Previous Article | Next Article 
Journal of Virology, April 2000, p. 3771-3780, Vol. 74, No. 8
0022-538X/00/$04.00+0
Golgi Network Targeting and Plasma Membrane
Internalization Signals in Vaccinia Virus B5R Envelope
Protein
Brian M.
Ward and
Bernard
Moss*
Laboratory of Viral Diseases, National
Institute of Allergy and Infectious Diseases, National Institutes
of Health, Bethesda, Maryland 20892-0445
Received 25 October 1999/Accepted 27 January 2000
 |
ABSTRACT |
The vaccinia virus B5R type I integral membrane protein accumulates
in the Golgi network, from where it becomes incorporated into the
envelope of extracellular virions. Our objective was to determine the
domains of B5R responsible for Golgi membrane targeting in the absence
of other viral components. Fusion of an enhanced green fluorescent
protein to the C terminus of B5R allowed imaging of the chimeric
protein without altering intracellular trafficking and Golgi network
localization in transfected cells. Deletion or swapping of B5R domains
with corresponding regions of the vesicular stomatitis virus G protein,
which is targeted to the plasma membrane, indicated that (i) the
N-terminal extracellular domain of B5R had no specific role in Golgi
apparatus localization, (ii) the transmembrane domain of B5R was
sufficient for exiting the endoplasmic reticulum, and (iii) removal of
the cytoplasmic tail impaired Golgi network localization and increased
the accumulation of B5R in the plasma membrane. Further experiments
demonstrated that the cytoplasmic tail mediated internalization of B5R
from the plasma membrane, suggesting a retrieval mechanism. Mutagenesis revealed residues required for Golgi membrane localization and efficient plasma membrane retrieval of the B5R protein: a tyrosine at
residue 310 and two adjacent leucines at residues 315 and 316.
 |
INTRODUCTION |
Vaccinia virus replicates in the
cytoplasm and produces two related infectious forms: intracellular
mature virions (IMV) and extracellular enveloped virions (EEV)
(32). EEV arise from IMV that have been wrapped by a
trans-Golgi network (TGN) or endosomal cisternae (18, 21, 31, 44,
47). While IMV comprise the majority of progeny virions, they are
released only following cell lysis. Cell surface adherent and detached
EEV are believed to be largely responsible for cell-to-cell spread and
long-range transmission of vaccinia virus (1, 4, 7, 37). Six
proteins, encoded by the A33R (42), A34R (12),
A36R (36), A56R (38, 45), B5R (13,
22), and F13L (19) open reading frames (ORFs), are
known to be EEV specific. When expression of A33R, A34R, A36R, B5R, or
F13L was prevented, the size of virus plaques was drastically reduced
because of inefficient virus spread (3, 30, 36, 41, 51).
F13L and B5R play crucial roles in morphogenesis, as deletion of either
inhibited the wrapping of IMV causing decreased EEV production (3,
14, 51). In contrast, deletion or repression of A33R, A34R, or
A36R had relatively little effect on EEV formation but decreased the
number of actin tails associated with intracellular enveloped virions
(IEV) (41, 42a, 52, 53).
While there is considerable information regarding the consequences of
EEV gene deletions on morphogenesis and virus spread, little is known
about how EEV proteins are targeted to the viral membrane. The 42-kDa
type I integral membrane glycoprotein encoded by the B5R ORF (13,
22) was found in the Golgi network when it was expressed in the
absence of other viral proteins (24), suggesting that it
contains the requisite transport and localization signals. Several
studies with infected cells showed that removal or replacement of
either the lumenal domain or the cytoplasmic tail had no effect on the
incorporation of B5R into EEV (17, 24, 26, 29). Taken
together, these results implied that the transmembrane domain of B5R
was necessary and sufficient for Golgi membrane localization and EEV
targeting. However, no mutant with a deletion of both the lumenal
domain and cytoplasmic tail of B5R was examined, leaving open the
possibility that redundant targeting signals are present in the lumenal
domain and cytoplasmic tail and absent from the transmembrane domain.
Furthermore, since all studies with mutated proteins were carried out
in the context of permissive virus infections, other viral proteins may
have served as chaperones. For these reasons, we thought it important to test the roles of the transmembrane domain and cytoplasmic tail
individually and in the absence of other vaccinia virus proteins.
In the present study, we modified and interchanged domains of the B5R
and vesicular stomatitis virus glycoprotein (VSVG) and demonstrated
that the transmembrane domain of B5R allowed endoplasmic reticulum
(ER)-to-Golgi membrane transport and that specific sequences in the cytoplasmic tail of B5R were responsible for its accumulation in
the Golgi network and retrieval from the plasma membrane.
 |
MATERIALS AND METHODS |
Construction of chimeric proteins.
The following primers,
with restriction endonuclease cleavage sites in italics, overlapping
nucleotides (nt) for two-stage PCR underlined, and mutations in the B5R
coding sequence in bold letters, were used in this study: B5RSacF,
CGGAGCTCTGCAACTTATCATATAATC; B5R3'NcoR,
GCTTACACCATGGGTAGCAATTTATGGAACT; VSVGctF,
TGTTCCTGTCGAGTTGGTATTTATC; B5RtmdR,
AAATACCAACTCGACAGGAACAAACTAAT; B5R5'D3F,
GAAGCTTCATAAATAAAAATGAAAACG; B5R
ctR,
ACCATGGTACAGGAACAAACTAATAC; B5RctF,
TTGGTTCTCTGTTCCTGTGACAAAAAT; VSVGtmdR,
GGAACAGAGAACCAAGAATAGTCC; B5R310AF,
GACCAAGCTAAGTTCCATAAATTGCTA; B5R310AR,
GAACTTAGCTTGGTCATTATTTTTGTC; B5RSacR,
AGAGCTCTCTAACGATTCTATTTCTTGT; B5R
LLR,
CCATGGGTTTATGGAACTTATATTGGTCATT; VSVG
ctR,
ATCCATGGCAATACCAACTCGGAGAACCAA; B5R310A/
LLR,
ACCATGGGTTTATGGAACTTAGCTTGG.
The cosmid pWR133-168 (46) was digested with
ScaI-NsiI and a 2.15-kbp fragment containing B5R
was cloned into pGEM-7Zf (Promega) that had been digested with
SmaI-NsiI. The resulting plasmid, pBMW-4,
contained B5R and approximately 500 bp of flanking sequence on each
side. Primers B5R5'D3F and B5R3'NcoR were used to amplify the entire
B5R sequence and add a HindIII site 17 bp upstream from
the translational start site and an NcoI site immediately in
front of the termination codon. PCR products were separated on a 1%
low-melting-point agarose (GIBCO) gel, and the appropriately sized
fragment was excised, purified by using Wizard PCR preps (Promega),
cloned into pGEM-T (Promega), and sequenced. Subsequently, a 970-bp
HindIII-NcoI fragment containing the coding
sequence for B5R was ligated together with a 734-bp
NcoI-XbaI fragment from pEGFP-N1 (Clontech)
containing the enhanced green fluorescent protein (GFP) ORF and the
expression vector pCDM8 (Invitrogen), which had been linearized with
HindIII-XbaI to yield pB5R-GFP. To simplify
the nomenclature of the chimeras, each was given a three-letter
designation, divided by slashes, corresponding to the three domains of
the protein (lumenal/transmembrane/cytoplasmic) and the protein from
which it was derived, G for VSVG and B for B5R (Fig.
1). VSVG-GFP (39) was a
generous gift from Jennifer Lippincott-Schwartz. Primers B5RSacF and
B5R3'NcoR were used to amplify a fragment of B5R containing the
transmembrane domain and cytoplasmic tail and add a SacI
site at nt 825 and an NcoI site immediately in front of the
termination codon. The amplified fragment was cloned into pGEM-T as
described above to yield pBMW1-T. To construct G/B/B-GFP, a fragment
containing the transmembrane domain and cytoplasmic tail was excised
from pBMW1-T by using SacI and NcoI. This
fragment was ligated with a 734-bp NcoI-XbaI fragment containing GFP from pEGFP-N1 and VSVG-GFP that had been linearized with XbaI and partially digested with
SacI to cleave only the SacI site at nt 1389 of
VSVG to yield G/B/B-GFP. To make templates for the construction of
other chimeras, the plasmids containing VSVG-GFP and G/B/B-GFP were
each digested with PstI-XbaI, and the resulting
fragments were cloned into pUC19 that had been digested the same way to
yield pBMW-10 and pBMW-3, respectively. Standard two-stage PCR was used
with the following primers and template pairs: primer pair B5RctF and
M13 forward (Promega) with template pBMW-3 and primer pair VSVGtmdR and
M13 reverse (Promega) with template pBMW-10 to construct G/G/B-GFP.
After amplification, fragments were separated as before and joined by a
third PCR. The resulting amplified fragment was cloned as described
before to yield pBMW-5T. A 730-bp PstI-NcoI
fragment from G/B/B-GFP was replaced with a 720-bp
PstI-NcoI fragment from pBMW-5T to yield G/G/B-GFP. Construct G/B/G-GFP was made in a similar way by using the
following primer pairs and templates: primer pair B5RtmdR and M13
reverse (Promega) with template pBMW-3 and primer pair VSVGctF and M13
forward and template pBMW-10 for the initial amplification.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 1.
VSVG, B5R, and GFP chimeras. (A) Schematic
representation of chimeras. VSVG-GFP and B5R-GFP are VSVG and B5R
proteins with GFP appended to the cytoplasmic tail, respectively.
Chimeras are constructed from the lumenal domain (LD), transmembrane
domain (TMD), and cytoplasmic tail (CT) of VSVG ( ) or
B5R ( ), and GFP
( ). ,
deleted cytoplasmic domain. (B) Amino acid sequences of predicted
transmembrane domains (underlined) and cytoplasmic tails of B5R and
VSVG. Tyrosine 310 and leucines 315 and 316 of B5R and the diacidic
signal of VSVG are shown in italics.
|
|
To construct G/B/

-GFP, primers B5R

ctR and M13 reverse were used
to amplify a 703-bp fragment from pBMW-4 that contained
an
NcoI site at nt 911 of B5R that is in frame with the 5'
NcoI
site in pEGFP-N1. Similarly, to construct G/G/

-GFP,
primers VSVG

ctR
and M13 reverse were used to amplify a 686-bp
fragment from pBMW-10
that contained an
NcoI site at nt 1461 of VSVG. Amplified fragments
were initially cloned into pGEM-T for
sequencing and then inserted
into VSVG-GFP as described above. To
construct B/G/

-GFP, primers
T7 and B5RSacR were used to amplify a
fragment from pBMW-10 that
contained a
SacI site at nt 825 of B5R. The resulting fragment
was cloned into pGEM-T as described
above to yield pBMW-24T. A
550-bp
EcoRI-
SacI
fragment from pBMW-24T was ligated with an 813-bp
SacI-
XbaI fragment from construct G/G/

-GFP and
B5R-GFP that had
been linearized with
EcoRI-
XbaI
to yield B/G/

-GFP.
Construct G/B/B
Y310A-GFP, in which the
nucleotide sequence was changed to encode an alanine at residue 310 instead of a tyrosine,
was made by two-stage PCR using pBMW-3 as the
template and primer
pairs B5R310AF-M13 forward and B5R310AR-M13 for the
initial amplification.
The second stage and subsequent cloning were
carried out as described
earlier. Primers B5R

LLR and M13 forward
were used to amplify
a 750-bp fragment from pBMW-3 that placed an
NcoI site at nt 349
of B5R and removed the sequence that
coded for the two leucines
at residues 315 and 316 of B5R. A fragment
containing both mutations
was amplified with primers B5R310A/

LLR and
T7 with G/B/B
315/316-GFP as the template.
Both fragments were cloned into pGEM-T for
sequencing and inserted into
G/B/B-GFP as previously
described.
Cells and transfections.
HeLa and COS-7 cell monolayers were
grown in Dulbecco's modified Eagle's medium (Quality Biologicals,
Gaithersburg, Md.) supplemented with 10% fetal calf serum. For
transfection, cells were grown on coverslips in six-well plates to
approximately 80% confluency and then transfected with Lipofectamine
reagent (Gibco BRL) as recommended by the manufacturer. DNA for
transfection was prepared with the Wizard Maxipreps DNA Purification
System according to the directions of Promega.
Fluorescence microscopy.
At 36 to 48 h after
transfection, cells expressing GFP chimeras were fixed in 4%
paraformaldehyde in phosphate-buffered saline (PBS) at 4°C. To stain
the Golgi network, fixed cells were permeabilized with 0.05% saponin
in PBS, quenched for 10 min in 0.1 M glycine, and incubated with
anti-58K antibody (Sigma) followed by CY5-conjugated goat anti-mouse
secondary antibody (Jackson ImmunoResearch Laboratories) that had been
diluted 1:100 in PBS.
Hybridoma cells expressing the anti-VSVG monoclonal antibody (MAb) I1
(
10,
25) were a generous gift of Jonathan Yewdell.
For live
staining, cells expressing GFP chimeras were washed twice
with ice-cold
PBS and incubated for 1 h on ice with hybridoma
I1 supernatant
diluted 1:100 in PBS. Following incubation, cells
were washed twice
with ice-cold PBS, fixed for 1 h, and stained
with secondary
antibody as described above. For internalization
of antibody complexes,
live cells expressing chimeras were incubated
with MAb I1 as described
above. After incubation, cells were washed
twice with ice-cold PBS and
incubated in Opti-MEM medium (Gibco
BRL) for 2 h at 31°C. After
incubation, cells were washed, fixed,
permeabilized with PBS containing
0.5% saponin for 1 h, and quenched.
Antibody staining was
detected as described
above.
Fab fragments of the MAb I1 were generated by using the ImmunoPure Fab
preparation Kit (Pierce) according to directions of
the manufacturer.
Cells expressing chimeras were washed twice
in Opti-MEM followed by
incubation overnight at 31°C with the
Fab fragments that had been
diluted 1:10 in Opti-MEM.
Nuclei were visualized by staining with 6 µg of Hoechst 33258 (Pierce) per ml in PBS for 10 min, followed by three 5-min washes
with
PBS. Coverslips were mounted in PBS and sealed with rubber
cement.
Fluorescence was detected on a Leica TCS NT inverted confocal
microscope with a UV laser (Coherent, Santa Clara, Calif.) attached.
Images were overlaid by using Adobe PhotoShop version 5.0.2.
Flow cytometry.
HeLa cells were harvested with PBS
containing 2% EDTA at 48 h after transfection. Harvested cells
were incubated for 1 h on ice with I1 hybridoma supernatant,
diluted 6:100 in PBS, followed by CY5-conjugated goat anti-mouse
secondary antibody. Stained cells were analyzed for GFP and CY5
staining on a FACSCalibur instrument (Becton Dickinson). At least 1,400 GFP-positive cells were analyzed.
 |
RESULTS |
Localization of a B5R-GFP fusion protein in the Golgi network.
The B5R ORF encodes a type I integral membrane protein that localizes
to the Golgi network independently of other viral proteins (24). In a previous study, Presley et al. (39)
had shown that fusion of GFP to the C terminus of VSVG, another type I
membrane glycoprotein, did not affect the trafficking of VSVG from the ER to the plasma membrane as detected by fluorescence microscopy. Based
on this result, we decided to add GFP to the C terminus of the B5R
protein (Fig. 1). A plasmid containing the B5R-GFP ORF regulated by a
cytomegalovirus promoter was transfected into HeLa cells. As shown in
Fig. 2, an intense green fluorescence was
detected in perinuclear and juxtanuclear structures characteristic of
the ER and Golgi complex, respectively. The GFP fluorescence colocalized with antibody to the Golgi 58K protein (Fig. 2) which has
been shown to be associated with the Golgi apparatus (5, 11). As will be shown later, constructs with an intact B5R
cytoplasmic tail are retained in the Golgi network even after a
prolonged chase in the presence of cycloheximide, an inhibitor of
protein synthesis. Whereas cells transfected with B5R-GFP exhibited
very low fluorescence in the plasma membrane, strong Golgi and plasma membrane fluorescence was noted in HeLa cells transfected with a
plasmid expressing VSVG-GFP (Fig. 2). (The VSVG protein expressed in
this study has a reversible temperature-sensitive mutation in the
lumenal domain that inhibits proper folding and subsequent exit from
the ER at the nonpermissive temperature of 40°C but refolds at the
permissive temperature of 31°C. Unless specifically mentioned, all
cited studies were carried out at 31°C.) Thus, the addition of GFP to
the C terminus of B5R did not interfere with its normal ability to
traffic to the Golgi network and accumulate there.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
Golgi network localization of B5R-GFP and G/B/B-GFP.
HeLa cells were transfected with plasmids containing B5R-GFP,
G/B/B-GFP, or VSVG-GFP (Fig. 1). Fixed, permeabilized cells were
stained with anti-Golgi 58K antibody, followed by CY5-conjugated goat
anti-mouse antibody to show location of the Golgi apparatus and with
Hoechst dye to show location of nuclei, and then examined by confocal
microscopy. Colors: green, GFP; red, 58K antibody; blue, Hoechst dye.
Note that green fluorescence only occurred in transfected cells,
whereas the Hoechst dye and antibody stained all cells.
|
|
The transmembrane domain and cytoplasmic tail of B5R are sufficient
for ER to Golgi network transport.
A segment containing most of
the lumenal domain of B5R (residues 1 to 275) was replaced with
residues 1 to 464 of VSVG to form a protein with the lumenal domain of
VSVG, the transmembrane domain of B5R, and the cytoplasmic tail of B5R
fused to GFP (G/B/B-GFP; Fig. 1). Expression of G/B/B-GFP at the
permissive temperature resulted in green fluorescence in a juxtanuclear
region that colocalized with the Golgi 58K marker (Fig. 2) indicating
that the B5R lumenal domain was not needed for this localization. As
with B5R-GFP, low fluorescence was detected on the plasma membrane.
When G/B/B-GFP or VSVG-GFP was expressed at the nonpermissive
temperature, widespread cytoplasmic staining characteristic of the ER
was observed (not shown), indicating that the VSVG lumenal domain was
temperature sensitive even with a heterologous transmembrane domain and
cytoplasmic tail.
Neither the cytoplasmic tail nor the lumenal domain of B5R was
needed for export from the ER.
A diacidic signal in the
cytoplasmic tail of VSVG is required for net export from the ER
(34). Accordingly, a construct with the VSVG lumenal and
transmembrane domains but lacking the VSVG cytoplasmic tail
(G/G/
-GFP; Fig. 1) largely remained in the ER (Fig.
3). In addition,
unpermeabilized cells that expressed G/G/
-GFP could not be stained
with MAb I1 to the VSVG extracellular domain (Fig. 3), whereas cells
expressing VSVG-GFP were readily labeled on the cell surface
by this procedure (not shown). Similarly, little surface staining
of G/B/B-GFP was detected by MAb I1 in unpermeabilized cells (Fig. 3).
The above results allowed us to investigate whether an ER export signal
capable of replacing that of VSVG occurs in the cytoplasmic domain of
B5R. Transfection experiments indicated that a construct consisting of
the lumenal and transmembrane domains of VSVG attached to the
cytoplasmic domain of B5R (G/G/B-GFP) also remained in the ER and was
not transported to the Golgi or plasma membrane (Fig. 3).
Permeabilized cells expressing either G/G/
-GFP or G/G/B-GFP were
readily stained with MAb I1 (not shown), which is conformation
specific (10, 25), indicating that the lumenal domain of
these proteins was properly folded and that misfolding was not the
reason for their inability to leave the ER. Thus, there was no evidence
of an ER-exiting signal in the cytoplasmic tail of B5R.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Intracellular and surface expression of chimeric
proteins. HeLa cells were transfected with plasmids containing the
indicated GFP chimeras, and the live, unpermeabilized cells were
stained with VSVG extracellular domain MAb I1, followed by
CY5-conjugated goat anti-mouse antibody to detect surface expression
and Hoechst dye to show location of nuclei by confocal microscopy.
Colors: green, GFP; red, MAb I1; blue, Hoechst dye.
|
|
Next, we exchanged the lumenal domain of VSVG with that of B5R to test
its ability to facilitate ER export. Cells expressing
the lumenal
domain of B5R and the transmembrane domain of VSVG
linked to GFP
(B/G/

-GFP; Fig.
1) showed widespread fluorescence
of the cytoplasm
similar to that seen for G/G/

-GFP (Fig.
3),
indicating that the
lumenal domain of B5R could not restore efficient
export from the ER.
Taken together, these data suggested that
neither the cytoplasmic
domain nor the lumenal domain of B5R contains
a strong ER-to-Golgi
transport signal which could substitute for
the one in
VSVG.
The transmembrane domain of B5R facilitated ER to Golgi
transport.
When the transmembrane domain of B5R and the lumenal
domain and cytoplasmic tail of VSVG were expressed as part of the same construct (G/B/G-GFP; Fig. 1), the protein was present in Golgi and
plasma membranes as determined by green fluorescence and staining of
live cells with VSVG MAb I1 (Fig. 3). With this construct, however,
transport out of the ER could have been mediated by either the
transmembrane domain of B5R or the diacidic signal in the cytoplasmic
tail of VSVG. To distinguish between these two possibilities, the
cytoplasmic tail of G/B/G-GFP was removed and GFP was placed directly
after the transmembrane domain of B5R (G/B/
-GFP; Fig. 1). As shown
in Fig. 3, expression of G/B/
-GFP resulted in green fluorescence of
both the Golgi and plasma membranes; fluorescence of the plasma
membrane also occurred when the live cells were stained with MAb I1.
Considering that G/G/
-GFP was unable to exit the ER efficiently, the
ability of G/B/
-GFP to traffic to the Golgi network indicated that
the transmembrane domain of B5R allowed efficient protein export from
the ER.
Signals in the cytoplasmic tail are required to maintain B5R in the
Golgi network and prevent accumulation on the plasma membrane.
The
striking difference in the localization of G/B/B-GFP and G/B/
-GFP
(Fig. 3) suggested that the cytoplasmic tail of B5R prevented the
accumulation of this protein in the plasma membrane. The cytoplasmic
tail could mediate Golgi membrane localization either by acting as a
Golgi membrane anchor or as a retrieval signal from the plasma membrane
via the endocytic pathway (33). Inspection of the sequence
constituting the short cytoplasmic tail of B5R revealed a tyrosine at
residue 310 and a two adjacent leucines at residues 315 and 316 (Fig.
1B) which could form parts of motifs for selective inclusion in
clathrin-coated vesicles. Such a receptor-mediated retrieval
pathway has been shown to function for both furin and the Golgi 58K
protein (6, 20, 33, 43). To determine if tyrosine or leucine
mutations affect the localization of B5R, three new constructs
were made. In one, the tyrosine at position 310 was changed to alanine
(G/B/BY310A-GFP); in another, the two
leucines at positions 315 and 316 were deleted
(G/B/B
315/316-GFP); and in the third,
both mutations were made
(G/B/BY310A/
315/316-GFP). Each
construct was tested independently and shown to express the GFP-fusion
protein (Fig. 4). Live, unpermeabilized
cells that had been transfected with plasmids capable of expressing
these mutated proteins were incubated at 0°C with VSVG MAb I1. As
shown in Fig. 4, the proteins with the mutated tyrosine or deleted
leucines were more highly expressed on the cell surface than was
G/B/B-GFP (Fig. 3), suggesting that these amino acids are part of a
signal that normally plays a role in preventing plasma membrane
accumulation.

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 4.
Effects of point mutations in the cytoplasmic tail of
B5R on intracellular trafficking of chimeric proteins. HeLa cells were
transfected with GFP chimeras containing the VSVG lumenal domain, the
B5R transmembrane domain, and the B5R cytoplasmic domain with mutations
in the putative retrieval sequences. Live, unpermeabilized cells were
stained with VSVG MAb I1, followed by CY5-conjugated goat anti-mouse
antibody to detect surface expression and Hoechst dye to show the
locations of nuclei by confocal microscopy. Colors: green, GFP; red,
MAb I1; blue, Hoechst dye.
|
|
Although mutations of the tyrosine and leucine residues led to the
presence of G/B/B
Y310A-GFP,
G/B/B
315/316-GFP, and
G/B/B
Y310A/
315/316-GFP in the plasma
membrane, there were still appreciable amounts
of the mutated proteins
associated with the Golgi network (Fig.
4). We suspected that
this protein was still in transit to the
plasma membrane. To test this
theory, we incubated cells expressing
VSVG-GFP,
G/B/B-GFP, G/B/

-GFP, or
G/B/B
Y310A/
-315/316-GFP in the presence
of cycloheximide to stop further protein
synthesis and to provide
additional time for the existing proteins
in the ER and Golgi network
to be transported to their final cellular
destination. In the case of
VSVG-GFP, which lacks Golgi retention
or retrieval signals, there were
considerable amounts of the protein
in the plasma membrane at the start
of cycloheximide treatment
and most had moved out of the Golgi network
after 4 h (Fig.
5).
In contrast,
G/B/B-GFP with an unmutated B5R cytoplasmic tail
remained in the Golgi
network at 8 h after the addition of cycloheximide
(Fig.
5)
and even after 20 h (not shown). With cells expressing
constructs G/B/

-GFP or
G/B/B
Y310A/
315/316-GFP, missing either
the entire B5R cytoplasmic domain or the
tyrosine and dileucine
residues, respectively, the fluorescence
was decreased in the Golgi
network and increased at the cell surface
at 4 and 8 h after
cycloheximide addition (Fig.
5). Therefore,
Golgi accumulation was
dependent on signals in the cytoplasmic
tail of the B5R protein.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 5.
Localization of chimeric proteins following a chase in
the presence of cycloheximide. COS-7 cells expressing the indicated GFP
chimeric proteins were incubated in medium containing 100 µg of
cycloheximide per ml at 31°C. Coverslips were removed at 0, 4, and
8 h after addition of cycloheximide and stained with Hoechst dye.
Colors: green, GFP; blue, Hoechst dye.
|
|
Flow cytometry was used to confirm differences in surface expression of
proteins with intact or mutated B5R cytoplasmic domains.
Live,
unpermeabilized cells expressing our various GFP chimeras
were
incubated with VSVG MAb I1 followed by a CY5-conjugated secondary
antibody. Cells expressing VSVG, which localizes to the plasma
membrane, served as a positive control; cells expressing B5R served
as
a negative control as the epitope for VSVG MAb I1 is absent.
Other
negative controls consisted of cells expressing VSVG but
not incubated
with MAb or secondary antibody. Histograms showing
representative data
of the CY5 fluorescence of GFP-positive cells
are shown in Fig.
6A. The percentages of CY5-positive cells
are
enumerated in Table
1 and confirm the higher surface
expression
when the B5R cytoplasmic domain was mutated or deleted as
compared
to that of G/B/B-GFP. To control for different levels of
expression
of the various proteins in the transfected cells, we divided
the
CY5 mean channel fluorescence (MCF) by the GFP MCF; the resulting
ratios are shown in Table
1 and represented graphically in Fig.
6B. The
highest MCF ratios were obtained for VSVG-GFP and G/B/G-GFP,
whereas expression of G/G/B-GFP and G/G/

-GFP yielded very low
MCF ratios due to their inability to exit the ER. The MCF ratios
of
cells transfected with G/B/B-GFP were higher than the negative
controls, indicating that significant amounts of B5R were present
on
the cell surface, although this had been difficult to detect
by
confocal microscopy. Importantly, higher MCF ratios were obtained
for
cells transfected with either
G/G/G
Y310A-GFP,
G/B/B
315/316-GFP,
G/B/B
Y310A/
315/316-GFP, or
G/B/

-GFP than with G/B/B-GFP, indicating increased surface
expression when signals in the cytoplasmic domain of B5R were
removed.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 6.
Surface expression of chimeric proteins. Transfected
HeLa cells were placed on ice and stained with VSVG MAb I1, followed by
CY5-conjugated goat anti-mouse antibody except as indicated. (A) Shaded
histograms of CY5 fluorescence of GFP-positive cells that were
transfected with plasmids expressing VSVG-GFP, G/B/B-GFP, B/B/ -GFP,
or G/B/BY310A/ 315/316-GFP. Unshaded peak in
each panel represents a negative control in which cells expressing VSVG
were stained with the CY5-conjugated second antibody only. (B)
Graphical representation of the CY5 MCF-to-GFP ratios in Table 1.
|
|
Retrieval of the B5R protein from the plasma membrane.
Thus
far, we have not specifically examined the roles of retention and
retrieval in the accumulation of the B5R protein in the Golgi network,
although the latter was suggested. To investigate these mechanisms, we
needed to determine whether the B5R protein cycles between the Golgi
network and the plasma membrane and if mutation of either the tyrosine
or leucines could inhibit this cycling. Our plan was to use
extracellular antibody to bind proteins on the cell surface and then
see if the complexes are internalized and returned to the
Golgi network. Live, unpermeabilized cells expressing VSVG-GFP, G/B/B-GFP, G/B/BY310A-GFP,
G/B/B
315/316-GFP, or
G/B/BY310A/
315/316-GFP were incubated on ice
for 1 h with the MAb I1. Afterwards, the cells were washed to
remove unbound antibody and prevent its fluid phase endocytosis and
then incubated at 31°C for 2 h to allow time for the
internalization of antibody-protein complexes. After incubation, cells
were washed, fixed, and processed for immunofluorescence, and also
examined for green fluorescence. Only cells expressing GFP showed
antibody staining, demonstrating the specificity of MAb I1. As shown in
Fig. 7, cells expressing VSVG-GFP
exhibited green fluorescence in the Golgi and plasma membranes but
antibody labeling was restricted to the cell surface, indicating
that no detectable antibody complexes had been internalized. This was
an important control to ensure that internalization of antibody
does not occur because of cross-linking or fluid phase endocytosis.
Cells expressing G/B/B-GFP showed green fluorescence in the Golgi
network but almost no antibody labeling, presumably because there are
small amounts of protein with an intact cytoplasmic tail on the
cell surface (Fig. 7). As before, cells expressing either
G/B/BY310A- GFP or
G/B/B
315/316-GFP exhibited intense plasma
membrane labeling with antibody. However, after the 2-h incubation,
antibody could also be detected in the juxtanuclear region of
these cells, suggesting that some complexes had been internalized from
the cell surface (Fig. 7). Cells expressing
G/B/BY310A/
315/316-GFP showed antibody
labeling on the plasma membrane but not in the juxtanuclear
region (Fig. 7). Thus, mutation of the tyrosine or leucines impaired
retrograde transport, whereas mutation of both sites abrogated it.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 7.
Surface staining and internalization of
chimeric proteins complexed with VSVG MAb I1. HeLa cells expressing the
indicated GFP chimeric proteins were labeled with MAb I1 on ice and
then incubated at 31°C to allow internalization of protein-MAb
complexes. Cells were stained with CY5-conjugated goat anti-mouse
antibody and Hoechst dye. Colors: green, GFP; red, MAb I1; blue,
Hoechst dye.
|
|
In the previous experiments, antibody binding and internalization were
carried out for a relatively short time to minimize
the possibility
that antibody-mediated cross-linking contributed
to endocytosis. Under
those conditions, however, there was sufficient
protein on the cell
surface for antibody staining only when the
tyrosine was mutated or the
leucines deleted. Presumably, because
of the efficiency of
internalization mediated by the unmutated
cytoplasmic tail, the
steady-state amount of G/B/B-GFP on the
surface was too small for
antibody staining under these conditions.
To allow longer continuous
labeling without the potential of antibody
cross-linking, monovalent
Fab fragments were made from MAb I1.
Transfected cells were incubated
overnight at 31°C with the Fab
fragments and then washed, fixed, and
further processed to detect
both GFP fluorescence and Fab staining. As
shown in Fig.
8, Fab
fragments that had
bound to antigen on the cell surface were mostly
detected in
overlapping regions of green fluorescence in the juxtanuclear
region of cells expressing G/B/B-GFP, suggesting that this
chimera
recycles between the plasma and Golgi membranes. It is
possible,
however, that some internalized Fab-protein complexes
dissociated
or were directed toward the lysosome for degradation
as confocal
microscopy is not quantitative. In contrast, VSVG-GFP and
G/B/B
Y310A/
315/316-GFP showed
intense Fab staining of the plasma membrane but little,
if any, Fab
staining in the juxtanuclear area (Fig.
8), indicating
that the
mutations effectively blocked retrieval from the plasma
membrane even
after prolonged incubation. The observation that
there was little
internal Fab staining of cells transfected with
VSVG-GFP or
G/B/B
Y310A/
315/316-GFP or of cells
that were not expressing chimeras indicated that
intracellular Fab
staining of G/B/B-GFP was specific for internalized
protein-Fab
complexes and was not due to fluid phase endocytosis
of the Fab
fragments.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 8.
Surface staining and internalization of chimeric
proteins complexed with Fab fragments. COS-7 cells expressing the
indicated GFP chimeric proteins were incubated overnight at 31°C with
Fab fragments prepared from VSVG MAb I1. Cells were stained with
CY5-conjugated goat anti-mouse antibody and Hoechst dye. Colors: green,
GFP; red, Fab fragments.
|
|
 |
DISCUSSION |
The outer membrane of extracellular vaccinia virus particles is
derived from the TGN or endosomal cisternae that have been modified by
the insertion of specific viral proteins. The type I integral membrane
protein encoded by the B5R ORF is crucial as deletion of it prevents
the wrapping of intracellular particles by the modified cellular
membranes (14, 51). Thus far, the B5R protein is the only
one encoded by vaccinia virus that has been shown to localize within
the Golgi network when expressed in the absence of other viral proteins
(24). The purpose of the present study was to identify the
B5R domains responsible for intracellular trafficking and localization.
We adapted an approach, successfully used for other integral membrane
proteins, involving the construction of chimeras between proteins that
localize in Golgi and plasma membranes (33). The
intracellular locations of the chimeras were visualized by appending
GFP to the C terminus of the cytoplasmic domain of the B5R protein. GFP
is particularly suitable as a reporter because it has a compact,
independently folding structure and its stable fluorescence is easily
monitored by confocal microscopy (48). Moreover, Presley et
al. (39) had reported that GFP did not perturb the plasma
membrane localization of VSVG and we found that it also did not alter
the normal Golgi membrane localization of the B5R protein. By swapping
domains between VSVG and B5R, we showed that the transmembrane domain of B5R was responsible for export from the ER and the cytoplasmic tail
was needed for accumulation of chimera in the Golgi network. Further
investigations provided evidence for cycling of B5R between the Golgi
and plasma membranes mediated by internalization sequences within the
cytoplasmic tail.
Integral membrane proteins exit the ER in COPII-coated vesicles.
Accumulation of a protein in the ER can occur for different reasons,
including improper folding, absence of exit signals, or recycling.
Signals that allow movement of proteins from the ER are generally
located in the transmembrane or cytoplasmic domains. A well-studied
example, in the cytoplasmic tail of VSVG and some other type 1 integral
membrane proteins, is a diacidic motif which interacts with COPII
machinery (2, 35). Another signal, present in the
cytoplasmic tail of the p24 family of type I integral membrane proteins
which move both anterograde and retrograde in the secretory pathway, includes a diphenylalanine motif that interacts with COPII component Sec23Ap (9, 23). A conserved
glutamine in the transmembrane domain acts in conjunction with the
diphenylalanine for efficient ER export (15). However,
neither a diacidic nor a diphenylalanine motif is present in the
cytoplasmic tail of B5R. Moreover, the inability of the cytoplasmic
tail of B5R to functionally replace the corresponding part of VSVG
suggested that it lacks an independent ER-exiting signal. Instead, ER
exiting was determined by the transmembrane domain of B5R. Thus, a
chimera consisting of the B5R transmembrane domain fused to either the lumenal domain of B5R or VSVG efficiently exited the ER. Whether constructs containing the B5R transmembrane domain exit by a default pathway or through specific signals cannot be distinguished from this
study. In the absence of any recognizable motif in the B5R transmembrane domain, extensive mutagenesis would be required to
correlate structure with function.
Having exited the ER, membrane proteins may accumulate in the Golgi
network because of retention or retrieval mechanisms. Retention can be
mediated by the transmembrane domain and has been attributed to
formation of large oligomeric complexes or to lipid sorting based on
the length of the transmembrane domain (reviewed in reference
33). Although a chimeric protein containing the VSVG
lumenal and B5R transmembrane domains was exported out of the ER, it
did not accumulate in the Golgi network but continued on to the plasma
membrane. Addition of the B5R cytoplasmic domain, however, allowed
Golgi network accumulation. Furthermore, internalization of B5R from
the plasma membrane was indicated by the internalization of
extracellular antibody as well as Fab fragments that targeted the
extracellular domain of B5R chimera. Although antibody cross-linking and fluid phase endocytosis were ruled out, we cannot be absolutely certain that the B5R chimera and antibody or Fab fragments remained complexed in the cytoplasm after internalization. However, it was
likely that the complexes did remain intact, because the internalized Fab fragment staining overlapped with GFP and because the antibody and
Fab fragments were found in juxtanuclear regions where the GFP chimera
accumulated. Therefore, the cytoplasmic tail of B5R appeared to mediate
retrograde transport from the plasma membrane to the Golgi apparatus.
It is possible that along with their role in internalization, signals
in the cytoplasmic tail are responsible for retaining B5R in the Golgi
network. In that case, mutation of these residues would prevent
retention, and this could also lead to increased levels of B5R on the
cell surface. Further analysis will be required to determine if these
signals can mediate Golgi retention as well as plasma membrane internalization.
Endosomal targeting signals have been found in the cytoplasmic domain
of some TGN resident proteins. The best characterized of these are two
tyrosine-containing motifs, YXXØ (where Y is tyrosine, X is any amino
acid, and Ø is an amino acid with a bulky hydrophobic side group) and
NPXY (where N and P are asparagine and proline, respectively) (reviewed
in reference 28). Studies have shown that
internalized TGN38 containing the YXXØ motif was delivered to the TGN
via an endocytic recycling compartment, whereas a chimera containing
the NPXY motif bypassed this compartment en route to the TGN (16,
27). Overexpression studies further suggested that these two
signals are internalized by distinct saturable mechanisms
(50). The YXXØ signal interacts with the µ2 subunit of
the clathrin adapter protein complex AP-2, accounting for its selective
recruitment into coated pits (40). Another motif, consisting
of two adjacent leucine residues, has been found in the cytoplasmic
tail of several proteins and shown to direct endocytosis (reviewed in
reference 28). This dileucine motif also interacts
with the µ2 subunit of the clathrin adapter protein complex AP-2
(8). Inspection of the B5R cytoplasmic tail sequence revealed a tyrosine at residue 310, although the neighboring amino acids did not conform exactly to either of the known tyrosine motifs,
as well as adjacent leucine residues at positions 315 and 316. Mutation
of either the tyrosine or the dileucine motif increased surface
expression of the B5R protein and impaired its internalization from the
plasma membrane, whereas mutation of both abrogated internalization. It
is possible that the tyrosine and two leucines constitute parts of a
single retrieval motif that has reduced efficiency when either the
tyrosine or leucines are missing. Alternatively, the tyrosine and
leucines could be parts of independent internalization signals that act
coordinately. Construction and analysis of additional mutations would
be needed to discriminate between these models and to determine the
roles of adjacent and intervening amino acid residues.
The B5R protein including the cytoplasmic tail is highly conserved
among orthopoxviruses, and the latter is therefore likely to have an
important role in virus replication or spread. One would expect the
cytoplasmic tail to allow retrieval of B5R that transited through the
Golgi network to the plasma membrane as well as B5R that was deposited
in the plasma membrane during the membrane fusion events that occur
during budding of EEV. The active internalization of B5R from the
plasma membrane could be related to the finding of enhanced traffic
between the plasma membrane and the TGN after vaccinia virus infection
(44). The retrieved B5R could be recycled for IEV membrane
formation. However, Lorenzo et al. (26) recently reported
that vaccinia virus expressing a mutated form of B5R without the
cytoplasmic tail formed similar amounts of EEV as wild-type virus in
cultured cells. Either the transit through the TGN of B5R lacking a
cytoplasmic tail is slow enough to permit wrapping of IMV or else other
viral proteins help retain B5R in the TGN or retrieve it from the
plasma membrane. Recovery of B5R from the plasma membrane for
conservation purposes, however, is only one possible function of
retrieval. Alternatively, there could be negative consequences of
having large amounts of B5R on the infected cell surface in vivo. Still
another possibility is that B5R associates with proteins on the cell
surface and transports them to the TGN either to remove them from the
plasma membrane or for their incorporation into EEV membranes. The
extracellular portion of B5R could be the interacting domain, as it
contains short consensus repeats that are homologous to those in
complement regulatory proteins. These repeats, however, were not
necessary for the incorporation of cellular complement regulatory
proteins in the EEV membrane (49). Therefore, either the
transmembrane domain of B5R is involved in the transport of the latter
proteins or other mechanisms are involved.
In future experiments, we plan to study the recycling of native and
mutated forms of the B5R protein between the plasma membrane and TGN in
infected cells and investigate the role of this process on
intracellular trafficking, EEV formation, and virulence in vivo.
 |
ACKNOWLEDGMENTS |
We thank Jonathan Yewdell for MAb I1 and the corresponding
hybridoma cell line, Jennifer Lippincott-Schwartz for a plasmid containing VSVG-GFP, Elizabeth Wolffe for advice and comments on the
manuscript, Chris Norbury and Jonathan Yewdell for help with the flow
cytometry, and Norman Cooper for provision of tissue culture cells.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 4 Center Dr.,
MSC 0445, NIH, Bethesda, MD 20892-0445. Phone: (301) 496-9869. Fax:
(301) 480-1147. E-mail: bmoss{at}nih.gov.
 |
REFERENCES |
| 1.
|
Appleyard, G.,
A. J. Hapel, and E. A. Boulter.
1971.
An antigenic difference between intracellular and extracellular rabbitpox virus.
J. Gen. Virol.
13:9-17[Abstract/Free Full Text].
|
| 2.
|
Aridor, M.,
S. I. Bannykh,
T. Rowe, and W. E. Balch.
1999.
Cargo can modulate COPII vesicle formation from the endoplasmic reticulum.
J. Biol. Chem.
274:4389-4399[Abstract/Free Full Text].
|
| 3.
|
Blasco, R., and B. Moss.
1991.
Extracellular vaccinia virus formation and cell-to-cell virus transmission are prevented by deletion of the gene encoding the 37,000-Dalton outer envelope protein.
J. Virol.
65:5910-5920[Abstract/Free Full Text].
|
| 4.
|
Blasco, R., and B. Moss.
1992.
Role of cell-associated enveloped vaccinia virus in cell-to-cell spread.
J. Virol.
66:4170-4179[Abstract/Free Full Text].
|
| 5.
|
Bloom, G. S., and T. A. Brashear.
1989.
A novel 58-kDa protein associates with the Golgi apparatus and microtubules.
J. Biol. Chem.
264:16083-16092[Abstract/Free Full Text].
|
| 6.
|
Bos, K.,
C. Wraight, and K. K. Stanley.
1993.
TGN38 is maintained in the trans-Golgi network by a tyrosine-containing motif in the cytoplasmic domain.
EMBO J.
12:2219-2228[Medline].
|
| 7.
|
Boulter, E. A., and G. Appleyard.
1973.
Differences between extracellular and intracellular forms of poxvirus and their implications.
Prog. Med. Virol.
16:86-108[Medline].
|
| 8.
|
Dietrich, J.,
J. Kastrup,
B. L. Nielsen,
N. Odum, and C. Geisler.
1997.
Regulation and function of the CD3gamma DxxxLL motif: a binding site for adaptor protein-1 and adaptor protein-2 in vitro.
J. Cell Biol.
138:271-281[Abstract/Free Full Text].
|
| 9.
|
Dominguez, M.,
K. Dejgaard,
J. Fullekrug,
S. Dahan,
A. Fazel,
J. P. Paccaud,
D. Y. Thomas,
J. J. Bergeron, and T. Nilsson.
1998.
gp25L/emp24/p24 protein family members of the cis-Golgi network bind both COP I and II coatomer.
J. Cell Biol.
140:751-765[Abstract/Free Full Text].
|
| 10.
|
Doms, R. W.,
A. Ruusala,
C. Machamer,
J. Helenius,
A. Helenius, and J. K. Rose.
1988.
Differential effects of mutations in three domains on folding, quaternary structure, and intracellular transport of vesicular stomatitis virus G protein.
J. Cell Biol.
107:89-99[Abstract/Free Full Text].
|
| 11.
|
Donaldson, J. G.,
J. Lippincott-Schwartz,
G. S. Bloom,
T. E. Kreis, and R. D. Klausner.
1990.
Dissociation of a 110-kD peripheral membrane protein from the Golgi apparatus is an early event in brefeldin A action.
J. Cell Biol.
111:2295-2306[Abstract/Free Full Text].
|
| 12.
|
Duncan, S. A., and G. L. Smith.
1992.
Identification and characterization of an extracellular envelope glycoprotein affecting vaccinia virus egress.
J. Virol.
66:1610-1621[Abstract/Free Full Text].
|
| 13.
|
Engelstad, M.,
S. T. Howard, and G. L. Smith.
1992.
A constitutively expressed vaccinia gene encodes a 42-kDa glycoprotein related to complement control factors that forms part of the extracellular virus envelope.
Virology
188:801-810[CrossRef][Medline].
|
| 14.
|
Engelstad, M., and G. L. Smith.
1993.
The vaccinia virus 42-kDa envelope protein is required for the envelopment and egress of extracellular virus and for virus virulence.
Virology
194:627-637[CrossRef][Medline].
|
| 15.
|
Fiedler, K., and J. E. Rothman.
1997.
Sorting determinants in the transmembrane domain of p24 proteins.
J. Biol. Chem.
272:24739-24742[Abstract/Free Full Text].
|
| 16.
|
Ghosh, R. N.,
W. G. Mallet,
T. T. Soe,
T. E. McGraw, and F. R. Maxfield.
1998.
An endocytosed TGN38 chimeric protein is delivered to the TGN after trafficking through the endocytic recycling compartment in CHO cells.
J. Cell Biol.
142:923-936[Abstract/Free Full Text].
|
| 17.
|
Herrera, E.,
M. del Mar Lorenzo,
R. Blasco, and S. N. Isaacs.
1998.
Functional analysis of vaccinia virus B5R protein: essential role in virus envelopment is independent of a large portion of the extracellular domain.
J. Virol.
72:294-302[Abstract/Free Full Text].
|
| 18.
|
Hiller, G., and K. Weber.
1985.
Golgi-derived membranes that contain an acylated viral polypeptide are used for vaccinia virus envelopment.
J. Virol.
55:651-659[Abstract/Free Full Text].
|
| 19.
|
Hirt, P.,
G. Hiller, and R. Wittek.
1986.
Localization and fine structure of a vaccinia virus gene encoding an envelope antigen.
J. Virol.
58:757-764[Abstract/Free Full Text].
|
| 20.
|
Humphrey, J. S.,
P. J. Peters,
L. C. Yuan, and J. S. Bonifacino.
1993.
Localization of TGN38 to the trans-Golgi network: involvement of a cytoplasmic tyrosine-containing sequence.
J. Cell Biol.
120:1123-1135[Abstract/Free Full Text].
|
| 21.
|
Ichihashi, Y.,
S. Matsumoto, and S. Dales.
1971.
Biogenesis of poxviruses: role of A-type inclusions and host cell membranes in virus dissemination.
Virology
46:507-532[CrossRef][Medline].
|
| 22.
|
Isaacs, S. N.,
E. J. Wolffe,
L. G. Payne, and B. Moss.
1992.
Characterization of a vaccinia virus-encoded 42-kilodalton class I membrane glycoprotein component of the extracellular virus envelope.
J. Virol.
66:7217-7224[Abstract/Free Full Text].
|
| 23.
|
Kappeler, F.,
D. R. Klopfenstein,
M. Foguet,
J. P. Paccaud, and H. P. Hauri.
1997.
The recycling of ERGIC-53 in the early secretory pathway. ERGIC-53 carries a cytosolic endoplasmic reticulum-exit determinant interacting with COPII.
J. Biol. Chem.
272:31801-31808[Abstract/Free Full Text].
|
| 24.
|
Katz, E.,
E. J. Wolffe, and B. Moss.
1997.
The cytoplasmic and transmembrane domains of the vaccinia virus B5R protein target a chimeric human immunodeficiency virus type 1 glycoprotein to the outer envelope of nascent vaccinia virions.
J. Virol.
71:3178-3187[Abstract].
|
| 25.
|
Lefrancios, L., and D. S. Lyles.
1982.
The interaction of antibody with the major surface glycoprotein of vesicular stomatitis virus. I. Analysis of neutralizing epitopes with monoclonal antibodies.
Virology
121:157-167[CrossRef][Medline].
|
| 26.
|
Lorenzo, M. D.,
E. Herrera,
R. Blasco, and S. N. Isaacs.
1998.
Functional analysis of vaccinia virus B5R protein: role of the cytoplasmic tail.
Virology
252:450-457[CrossRef][Medline].
|
| 27.
|
Mallet, W. G., and F. R. Maxfield.
1999.
Chimeric forms of furin and TGN38 are transported with the plasma membrane in the trans-Golgi network via distinct endosomal pathways.
J. Cell Biol.
146:345-359[Abstract/Free Full Text].
|
| 28.
|
Marks, M. S.,
L. Woodruff,
H. Ohno, and J. S. Bonifacino.
1996.
Protein targeting by tyrosine- and di-leucine-based signals: evidence for distinct saturable components.
J. Cell Biol.
135:341-354[Abstract/Free Full Text].
|
| 29.
|
Mathew, E.,
C. M. Sanderson,
M. Hollinshead, and G. L. Smith.
1998.
The extracellular domain of vaccinia virus protein B5R affects plaque phenotype, extracellular enveloped virus release, and intracellular actin tail formation.
J. Virol.
72:2429-2438[Abstract/Free Full Text].
|
| 30.
|
McIntosh, A. A. G., and G. L. Smith.
1996.
Vaccinia virus glycoprotein A34R is required for infectivity of extracellular enveloped virus.
J. Virol.
70:272-281[Abstract].
|
| 31.
|
Morgan, C.
1976.
Vaccinia virus reexamined: development and release.
Virology
73:43-58[CrossRef][Medline].
|
| 32.
|
Moss, B.
1996.
Poxviridae: the viruses and their replication, p. 2637-2671.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 33.
|
Munro, S.
1998.
Localization of proteins to the Golgi apparatus.
Trends Cell Biol.
8:11-15[CrossRef][Medline].
|
| 34.
|
Nishimura, N., and W. E. Balch.
1997.
A di-acidic signal required for selective export from the endoplasmic reticulum.
Science
277:556-558[Abstract/Free Full Text].
|
| 35.
|
Nishimura, N.,
S. Bannykh,
S. Slabough,
J. Matteson,
Y. Altschuler,
K. Hahn, and W. E. Balch.
1999.
A di-acidic (DXE) code directs concentration of cargo during export from the endoplasmic reticulum.
J. Biol. Chem.
274:15937-15946[Abstract/Free Full Text].
|
| 36.
|
Parkinson, J. E., and G. L. Smith.
1994.
Vaccinia virus gene A36R encodes a Mr 43-50 K protein on the surface of extracellular enveloped virus.
Virology
204:376-390[CrossRef][Medline].
|
| 37.
|
Payne, L. G.
1980.
Significance of extracellular virus in the in vitro and in vivo dissemination of vaccinia virus.
J. Gen. Virol.
50:89-100[Abstract/Free Full Text].
|
| 38.
|
Payne, L. G., and E. Norrby.
1976.
Presence of hemagglutinin in the envelope of extracellular vaccinia virus particles.
J. Gen. Virol.
32:63-72[Abstract/Free Full Text].
|
| 39.
|
Presley, J. F.,
N. B. Cole,
T. A. Schrer,
K. Hirschberg,
K. J. M. Zaal, and J. Lippincott-Schwartz.
1997.
ER-to-Golgi transport visualized in living cells.
Nature
389:81-85[CrossRef][Medline].
|
| 40.
|
Rapoport, I.,
M. Miyazaki,
W. Boll,
B. Duckworth,
L. C. Cantley,
S. Shoelson, and T. Kirchhausen.
1997.
Regulatory interactions in the recognition of endocytic sorting signals by AP-2 complexes.
EMBO J.
16:2240-2250[CrossRef][Medline].
|
| 41.
|
Roper, R.,
E. J. Wolffe,
A. Weisberg, and B. Moss.
1998.
The envelope protein encoded by the A33R gene is required for formation of actin-containing microvilli and efficient cell-to-cell spread of vaccinia virus.
J. Virol.
72:4192-4204[Abstract/Free Full Text].
|
| 42.
|
Roper, R. L.,
L. G. Payne, and B. Moss.
1996.
Extracellular vaccinia virus envelope glycoprotein encoded by the A33R gene.
J. Virol.
70:3753-3762[Abstract].
|
| 42a.
|
Sanderson, C. M.,
F. Frischknecht,
M. Way,
M. Hollinshead, and G. L. Smith.
1998.
Roles of vaccinia virus EEV-specific proteins in intracellular actin tail formation and low pH-induced cell-cell fusion.
J. Gen. Virol.
79:1415-1425[Abstract].
|
| 43.
|
Schafer, W.,
A. Stroh,
S. Berghofer,
J. Seiler,
M. Vey,
M. L. Kruse,
H. F. Kern,
H. D. Klenk, and W. Garten.
1995.
Two independent targeting signals in the cytoplasmic domain determine trans-Golgi network localization and endosomal trafficking of the proprotein convertase furin.
EMBO J.
14:2424-2435[Medline].
|
| 44.
|
Schmelz, M.,
B. Sodeik,
M. Ericsson,
E. J. Wolffe,
H. Shida,
G. Hiller, and G. Griffiths.
1994.
Assembly of vaccinia virus: the second wrapping cisterna is derived from the trans-Golgi network.
J. Virol.
68:130-147[Abstract/Free Full Text].
|
| 45.
|
Shida, H.
1986.
Nucleotide sequence of the vaccinia virus hemagglutinin gene.
Virology
150:451-462[CrossRef][Medline].
|
| 46.
|
Thompson, C. L., and R. C. Condit.
1986.
Marker rescue mapping of vaccinia virus temperature-sensitive mutants using overlapping cosmid clones representing the entire virus genome.
Virology
150:10-20[CrossRef][Medline].
|
| 47.
|
Tooze, J.,
M. Hollinshead,
B. Reis,
K. Radsak, and H. Kern.
1993.
Progeny vaccinia and human cytomegalovirus particles utilize early endosomal cisternae for their envelopes.
Eur. J. Cell Biol.
60:163-178[Medline].
|
| 48.
|
Tsien, R. Y.
1998.
The green fluorescent protein.
Annu. Rev. Biochem.
67:509-544[CrossRef][Medline].
|
| 49.
|
Vanderplasschen, A.,
E. Mathew,
M. Hollinshead,
R. B. Sim, and G. L. Smith.
1998.
Extracellular enveloped vaccinia virus is resistant to complement because of incorporation of host complement control proteins into its envelope.
Proc. Natl. Acad. Sci. USA
95:7544-7549[Abstract/Free Full Text].
|
| 50.
|
Warren, R. A.,
F. A. Green,
P. E. Stenberg, and C. A. Enns.
1998.
Distinct saturable pathways for the endocytosis of different tyrosine motifs.
J. Biol. Chem.
273:17056-17063[Abstract/Free Full Text].
|
| 51.
|
Wolffe, E. J.,
S. N. Isaacs, and B. Moss.
1993.
Deletion of the vaccinia virus B5R gene encoding a 42-kilodalton membrane glycoprotein inhibits extracellular virus envelope formation and dissemination.
J. Virol.
67:4732-4741[Abstract/Free Full Text].
|
| 52.
|
Wolffe, E. J.,
E. Katz,
A. Weisberg, and B. Moss.
1997.
The A34R glycoprotein gene is required for induction of specialized actin-containing microvilli and efficient cell-to-cell transmission of vaccinia virus.
J. Virol.
71:3904-3915[Abstract].
|
| 53.
|
Wolffe, E. J.,
A. S. Weisberg, and B. Moss.
1998.
Role for the vaccinia virus A36R outer envelope protein in the formation of virus-tipped actin-containing microvilli and cell-to-cell virus spread.
Virology
244:20-26[CrossRef][Medline].
|
Journal of Virology, April 2000, p. 3771-3780, Vol. 74, No. 8
0022-538X/00/$04.00+0
This article has been cited by other articles:
-
Roberts, K. L., Breiman, A., Carter, G. C., Ewles, H. A., Hollinshead, M., Law, M., Smith, G. L.
(2009). Acidic residues in the membrane-proximal stalk region of vaccinia virus protein B5 are required for glycosaminoglycan-mediated disruption of the extracellular enveloped virus outer membrane. J. Gen. Virol.
90: 1582-1591
[Abstract]
[Full Text]
-
Benhnia, M. R.-E.-I., McCausland, M. M., Moyron, J., Laudenslager, J., Granger, S., Rickert, S., Koriazova, L., Kubo, R., Kato, S., Crotty, S.
(2009). Vaccinia Virus Extracellular Enveloped Virion Neutralization In Vitro and Protection In Vivo Depend on Complement. J. Virol.
83: 1201-1215
[Abstract]
[Full Text]
-
Earley, A. K., Chan, W. M., Ward, B. M.
(2008). The Vaccinia Virus B5 Protein Requires A34 for Efficient Intracellular Trafficking from the Endoplasmic Reticulum to the Site of Wrapping and Incorporation into Progeny Virions. J. Virol.
82: 2161-2169
[Abstract]
[Full Text]
-
Perdiguero, B., Lorenzo, M. M., Blasco, R.
(2008). Vaccinia Virus A34 Glycoprotein Determines the Protein Composition of the Extracellular Virus Envelope. J. Virol.
82: 2150-2160
[Abstract]
[Full Text]
-
Garcia, A. D., Meseda, C. A., Mayer, A. E., Kumar, A., Merchlinsky, M., Weir, J. P.
(2007). Characterization and Use of Mammalian-Expressed Vaccinia Virus Extracellular Membrane Proteins for Quantification of the Humoral Immune Response to Smallpox Vaccines. CVI
14: 1032-1044
[Abstract]
[Full Text]
-
Husain, M., Weisberg, A. S., Moss, B.
(2007). Sequence-Independent Targeting of Transmembrane Proteins Synthesized within Vaccinia Virus Factories to Nascent Viral Membranes. J. Virol.
81: 2646-2655
[Abstract]
[Full Text]
-
Husain, M., Weisberg, A. S., Moss, B.
(2006). Existence of an operative pathway from the endoplasmic reticulum to the immature poxvirus membrane. Proc. Natl. Acad. Sci. USA
103: 19506-19511
[Abstract]
[Full Text]
-
Fleming, E. H., Kolokoltsov, A. A., Davey, R. A., Nichols, J. E., Roberts, N. J. Jr.
(2006). Respiratory Syncytial Virus F Envelope Protein Associates with Lipid Rafts without a Requirement for Other Virus Proteins. J. Virol.
80: 12160-12170
[Abstract]
[Full Text]
-
Perdiguero, B., Blasco, R.
(2006). Interaction between Vaccinia Virus Extracellular Virus Envelope A33 and B5 Glycoproteins.. J. Virol.
80: 8763-8777
[Abstract]
[Full Text]
-
Herrero-Martinez, E., Roberts, K. L., Hollinshead, M., Smith, G. L.
(2005). Vaccinia virus intracellular enveloped virions move to the cell periphery on microtubules in the absence of the A36R protein. J. Gen. Virol.
86: 2961-2968
[Abstract]
[Full Text]
-
Brock, S. C., Heck, J. M., McGraw, P. A., Crowe, J. E. Jr.
(2005). The Transmembrane Domain of the Respiratory Syncytial Virus F Protein Is an Orientation-Independent Apical Plasma Membrane Sorting Sequence. J. Virol.
79: 12528-12535
[Abstract]
[Full Text]
-
Husain, M., Moss, B.
(2005). Role of Receptor-Mediated Endocytosis in the Formation of Vaccinia Virus Extracellular Enveloped Particles. J. Virol.
79: 4080-4089
[Abstract]
[Full Text]
-
Rixon, H. W. McL., Brown, G., Murray, J. T., Sugrue, R. J.
(2005). The respiratory syncytial virus small hydrophobic protein is phosphorylated via a mitogen-activated protein kinase p38-dependent tyrosine kinase activity during virus infection. J. Gen. Virol.
86: 375-384
[Abstract]
[Full Text]
-
Husain, M., Moss, B.
(2003). Evidence against an Essential Role of COPII-Mediated Cargo Transport to the Endoplasmic Reticulum-Golgi Intermediate Compartment in the Formation of the Primary Membrane of Vaccinia Virus. J. Virol.
77: 11754-11766
[Abstract]
[Full Text]
-
Carter, G. C., Rodger, G., Murphy, B. J., Law, M., Krauss, O., Hollinshead, M., Smith, G. L.
(2003). Vaccinia virus cores are transported on microtubules. J. Gen. Virol.
84: 2443-2458
[Abstract]
[Full Text]
-
Husain, M., Moss, B.
(2003). Intracellular Trafficking of a Palmitoylated Membrane-Associated Protein Component of Enveloped Vaccinia Virus. J. Virol.
77: 9008-9019
[Abstract]
[Full Text]
-
Smith, G. L., Vanderplasschen, A., Law, M.
(2002). The formation and function of extracellular enveloped vaccinia virus. J. Gen. Virol.
83: 2915-2931
[Abstract]
[Full Text]
-
Krauss, O., Hollinshead, R., Hollinshead, M., Smith, G. L.
(2002). An investigation of incorporation of cellular antigens into vaccinia virus particles. J. Gen. Virol.
83: 2347-2359
[Abstract]
[Full Text]
-
Husain, M., Moss, B.
(2002). Similarities in the Induction of Post-Golgi Vesicles by the Vaccinia Virus F13L Protein and Phospholipase D. J. Virol.
76: 7777-7789
[Abstract]
[Full Text]
-
Rodger, G., Smith, G. L.
(2002). Replacing the SCR domains of vaccinia virus protein B5R with EGFP causes a reduction in plaque size and actin tail formation but enveloped virions are still transported to the cell surface. J. Gen. Virol.
83: 323-332
[Abstract]
[Full Text]
-
Ward, B. M., Moss, B.
(2001). Vaccinia Virus Intracellular Movement Is Associated with Microtubules and Independent of Actin Tails. J. Virol.
75: 11651-11663
[Abstract]
[Full Text]
-
Husain, M., Moss, B.
(2001). Vaccinia Virus F13L Protein with a Conserved Phospholipase Catalytic Motif Induces Colocalization of the B5R Envelope Glycoprotein in Post-Golgi Vesicles. J. Virol.
75: 7528-7542
[Abstract]
[Full Text]
-
Ward, B. M., Moss, B.
(2001). Visualization of Intracellular Movement of Vaccinia Virus Virions Containing a Green Fluorescent Protein-B5R Membrane Protein Chimera. J. Virol.
75: 4802-4813
[Abstract]
[Full Text]
-
Mathew, E. C., Sanderson, C. M., Hollinshead, R., Smith, G. L.
(2001). A mutational analysis of the vaccinia virus B5R protein. J. Gen. Virol.
82: 1199-1213
[Abstract]
[Full Text]
-
Lorenzo, M. M., Galindo, I., Griffiths, G., Blasco, R.
(2000). Intracellular Localization of Vaccinia Virus Extracellular Enveloped Virus Envelope Proteins Individually Expressed Using a Semliki Forest Virus Replicon. J. Virol.
74: 10535-10550
[Abstract]
[Full Text]