. Chen,
X. Yu,
J. L. Leibowitz, and S. Makino.
1999.
Induction of apoptosis in murine coronavirus-infected cultured cells and demonstration of E protein as an apoptosis inducer.
J. Virol.
73:7853-7859[Abstract/Free Full Text].
|
| 2.
|
Bitzer, M.,
F. Prinz,
M. Bauer,
M. Spiegel,
W. J. Neubert,
M. Gregor,
K. Schulze-Osthoff, and U. Lauer.
1999.
Sendai virus infection induces apoptosis through activation of caspase-8 (FLICE) and caspase-3 (CPP32).
J. Virol.
73:702-708[Abstract/Free Full Text].
|
| 3.
|
Clouston, W. M., and J. F. Kerr.
1985.
Apoptosis, lymphocytotoxicity and the containment of viral infections.
Med. Hypothesis
18:399-404[CrossRef][Medline].
|
| 4.
|
Delmas, B.,
J. Gelfi,
R. l'Haridon,
L. K. Vogel,
H. Sjöstrom,
O. Norén, and H. Laude.
1992.
Aminopeptidase N is a major receptor for the enteropathogenic coronavirus TGEV.
Nature
357:417-419[CrossRef][Medline].
|
| 5.
|
Delmas, B.,
J. Gelfi,
H. Sjöström,
O. Noren, and H. Laude.
1993.
Further characterization of aminopeptidase-N as a receptor for coronaviruses.
Adv. Exp. Med. Biol.
342:293-298[Medline].
|
| 6.
|
Delmas, B.,
E. Kut,
J. Gelfi, and H. Laude.
1995.
Overexpression of TGEV cell receptor impairs the production of virus particles.
Adv. Exp. Med. Biol.
380:379-385[Medline].
|
| 7.
|
Devireddy, L. R., and C. J. Jones.
1999.
Activation of caspases and p53 by bovine herpesvirus 1 infection results in programmed cell death and efficient virus release.
J. Virol.
73:3778-3788[Abstract/Free Full Text].
|
| 8.
|
Earnshaw, W. C.,
L. M. Martins,
H. Scott, and S. H. Kaufmann.
1999.
Mammalian caspases: structure, activation, substrates, and functions during apoptosis.
Annu. Rev. Biochem.
68:383-424[CrossRef][Medline].
|
| 9.
|
Eléouët, J.-F.,
D. Rasschaert,
P. Lambert,
L. Levy,
P. Vende, and H. Laude.
1995.
Complete sequence (20 kilobases) of the polyprotein-encoding gene 1 of transmissible gastroenteritis virus.
Virology
206:817-822[CrossRef][Medline].
|
| 10.
|
Eleouet, J.-F.,
S. Chilmonczyk,
L. Besnardeau, and H. Laude.
1998.
Transmissible gastroenteritis coronavirus induces programmed cell death in infected cells through a caspase-dependent pathway.
J. Virol.
72:4918-4924[Abstract/Free Full Text].
|
| 11.
|
Enjuanes, L., and B. A. M. Van der Zeijst.
1995.
Molecular basis of transmissible gastroenteritis virus epidemiology, p. 337-364.
In
S. G. Siddell (ed.), The Coronaviridae. Plenum Press, New York, N.Y.
|
| 12.
|
Erhardt, P.,
K. J. Tomaselli, and G. M. Cooper.
1997.
Identification of the MDM2 oncoprotein as a substrate for CPP32-like apoptotic proteases.
J. Biol. Chem.
272:15049-15052[Abstract/Free Full Text].
|
| 13.
|
Galvan, V.,
R. Brandimarti, and B. Roizman.
1999.
Herpes simplex virus 1 blocks caspase-3-independent and caspase-dependent pathways to cell death.
J. Virol.
73:3219-3226[Abstract/Free Full Text].
|
| 14.
|
Garwes, D. J.,
L. Bountiff,
G. C. Millson, and C. J. Elleman.
1984.
Defective replication of porcine transmissible gastroenteritis virus in a continuous cell line.
Adv. Exp. Med. Biol.
178:79-93.
|
| 15.
|
Kluck, R. M.,
E. Bossy-Wetzel,
D. R. Green, and D. D. Newmeyer.
1997.
The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis.
Science
275:1132-1136[Abstract/Free Full Text].
|
| 16.
|
LaCasse, E. C.,
S. Baird,
R. G. Korneluk, and A. E. MacKenzie.
1998.
The inhibitors of apoptosis (IAPs) and their emerging role in cancer.
Oncogene
17:3247-3259[CrossRef][Medline].
|
| 17.
|
Laude, H.,
J.-M. Chapsal,
J. Gelfi,
S. Labiau, and J. Grosclaude.
1986.
Antigenic structure of transmissible gastroenteritis virus. I. Properties of monoclonal antibodies directed against virion proteins.
J. Gen. Virol.
67:119-130[Abstract/Free Full Text].
|
| 18.
|
Laude, H.,
K. Van Reeth, and M. Pensaert.
1993.
Porcine respiratory coronavirus: molecular features and virus-host interactions.
Vet. Res.
24:125-150[Medline].
|
| 19.
|
Laude, H., and P. Masters.
1995.
The coronavirus nucleocapsid protein, p. 141-158.
In
S. G. Siddell (ed.), The Coronaviridae. Plenum Press, New York, N.Y.
|
| 20.
|
Li, P.,
D. Nijhawan,
I. Budihardjo,
S. M. Srinivasula,
M. Ahmad,
E. S. Alnemri, and X. Wang.
1997.
Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade.
Cell
91:479-489[CrossRef][Medline].
|
| 21.
|
Martin, S. J., and D. R. Green.
1995.
Protease activation during apoptosis: death by a thousand cuts?
Cell
82:349-352[CrossRef][Medline].
|
| 22.
|
Martin, S. J.,
G. P. Amarante-Mendes,
L. Shi,
T. H. Chuang,
C. A. Casiano,
G. A. O'Brien,
P. Fitzgerald,
E. M. Tan,
G. M. Bokoch,
A. H. Greenberg, and D. R. Green.
1996.
The cytotoxic cell protease granzyme B initiates apoptosis in a cell-free system by proteolytic processing and activation of the ICE/CED-3 family protease, CPP32, via a novel two-step mechanism.
EMBO J.
15:2407-2416[Medline].
|
| 23.
|
McFadden, G., and M. Barry.
1998.
How poxviruses oppose apoptosis.
Semin. Virol.
8:429-442[CrossRef].
|
| 24.
|
Miller, L. K., and E. White.
1998.
Apoptosis in virus infection.
Semin. Virol.
8:443-444[CrossRef].
|
| 25.
|
Miller, L. K.,
W. J. Kaiser, and S. Seshagiri.
1998.
Baculovirus regulation of apoptosis.
Semin. Virol.
8:445-452[CrossRef].
|
| 26.
|
Na, S.,
T. H. Chuang,
A. Cunningham,
T. G. Turi,
J. H. Hanke,
G. M. Bokoch, and D. E. Danley.
1996.
D4-GDI, a substrate of CPP32, is proteolyzed during Fas-induced apoptosis.
J. Biol. Chem.
271:11209-11213[Abstract/Free Full Text].
|
| 27.
|
Nicholson, D. W., and N. A. Thornberry.
1997.
Caspases: killer proteases.
Trends Biochem. Sci.
22:299-306[CrossRef][Medline].
|
| 28.
|
Piron, M.,
P. Vende,
J. Cohen, and D. Poncet.
1998.
Rotavirus RNA-binding protein NSP3 interacts with eIF4GI and evicts the poly(A) binding protein from eIF4F.
EMBO J.
17:5811-5821[CrossRef][Medline].
|
| 29.
|
Rasschaert, D.,
J. Gelfi, and H. Laude.
1987.
Enteric coronavirus TGEV: partial sequence of the genomic RNA, its organization and expression.
Biochimie
69:591-600[Medline].
|
| 30.
|
Robbins, S. G.,
M. F. Frana,
J. J. McGowan,
J. F. Boyle, and K. V. Holmes.
1986.
RNA-binding proteins of coronavirus MHV: detection of monomeric and multimeric N protein with an RNA overlay-protein blot assay.
Virology
150:402-410[CrossRef][Medline].
|
| 31.
|
Roulston, A.,
R. C. Marcellus, and P. E. Branton.
1999.
Viruses and apoptosis.
Annu. Rev. Microbiol.
53:577-628[CrossRef][Medline].
|
| 32.
|
Salvesen, G. S., and V. M. Dixit.
1997.
Caspases: intracellular signaling by proteolysis.
Cell
91:443-446[CrossRef][Medline].
|
| 33.
|
Siddell, S. G.
1995.
The Coronaviridae: an introduction, p. 1.
In
S. G. Siddell (ed.), The Coronaviridae. Plenum Press, New York, N.Y.
|
| 34.
|
Sirinarumitr, T.,
J. P. Kluge, and P. S. Paul.
1998.
Transmissible gastroenteritis virus induced apoptosis in swine testes cell cultures.
Arch. Virol.
143:2471-2485[CrossRef][Medline].
|
| 35.
|
Slee, E. A.,
M. T. Harte,
R. M. Kluck,
B. B. Wolf,
C. A. Casiano,
D. D. Newmeyer,
H. G. Wang,
J. C. Reed,
D. W. Nicholson,
E. S. Alnemri,
D. R. Green, and S. J. Martin.
1999.
Ordering the cytochrome c-initiated caspase cascade: hierarchical activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase-9-dependent manner.
J. Cell Biol.
144:281-292[Abstract/Free Full Text].
|
| 36.
|
Slee, E. A.,
C. Adrain, and S. J. Martin.
1999.
Serial killers: ordering caspase activation events in apoptosis.
Cell Death Differ.
6:1067-1074[CrossRef][Medline].
|
| 37.
|
Sol, N.,
J. Le Junter,
I. Vassias,
J. M. Freyssinier,
A. Thomas,
A. F. Prigent,
B. B. Rudkin,
S. Fichelson, and F. Morinet.
1999.
Possible interactions between the NS-1 protein and tumor necrosis factor alpha pathways in erythroid cell apoptosis induced by human parvovirus B19.
J. Virol.
73:8762-8770[Abstract/Free Full Text].
|
| 38.
|
Sordet, O.,
A. Bettaieb,
J. M. Bruey,
B. Eymin,
N. Droin,
M. Ivarsson,
C. Garrido, and E. Solary.
1999.
Selective inhibition of apoptosis by TPA-induced differentiation of U937 leukemic cells.
Cell Death Differ.
6:351-361[CrossRef][Medline].
|
| 39.
|
Stennicke, H. R., and G. S. Salvesen.
1997.
Biochemical characteristics of caspases-3, -6, -7, and -8.
J. Biol. Chem.
272:25719-25723[Abstract/Free Full Text].
|
| 40.
|
Tepper, C. G., and M. F. Seldin.
1999.
Modulation of caspase-8 and FLICE-inhibitory protein expression as a potential mechanism of Epstein-Barr virus tumorigenesis in Burkitt's lymphoma.
Blood
94:1727-1737[Abstract/Free Full Text].
|
| 41.
|
Thornberry, N. A., and Y. Lazebnik.
1998.
Caspases: enemies within.
Science
281:1312-1316[Abstract/Free Full Text].
|
| 42.
|
Trapani, J. A.,
D. A. Jans,
P. J. Jans,
M. J. Smyth,
K. A. Browne, and V. R. Sutton.
1998.
Efficient nuclear targeting of granzyme B and the nuclear consequences of apoptosis induced by granzyme B and perforin are caspase-dependent, but cell death is caspase-independent.
J. Biol. Chem.
273:27934-27938[Abstract/Free Full Text].
|
| 43.
|
Villa, P.,
S. H. Kaufmann, and W. C. Earnshaw.
1997.
Caspases and caspase inhibitors.
Trends Biochem. Sci.
22:388-393[CrossRef][Medline].
|
| 44.
|
Yang, J.,
X. Liu,
K. Bhalla,
C. N. Kim,
A. M. Ibrado,
J. Cai,
T. I. Peng,
D. P. Jones, and X. Wang.
1997.
Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked.
Science
275:1129-1132[Abstract/Free Full Text].
|
| 45.
|
Zhirnov, O. P.,
T. E. Konakova,
W. Garten, and H.-D. Klenk.
1999.
Caspase-dependent N-terminal cleavage of influenza virus nucleocapsid protein in infected cells.
J. Virol.
73:10158-10163[Abstract/Free Full Text].
|
Journal of Virology, May 2000, p. 3975-3983, Vol. 74, No. 9
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Klaiman, G., Petzke, T. L., Hammond, J., LeBlanc, A. C.
(2008). Targets of Caspase-6 Activity in Human Neurons and Alzheimer Disease. Mol. Cell. Proteomics
7: 1541-1555
[Abstract]
[Full Text]
-
Tan, Y. W., Fang, S., Fan, H., Lescar, J., Liu, D.X.
(2006). Amino acid residues critical for RNA-binding in the N-terminal domain of the nucleocapsid protein are essential determinants for the infectivity of coronavirus in cultured cells. Nucleic Acids Res
34: 4816-4825
[Abstract]
[Full Text]
-
Kalamvoki, M., Georgopoulou, U., Mavromara, P.
(2006). The NS5A Protein of the Hepatitis C Virus Genotype 1a Is Cleaved by Caspases to Produce C-terminal-truncated Forms of the Protein That Reside Mainly in the Cytosol. J. Biol. Chem.
281: 13449-13462
[Abstract]
[Full Text]
-
Law, P. T. W., Wong, C.-H., Au, T. C. C., Chuck, C.-P., Kong, S.-K., Chan, P. K. S., To, K.-F., Lo, A. W. I., Chan, J. Y. W., Suen, Y.-K., Chan, H. Y. E., Fung, K.-P., Waye, M. M. Y., Sung, J. J. Y., Lo, Y. M. D., Tsui, S. K. W.
(2005). The 3a protein of severe acute respiratory syndrome-associated coronavirus induces apoptosis in Vero E6 cells. J. Gen. Virol.
86: 1921-1930
[Abstract]
[Full Text]
-
Ito, N., Mossel, E. C., Narayanan, K., Popov, V. L., Huang, C., Inoue, T., Peters, C. J., Makino, S.
(2005). Severe Acute Respiratory Syndrome Coronavirus 3a Protein Is a Viral Structural Protein. J. Virol.
79: 3182-3186
[Abstract]
[Full Text]
-
Guan, M., Chen, H. Y., Tan, P. H., Shen, S., Goh, P.-Y., Tan, Y.-J., Pang, P. H., Lu, Y., Fong, P. Y., Chin, D.
(2004). Use of Viral Lysate Antigen Combined with Recombinant Protein in Western Immunoblot Assay as Confirmatory Test for Serodiagnosis of Severe Acute Respiratory Syndrome. CVI
11: 1148-1153
[Abstract]
[Full Text]
-
Mendez, E., Salas-Ocampo, E., Arias, C. F.
(2004). Caspases Mediate Processing of the Capsid Precursor and Cell Release of Human Astroviruses. J. Virol.
78: 8601-8608
[Abstract]
[Full Text]
-
Best, S. M., Shelton, J. F., Pompey, J. M., Wolfinbarger, J. B., Bloom, M. E.
(2003). Caspase Cleavage of the Nonstructural Protein NS1 Mediates Replication of Aleutian Mink Disease Parvovirus. J. Virol.
77: 5305-5312
[Abstract]
[Full Text]
-
Al-Molawi, N., Beardmore, V. A., Carter, M. J., Kass, G. E. N., Roberts, L. O.
(2003). Caspase-mediated cleavage of the feline calicivirus capsid protein. J. Gen. Virol.
84: 1237-1244
[Abstract]
[Full Text]
-
Krokhin, O., Li, Y., Andonov, A., Feldmann, H., Flick, R., Jones, S., Stroeher, U., Bastien, N., Dasuri, K. V. N., Cheng, K., Simonsen, J. N., Perreault, H., Wilkins, J., Ens, W., Plummer, F., Standing, K. G.
(2003). Mass Spectrometric Characterization of Proteins from the SARS Virus: A Preliminary Report. Mol. Cell. Proteomics
2: 346-356
[Abstract]
[Full Text]
-
Nyormoi, O., Wang, Z., Doan, D., Ruiz, M., McConkey, D., Bar-Eli, M.
(2001). Transcription Factor AP-2{alpha} Is Preferentially Cleaved by Caspase 6 and Degraded by Proteasome during Tumor Necrosis Factor Alpha-Induced Apoptosis in Breast Cancer Cells. Mol. Cell. Biol.
21: 4856-4867
[Abstract]
[Full Text]