Previous Article | Next Article 
Journal of Virology, April 2000, p. 3793-3803, Vol. 74, No. 8
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Nonrandom Transduction of Recombinant
Adeno-Associated Virus Vectors in Mouse Hepatocytes In Vivo: Cell
Cycling Does Not Influence Hepatocyte Transduction
Carol H.
Miao,1
Hiroyuki
Nakai,2
Arthur R.
Thompson,1
Theresa A.
Storm,2
Winnie
Chiu,2
Richard O.
Snyder,3 and
Mark A.
Kay2,*
Puget Sound Blood Center, University of
Washington, Seattle, Washington,1 and
Departments of Pediatrics and Genetics, Stanford University,
Stanford,2 and Cell Genesys, Foster
City,3 California
Received 3 August 1999/Accepted 5 January 2000
 |
ABSTRACT |
Recombinant adeno-associated virus vectors (rAAV) show promise in
preclinical trials for the treatment of genetic diseases including
hemophilia. Liver-directed gene transfer results in a slow rise in
transgene expression, reaching steady-state levels over a period of 5 weeks concomitant with the conversion of the single-stranded rAAV
molecules into high-molecular-weight concatemers in about 5% of
hepatocytes. Immunohistochemistry and RNA in situ hybridization show
that the transgene product is made in about ~5% of hepatocytes,
suggesting that most rAAV-mediated gene expression occurs in
hepatocytes containing the double-stranded concatemers. In this study,
the mechanism(s) involved in stable transduction in vivo was evaluated.
While only ~5% of hepatocytes are stably transduced, in situ
hybridization experiments demonstrated that the vast majority of the
hepatocytes take up AAV-DNA genomes after portal vein infusion of the
vector. Two different vectors were infused together or staggered by 1, 3, or 5 weeks, and two-color fluorescent in situ hybridization and
molecular analyses were performed 5 weeks after the infusion of the
second vector. These experiments revealed that a small but changing
subpopulation of hepatocytes were permissive to stable transduction.
Furthermore, in animals that received a single infusion of two vectors,
about one-third of the transduced cells contained heteroconcatemers, suggesting that dimer formation was a critical event in the process of
concatemer formation. To determine if the progression through the cell
cycle was important for rAAV transduction, animals were continuously
infused with 5'-bromo-2'-deoxyuridine (BrdU), starting at the time of
administration of a rAAV vector that expressed cytoplasmic
-galactosidase. Colabeling for -galactosidase and BrdU revealed
that there was no preference for transduction of cycling cells. This
was further confirmed by demonstrating no increase in rAAV transduction
efficiencies in animals whose livers were induced to cycle at the time
of or after vector administration. Taken together, our studies suggest
that while virtually all hepatocytes take up vector, unknown cellular
factors are required for stable transduction, and that dimer formation
is a critical event in the transduction pathway. These studies have
important implications for understanding the mechanism of integration
and may be useful for improving liver gene transfer in vivo.
| |
INTRODUCTION |
Recombinant adeno-associated virus
vectors (rAAV) have been used to deliver therapeutic and in some cases
curative amounts of the factor IX gene into mice and dogs with
hemophilia B (8, 16, 23, 24). After intraportal delivery,
factor IX levels slowly rise during the first 5 weeks to reach a
steady-state concentration in plasma. During this period, the number of
single-stranded rAAV vector genomes slowly decreases and there is a
concomitant increase in the number of high-molecular-weight concatemers
(15). With a dose of 6.4 × 1010 viral
particles, pulsed-field gel electrophoresis and fluorescent in situ
hybridization (FISH) analysis of isolated hepatic nuclei showed that
there are concatemers and integrated rAAV proviral genomes in about 5%
of hepatocytes (15, 24). More recently, integration of rAAV
into the mouse genome has been confirmed by the cloning of mouse
chromosomal AAV vector junction fragments from liver (17).
The number of hepatocytes that express the rAAV-mediated transgene
product, as determined by RNA in situ hybridization and protein
immunohistochemistry, is similar to the number of hepatocytes that
contain the concatemers (24). This suggests that most if not
all of the gene expression from the liver comes from the hepatocytes
that contain the integrated concatemers.
In cell culture, most but not all integrants contain a single-copy
proviral genome (14, 22, 29). Some of the in vitro studies
were done using rAAV vectors that express neomycin phosphotransferase in G418-treated cells where all nonintegrated transduction events would
be quickly lost due to cell division. Whether the rapid cell division
in cultured cells, selective pressure, metabolic state of the cells, or
cell type is responsible for the differences observed between in vivo
and in vitro studies is not known.
The mechanism(s) by which rAAV genomes transduce liver is not known,
and it is not clear why only a small proportion of hepatocytes are
stably transduced, as opposed to other tissues like brain, muscle, and
retina, where high rates of transduction can be obtained around the
injection site (7, 13, 25, 28). One possible explanation is
that unlike other tissues, with intravascular infusion into the liver,
rAAV vector virions are not able to bind or enter the majority of
hepatocytes. A previous study showed that 10 to 25% of hepatocytes
were transduced with rAAV genomes when the vector was coadministered
with an adenovirus (6). This suggested that many hepatocytes
take up rAAV; however, it was not conclusive, because of the
possibility that rAAV entry into the cells was influenced by the
adenovirus particles.
The studies described here were designed to better understand the
process of liver transduction in vivo. To do this, we studied (i)
whether all hepatocytes are equally capable of taking up the vector
shortly after its administration and/or whether there is a defined
population of hepatocytes that are permissive to stable transduction,
(ii) the relative frequency of independent transduction events, (iii)
heteromultimer formation within individual hepatocytes, and (iv) the
importance of the cell cycle for transduction.
These factors are important not only because they may lead to insights
into the mechanism(s) of vector integration, but also because with the
vector genome size limitations, they may allow a means of using two
vectors to make a single functional gene. In early studies, dual vector
transduction has been suggested in the brain (3, 13, 26) and
muscle (19, 31) but the molecular state of the genomes
(heterogenomes versus two homogenomes) was not determined. However,
very recent results clearly establish the formation of
heteroconcatemers in muscle (30). If transduction is a
random event, then in the liver, where the frequency of transduced hepatocytes is low, the probability that two vectors will transduce a
single cell may be much lower than that expected for the muscle and
brain, where a high proportion of transduced cells are found concentrated at the injection site. Thus, it is possible that the
mechanism(s) involved in stable transduction will ultimately turn out
to be different for different tissues.
| |
MATERIALS AND METHODS |
rAAV vector preparation and characterization.
Preparation
and characterization of rAAV-FIX from pSSV9-MFG-hFIX, rAAV-TH from
pSSV-MFG-TH, rAAV-EF1
-FIX, and rAAV-CMV-LacZ were performed as
described previously (10, 17, 24). rAAV-EF1-LacZ contains
a truncated EF1 promoter (17) driving the
Escherichia coli lacZ gene. The total particle titer of the
rAAV vectors was determined by a dot-blot assay. The structures of the
vectors used are given in Fig. 1.
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Molecular structures of the vectors. (A) rAAV-FIX; (B)
rAAV-TH; (C) rAAV-CMV-LacZ; (D) rAAV-EF1-LacZ; (E) rAAV-EF1-FIX.
The black boxes at both vector ends represent the inverted terminal
repeats. MFG-P, Moloney murine leukemia virus long terminal repeat
promoter; IVS, mRNA splice donor/splice acceptor; hFIX cDNA, human
coagulation factor IX cDNA; pA(bGH), bovine growth hormone
polyadenylation signal; hTH cDNA, human tyrosine hydroxylase cDNA;
CMV-P; human cytomegalovirus immediate-early gene enhancer/promoter;
hGH int, human growth hormone intron; lacZ, the bacterial
lacZ gene; pA(SV40), simian virus 40 mRNA polyadenylation
signal; EF1-P, human polypeptide elongation factor 1 gene
enhancer/promoter;  EF1-P, truncated EF1-P; pA(hGH), human
growth hormone polyadenylation signal.
|
|
Animal studies.
All methods of vector infusion, partial
hepatectomy, and DNA isolation have been described previously (9,
15, 24). Animals were treated according to the National
Institutes of Health guidelines for animal care and the guidelines of
the University of Washington and Stanford University. Adult female
C57BL/6, C57BL/6 scid, and C57BL/6 Rag-1 mice were purchased from
Jackson Laboratory and infused with rAAV vectors via the portal vein as
described below. Blood samples were taken from the retro-orbital plexus.
For 5'-bromo-2'-deoxyuridine (BrdU)-labeling studies, immediately after
portal vein infusion of the vector and 200 mg of BrdU
per kg, a
miniosmotic pump that can continuously administer BrdU
solution in 0.5 N sodium bicarbonate at a rate of 1 mg/day for
14 days (model 2002;
Alzet, Palo Alto, Calif.) was implanted into
the subcutaneous space on
the dorsal surface. To allow for immediate
release of BrdU from the
pump, all pumps were incubated in saline
at 37°C for at least 4 h prior to implantation as recommended
by the manufacturer. These pumps
were replaced twice during the
experiment, every 12 days for up to 36 days, to allow for continuous
labeling of hepatocytes. Additional
subcutaneous injection of
200 mg of BrdU per kg was administered during
the surgical procedure
of pump replacement to ensure continuous
labeling. Continuous
infusion of BrdU at this rate caused no liver
damage as determined
by serum alanine aminotransferase measurements
(data not
shown).
FISH in hepatic nuclei.
From each group of mice infused with
both rAAV-FIX and rAAV-TH, primary mouse hepatocytes were isolated by
the collagenase perfusion method 5 weeks after the infusion of the
second vector, rAAV-TH (15). The hepatocytes were
subsequently suspended in Williams's medium supplemented with 10%
fetal calf serum, filtered, and washed three times with the same
medium. Mouse interphase nuclei were then prepared from freshly
isolated primary hepatocytes by a standard methanol-acetic acid method.
The rAAV-FIX probe made from the rAAV plasmid, pSSV9-MFG-hFIX, was
labeled by nick translation, incorporating biotin-14-dATP (GIBCO BRL),
and the rAAV-TH probe made from the pSSV-MFG-TH plasmid was labeled by nick translation, incorporating digoxigenin-11-dUTP (Boehringer Mannheim). Labeled DNA (100 ng) was ethanol precipitated along with 10 µg of salmon sperm DNA for use on each slide. The slides were
hybridized with both probes in 50% formamide-2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-10% dextran sulfate at 37°C
overnight. The next day, the slides were washed in 50% formamide-2×
SSC at 42°C and 2× SSC at 42°C. Texas red-conjugated avidin was
used in combination with biotinylated goat anti-avidin antibody for
detection of hybridization signals generated from the rAAV-FIX probe.
Mouse anti-digoxigenin antibody was used in combination with
fluorescein isothiocyanate-conjugated rabbit anti-mouse immunoglobulin
G and fluorescein isothiocyanate-conjugated goat anti-rabbit
immunoglobulin G to detect hybridization signals generated from the
rAAV-TH probe. The nuclei were counterstained with
4',6-diamidino-2-phenylindole (DAPI). Photomicroscopy was performed
with a standard epifluorescence microscope (Zeiss Co.).
Southern analyses.
Genomic DNA was prepared from primary
mouse hepatocytes from the mice injected with rAAV-FIX and rAAV-TH. A
15-µg sample of each DNA was digested with BamHI and
XbaI at 37°C overnight and then electrophoresed through a
0.8% agarose gel and transferred to a nylon membrane (Hybond
N+; Amersham). The membrane was prehybridized and then
hybridized with an hFIX cDNA probe at 65°C using a Rapid-Hyb buffer
(Amersham). The final stringency of washing was 0.1× SSC-0.1% sodium
dodecyl sulfate at 65°C. After autoradiography, the blot was stripped and then hybridized with a TH cDNA probe under the same conditions. The
hFIX cDNA probe is 1.4 kb in size, and the TH cDNA probe is 1.2 kb.
Both probes were labeled to a specific activity of 108
cpm/µg with [-32P]dCTP, using a random-primer
labeling kit (Stratagene).
To determine the vector copy number per cell (the number of
double-stranded vector genomes per diploid genomic equivalent)
in the
transduced livers of rAAV-EF1
-FIX-injected mice, 20 µg
of genomic
DNA extracted from livers was digested with
XhoI that
cuts
three times within the vector, electrophoresed together with
copy
number standards, and subjected to Southern blot analysis
as described
previously (
17), with a 1.9-kb vector sequence-specific
probe. The intensity of the bands was quantitated by
densitometry.
PCR detection methods.
rAAV-FIX and rAAV-TH vector genomes
were detected in the transduced mouse livers by one-round PCR
experiments using internal primer sets within the cDNA sequence of hFIX
and TH, respectively. Two sets of primers were used in nested-PCR
experiments to amplify concatemers composed of the same vector genomes
and mixed vector genomes, respectively. After electrophoresis of the
PCR products, the gel was blotted and hybridized with a hFIX cDNA
probe. Subsequently, the blots were stripped and hybridized with a TH
cDNA probe. The hFIX and TH probes and the hybridization procedures
used were the same as the ones in the Southern analysis. The primer
sequences are as follows: H1, 5' GATGGAGATCAGTGTGAGTCCAATCCATGT;
H2, 5' AGTTTAAACCTAGACCGATACATTCACCGA; H3, 5'
CTCTCAAGGTTCCCTTGAACAAACTCTTCC; H4, 5'
ACTGAAGTGGAAGGGACCAGTTTCTTAAC; H8, 5'
GCTGGGGTGAAGAGTGTGCAATGAAAGGCA; H9, 5'
CCTTGAACAAACTCTTCCAATTTACCTG; T1, 5'
GGCCATCATGGTAAGAGG; T2, 5' ACTGGGTGCACTGGAACAC;
T3, 5' AAACGTCTCAAACACCTTCACAGCTC; T4, 5'
TATCCGCCACGCGTCCTCGCCCATGCACTC; T7, 5' CTCTGCCTGCTTGGCGTCCAGCTCAGACAC; and
T10, 5' ACCAAGACCAGACGTACCAGTCAGTCTAC.
DNA in situ hybridization in liver tissue.
Livers from mice
were fixed in 10% neutral buffered formalin, dehydrated, and paraffin
embedded. Sections (5 µm) were cut onto Superfrost Plus charged
slides and baked at 60°C for 1 h. Plasmid pAAV-EF1-LacZ DNA
was labeled with digoxigenin-11-dUTP using the DIG High Prime (Roche
Molecular) random-primer labeling kit.
Slides were deparaffinized in xylene and rehydrated through a series of
graded ethanols (100, 95, and 70%) into water. They
were then treated
in 0.2 N HCl for 20 min at room temperature,
(RT), briefly rinsed in
water, digested with 100 µg of proteinase
K per ml in
phosphate-buffered saline for 20 min at 37°C, and
washed for 5 min in
water. The sections were postfixed for 1 min
in 10% neutral buffered
formalin and rinsed in water, treated
with 0.1 M
triethanolamine-0.25% acetic anhydride for 10 min at
RT, and washed
twice in phosphate-buffered saline for 3 min each.
The slides were then
dehydrated through a series of graded ethanols
(70, 95, and 100%) and
allowed to air dry. The tissues were denatured
in 70% formamide-2×
SSC for 5 min at 75°C, immediately dipped
into a series of cold 70, 95, and 100% ethanols, and once again
allowed to air dry. Then 0.75 µg of labeled probe was added to
a hybridization solution consisting
of 60 µl of 2× hybridization
buffer (4× SSC, 2× Denhardt's
solution, 0.2 M sodium phosphate
buffer [pH 6.5]), 60 µl of 20%
dextran sulfate, and 0.06 µg of
salmon sperm DNA per µl. The final
probe concentration was 6 µg/ml.
The probe was denatured at 75°C
for 5 min and quickly placed in
an ice bath. Approximately 20 µl of
diluted probe was applied
under a coverslip and hybridized in a moist
chamber at 42°C overnight.
The next day, the coverslips were removed
and the slides were
subjected to a series of posthybridization washes
including a
2× SSC-0.1 mM dithiothreitol wash for 30 min at RT
followed by
a 0.1× SSC-0.1 mM dithiothreitol wash for 30 min at
37°C and a
final 3-min rinse in 0.1×
SSC.
A blocking buffer (2× SSC-0.05% Triton X-100) supplemented with 30%
normal sheep serum was applied to the sections, and the
slides were
incubated in a moist chamber for 2 h at RT. They were
then washed
twice in Tris-buffered saline (TBS) for 10 min at
RT. Anti-DIG-AP
(Roche Molecular) was applied at a dilution of
1:500 in a buffer (0.3%
Triton X-100, TBS) supplemented with 5%
normal sheep serum, and the
slides were incubated in a moist chamber
overnight at RT. Tissue
sections were washed twice the next day
in TBS for 15 min at RT and
placed in an alkaline phosphatase
buffer (a mixture of 0.3 M Tris-HCl
[pH 9.5], 0.15 M MgCl
2, and
0.3 M NaCl in equal parts,
made immediately prior to use) for
5 min at RT. Nitroblue tetrazolium
chloride-5-bromo-4-chloro-3-indolylphosphate
(NBT-BCIP stock solution
from Roche Molecular) color substrate
was used at a dilution of 40 µl
of stock solution to 10 ml of
alkaline phosphatase buffer for 1 h
45 min to detect the signals.
Slides were washed well in water, allowed
to air dry, and coverslipped
with a nonxylene
medium.
X-Gal and BrdU double staining of transduced hepatocytes.
The mice injected with rAAV-EF1-LacZ and labeled with BrdU were
sacrificed 36 days after vector administration, and the liver and
duodenum were harvested, embedded in OCT compound (Tissue-Tek; Sakura
Finetek, U.S.A. Inc., Torrance, Calif.), and frozen in 2-methylbutane
chilled with dry ice. Sections (10 µm) were subjected to X-Gal
(5-bromo-4-chloro-3-indolyl--D-galactopyranoside)
staining for analysis of cytoplasmic -galactosidase expression
(9). For the X-Gal and BrdU double staining, 7-µm-thick
sections were prepared, stained with X-Gal, and immunostained against
incorporated BrdU with sheep anti-BrdU antibody (Maine Biotechnology
Services, Inc., Portland, Maine) as described elsewhere
(18).
Statistical methods.
The data obtained from FISH were
assessed statistically. The number of transduction events by viral
vectors in any cell was assumed to follow a Poisson distribution. We
conditioned on the number of cells having no viral vectors integrated
to estimate the parameter of the Poisson distribution, i.e.,
P(X = 0) = exp(
). Then the expected number of
cells with 1, 2, 3, etc., transduction or integration events by viral
vectors was calculated by assuming a Poisson distribution with
parameter lambda. The fit of the data to this random model was
evaluated using a chi-square goodness-of-fit statistic, with cells
classified as having 1, 2, or more transduction or integration events.
Since it was not possible to determine if cells containing two red or
green signals had undergone individual transduction events (see Table
1), they were counted as indicating a single transduction event. This
would only underestimate the number of double transduction events and
decrease the probability of statistical significance.
| |
RESULTS |
Functional rAAV genomes are taken up by most hepatocyte nuclei in
vivo.
To attempt to understand why only a small percentage of the
hepatocytes become transduced in vivo, an experiment was performed to
establish whether all or most of the hepatocytes take up the vector
genomes. The liver sections from C57BL/6 mice injected with
rAAV-EF1-LacZ (Fig. 1D) at an estimated multiplicity of infection of
1,000 (1.2 × 1011 particles per mouse, with
108 hepatocytes/liver) were prepared 24 h
postinjection and examined for rAAV single-stranded vector genomes by
DNA in situ hybridization. As shown in Fig. 2a and
b, most
if not all of the hepatocyte nuclei had a positive signal for rAAV,
establishing that the low rate-limiting step for transduction was not
selective nuclear entry of the single-stranded vector genomes.
View larger version (159124K):
[in this window]
[in a new window]
|
FIG. 2.
DNA in situ hybridization and biological assay for
functional rAAV genomes. (A and B) C57BL/6 mice (n = 2)
were injected with 1.2 × 1011 particles of
rAAV-EF1-LacZ by intraportal infusion. One day later, the animals
were sacrificed and the livers were examined for the presence of rAAV
genomes. (A) Representative liver sample from one of two rAAV-treated
animals. Original magnification, ×200. (B) Liver sample from a
non-rAAV control. Original magnification, ×100. Note the presence of
staining in most of the hepatocyte nuclei in panel A. (C and D) C57BL/6
mice (n = 2) were injected with 1.0 × 1011 particles of AAV-CMV-LacZ by intraportal infusion. At
18 h after rAAV was administered, mouse hepatocytes were prepared
and plated in six-well dishes. At 6 h later, the cells were
infected with wild-type adenovirus type 2 at a multiplicity of
infection of 100 (C [original magnification, ×100]) or not infected
(D [original magnification, ×50]). At 24 h later, the cells
were stained with X-Gal.
|
|
To establish that these cells contained a substantial number of nuclear
rAAV genomes that were actually capable of transduction,
two mice
infused with 1.0 × 10
11 particles of rAAV-CMV-LacZ
were sacrificed 18 h later and primary
mouse hepatocytes were
cultured from these animals. At 6 h after
isolation, the
hepatocytes were infected for 24 h with a wild-type
adenovirus
type 2 (controls were cultured without adenovirus)
at a dose known to
infect about 90% of hepatocytes (
11). The
wild-type
adenovirus was used to supply helper gene function to
allow
second-strand rAAV synthesis to proceed into a potential
transcriptionally active molecule (
5,
6,
19,
31). From
65 to
71% (
n = 2 animals) of the adenovirus-infected and
less
than 0.1% of the non-adenovirus-infected hepatocytes stained
positive
with X-Gal, demonstrating that the majority of hepatocytes
have
"transduction-competent" rAAV genomes (Fig.
2c and d) shortly
after vector administration in
vivo.
These single-stranded competent genomes were lost over time, because
when a similar study was performed 5 weeks after infusion
of 1.8 × 10" rAAV-EF1
-LacZ particles into C57BL/6 Rag-1 mice
(
n = 3) (to avoid immune system responses to the
E. coli
-galactosidase),
there was only a slight (threefold) enhancement
from 0.7 ± 0.1%
(representing stable rAAV transduction) to
2.1 ± 0.3% X-Gal-positive
cells with the addition of wild-type
adenovirus. This is consistent
with our previous findings that
single-stranded rAAV vector genomes
decrease over a 5- to 13-week
period (
15).
A changing subpopulation of hepatocytes is permissive to stable
rAAV transduction, and dimer formation is an important event in
achieving stable transduction.
To further evaluate the
mechanism(s) of transduction in vivo, a mixed-vector experiment was
performed. A total of 1.0 × 1011 particles of rAAV
encoding human factor IX (rAAV-FIX) were infused per C57BL/6-scid mouse
(scid mice were used to eliminate the humoral immune response to the
vector and avoid interference with repeat dosing) into four groups of
animals (n = 3/group) through their portal vein. Each
group of mice was then infused with 1.0 × 1011
particles of rAAV encoding tyrosine hydroxylase (rAAV-TH) at the same
time (T1) or 1 week (T2), 3 weeks (T3), or 5 weeks (T4) after rAAV-FIX
infusion. Interphase nuclei were prepared from primary hepatocytes
isolated from each group of mice 5 weeks after rAAV-TH infusion to
determine the distribution of the two genomes in the nucleus by
two-color FISH (Fig. 3) (data are
summarized in Table 1). Consistent with
our previous studies (15, 24), we found that a small
percentage of the nuclei (3.2% to 6.8%) contained rAAV signals (a
quantitative measure of transduction efficiency) (Table 1).
View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
FISH from mice transduced in vivo with rAAV-FIX and
rAAV-TH vectors. C57BL/6-scid mice were infused with 1.0 × 1011 particles of each rAAV-FIX and rAAV-TH vectors. At 5 weeks later, mouse interphase nuclei from freshly isolated primary
hepatocytes were subjected to FISH with fluorescence-labeled rAAV-FIX
and/or rAAV-TH probes. Nuclei contained only rAAV-FIX signal (A), only
rAAV-TH signal (B), separate rAAV-FIX and rAAV-TH signals (C), or
overlapping rAAV-FIX and rAAV-TH signals (D). The discrete red
hybridization signals were produced by hybridizing with the rAAV-FIX
probe, the green signals were produced by hybridizing with the rAAV-TH
probe, and the yellow signal was generated from overlapping red and
green signals. Rare cells contained two red or two green signals (not
shown). Because some hepatocytes undergo DNA synthesis without nuclear
or cell division, it is not possible to determine whether these doubly
labeled single-color signals represent two independent events or DNA
synthesis after transduction; these were counted as single red or green
positive cells.
|
|
Most of the rAAV stably transduced positive nuclei contained either
rAAV-FIX genomes (red) (Fig.
3A) or rAAV-TH genomes (green)
(Fig.
3B)
(Table
1). However, when rAAV-FIX and rAAV-TH were
infused at the same
time, 42% of the transduced cells contained
both genomes (Fig.
3C and
D). While 0.9% of the hepatocytes (28%
of transduced hepatocytes)
contained a hybrid genome signal (yellow),
indicative of a single
transduction event using a mixture of the
two vector genomes (Fig.
3C),
0.4% of the hepatocytes (12.5% of
transduced hepatocytes) contained
separate red and green signals
in the same nucleus (Fig.
3D),
indicating two separate transduction
events at different loci within
the same cell. These results have
intriguing implications. If many of
the input vector genomes were
involved in a transduction event, we
would expect that most of
the FISH signals would contain a red-green
mix (yellow), whereas
if a single genome were used, a yellow signal
would never be observed.
The approximate 1:1:1 red/green/yellow ratio
of rAAV-positive
nuclei was most consistent with dimer formation as a
critical
event in the transduction
pathway.
Next, we examined whether rAAV transduction in hepatocytes was a random
event. For this purpose, we assumed that a cell containing
both a red
and green signal was the subject of two independent
transduction
events. Yellow signals were counted as a single transduction
event
because the probability of two independent events occurring
in close
enough proximity to yield a yellow signal would be small.
Furthermore,
even if side-by-side transduction events were to
occur on rare
occasions, their exclusion as double transduction
events would only
decrease the statistical significance. By assuming
that the
transduction of a viral vector in any cell follows a
Poisson
distribution, the fit of the data to a random model was
evaluated using
a chi-square goodness-of-fit statistic, with cells
classified as having
one or multiple transduction events. From
this random model, the number
of cells with dual transduction
events at time point T1 was predicted
to occur at much lower frequency
(0.05%) than the actual observed
frequency (at least 0.4% [Table
1]) (
P < 0.00001).
These analyses indicate that rAAV transduction
was not a random event
and that there is a finite number of hepatocytes
permissive to rAAV
transduction. As the time between the injection
of vector 1 and vector
2 increases, the number of dual-transduction
events decreases but the
total number of transduced hepatocytes
increases, suggesting that cells
permissive to transduction change
over time. Taken together, our data
suggest that there exists
a relatively small subpopulation of
hepatocytes that are permissive
to transduction but that these cells
are not static and change
over
time.
Molecular analysis of mixed rAAV concatemers in vivo.
To begin
to understand the molecular nature of the transduced rAAV genome in
cells, Southern and PCR analyses were performed. Southern analysis of
the genomic DNA digested with enzymes that cleave twice within either
vector demonstrated the presence of both rAAV-FIX and rAAV-TH in the
transduced mouse liver in all four groups of mice (data not shown).
Furthermore, we confirmed the presence of both vector genomes in mouse
liver by PCR amplification using internal primer sets (Fig.
4a) within the cDNA sequence of hFIX and
TH (Fig. 4b, lanes 1 and 2 and lanes 6 and 7). Since it was more
difficult to amplify longer sequences from genomic DNA, we used a
nested-PCR amplification method with two sets of vector-specific
primers, as shown in Fig. 4a, to detect the presence of head-to-tail
concatemers, circular monomers or dimers composed of the same vector
genomes, or mixed-vector genomes. After electrophoresis of the PCR
products, the gel was blotted and hybridized with the hFIX cDNA probe.
Subsequently, the same blots were stripped and hybridized with the TH
cDNA probe. The control monomer vector band and concatemers composed of
rAAV-FIX genomes hybridized with the hFIX probe only but not with the
TH probe (Fig. 4b, lanes 1, 3, 6, and 8), whereas control monomer and
concatemers of rAAV-TH hybridized with the TH probe only but not with
the hFIX probe (lanes 2, 4, 7, and 9). The majority of the molecules
are in a head-to-tail orientation; however, with longer exposure, minor bands of ~0.9 kb corresponding to the tail-to-tail orientation could
sometimes be detected (data not shown).
View larger version (16106K):
[in this window]
[in a new window]
|
FIG. 4.
PCR detection of the vector genomes from transduced
mouse hepatocytes. (a) Proposed structure of the amplified fragments.
Horizontal arrows indicate the location and direction of PCR primers,
and the sizes of the expected fragments are given. (b) The vector
genomes were amplified from liver DNA of animals in each of the four
groups (T1, both rAAV vectors infused at the same time; T2, vectors
administered 1 week apart; T3, vectors administered 3 weeks apart; and
T4, vectors administered 5 weeks apart) as summarized in Table 1. The
presence of vector genomes in the mouse liver was confirmed by PCR
experiments using sequence-specific primer sets within the cDNA
sequence of hFIX (H1 and H2) (lanes 1 and 6) and TH (T1 and T2) (lanes
2 and 7). Two sets of primers as shown in panel a were used in nested
PCR experiments to amplify vector-vector junctions composed of the same
vector genomes and mixed-vector genomes, respectively. After
electrophoresis of the PCR products, the gel was blotted and hybridized
with an hFIX cDNA probe (lanes 1 to 5). Subsequently, the blots were
stripped and hybridized with a TH cDNA probe (lanes 6 to 10). Primer
sets consisting of H3-H4 and H8-H9 amplified head-to-tail rAAV-FIX
molecules that hybridized with the hFIX probe but not the TH probe
(lanes 3 and 8), primer sets consisting of T3-T4 and T7-T10 amplified
head-to-tail rAAV-TH molecules which hybridized with the TH probe but
not the hFIX probe (lanes 4 and 9), and primer sets consisting of H3-T4
and H9-T10 amplified head-to-tail rAAV-TH-rAAV-FIX mixed dimers which
hybridized with both hFIX and TH probes (lanes 5 and 10). While a
2.7-kb band could arise from a PCR artifact, the livers from mice
infused at the later time points (T3 and T4), which do contain both
vector genomes in the same liver samples, do not give the 2.7-kb
band.
|
|
Most interestingly, a single band of ~2.7 kb was amplified by PCR and
hybridized with both hFIX and TH probes; it was found
to represent a
mixed-genome species (Fig.
4b, lanes 5 and 10 in
samples T1 and T2
only). The mixed concatemers containing rAAV-FIX
and rAAV-TH genomes in
a head-to-tail orientation were detected
only in hepatocytes of mice
given the two constructs simultaneously
or 1 week apart, not in those
of mice given the constructs 3 and
5 weeks apart; this was consistent
with the presence or absence
of yellow FISH signals (Fig.
3) in
transduced hepatocytes. Larger
molecules consisting of
(rAAV-TH)
n-(rAAV-FIX)
n in
either head-to-tail, head-to-head, or tail-to-tail forms may
also exist
but may not be detectable because of heterogeneity,
primer selection,
or length of the PCR product. Thus, further
studies are required to
establish the most prevalent molecular
structure (if one exists) of the
heterogenomes.
The permissive subpopulation of hepatocytes comprises both
non-S-phase and S-phase cells.
Although most hepatocytes at a
single time point are quiescent, a small percentage are in the cell
cycle, and some of these do not undergo cytokinesis; this results in
polyploid nuclei and/or doubly nucleated hepatocytes (4).
Thus, a substantial fraction of hepatocytes could cycle over the 5-week
period required for rAAV transduction of hepatocytes. In addition, it
has been demonstrated that rAAV vectors preferentially transduce cells
in S phase in vitro (21). Therefore, we designed studies to
determine if the cell cycle status could account for the permissive
subpopulation of hepatocytes that were transduced by rAAV vectors in
vivo. We first compared the rAAV-EF1-LacZ transduction efficiency in
the two groups of mice that were not hepatectomized or were partially hepatectomized 48 h (time to maximal hepatocellular division) prior to vector administration. Continuous labeling with BrdU for 36 days revealed that 50% of the hepatocytes passed through S phase after
vector administration in the hepatectomized group while 15% of the
hepatocytes were labeled in the nonhepatectomized group (Fig.
5; Table
2); however, there was no significant
difference in the number of -galactosidase-positive hepatocytes
between these two groups. This suggested that cell division at or
around the time of vector injection was not a requirement for
transduction of mouse hepatocytes. More importantly, among the
-galactosidase-positive hepatocytes, the BrdU-positive cells
appeared to be of the same or lower prevalence compared with the
BrdU-negative cells in both the partially hepatectomized and
nonhepatectomized animals (Fig. 5; Table 2). This substantiates the
notion that there was no preference for transduction in hepatocytes
that had passed through the S phase in vivo.
View larger version (151K):
[in this window]
[in a new window]
|
FIG. 5.
Determination of rAAV transgene expression in
BrdU-labeled hepatocytes. C57BL/6 Rag-1 mice were injected with
1.8 × 1011 particles of rAAV-EF1-LacZ with
(n = 3) (A) or without (n = 4) (B) a
prior hepatectomy. The animals were continuously labeled with BrdU for
36 days, as described in Materials and Methods. At 36 days, liver
sections were costained with X-Gal and BrdU. The cytoplasmic blue and
nuclear brown staining represents -galactosidase and BrdU,
respectively. (A) Magnification, ×400. One doubly labeled hepatocyte
is present in the lower left corner. (B) Magnification, ×200. The
-galactosidase-positive cells are negative for BrdU.
|
|
We next wanted to know if stimulating cell division by partial
hepatectomy after vector injection would enhance transduction
and/or
change the molecular forms of the vector. To address this
question,
C57BL/6 mice (13 to 16 weeks old) injected with rAAV-EF1
-FIX
vector
intraportally at a dose of 1.7 × 10
11 particles were
partially hepatectomized on days 3, 10, 17, and
24 postinjection. All
the mice that underwent hepatectomy were
sacrificed 7 days after the
procedure (days 10, 17, 24, and 31
after vector administration) for
rAAV DNA analysis. Plasma hFIX
levels, rAAV genome number per cell, and
rAAV vector forms were
compared in rAAV-treated, nonhepatectomized and
partially hepatectomized
animals. Consistent with our previous studies,
the hFIX levels
increased over time (
15) but were
accompanied by a reduction
in the number of vector genomes in the
nonhepatectomized mice
(Fig.
6). The hFIX
levels in the partially hepatectomized group
were consistently lower
than those in the nonhepatectomized group,
presumably representing loss
of the vector genomes that had the
potential to participate in the
protein expression. The loss of
vector genomes was most prevalent
between the 3- and 10-day partial
hepatectomy groups, a period when a
large proportion of vector
genomes have not integrated (
15).
The loss of DNA and the lower
hFIX gene expression may have simply been
due to the dilution
of the nonintegrated vector genomes per hepatocyte
during cell
division. The smaller decrease in the number of vector
genomes
observed between the 17- and 24-day partially hepatectomized
animals
(Fig.
6) probably occurred because some of the stable
transduced
hepatocytes contained integrated rAAV genomes by this time
that
would not be diluted by cellular division. Finally, cell cycle
activation after vector injection did not promote the conversion
of the
low-molecular-weight episomal forms to the high-molecular-weight
species (data not shown). Taken together, the results show that
cell
cycling did not facilitate the rAAV transduction in hepatocytes.
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
Comparison of transgene expression and vector copy
number per cell in the liver between mice partially hepatectomized
after rAAV administration and control mice without hepatectomy. Sixteen
adult C57BL/6 mice were injected with rAAV-EF1-FIX. Three mice were
partially hepatectomized on days 3, 10, 17, and 24 and sacrificed 7 days after the hepatectomy. hFIX levels in mouse plasma were determined
by an enzyme-linked immunosorbent assay, and the vector copy number per
diploid amount of DNA in livers was determined by Southern blot
analysis. DNA signals represent all double-stranded vector sequences
(see Materials and Methods). Error bars represent standard deviation.
The number above each bar indicates the number of mouse samples
analyzed. PHx, partial hepatectomy.
|
|
| |
DISCUSSION |
Possible mechanisms of concatemerization leading to stable
transduction.
The mechanisms involved in rAAV integration have
been studied in tissue culture and are now starting to be addressed in
vivo (reviewed in reference 20). It is becoming
apparent that the process of integration may not be the same under
different experimental conditions, and it is likely that the metabolic
state of the cell and/or the cell type is a crucial factor.
Our results are consistent with the mechanism that the random linkage
of two genomes is a critical event or that only a few
input rAAV
genomes are directly involved in the process of transduction
in the
absence of helper viruses (
12). The presence of the
concatemeric
mixed genomes argues against the models where AAV proviral
concatemers
are the exclusive result of the amplification of a single
input
genome in a rolling-circle model, or as a monomer-length input
genome that integrates and is then amplified in place. The formation
of
vector concatemers may involve joining of existing single-stranded
genomes and/or rolling-circle replicative mechanisms. The presence
of
mixed concatemeric structures indicates that recombination
between two
vector monomers may occur. In view of the great stability
of
single-stranded rAAV genomes in the liver for at least 5 weeks
(
15) and the recent evidence of circular intermediates of
monomer
and dimer viral genomes in a head-to-tail array in muscle
tissue
(
2,
27,
30), our data are consistent with our current
hypothesis
that two genomes somehow become linked and then become
larger
concatermers before, during, or after chromosomal integration.
Further experiments are required to clarify the molecular
mechanism.
Permissive state of cells required for transduction.
The
reason why only a small, changing population of hepatocytes is
permissible to rAAV transduction is not known but may be associated
with a special metabolic state of the cell. Alternatively, the
permissive state could be nothing more than a stochastic event where a
large threshold number of genomes is needed for transduction even if
only a few genomes are used and required in the initial steps of
concatemer formation. If this were true, we would expect most, if not
all, of the transduced hepatocytes to be periportal, because they would
have received the highest concentration of vector after an intraportal
infusion. However, there is only a slight preference for transduction
of periportal hepatocytes (24). Dose-response studies with
careful quantitation of transgene product and the number of transduced
hepatocytes may help to distinguish between these different possibilities.
Clearly, our studies demonstrate that the cell cycle is not an
important factor for rAAV transduction. In a previous study,
regenerating muscle was less permissive to rAAV transduction than
was
mature muscle (
25). However, the situation for muscle is
different from that for liver, because regenerating hepatocytes
are
fully differentiated cells whereas the cells involved in muscle
replacement are not terminally differentiated. In our studies,
we
demonstrate that rAAV uptake is not the limiting step to transduction
in regenerating livers. Moreover, in livers that had taken up
rAAV
genomes and then underwent a regenerative stimulus by partial
hepatectomy, there was no enhancement in
transduction.
There is still no way to easily reconcile these studies with the
studies of Russell et al., who showed enhanced rAAV transduction
in
cultured cells that had passed through the S phase (
21).
There are multiple issues, including the possibility of low levels
of
wild-type helper virus that may have been present in earlier
viral
preparations, the difference in timing when the cultured
cells were
examined for rAAV-mediated gene expression compared
to the in vivo
studies (48 h and 36 days, respectively), and/or
the presence of
[
3H]thymidine (used for S-phase labeling), which itself
can increase
rAAV transduction (
1). Cultured cells may not
behave in the
same way as cells in vivo, or the differences may be
related to
the different cell types
studied.
It is important to resolve the process involved in the permissive
nature of hepatocytes that allows stable transduction, because
it may
allow the presently limited transduction efficiency in
vivo to be
expanded. However, the inability to analyze single
cells or their
clones at the molecular level makes this a challenging
task for future
studies.
| |
ACKNOWLEDGMENTS |
C.H.M. and H.N. contributed equally to this work.
We thank Doug Bolgiano for assistance with the statistical analysis.
This work was supported by NIH grant HL53682. C.H.M. was supported by
individual NIH-NRSA grant HL09754.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pediatrics, 300 Pasteur Dr., Rm G305A, Stanford University, Stanford, CA 94305. Phone: (650) 498-6531. Fax: (650) 498-6540. E-mail: Markay{at}stanford.edu.
Present address: Division of Molecular Medicine, Department of
Pediatrics, Harvard Medical School, Boston, MA 02115.
| |
REFERENCES |
| 1.
|
Alexander, I. E.,
D. W. Russell, and A. D. Miller.
1994.
DNA-damaging agents greatly increase the transduction of non-dividing cells by adeno-associated virus vectors.
J. Virol.
68:8282-8287[Abstract/Free Full Text].
|
| 2.
|
Duan, D.,
P. Sharma,
J. Yang,
Y. Yue,
L. Dudus,
Y. Zhang,
K. Fisher, and J. Engelhardt.
1998.
Circular intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue.
J. Virol.
72:8568-8577[Abstract/Free Full Text].
|
| 3.
|
Fan, D. S.,
M. Ogawa,
K. I. Fujimoto,
K. Ikeguchi,
Y. Ogasawara,
M. Urabe,
M. Nishizawa,
I. Nakano,
M. Yoshida,
I. Nagatsu,
H. Ichinose,
T. Nagatsu,
G. J. Kurtzman, and K. Ozawa.
1998.
Behavioral recovery in 6-hydroxydopamine-lesioned rats by cotransduction of striatum with tyrosine hydroxylase and aromatic L-amino acid decarboxylase genes using two separate adeno-associated virus vectors.
Hum. Gene Ther.
9:2527-2535[CrossRef][Medline].
|
| 4.
|
Fausto, N.
1996.
Hepatic regeneration, p. 35-58.
In
D. Zakim, and T. D. Boyer (ed.), Hepatology, 3rd ed., vol. 1. The W. B. Saunders Co., Philadelphia, Pa.
|
| 5.
|
Ferrari, F. K.,
T. Samulski,
T. Shenk, and R. J. Samulski.
1996.
Second-strand synthesis is a rate-limiting step for efficient transduction by recombinant adeno-associated virus vectors.
J. Virol.
70:3227-3234[Abstract].
|
| 6.
|
Fisher, K. J.,
G.-P. Gao,
M. D. Weitzman,
R. DeMatteo,
J. F. Burda, and J. M. Wilson.
1996.
Transduction with recombinant adeno-associated virus for gene therapy is limited by leading-strand synthesis.
J. Virol.
70:520-532[Abstract].
|
| 7.
|
Flannery, J. G.,
S. Zolotukhin,
M. I. Vaquero,
N. M. LaVail,
N. Muzyczka, and W. W. Hauswirth.
1997.
Efficient photoreceptor-targeted gene expression in vivo by recombinant adeno-associated virus.
Proc. Natl. Acad. Sci USA
94:6916-6921[Abstract/Free Full Text].
|
| 8.
|
Herzog, R.,
E. Yang,
L. Couto,
J. Hagstrom,
D. Elwell,
P. Fields,
M. Burton,
D. Bellinger,
M. Read,
K. Brinkhous,
G. Podsakoff,
T. Nichols,
G. Hurtzman, and K. High.
1999.
Long-term correction of canine hemophilia B by gene transfer of blood coagulation factor IX mediated by adeno-associated viral vector.
Nat. Med.
5:56-63[CrossRef][Medline].
|
| 9.
|
Kay, M. A.,
Q. Li,
T. J. Liu,
F. Leland,
C. Toman,
M. Finegold, and S. L. C. Woo.
1992.
Hepatic gene therapy: persistent expression of human alpha 1-antitrypsin in mice after direct gene delivery in vivo.
Hum. Gene Ther.
3:641-647[Medline].
|
| 10.
|
Kessler, P. D.,
G. M. Podsakoff,
X. Chen,
S. A. McQuiston,
P. C. Colosi,
L. A. Matelis,
G. J. Kurtzman, and B. J. Byrne.
1996.
Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein.
Proc. Natl. Acad. Sci. USA
93:14082-14087[Abstract/Free Full Text].
|
| 11.
|
Li, Q.,
M. A. Kay,
M. Finegold,
L. D. Stratford-Perricaudet, and S. L. C. Woo.
1993.
Assessment of recombinant adenoviral vectors for hepatic gene therapy.
Hum. Gene Ther.
4:403-409[Medline].
|
| 12.
|
Linden, R. M.,
E. Winocour, and K. I. Berns.
1996.
The recombination signals for adeno-associated virus site-specific integration.
Proc. Natl. Acad. Sci. USA
93:7966-7972[Abstract/Free Full Text].
|
| 13.
|
Mandel, R. J.,
K. G. Rendahl,
S. K. Spratt,
R. O. Snyder,
L. K. Cohen, and S. E. Leff.
1998.
Characterization of intrastriatal recombinant adeno-associated virus-mediated gene transfer of human tyrosine hydroxylase and human GTP-cyclohydrolase I in a rat model of Parkinson's disease.
J. Neurosci.
18:4271-4284[Abstract/Free Full Text].
|
| 14.
|
McLaughlin, S. K.,
P. Collis,
P. L. Hermonat, and N. Muzyczka.
1988.
Adeno-associated virus general transduction vectors: analysis of proviral structures.
J. Virol.
62:1963-1973[Abstract/Free Full Text].
|
| 15.
|
Miao, C.,
R. Snyder,
D. Schowalter,
G. Patijn,
B. Donahue,
B. Winther, and M. A. Kay.
1998.
The kinetics of rAAV integration in the liver.
Nat. Genet.
19:13-15[CrossRef][Medline].
|
| 16.
|
Nakai, H.,
R. Herzog,
J. Hagstrom,
J. Walter,
S.-H. Kung,
E. Yang,
S. Tai,
Y. Iwaki,
G. Kurtzman,
K. Fisher,
P. Colosi,
L. Couto, and K. High.
1998.
Adeno-associated viral vector-mediated gene transfer of human blood coagulation factor IX into mouse liver.
Blood
91:4600-4607[Abstract/Free Full Text].
|
| 17.
|
Nakai, H.,
Y. Iwaki,
M. A. Kay, and L. B. Couto.
1999.
Isolation of recombinant adeno-associated virus (rAAV) vector-cellular DNA junctions from mouse liver.
J. Virol.
77:5438-5447.
|
| 18.
|
Park, F.,
K. Ohashi,
W. Chiu, and M. A. Kay.
2000.
Efficient lentiviral transduction of liver requires cell cycling in vivo.
Nat. Genet.
24:49-52[CrossRef][Medline].
|
| 19.
|
Rendahl, K. G.,
S. E. Leff,
G. R. Otten,
S. K. Spratt,
D. Bohl,
M. Van Roey,
B. A. Donahue,
L. K. Cohen,
R. J. Mandel,
O. Danos, and R. O. Snyder.
1998.
Regulation of gene expression in vivo following transduction by two separate rAAV vectors.
Nat. Biotechnol.
16:757-761[CrossRef][Medline].
|
| 20.
|
Russell, D., and M. A. Kay.
1999.
rAAV and hematology.
Blood
94:864-874[Free Full Text].
|
| 21.
|
Russell, D. W.,
A. D. Miller, and I. E. Alexander.
1994.
Adeno-associated virus vectors preferentially transduce cells in S phase.
Proc. Natl. Acad. Sci. USA
91:8915-8919[Abstract/Free Full Text].
|
| 22.
|
Rutledge, E. A., and D. W. Russell.
1997.
Adeno-associated virus vector integration junctions.
J. Virol.
71:8429-8436[Abstract].
|
| 23.
|
Snyder, R.,
C. Miao,
L. Meuse,
J. Tubb,
B. Donahue,
H. Lin,
D. Stafford,
S. Patel,
A. Thompson,
T. Nichols,
M. Read,
D. Bellinger,
K. Brinkhous, and M. Kay.
1999.
Correction of hemophilia B in canine and murine models using recombinant adeno-associated viral vectors.
Nat. Med.
5:64-70[CrossRef][Medline].
|
| 24.
|
Snyder, R.,
C. Miao,
G. Patijn,
S. Spratt,
O. Danos,
D. Nagy,
A. Gown,
B. Winther,
L. Meuse,
L. Cohen,
A. Thompson, and M. Kay.
1997.
Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors.
Nat. Genet.
16:270-276[CrossRef][Medline].
|
| 25.
|
Snyder, R. O.,
S. K. Spratt,
C. Lagarde,
D. Bohl,
B. Kaspar,
B. Sloan,
L. K. Cohen, and O. Danos.
1997.
Efficient and stable adeno-associated virus-mediated transduction in the skeletal muscle of adult immunocompetent mice.
Hum. Gene Ther.
8:1891-1900[Medline].
|
| 26.
|
Szczypka, M. S.,
R. J. Mandel,
B. A. Donahue,
R. O. Snyder, and R. D. Palmiter.
1999.
Viral gene delivery selectively restores feeding and prevents lethality of dopamine-deficient mice.
Neuron
22:167-178[CrossRef][Medline].
|
| 27.
|
Vincent-Lacaze, N.,
R. O. Snyder,
R. Gluzman,
D. Bohl,
C. Lagarde, and O. Danos.
1999.
Structure of adeno-associated virus vector DNA following transduction of the skeletal muscle.
J. Virol.
73:1949-1955[Abstract/Free Full Text].
|
| 28.
|
Xiao, X.,
J. Li, and R. J. Samulski.
1996.
Efficient long-term gene transfer into muscle tissue of immunocompetent mice by adeno-associated virus vector.
J. Virol.
70:8098-8108[Abstract].
|
| 29.
|
Yang, C. C.,
X. Xiao,
X. Zhu,
D. C. Ansardi,
N. D. Epstrein,
M. R. Frey,
A. G. Matera, and R. J. Samulski.
1997.
Cellular recombination pathways and viral terminal repeat hairpin structures are sufficient for adeno-associated virus integration in vivo and in vitro.
J. Virol.
71:9231-9246[Abstract].
|
| 30.
|
Yang, J.,
W. Zhou,
Y. Zhang,
T. Zidon,
T. Ritchie, and J. F. Engelhardt.
1999.
Concatamerization of adeno-associated virus circular genomes occurs through intermolecular recombination.
J. Virol.
73:9468-9477[Abstract/Free Full Text].
|
| 31.
|
Ye, X.,
V. M. Rivera,
P. Zoltick,
F. Cerasoli,
M. A. Schnell,
G. P. Gao,
J. V. Hughes,
M. Gilman, and J. M. Wilson.
1999.
Regulated delivery of therapeutic proteins after in vivo somatic gene transfer.
Science
283:88-91[Abstract/Free Full Text].
|
Journal of Virology, April 2000, p. 3793-3803, Vol. 74, No. 8
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Penaud-Budloo, M., Le Guiner, C., Nowrouzi, A., Toromanoff, A., Cherel, Y., Chenuaud, P., Schmidt, M., von Kalle, C., Rolling, F., Moullier, P., Snyder, R. O.
(2008). Adeno-Associated Virus Vector Genomes Persist as Episomal Chromatin in Primate Muscle. J. Virol.
82: 7875-7885
[Abstract]
[Full Text]
-
Wang, J., Xie, J., Lu, H., Chen, L., Hauck, B., Samulski, R. J., Xiao, W.
(2007). Existence of transient functional double-stranded DNA intermediates during recombinant AAV transduction. Proc. Natl. Acad. Sci. USA
104: 13104-13109
[Abstract]
[Full Text]
-
Wuensch, S. A., Pierce, R. H., Crispe, I. N.
(2006). Local Intrahepatic CD8+ T Cell Activation by a Non-Self- Antigen Results in Full Functional Differentiation. J. Immunol.
177: 1689-1697
[Abstract]
[Full Text]
-
Gao, G.-P., Lu, Y., Sun, X., Johnston, J., Calcedo, R., Grant, R., Wilson, J. M.
(2006). High-Level Transgene Expression in Nonhuman Primate Liver with Novel Adeno-Associated Virus Serotypes Containing Self-Complementary Genomes.. J. Virol.
80: 6192-6194
[Abstract]
[Full Text]
-
Grimm, D., Pandey, K., Nakai, H., Storm, T. A., Kay, M. A.
(2006). Liver Transduction with Recombinant Adeno-Associated Virus Is Primarily Restricted by Capsid Serotype Not Vector Genotype. J. Virol.
80: 426-439
[Abstract]
[Full Text]
-
Nakai, H., Fuess, S., Storm, T. A., Muramatsu, S.-i., Nara, Y., Kay, M. A.
(2005). Unrestricted Hepatocyte Transduction with Adeno-Associated Virus Serotype 8 Vectors in Mice. J. Virol.
79: 214-224
[Abstract]
[Full Text]
-
Thomas, C. E., Storm, T. A., Huang, Z., Kay, M. A.
(2004). Rapid Uncoating of Vector Genomes Is the Key to Efficient Liver Transduction with Pseudotyped Adeno-Associated Virus Vectors. J. Virol.
78: 3110-3122
[Abstract]
[Full Text]
-
Grimm, D., Zhou, S., Nakai, H., Thomas, C. E., Storm, T. A., Fuess, S., Matsushita, T., Allen, J., Surosky, R., Lochrie, M., Meuse, L., McClelland, A., Colosi, P., Kay, M. A.
(2003). Preclinical in vivo evaluation of pseudotyped adeno-associated virus vectors for liver gene therapy. Blood
102: 2412-2419
[Abstract]
[Full Text]
-
Davidoff, A. M., Ng, C. Y. C., Zhou, J., Spence, Y., Nathwani, A. C.
(2003). Sex significantly influences transduction of murine liver by recombinant adeno-associated viral vectors through an androgen-dependent pathway. Blood
102: 480-488
[Abstract]
[Full Text]
-
Nakai, H., Thomas, C. E., Storm, T. A., Fuess, S., Powell, S., Wright, J. F., Kay, M. A.
(2002). A Limited Number of Transducible Hepatocytes Restricts a Wide-Range Linear Vector Dose Response in Recombinant Adeno-Associated Virus-Mediated Liver Transduction. J. Virol.
76: 11343-11349
[Abstract]
[Full Text]
-
Mingozzi, F., Schuttrumpf, J., Arruda, V. R., Liu, Y., Liu, Y.-L., High, K. A., Xiao, W., Herzog, R. W.
(2002). Improved Hepatic Gene Transfer by Using an Adeno-Associated Virus Serotype 5 Vector. J. Virol.
76: 10497-10502
[Abstract]
[Full Text]
-
Nathwani, A. C., Davidoff, A. M., Hanawa, H., Hu, Y., Hoffer, F. A., Nikanorov, A., Slaughter, C., Ng, C. Y. C., Zhou, J., Lozier, J. N., Mandrell, T. D., Vanin, E. F., Nienhuis, A. W.
(2002). Sustained high-level expression of human factor IX (hFIX) after liver-targeted delivery of recombinant adeno-associated virus encoding the hFIX gene in rhesus macaques. Blood
100: 1662-1669
[Abstract]
[Full Text]
-
Brown, B. D., Lillicrap, D.
(2002). Dangerous liaisons: the role of "danger" signals in the immune response to gene therapy. Blood
100: 1133-1140
[Abstract]
[Full Text]
-
Aikawa, R., Huggins, G. S., Snyder, R. O.
(2002). Cardiomyocyte-specific Gene Expression Following Recombinant Adeno-associated Viral Vector Transduction. J. Biol. Chem.
277: 18979-18985
[Abstract]
[Full Text]
-
Nakai, H., Yant, S. R., Storm, T. A., Fuess, S., Meuse, L., Kay, M. A.
(2001). Extrachromosomal Recombinant Adeno-Associated Virus Vector Genomes Are Primarily Responsible for Stable Liver Transduction In Vivo. J. Virol.
75: 6969-6976
[Abstract]
[Full Text]
-
Nathwani, A. C., Davidoff, A., Hanawa, H., Zhou, J.-F., Vanin, E. F., Nienhuis, A. W.
(2001). Factors influencing in vivo transduction by recombinant adeno-associated viral vectors expressing the human factor IX cDNA. Blood
97: 1258-1265
[Abstract]
[Full Text]
-
Nakai, H., Storm, T. A., Kay, M. A.
(2000). Recruitment of Single-Stranded Recombinant Adeno-Associated Virus Vector Genomes and Intermolecular Recombination Are Responsible for Stable Transduction of Liver In Vivo. J. Virol.
74: 9451-9463
[Abstract]
[Full Text]
-
Williams, D. A., Nienhuis, A. W., Hawley, R. G., Smith, F. O.
(2000). Gene Therapy 2000. ASH Education Book
2000: 376-393
[Abstract]
[Full Text]
Top
Abstract
Introduction
