Previous Article | Next Article 
Journal of Virology, April 2000, p. 3892-3898, Vol. 74, No. 8
Laboratory of Molecular Microbiology,
National Institute of Allergy and Infectious Diseases, National
Institutes of Health, Rockville, Maryland
208521; Institute of Genetics,
University of Nottingham, Queens Medical Centre, Nottingham NG7 2UH,
United Kingdom2; Division of
Pathobiology and Immunology, Oregon Health Sciences University,
Beaverton, Oregon 970063; Advanced
BioScience Laboratories Inc., Kensington, Maryland
208954; Institut Jean Godinot, 51100 Reims,5 and Université Pierre
et Marie Curie, Paris,6 France; and
Basic Research Laboratory, National Cancer Institute,
National Institutes of Health, Bethesda, Maryland
208927
Received 9 November 1999/Accepted 25 January 2000
Recently, we described a novel simian immunodeficiency virus
(SIVlhoest) from a wild-caught L'Hoest monkey (Cercopithecus lhoesti) from a North American zoo. To investigate whether
L'Hoest monkeys are the natural host for these viruses, we have
screened blood samples from 14 wild animals from the Democratic
Republic of Congo. Eight (57%) were found to be seropositive for SIV.
Nearly full-length genome sequences were obtained for SIV isolates from three of these monkeys and compared to the original isolate and to
other SIVs. The four samples of SIVlhoest formed a distinct cluster in
phylogenetic trees. Two of these isolates differed on average at only
about 5% of nucleotides, suggesting that they were epidemiologically
linked; otherwise, the SIVlhoest isolates differed on average by 18%.
Both the level of diversity and the pattern of its variation along the
genome were very similar to those seen among isolates of SIVagm from
vervet monkeys, pointing to similarities in the nature of, and
constraints on, SIV evolution in these two species. Discordant
phylogenetic relationships among the SIVlhoest isolates for different
genomic regions indicated that mosaic viruses have been generated by
recombination, implying that individual monkeys have been coinfected by
more than one strain of SIV. Taken together, these observations provide
strong evidence that L'Hoest monkeys constitute a natural reservoir
for SIV.
Simian immunodeficiency viruses
(SIVs) are lentiviruses that have been isolated from a number of
species of African primates (1, 3, 11, 13, 21-24, 29, 37, 40,
48). Phylogenetic analyses of those viruses that have been fully
characterized have revealed five major lineages (45). Four
of these lineages, represented by SIVcpz, SIVsm, SIVagm, and SIVsyk,
appear to naturally infect chimpanzees (Pan troglodytes)
(15, 39, 40), sooty mangabeys (Cercocebus atys)
(6, 7, 36), African green monkeys (Chlorocebus spp.) (1, 2, 8, 11, 13, 23, 27, 29, 37), and Sykes' monkeys
(Cercopithecus albogularis) (10), respectively. The fifth lineage was initially represented by SIVmnd, isolated from a
mandrill (Mandrillus sphinx) (48, 49) more than
10 years ago. Much more recently, we described a second member of this
lineage, SIVlhoest, isolated from a L'Hoest monkey
(Cercopithecus lhoesti) (21); while SIVlhoest was
found to be quite distant from SIVmnd, nevertheless, the two viruses
were clearly more closely related to each other than to any other SIV.
Since mandrills and L'Hoest monkeys are not closely related, it seems
clear that either SIVmnd or SIVlhoest must have arisen through
cross-species transmission.
A number of instances of cross-species transmissions of SIVs have
occurred in the past, most notably to humans, but also to other
primates in the wild and in captivity, complicating attempts to
understand the evolution of the primate lentiviruses. Thus, human
immunodeficiency virus type 1 (HIV-1) has been traced to three
independent transmissions of SIVcpz from Pan troglodytes troglodytes in the western part of central Africa (15, 25, 26, 40), while HIV-2 has resulted from several transmissions of
SIVsm in west Africa (5, 7, 17). SIVsm has also been introduced accidentally into macaques in captivity (18, 35), while in the wild, strains of SIVagm have been found in baboons (Papio spp.) (28, 51) and a patas monkey
(Erythrocebus patas) (4). Both members of the
fifth SIV lineage, SIVmnd and SIVlhoest, were isolated from animals
held in captivity (21, 48, 49), and so it is possible that
one (or both) species could have been the recipient of a recent
cross-species transmission. To enhance our understanding of the origins
and evolution of the primate lentiviruses, we have asked whether
L'Hoest monkeys are the natural hosts of this lineage of viruses.
We have taken two complementary approaches to address this question. In
the first, we isolated and characterized a lentivirus (SIVsun) from a
suntailed monkey (Cercopithecus solatus) (3). Suntailed and L'Hoest monkeys are genetically and phenotypically very
closely related (19), and SIVsun and SIVlhoest were found to
be each other's closest relatives. That result is consistent with
host-dependent evolution of SIV within this group of monkeys. The
second approach, described here, has been to investigate whether L'Hoest monkeys are indeed a natural reservoir for SIVlhoest by examining seroprevalence in wild animals and the extent and nature of
genetic diversity among SIVs from this species.
For this purpose, blood samples collected in 1988 from 14 wild-caught
L'Hoest monkeys (C. lhoesti) in the Haut-Congo and Kivu regions of the Democratic Republic of Congo (formerly Zaïre) were investigated for the presence of anti-SIV cross-reactive antibodies. Serology was performed using radioimmunoprecipitation (Fig.
1) with SIVmac251/K6W cell lysate
(12). Eight of the 14 monkeys had antibodies cross-reactive
with the gp160 envelope glycoprotein of SIVmac, consistent with a
seroprevalence of about 57% in this population. One animal (489) which
showed a very faint gp160 band was not considered to be SIV
seropositive because a repeated test showed a negative result (data not
shown). No cross-reactivity was observed with the Gag proteins of
SIVmac251 (p55 and p27). Virus was isolated by cocultivation of the
human Molt4clone8 cell line with phytohemagglutinin-stimulated
peripheral blood mononuclear cells from three of these monkeys
(447, 485, and 524), and the viruses were designated SIVlhoest447,
SIVlhoest485, and SIVlhoest524, respectively. DNA was extracted from
the SIV-infected Molt4-clone8 cells, and four fragments of the genome
(gag, pol, pol to env, and
env to long terminal repeat) were amplified by PCR from 500 ng of total cellular DNA. The PCR conditions were 94°C for 1 min, 55°C for 1.5 min, and 72°C for 1 min per 1 kb of amplified genome, and the following primer pairs were used (underlined sequences represent restriction enzyme sites introduced to facilitate cloning): lhoest gagF, 5'
CTAGCTCGAGGCGCCCGAACAGGGACTTCAAG 3'; lhoest
gagR, 5'
ATTCATTCGAACTATTGGTCGTCTGGAAAGAG 3'; lhoest
polF, 5' CTAGCTCGAGCTCTTTCCAGACGACCAATAGA 3'; lhoest polR, 5'
ATTCATTCGAAGCACCTTCTCCTTTCCACAGAA 3'; lhoest pol-endF, 5'
AGCTCTCGAGTCTGTGGAAAGGAGAAGGTGC 3'; lhoest
envR, 5' AGCTTTCGAAGCTGTCAGGCGTGCTTGGAGA
3'; lhoest envF, 5'
AGCTCTCGAGTCTCCAAGCACGCCTGACAGC 3'; and lhoest LTR-R,
5' AGCTTTCGAAAGAGCAGCTGCTTATATGCAG 3'. The resulting fragments were cloned into the pGEM-7Zf plasmid vector (Promega, Madison, Wis.) and sequenced by automated fluorescent sequencing (DNA sequencing kit; Perkin-Elmer Applied Biosystems, Warrington, United Kingdom). The four fragments were assembled to yield
an 8.6-kb continuous sequence which spanned all eight genes from the
three SIV isolates 447, 485, and 524.
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Patterns of Genomic Sequence Diversity among Their
Simian Immunodeficiency Viruses Suggest that L'Hoest Monkeys
(Cercopithecus lhoesti) Are a Natural Lentivirus
Reservoir
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
View larger version (90K):
[in a new window]
FIG. 1.
Radioimmunoprecipitation using SIVmac whole-cell lysate.
443, 444, 447, 448, 456, 485, 489, 524, 539, 545, 546, 548, 555, and
554 are plasma samples from L'Hoest monkeys which were wild caught in
the northeastern part of the Democratic Republic of Congo.
The three new SIVlhoest isolates from Africa were all found to exhibit
strong sequence similarity to the previously characterized SIVlhoest7
isolated from a zoo animal. Among the new isolates, two (447 and 485)
were very similar to one another, with 90 to 96% sequence identity,
depending on the gene product compared (Table
1). All other pairwise comparisons among
the four SIVlhoest isolates gave similar and lower identities for any
particular protein. On average, the conserved Gag and Pol proteins
shared a little under 90% identity, whereas the divergent Tat and Rev proteins were only around 70% identical (Table 1).
|
Parts of the envelope proteins of the four different SIVlhoest
isolates were quite highly conserved, as illustrated in an alignment of the surface unit (gp120) portion of the Env protein (Fig.
2). The four SIVlhoest isolates shared 27 conserved cysteines and 15 conserved N-linked glycosylation sites. The
amino acid identity was remarkable in the V3 loop homologue and the CD4
binding domain. The V3 loop was totally conserved among SIVlhoest447, 485, and 524 and had only one amino acid exchange in SIVlhoest7. This
finding is consistent with the conservation of the V3 loop in other SIV
isolates, for example, SIVagm and SIVcpz (27, 37, 50), but
in contrast to the V3 loop hypervariability of different HIV-1 isolates
(9).
|
To compare the identities within SIVlhoest isolates with that observed for other SIV strains, the range and mean identities between viral proteins were compared with that between SIVcpz isolates from P. troglodytes troglodytes (SIVcpzPtt/Gab-1 and US) and among SIVagm isolates from vervet monkeys (SIVagmVer3, 155, 9063, and Tyo-1) in Table 1. Excluding the comparison between the two closely related SIVlhoest isolates (447 and 485), the extent of protein sequence identity among SIVlhoest isolates was very similar to that among the SIVagmVer isolates. In contrast, the level of identity between the two SIVcpzPtt isolates was always lower than the means for SIVlhoest and SIVagmVer and lower than the minimum identity values for those isolates for all proteins except Vif. As shown in Table 1, the extent of divergence among SIVs isolated from the same species is considerably less than that observed between SIVlhoest and SIVsun, SIVcpzPtt and SIVcpzPts, and SIVagm from different species of African green monkeys (3, 37, 50).
To investigate further the extent of sequence difference across the
genome, diversity plots of concatenated gene sequences were constructed
(Fig. 3). The close genetic relationship
between SIVlhoest isolates 447 and 485 was found consistently across
the genome. Two regions of higher divergence between isolates 447 and
485 in the env gene were found to also exhibit higher
divergence in other comparisons among SIVlhoest isolates (Fig. 3A). The
relative extent of sequence difference in comparisons of isolate 447 versus isolates 7 and 524 was found to vary along the genome. For
example, in the env gene SIVlhoest524 was closer than 7 to
447, whereas in the 3' half of pol, this situation was
reversed (Fig. 3A). Such crossing of diversity plots can be diagnostic
of mosaic genomes generated by recombination (16). The
pattern and extent of nucleotide sequence divergence between
SIVlhoest isolates were very similar to those seen between
isolates of SIVagmVer. Across most of the genome, the SIVlhoest and
SIVagmVer plots tracked each other very closely (Fig. 3B). The simplest
interpretation of these data would be that, within each host species,
the times since the pairs of viruses last shared a common ancestor are
similar. It also suggests that the constraints on sequence evolution of
SIV in these two hosts are largely similar. The exceptional regions lie
at the 5' ends of gag and env and more
extensively across the 5' half of pol (Fig. 3B). These
unusual areas of the plots might again reflect past
recombination. However, the two plots shown were representative of
all pairwise comparison plots among SIVlhoest isolates and among
SIVagmVer isolates. Thus, it seems more likely that there are some
differences in the evolutionary constraints on these regions of the SIV
genome in the different hosts. The values in Table 1, based on overall
protein comparisons, suggest a uniformly greater level of divergence
between strains of SIVcpzPtt than between strains of SIVlhoest or
SIVagmVer compared to the divergence seen in the nucleotide diversity
plot (Fig. 3B). Using the latter method, a greater level of sequence
difference between SIVcpzPtt isolates was observed only in certain
regions of the genome, notably across gag, vpr,
and regions of env. Across most of pol and
vif, the SIVcpzPtt strains exhibit a level of divergence similar to that for SIVlhoest strains and SIVagmVer strains.
|
The phylogenetic relationships of the newly derived sequences were
estimated by both neighbor-joining and maximum likelihood analyses of
Gag, Pol, and Env proteins. Since both methods generated similar tree
topologies, only the neighbor-joining results are shown (Fig.
4). The SIVlhoest strains, SIVsun, and
SIVmnd formed a lineage-specific cluster with the SIVlhoest isolates
being clearly more related to one another than to SIVsun. As expected,
SIVlhoest isolates 447 and 485 were found to be closely related in all
three trees. However, the branching order among isolates 7 and 524 and the 447-485 cluster differed depending upon the protein used. Thus,
SIVlhoest7 clustered with isolates 447 and 485 in the Gag tree but with
isolate 524 in the Pol tree and was the outgroup among the SIVlhoest
isolates in the Env tree. This discordance among the topologies of the
trees was again suggestive of recombination during the evolution of
SIVlhoest.
|
To localize putative crossover points and evaluate the statistical
significance of the evidence for recombination among the SIVlhoest
lineages, informative site analysis (42, 43) was performed
on a four-sequence alignment of the concatenated proteome. Isolate 485 was taken as representative of the 447-485 cluster, and SIVsun was used
as a close outgroup. Informative sites (where two of the sequences
shared a common residue and the other two shared another) were defined
as either type 1, 2, or 3, depending on the branching order that they
supported (Table 2). The linear distribution of 92 such sites along the
proteome was mapped, and potential breakpoints between adjacent
informative sites were identified as those maximizing the discrepancy,
across the breakpoint, of numbers of sites supporting alternative
trees. The magnitude of the discrepancy was assessed by heterogeneity
chi-square values, and the significance of these values was assessed by
permutation tests. These analyses yielded four significant breakpoints,
defining five genomic regions (Table 2).
For example, the fourth breakpoint was located near the border between
the concatenated Env and Nef proteins. This separated a region
comprising much of the 3' half of the Env protein where the majority of
informative sites were of type 3, indicating a clustering of isolates
485 (and 447) and 524 as seen in the Env tree (Fig. 4), from a region
comprising the Nef protein where the majority of sites were of type 1, supporting a clustering of isolates 7 and 485 (and 447) as seen in the
Gag tree (Fig. 4). Most of the informative sites across the proteome were of types 1 and 3, supporting these two alternative trees. However,
a region was found in the middle of Env where six adjacent informative
sites were of type 2, supporting the final alternative tree in which
isolates 7 and 524 clustered.
|
Within any genomic region where the evolutionary history has not been disrupted by recombination events, the numbers of informative sites supporting the two incorrect trees should be small. This was observed for regions 2 to 5, but in the first region 21 out of 40 informative sites supported trees other than the inferred topology. Recombination between primate lentiviruses typically involves multiple crossovers along the genome (16). Region 1 was very long, covering more than half of the genome, and the three types of informative sites appeared to be nonrandomly distributed across region 1. Several putative breakpoints were identified within this region, but not with statistical significance. One region comprising much of Pol contained mainly sites of types 2 and 3, perhaps explaining why the tree for the Pol protein (Fig. 4) was dissimilar to that for Gag, even though both Gag and Pol were included within region 1 (Table 2). This informative site analysis supported the suggestions from diversity plots (Fig. 3) and the phylogenetic analyses (Fig. 4) that the SIVlhoest sequences reflect a complex history of recombination in the past. This implies that individual monkeys have been coinfected with two or more divergent strains of SIVlhoest, which is not surprising if the evaluation of the seroprevalence in our small sample collection can be extrapolated to a larger L'Hoest monkey population in their natural habitat.
There is considerable precedent in the literature for recombination among the primate lentiviruses. For example, recent recombinants have been identified between different subtypes of HIV-1 group M (16, 43) and between groups M and O (41, 46) in populations where these different clades cocirculate. Discordant branching patterns for strains of SIVsm in trees derived from gag and env sequences suggest that recombination has occurred among SIVsm in feral sooty mangabeys (7). The discordant branching orders for the four strains of SIVagmVer in Gag, Pol, and Env trees (Fig. 4) may be the consequence of past recombination, and indeed it would be surprising if further investigations of SIVagm do not reveal additional examples.
In conclusion, this study presents evidence that L'Hoest monkeys are indeed the natural reservoir for SIVlhoest. The seroprevalence of SIV among wild L'Hoest monkeys was high, similar to that observed in wild African green monkey populations (20, 31, 32, 34, 38). The four SIVlhoest isolates so far characterized formed a phylogenetic cluster, most closely related to SIVsun from a closely related species of monkey (3). The extent of genetic diversity observed among the SIVlhoest isolates was very similar to that seen previously among SIVagm isolates from naturally infected vervet monkeys (2, 8, 13, 29). Furthermore, the pattern of this genetic diversity across the genome was also largely similar to that in SIVagmVer, especially in terms of the relative conservation of the V3 loop of the Env protein. Finally, evidence that SIVlhoest sequences have undergone recombination is consistent with a high rate of infection in wild populations.
Nucleotide sequence accession number. The sequences of SIVlhoest447, SIVlhoest485, and SIVlhoest524 have been submitted to GenBank under accession no. AF188114, AF188115, and AF188116, respectively.
| |
ACKNOWLEDGMENTS |
|---|
We thank Malcolm Martin for continued support of this study.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, MD 20852. Phone: (301) 496-2976. Fax: (301) 480-2618. E-mail: vhirsch{at}niaid.nih.gov.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Allan, J. S.,
M. Short,
M. E. Taylor,
S. Su,
V. M. Hirsch,
P. R. Johnson,
G. M. Shaw, and B. H. Hahn.
1991.
Species-specific diversity among simian immunodeficiency viruses from African green monkeys.
J. Virol.
65:2816-2828 |
| 2. |
Baier, M.,
A. Werner,
K. Cichutek,
C. Garber,
C. Mueller,
G. Kraus,
F. J. Ferdinand,
S. Hartung,
T. S. Papas, and R. Kurth.
1989.
Molecularly cloned simian immunodeficiency virus SIVagm3 is highly divergent from other SIVagm isolates and is biologically active in vitro and in vivo.
J. Virol.
63:5119-5123 |
| 3. |
Beer, B. E.,
E. Bailes,
R. Goeken,
G. Dapolito,
C. Coulibaly,
S. G. Norley,
R. Kurth,
J. P. Gautier,
A. Gautier-Hion,
D. Vallet,
P. M. Sharp, and V. M. Hirsch.
1999.
Simian immunodeficiency virus (SIV) from sun-tailed monkeys (Cercopithecus solatus): evidence for host-dependent evolution of SIV within the C. lhoesti superspecies.
J. Virol.
73:7734-7744 |
| 4. |
Bibollet-Ruche, F.,
A. Galat-Luong,
G. Cuny,
P. Sarni-Manchado,
G. Galat,
J. P. Durand,
X. Pourrut, and F. Veas.
1996.
Simian immunodeficiency virus infection in a patas monkey (Erythrocebus patas): evidence for cross-species transmission from African green monkeys (Cercopithecus aethiops sabaeus) in the wild.
J. Gen. Virol.
77:773-781 |
| 5. | Chen, Z., A. Luckay, D. L. Sodora, P. Telfer, P. Reed, A. Gettie, J. M. Kanu, R. F. Sadek, J. Yee, D. D. Ho, L. Zhang, and P. A. Marx. 1997. Human immunodeficiency virus type 2 (HIV-2) seroprevalence and characterization of a distinct HIV-2 genetic subtype from the natural range of simian immunodeficiency virus-infected sooty mangabeys. J. Virol. 71:3953-3960[Abstract]. |
| 6. | Chen, Z., P. Telfer, P. Reed, L. Zhang, A. Getti, D. D. Ho, and P. A. Marx. 1995. Isolation and characterization of the first simian immunodeficiency virus from a feral sooty mangabey (Cercocebus atys) in West Africa. J. Med. Primatol. 24:108-115[Medline]. |
| 7. | Chen, Z., P. Telfer, A. Gettie, P. Reed, L. Zhang, D. D. Ho, and P. A. Marx. 1996. Genetic characterization of new West African simian immunodeficiency virus SIVsm: geographic clustering of household-derived SIV strains with human immunodeficiency virus type 2 subtypes and genetically diverse viruses from a single feral sooty mangabey troop. J. Virol. 70:3617-3627[Abstract]. |
| 8. |
Daniel, M. D.,
Y. Li,
Y. M. Naidu,
P. J. Durda,
D. K. Schmidt,
C. D. Troup,
D. P. Silva,
J. J. MacKey,
H. W. Kestler III,
P. K. Sehgal,
N. W. King,
Y. Ohta,
M. Hayami, and R. C. Desrosiers.
1988.
Simian immunodeficiency virus from African green monkeys.
J. Virol.
62:4123-4128 |
| 9. | Dighe, P. K., B. T. Korber, and B. T. Foley. 1997. Global variation in the HIV-1 V3 region, p. III74-206. In B. Korber, B. Foley, T. Leitner, F. McCutchan, B. Hahn, J. W. Mellors, G. Myers, and C. Kuiken (ed.), Human retroviruses and AIDS. Theoretical Biology and Biophysics Group T-10 Los Alamos, N.Mex. |
| 10. |
Emau, P.,
H. M. McClure,
M. Isahakia,
J. G. Else, and P. N. Fultz.
1991.
Isolation from African Sykes' monkeys (Cercopithecus mitis) of a lentivirus related to human and simian immunodeficiency viruses.
J. Virol.
65:2135-2140 |
| 11. | Fomsgaard, A., V. M. Hirsch, J. S. Allan, and P. R. Johnson. 1991. A highly divergent proviral DNA clone of SIV from a distinct species of African green monkey. Virology 182:397-402[CrossRef][Medline]. |
| 12. | Franchini, G., C. Gurgo, H. G. Guo, R. C. Gallo, E. Collati, K. A. Fargnoli, L. F. Hall, F. Wong-Staal, and M. S. Reitz. 1987. Sequence of simian immunodeficiency virus and its relationship to the human immunodeficiency viruses. Nature 328:539-543[CrossRef][Medline]. |
| 13. | Fukasawa, M., T. Miura, A. Hasegawa, S. Morikawa, H. Tsujimoto, K. Miki, T. Kitamura, and M. Hayami. 1988. Sequence of simian immunodeficiency virus from African green monkey, a new member of the HIV/SIV group. Nature 333:457-461[CrossRef][Medline]. |
| 14. |
Galtier, N.,
M. Gouy, and C. Gautier.
1996.
SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny.
Comput. Appl. Biosci.
12:543-548 |
| 15. | Gao, F., E. Bailes, D. L. Robertson, Y. Chen, C. M. Rodenburg, S. F. Michael, L. B. Cummins, L. O. Arthur, M. Peeters, G. M. Shaw, P. M. Sharp, and B. H. Hahn. 1999. Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes. Nature 397:436-441[CrossRef][Medline]. |
| 16. |
Gao, F.,
D. L. Robertson,
C. D. Carruthers,
S. G. Morrison,
B. Jian,
Y. Chen,
F. Barre-Sinoussi,
M. Girard,
A. Srinivasan,
A. G. Abimiku,
G. M. Shaw,
P. M. Sharp, and B. H. Hahn.
1998.
A comprehensive panel of near-full-length clones and reference sequences for non-subtype B isolates of human immunodeficiency virus type 1.
J. Virol.
72:5680-5698 |
| 17. | Gao, F., L. Yue, A. T. White, P. G. Pappas, J. Barchue, A. P. Hanson, B. M. Greene, P. M. Sharp, G. M. Shaw, and B. H. Hahn. 1992. Human infection by genetically diverse SIVSM-related HIV-2 in west Africa. Nature 358:495-499[CrossRef][Medline]. |
| 18. | Gardner, M. B. 1996. The history of simian AIDS. J. Med. Primatol. 25:148-157[Medline]. |
| 19. | Harrison, M. J. S. 1988. A new species of guenon (genus Cercopithecus) from Gabon. J. Zool. 215:561-575. |
| 20. | Hendry, R. M., M. A. Wells, M. A. Phelan, A. L. Schneider, J. S. Epstein, and G. V. Quinnan. 1986. Antibodies to simian immunodeficiency virus in African green monkeys in Africa in 1957-62. Lancet ii:455. |
| 21. |
Hirsch, V. M.,
B. J. Campbell,
E. Bailes,
R. Goeken,
C. Brown,
W. R. Elkins,
M. Axthelm,
M. Murphey-Corb, and P. M. Sharp.
1999.
Characterization of a novel simian immunodeficiency virus (SIV) from L'hoest monkeys (Cercopithecus l'hoesti): implications for the origins of SIVmnd and other primate lentiviruses.
J. Virol.
73:1036-1045 |
| 22. |
Hirsch, V. M.,
G. A. Dapolito,
S. Goldstein,
H. McClure,
P. Emau,
P. N. Fultz,
M. Isahakia,
R. Lenroot,
G. Myers, and P. R. Johnson.
1993.
A distinct African lentivirus from Sykes' monkeys.
J. Virol.
67:1517-1528 |
| 23. | Hirsch, V. M., C. McGann, G. Dapolito, S. Goldstein, A. Ogen-Odoi, B. Biryawaho, T. Lakwo, and P. R. Johnson. 1993. Identification of a new subgroup of SIVagm in tantalus monkeys. Virology 197:426-430[CrossRef][Medline]. |
| 24. | Hirsch, V. M., R. A. Olmsted, M. Murphy-Corb, R. H. Purcell, and P. R. Johnson. 1989. An African primate lentivirus (SIVsm) closely related to HIV-2. Nature 339:389-392[CrossRef][Medline]. |
| 25. | Huet, T., R. Cheynier, A. Meyerhans, G. Roelants, and S. Wain-Hobson. 1990. Genetic organization of a chimpanzee lentivirus related to HIV-1. Nature 345:356-359[CrossRef][Medline]. |
| 26. | Janssens, W., K. Fransen, M. Peeters, L. Heyndrickx, J. Motte, L. Bedjabaga, E. Delaporte, P. Piot, and G. van der Groen. 1994. Phylogenetic analysis of a new chimpanzee lentivirus SIVcpz-gab2 from a wild-captured chimpanzee from Gabon. AIDS Res. Hum. Retrovir. 10:1191-1192[Medline]. |
| 27. | Jin, M. J., H. Hui, D. L. Robertson, M. C. Mueller, F. Barre-Sinoussi, V. M. Hirsch, J. S. Allan, G. M. Shaw, P. M. Sharp, and B. H. Hahn. 1994. Mosaic genome structure of simian immunodeficiency virus from west African green monkeys. EMBO J. 13:2935-2947[Medline]. |
| 28. |
Jin, M. J.,
J. Rogers,
J. E. Phillips-Conroy,
J. S. Allan,
R. C. Desrosiers,
G. M. Shaw,
P. M. Sharp, and B. H. Hahn.
1994.
Infection of a yellow baboon with simian immunodeficiency virus from African green monkeys: evidence for cross-species transmission in the wild.
J. Virol.
68:8454-8460 |
| 29. |
Johnson, P. R.,
A. Fomsgaard,
J. S. Allan,
M. Gravell,
W. T. London,
R. A. Olmsted, and V. M. Hirsch.
1990.
Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.
J. Virol.
64:1086-1092 |
| 30. |
Jones, D. T.,
W. R. Taylor, and J. M. Thornton.
1992.
The rapid generation of mutation data matrices from protein sequences.
Comput. Appl. Biosci.
8:275-282 |
| 31. |
Kanki, P. J.,
J. Alroy, and M. Essex.
1985.
Isolation of T-lymphotropic retrovirus related to HTLV-III/LAV from wild-caught African green monkeys.
Science
230:951-954 |
| 32. | Kanki, P. J., R. Kurth, W. Becker, G. Dreesman, M. F. McLane, and M. Essex. 1985. Antibodies to simian T-lymphotropic retrovirus type III in African green monkeys and recognition of STLV-III viral proteins by AIDS and related sera. Lancet ii:1330-1332. |
| 33. | Kimura, M. 1983. The neutral theory of molecular evolution. Cambridge University Press, Cambridge, United Kingdom. |
| 34. | Lowenstine, L. J., N. C. Pedersen, J. Higgins, K. C. Pallis, A. Uyeda, P. Marx, N. W. Lerche, R. J. Munn, and M. B. Gardner. 1986. Seroepidemiologic survey of captive Old-World primates for antibodies to human and simian retroviruses, and isolation of a lentivirus from sooty mangabeys (Cercocebus atys). Int. J. Cancer 38:563-574[Medline]. |
| 35. | Mansfield, K. G., N. W. Lerche, M. B. Gardner, and A. A. Lackner. 1995. Origins of simian immunodeficiency virus infection in macaques at the New England Regional Primate Research Center. J. Med. Primatol. 24:116-122[Medline]. |
| 36. |
Marx, P. A.,
Y. Li,
N. W. Lerche,
S. Sutjipto,
A. Gettie,
J. A. Yee,
B. H. Brotman,
A. M. Prince,
A. Hanson,
R. G. Webster, and R. C. Desrosiers.
1991.
Isolation of a simian immunodeficiency virus related to human immunodeficiency virus type 2 from a West African pet sooty mangabey.
J. Virol.
65:4480-4485 |
| 37. |
Mueller, M. C.,
N. K. Saksena,
E. Nerrienet,
C. Chappey,
V. M. Herve,
J. P. Durand,
P. Legal-Campodonico,
M. C. Lang,
J. P. Digoutte,
A. J. Georges,
M.-C. Georges-Courbot,
P. Sonigo, and F. Barre-Sinoussi.
1993.
Simian immunodeficiency viruses from central and western Africa: evidence for a new species-specific lentivirus in tantalus monkeys.
J. Virol.
67:1227-1235 |
| 38. | Ohta, Y., T. Masuda, H. Tsujimoto, K. Ishikawa, T. Kodama, S. Morikawa, M. Nakai, S. Honjo, and M. Hayami. 1988. Isolation of simian immunodeficiency virus from African green monkeys and seroepidemiologic survey of the virus in various non-human primates. Int. J. Cancer 41:115-122[Medline]. |
| 39. | Peeters, M., K. Fransen, E. Delaporte, M. Vanden Haesevelde, G. M. Gershy-Damet, L. Kestens, G. van der Groen, and P. Piot. 1992. Isolation and characterization of a new chimpanzee lentivirus (simian immunodeficiency virus isolate cpz-ant) from a wild-captured chimpanzee. AIDS 6:447-451[Medline]. |
| 40. | Peeters, M., C. Honore, T. Huet, L. Bedjabaga, S. Ossari, P. Bussi, R. W. Cooper, and E. Delaporte. 1989. Isolation and partial characterization of an HIV-related virus occurring naturally in chimpanzees in Gabon. AIDS 3:625-630[Medline]. |
| 41. |
Peeters, M.,
F. Liegeois,
N. Torimiro,
A. Bourgeois,
E. Mpoudi,
L. Vergne,
E. Saman,
E. Delaporte, and S. Saragosti.
1999.
Characterization of a highly replicative intergroup M/O human immunodeficiency virus type 1 recombinant isolated from a Cameroonian patient.
J. Virol.
73:7368-7375 |
| 42. | Robertson, D. L., B. H. Hahn, and P. M. Sharp. 1995. Recombination in AIDS viruses. J. Mol. Evol. 40:249-259[CrossRef][Medline]. |
| 43. | Robertson, D. L., P. M. Sharp, F. E. McCutchan, and B. H. Hahn. 1995. Recombination in HIV-1. Nature 374:124-126[Medline]. |
| 44. | Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425[Abstract]. |
| 45. | Sharp, P. M., D. L. Robertson, F. Gao, and B. H. Hahn. 1994. Origins and diversity of human immunodeficiency viruses. AIDS 8:S27-S42. |
| 46. |
Takehisa, J.,
L. Zekeng,
E. Ido,
Y. Yamaguchi-Kabata,
I. Mboudjeka,
Y. Harada,
T. Miura,
L. Kaptu, and M. Hayami.
1999.
Human immunodeficiency virus type 1 intergroup (M/O) recombination in Cameroon.
J. Virol.
73:6810-6820 |
| 47. |
Thompson, J. D.,
T. J. Gibson,
F. Plewniak,
F. Jeanmougin, and D. G. Higgins.
1997.
The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res.
25:4876-4882 |
| 48. |
Tsujimoto, H.,
R. W. Cooper,
T. Kodama,
M. Fukasawa,
T. Miura,
Y. Ohta,
K. Ishikawa,
M. Nakai,
E. Frost,
G. E. Roelants,
J. Roffi, and M. Hayami.
1988.
Isolation and characterization of simian immunodeficiency virus from mandrills in Africa and its relationship to other human and simian immunodeficiency viruses.
J. Virol.
62:4044-4050 |
| 49. | Tsujimoto, H., A. Hasegawa, N. Maki, M. Fukasawa, T. Miura, S. Speidel, R. W. Cooper, E. N. Moriyama, T. Gojobori, and M. Hayami. 1989. Sequence of a novel simian immunodeficiency virus from a wild-caught African mandrill. Nature 341:539-541[CrossRef][Medline]. |
| 50. | Vanden Haesevelde, M. M., M. Peeters, G. Janssens, W. Janssens, G. van der Groen, P. M. Sharp, and E. Saman. 1996. Sequence analysis of a highly divergent HIV-1-related lentivirus isolated from a wild captured chimpanzee. Virology 221:346-350[CrossRef][Medline]. |
| 51. | Van Rensburg, E. J., S. Engelbrecht, J. Mwenda, J. D. Laten, B. A. Robson, T. Stander, and G. K. Chege. 1998. Simian immunodeficiency viruses (SIVs) from eastern and southern Africa: detection of a SIVagm variant from a chacma baboon. J. Gen. Virol. 79:1809-1814[Abstract]. |
Journal of Virology, April 2000, p. 3892-3898, Vol. 74, No. 8
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
VandeWoude, S., Apetrei, C.
(2006). Going Wild: Lessons from Naturally Occurring T-Lymphotropic Lentiviruses. Clin. Microbiol. Rev.
19: 728-762
[Abstract] [Full Text] -
Chen, J., Powell, D., Hu, W.-S.
(2006). High Frequency of Genetic Recombination Is a Common Feature of Primate Lentivirus Replication. J. Virol.
80: 9651-9658
[Abstract] [Full Text] -
Onanga, R., Souquiere, S., Makuwa, M., Mouinga-Ondeme, A., Simon, F., Apetrei, C., Roques, P.
(2006). Primary Simian Immunodeficiency Virus SIVmnd-2 Infection in Mandrills (Mandrillus sphinx).. J. Virol.
80: 3301-3309
[Abstract] [Full Text] -
Gaddis, N. C., Sheehy, A. M., Ahmad, K. M., Swanson, C. M., Bishop, K. N., Beer, B. E., Marx, P. A., Gao, F., Bibollet-Ruche, F., Hahn, B. H., Malim, M. H.
(2004). Further Investigation of Simian Immunodeficiency Virus Vif Function in Human Cells. J. Virol.
78: 12041-12046
[Abstract] [Full Text] -
Bibollet-Ruche, F., Bailes, E., Gao, F., Pourrut, X., Barlow, K. L., Clewley, J. P., Mwenda, J. M., Langat, D. K., Chege, G. K., McClure, H. M., Mpoudi-Ngole, E., Delaporte, E., Peeters, M., Shaw, G. M., Sharp, P. M., Hahn, B. H.
(2004). New Simian Immunodeficiency Virus Infecting De Brazza's Monkeys (Cercopithecus neglectus): Evidence for a Cercopithecus Monkey Virus Clade. J. Virol.
78: 7748-7762
[Abstract] [Full Text] -
Paraskevis, D., Lemey, P., Salemi, M., Suchard, M., Van de Peer, Y., Vandamme, A.-M.
(2003). Analysis of the Evolutionary Relationships of HIV-1 and SIVcpz Sequences Using Bayesian Inference: Implications for the Origin of HIV-1. Mol Biol Evol
20: 1986-1996
[Abstract] [Full Text] -
Salemi, M., De Oliveira, T., Courgnaud, V., Moulton, V., Holland, B., Cassol, S., Switzer, W. M., Vandamme, A.-M.
(2003). Mosaic Genomes of the Six Major Primate Lentivirus Lineages Revealed by Phylogenetic Analyses. J. Virol.
77: 7202-7213
[Abstract] [Full Text] -
Santiago, M. L., Lukasik, M., Kamenya, S., Li, Y., Bibollet-Ruche, F., Bailes, E., Muller, M. N., Emery, M., Goldenberg, D. A., Lwanga, J. S., Ayouba, A., Nerrienet, E., McClure, H. M., Heeney, J. L., Watts, D. P., Pusey, A. E., Collins, D. A., Wrangham, R. W., Goodall, J., Brookfield, J. F. Y., Sharp, P. M., Shaw, G. M., Hahn, B. H.
(2003). Foci of Endemic Simian Immunodeficiency Virus Infection in Wild-Living Eastern Chimpanzees (Pan troglodytes schweinfurthii). J. Virol.
77: 7545-7562
[Abstract] [Full Text] -
Barlow, K. L., Ajao, A. O., Clewley, J. P.
(2003). Characterization of a Novel Simian Immunodeficiency Virus (SIVmonNG1) Genome Sequence from a Mona Monkey (Cercopithecus mona). J. Virol.
77: 6879-6888
[Abstract] [Full Text] -
Hu, J., Switzer, W. M., Foley, B. T., Robertson, D. L., Goeken, R. M., Korber, B. T., Hirsch, V. M., Beer, B. E.
(2003). Characterization and Comparison of Recombinant Simian Immunodeficiency Virus from Drill (Mandrillus leucophaeus) and Mandrill (Mandrillus sphinx) Isolates. J. Virol.
77: 4867-4880
[Abstract] [Full Text] -
Lowenstine, L. J.
(2003). A Primer of Primate Pathology: Lesions and Nonlesions. Toxicol Pathol
31: 92-102
[Abstract] -
Onanga, R., Kornfeld, C., Pandrea, I., Estaquier, J., Souquiere, S., Rouquet, P., Mavoungou, V. P., Bourry, O., M'Boup, S., Barre-Sinoussi, F., Simon, F., Apetrei, C., Roques, P., Muller-Trutwin, M. C.
(2002). High Levels of Viral Replication Contrast with Only Transient Changes in CD4+ and CD8+ Cell Numbers during the Early Phase of Experimental Infection with Simian Immunodeficiency Virus SIVmnd-1 in Mandrillus sphinx. J. Virol.
76: 10256-10263
[Abstract] [Full Text] -
Masciotra, S., Yang, C., Pieniazek, D., Thomas, C., Owen, S. M., McClure, H. M., Lal, R. B.
(2002). Detection of Simian Immunodeficiency Virus in Diverse Species and of Human Immunodeficiency Virus Type 2 by Using Consensus Primers within the pol Region. J. Clin. Microbiol.
40: 3167-3171
[Abstract] [Full Text] -
Courgnaud, V., Salemi, M., Pourrut, X., Mpoudi-Ngole, E., Abela, B., Auzel, P., Bibollet-Ruche, F., Hahn, B., Vandamme, A.-M., Delaporte, E., Peeters, M.
(2002). Characterization of a Novel Simian Immunodeficiency Virus with a vpu Gene from Greater Spot-Nosed Monkeys (Cercopithecus nictitans) Provides New Insights into Simian/Human Immunodeficiency Virus Phylogeny. J. Virol.
76: 8298-8309
[Abstract] [Full Text] -
Beer, B. E., Foley, B. T., Kuiken, C. L., Tooze, Z., Goeken, R. M., Brown, C. R., Hu, J., Claire, M. St., Korber, B. T., Hirsch, V. M.
(2001). Characterization of Novel Simian Immunodeficiency Viruses from Red-Capped Mangabeys from Nigeria (SIVrcmNG409 and -NG411). J. Virol.
75: 12014-12027
[Abstract] [Full Text] -
Souquiere, S., Bibollet-Ruche, F., Robertson, D. L., Makuwa, M., Apetrei, C., Onanga, R., Kornfeld, C., Plantier, J.-C., Gao, F., Abernethy, K., White, L. J. T., Karesh, W., Telfer, P., Wickings, E. J., Mauclere, P., Marx, P. A., Barre-Sinoussi, F., Hahn, B. H., Muller-Trutwin, M. C., Simon, F.
(2001). Wild Mandrillus sphinx Are Carriers of Two Types of Lentivirus. J. Virol.
75: 7086-7096
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»