Previous Article | Next Article ![]()
Journal of Virology, April 2000, p. 3682-3695, Vol. 74, No. 8
Department of Microbiology and Molecular
Genetics, Medical College of Wisconsin, Milwaukee, Wisconsin
53226,1 and Program in Molecular
Biology, Cornell University Graduate School of Biomedical Sciences,
New York, New York 100212
Received 4 October 1999/Accepted 27 January 2000
We have previously reported the construction and characterization
of vindH1, an inducible recombinant in which expression of
the vaccinia virus H1 phosphatase is regulated experimentally by IPTG
(isopropyl- Vaccinia virus is a complex DNA
virus characterized by a high degree of genetic and physical autonomy
from the host cell. Among the functions of the 200 gene products
encoded by the 192-kb genome are those required for the expression of
three temporal classes of genes, the replication of viral DNA, and the
morphogenesis of nascent virions (27). The last is a complex
process which remains poorly understood but is the subject of intense
study. Electron microscopy, in conjunction with pharmacological
intervention and the study of conditionally lethal mutants, has been
useful in generating models of virion assembly (7, 9, 12, 20, 24,
25, 28, 31, 41, 44, 47, 49, 53, 55, 58, 59, 62, 63). Within the
cytoplasm, morphogenesis is concentrated around areas of increased
electron density which have been shown to contain viral DNA and the
proteins to be encapsidated. Membrane crescents, which appear to
elongate and curve until they enclose the electron-dense material
within oval immature virions (IV), are the first hallmark of
morphogenesis. The origin of these membranes is still a matter of
controversy. De novo biogenesis of these membranes to form an IV
delimited by a single lipid bilayer was an early and provocative model
(10). Recent measurements of the membrane surrounding the IV
are also consistent with the single-bilayer model (22),
although this work did not address the origin of the membrane in
question. Other investigators have presented data suggesting that the
virion membrane derives from the intermediate compartment
(49), a transitional zone of tubulovesicular components that
reflects anterograde and retrograde transport between the endoplasmic
reticulum and the Golgi apparatus. Membrane crescents, derived from
tubulovesicular components of the intermediate compartment, would
therefore be comprised of two membranes that have become so tightly
apposed that the lumenal space is essentially absent. Clarification of
which features of these distinct models are correct must be a central
goal for researchers in the field.
IV formation is followed by a maturation process that involves
morphological changes and a series of proteolytic processing events
which generate infectious virions known as intracellular mature virons
(IMV). A number of viral proteins have been shown to play a role in IV
and IMV morphogenesis. Of great interest to our laboratory is the
demonstration that nonpermissive infections performed with
temperature-sensitive mutants carrying lesions within the F10 protein
kinase arrest at the earliest stage of morphogenesis (53,
55). No crescents or immature or mature particles are seen during
these infections, and no electron-dense virosomes appear. These data
strongly suggest that protein phosphorylation plays an essential role
in the membrane remodeling that initiates viral morphogenesis. Recent
experiments in our laboratory have provided evidence supporting the
characterization of F10 as a dual-specificity kinase that can
phosphorylate serine, threonine, and tyrosine residues (13).
The importance of protein phosphorylation as a regulator of the viral
life cycle is underscored by the fact that vaccinia virus encodes
another protein kinase (B1) (2, 34, 42, 52) as well as a
dual-specificity protein phosphatase, the product of the H1 gene. Using
an inducible viral recombinant in which expression of the H1
phosphatase can be regulated experimentally (vindH1), we
were able to demonstrate that H1 synthesis is not required for virion
morphogenesis but is necessary to ensure the infectivity and
transcriptional competence of nascent virions (35). Making
the assumption that it was the phosphatase activity of H1 that was
essential, we concentrated on identifying which virion proteins were H1
substrates. To do so, we examined 32P-labeled wild-type
(wt) and H1-deficient (H1 Materials.
Restriction endonucleases, polynucleotide kinase,
T4 DNA ligase, calf intestinal phosphatase, pancreatic RNase, S1
endonuclease, Taq polymerase, and DNA molecular weight
standards were purchased from New England Biolabs, Inc. (Beverly,
Mass.), or Boehringer Mannheim Biochemicals (Indianapolis, Ind.) and
were used according to the instructions provided by the manufacturers.
32P-labeled nucleoside triphosphates,
[32P]orthophosphate, and 35S-labeled
methionine were acquired from Dupont/New England Nuclear Corp. (Boston,
Mass.). Thin-layer cellulose F chromatography plates were purchased
from EM Separations, Inc. (Gibbstown, N.J.). Constant boiling HCl was
purchased from Pierce (Rockford, Ill.).
Cells and viruses.
Monolayer cultures of BSC40 primate
cells, mouse L cells, or human thymidine kinase-deficient
(TK Construction of vtetR.
The coding sequences of
tetR were amplified from an appropriate plasmid using PCR
and the following primers: TR1, 5'
GGGGATCCATGTCTAGATTAGATAA 3', and TR2,
5' GGGGATCCTTAAGACCCACTTTCACATT 3'.
Primer TR1 introduced a BamHI site (bold) at the
initiation codon (underlined), and primer TR2 introduced a
BamHI site (bold) at the termination codon (underlined). The
BamHI-cleaved PCR product was inserted into pGS53 vector DNA
(37) which had been previously digested with
BamHI and treated with calf intestinal alkaline phosphatase. The resultant plasmid places the tetR open reading frame
(ORF) under the regulation of a constitutive vaccinia virus promoter; the flanking sequences allow insertion of this cassette into the nonessential TK gene of the viral genome via homologous recombination. BSC40 cells were infected with wt virus (multiplicity of infection [MOI], 0.03) and transfected with the pGS53/tetR plasmid.
After 2 days, cells were harvested and TK Construction of vindA14.
Overlap PCR was used to
generate a 770-bp DNA fragment which included the 270-bp A14 ORF as
well as 102 bp of downstream (towards A13) and 384 bp of upstream
(towards A15) sequence. This construct also inserted the 19-bp operator
sequence (O2) from the TET operon (5' TCCCTATCAGTGATAGAGA 3')
(16, 17, 19) between the transcriptional and
translational start sites of the A14 gene. The primers used to generate
this fragment were 1, 5' GGGGATCCATTGATCAAGTATGCAAT; B, 5'
CCTATCAGTGATAGAGAATGGACATGATGCTTA 3'; C,
5' TCTATCACTGATAGGGATATTTAACTAATAAAAAT 3';
and 4, 5' GGGGATCCTTATGCCAGATAATAGAT 3'.
The template was viral genomic DNA. Primers 1 and 4 insert
BamHI sites (bold) at the termini of the final PCR product;
primers B and C insert the operator sequences (italicized) between the
transcriptional and translational start sites (underlined) of the A14
ORF. In the first round of PCR, primers 1 plus B and C plus 4 were used to generate fragments of 385 and 400 bp that overlapped by 15 bp. The
products were purified on glass beads (54); aliquots of each
were taken and together served as the template for a second round of
amplification that was performed using primers 1 and 4. The final
770-bp product was digested with BamHI and ligated to
pUC/NEO DNA (31, 35) which had been digested with
BamHI and treated with calf intestinal alkaline phosphatase.
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Elucidating the Essential Role of the A14 Phosphoprotein in
Vaccinia Virus Morphogenesis: Construction and Characterization of a
Tetracycline-Inducible Recombinant
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-D-thiogalactopyranoside) (35). In
the absence of H1 expression, the transcriptional competence and
infectivity of nascent virions are severely compromised. We have sought
to identify H1 substrates by characterizing proteins that are
hyperphosphorylated in H1-deficient virions. Here, we demonstrate that
the A14 protein, a component of the virion membrane, is indeed an H1
phosphatase substrate in vivo and in vitro. A14 is hyperphosphorylated
on serine residues in the absence of H1 expression. To enable a genetic analysis of A14's function during the viral life cycle, we have adopted the regulatory components of the tetracycline (TET) operon and
created new reagents for the construction of TET-inducible vaccinia
virus recombinants. In the context of a virus expressing the TET
repressor (tetR), insertion of the TET operator between the
transcriptional and translational start sites of a late viral gene
enables its expression to be tightly regulated by TET. We constructed a
TET-inducible recombinant for the A14 gene, vindA14. In the
absence of TET, vindA14 fails to form plaques and the 24-h yield of infectious progeny is reduced by 3 orders of magnitude. The
infection arrests early during viral morphogenesis, with the accumulation of large numbers of vesicles and the appearance of "empty" crescents that appear to adhere only loosely to virosomes. This phenotype corresponds closely to that observed for an
IPTG-inducible A14 recombinant whose construction and characterization
were reported while our work was ongoing (47). The
consistency in the phenotypes seen for the IPTG- and TET-inducible
recombinants confirms the efficacy of the TET-inducible system and
reinforces the value of having a second, independent system available
for generating inducible recombinants.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) virions in order to determine
which proteins were hyperphosphorylated in the absence of H1. Three
proteins with apparent molecular weights of 25,000 (25K), 16K, and 11K
were identified. We have previously shown that the 11K protein is the
DNA-binding protein encoded by the F18 (F17 in the Copenhagen strain)
gene and that the 25K protein is the product of the A17 gene (13,
35). The identification of the 16K phosphoprotein as the product
of the A14 gene and its subsequent characterization are the subjects of
this paper. As part of our analysis of the structure and function of
the A14 protein, we also developed an alternative inducible system in which expression of viral genes can be regulated by the inclusion of
tetracycline (TET) in the culture medium.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) cells were maintained in Dulbecco modified Eagle
medium (DMEM; GIBCO-BRL, Gaithersburg, Md.) containing 5% fetal calf
serum (FCS). wt vaccinia virus (WR strain), vindH1
(35), virus expressing the TET repressor (vtetR),
and vindA14 (this report) were amplified in monolayer
cultures of BSC40 cells or suspension cultures of L cells. Viral stocks
were prepared from cytoplasmic lysates of infected cells by
ultracentrifugation through 36% sucrose; titrations were performed on
BSC40 cells. In some cases, virions were further purified by banding on
25 to 40% sucrose gradients (35). For vindA14,
permissive infections were performed in the presence of TET (1 µg/ml). Where indicated, cytosine arabinoside (araC) was added to
infected cultures a final concentration of 20 µg/ml.
virus was
purified by two rounds of plaque purification on human TK
cells in the presence of bromodeoxyuridine (25 µg/ml). The presence of the tetR gene within these viruses was confirmed by dot
blot hybridization and PCR.
Construction of a TET-inducible
-Gal plasmid.
The goal
was to construct a plasmid in which the
-galactosidase (
-Gal)
gene was under the regulation of a late poxvirus promoter and the TET
operator/repressor. A 1.3-kb fragment of plasmid p1246 (kindly provided
by David Pickup, Duke University) containing the cowpox virus ATI
promoter (40) was excised with EcoRI and cloned
into pUC19. Clones in which the promoter was oriented towards the
ClaI and BamHI sites in the pUC polylinker were
chosen for further manipulation. The plasmid was digested with
ClaI and BamHI and ligated to an oligonucleotide
duplex which contained the sequence of the TET operator followed by an
initiator methionine codon (underlined). This duplex was obtained by
annealing the following two oligonucleotides: 5'
CGATCCCTATCAGTGATAGAGAATG 3'
(top) and 5'
GATCCATTCTCTATCACTGATAGGGAT 3'
(bottom). The annealed duplex contained the TET operator (bold)
and a translational start site (underlined) flanked by 5' single-strand
extensions complementary to the extensions on the ClaI- and
BamHI-cleaved plasmid DNA (italicized). Transformants
containing the pUC/promoter/operator plasmid were identified, and the
plasmid DNA was purified, cleaved with BamHI, and treated
with calf intestinal alkaline phosphatase. The
-Gal gene was excised
from plasmid pSC11 (8) as a 3.1-kb BamHI fragment
and ligated into the BamHI-cleaved pUC/promoter/operator plasmid. The final plasmid was designated pLate/op/
-gal.
Construction of pInt/
-gal.
This plasmid was originally
constructed in order to place the
-Gal ORF under the regulation of
an intermediate vaccinia virus promoter. A 150-bp fragment containing
the promoter of the vaccinia virus G8 gene was amplified by PCR using
the HindIII G fragment of the viral genome as the
template and the following primers: 1, 5'
GGTCTAGACAATTGTTTAGCTTTGG 3', and 2, 5'
GGGGATCCATTTTAAATTTTTGTA 3'. These primers placed an
XbaI site at the 5' end of the promoter fragment (bold) and
a BamHI site at its 3' end (bold). The fragment was
cleaved with XbaI and BamHI and inserted into pUC
19 DNA that had been similarly cleaved; Escherichia coli
transformants carrying the pUC/pG8 plasmid were isolated. pUC/pG8 DNA
was then purified, treated with BamHI and calf intestinal
alkaline phosphatase, and ligated to a 3.1-kb BamHI fragment
encoding the
-Gal gene that had been excised from plasmid pSC11
(8). Plasmids in which the
-Gal gene was in the proper
orientation for expression from the G8 promoter were selected for
further use and called pInt/
-gal.
Assay of
-Gal activity in infected cell lysates.
Thirty-five-millimeter-diameter dishes of BSC40 cells were infected
with vtetR (MOI, 15) and transfected with 4 µg of the indicated plasmid. At 24 hpi, cells were harvested, washed once with
phosphate-buffered saline (PBS), and resuspended in 100 µl of 10 mM
Tris (7.8)-1 mM EDTA. Cell suspensions were subjected to three cycles
of freezing and thawing and then clarified by centrifugation at
12,000 × g for 5 min at 4°C. One or 5 µl of these
extracts was mixed with 400 µl of Z buffer (60 mM
Na2HPO4, 40 mM NaH2PO4,
10 mM KCl, 1 mM MgSO4, 40 mM
-mercaptoethanol) and
incubated for 5 min, at which time 100 µl of Z buffer containing 4 mg
of ONPG (o-nitrophenyl-
-D-galactopyranoside)
per ml was added (1). The reaction mixtures were mixed, and
the incubation was allowed to proceed for 30 min at room temperature
before being stopped by the addition of 500 µl of 1 M sodium
carbonate. The reaction mixtures were then analyzed by measuring their
optical densities at 420 nm in a Beckman spectrophotometer.
Preparation of anti-A14 and anti-A17 antisera. (i) Construction of pATH:A14. The A14 ORF was amplified by PCR using genomic DNA as the template. The upstream primer (5' GGGAATTCCATATGGACATGATGCTTAT 3') introduced EcoRI (italicized) and NdeI (bold) sites upstream of and overlapping the initiating ATG (underlined), respectively; the downstream primer (5' GGGGATCCTTAGTTCATGGAAATAT 3') introduced a BamHI (bold) site downstream of the termination codon (underlined). The 292-bp PCR product was digested with EcoRI and BamHI and inserted into pATH11 DNA (32) that had been previously digested with EcoRI and BamHI. The resultant plasmid fused the A14 ORF downstream of, and in frame with, the E. coli trpE gene.
(ii) Construction of pATH:A17. The A17 ORF was amplified by PCR using genomic DNA as the template. The upstream primer (5' CCCGCGTCTAGAATGAGTTATTTAAGATA 3') introduced an XbaI site (italicized) upstream of the initiating ATG (underlined); the downstream primer (5' GGGGGATCCTTAATAATCGTCAGTAT 3') introduced a BamHI (italicized) site downstream of the termination codon (underlined). The 630-bp PCR product was digested with XbaI and BamHI and inserted into pATH23 DNA (32) that had been previously digested with XbaI and BamHI. The resultant plasmid fused the A17 ORF downstream of, and in frame with, the E. coli trpE gene.
(iii) Expression of trpE:A14 and trpE:A17 antigens. E. coli transformants containing pATH:A14 directed the inducible synthesis of a 43-kDa fusion protein containing 34 kDa of E. coli trpE and 10 kDa of A14; pATH:A17 transformants expressed a 61-kDa fusion protein containing the E. coli trpE protein and the entire 25-kDa A17 protein. These fusion proteins were excised from sodium dodecyl sulfate (SDS)-polyacrylamide gels and used to immunize rabbits. The specificities of the resultant polyclonal antisera were confirmed by immunoblotting and immunoprecipitation assays.
Immunodetection analyses.
Ed Niles (State University of New
York, Buffalo) kindly provided rabbit serum directed against the D8
protein. Rabbit anti-I3 (43), anti-L4 and anti-F18
(35), and anti-A14 and anti-A17 (this report) sera were
developed in our laboratory. For immunoblot analysis, phosphatase
inhibitors (1 mM sodium orthovanadate, 1 mM sodium fluoride, and 40 mM
-glycerol phosphate) were often included during the preparation of
cell and virion extracts that were then subjected to fractionation by
SDS-polyacrylamide gel electrophoresis (PAGE) and electrophoretic
transfer to nitrocellulose (Schleicher and Schuell, Keene, N.H.) or
Immobilon P (Millipore Corp., Bedford, Mass.) membranes as described
previously (13). Primary sera are described above. Secondary
antibodies (horseradish peroxidase-conjugated goat anti-rabbit
antibodies) were obtained from Bio-Rad (Richmond, Calif.) and used
according the manufacturer's instructions. Blots were developed
colorimetrically or by enhanced chemiluminescence (DuPont NEN, Boston,
Mass., or Pierce). Immunoprecipitation analyses were performed as
described previously (13).
Preparation of protein sample for amino acid microsequencing. Proteins were resolved on SDS-polyacrylamide gels and transferred to polyvinylidene difluoride (PVDF) membrane in CAPS transfer buffer (10 mM CAPS {3-[(cyclohexylamino)-1-propane-sulfonic acid} in 10% methanol, pH 11.3). Filters were stained with 0.1% amido black to reveal the relevant band, which was excised and submitted to the Protein Sequencing Facility of the Rockefeller University for microsequencing.
Metabolic labeling. (i) Metabolic labeling with 32PPi. At the times indicated in the figures, infected monolayers were incubated with phosphate-free DMEM (ICN-Flow, Costa Mesa, Calif.) supplemented with L-glutamine, 5% phosphate-free FCS (prepared by dialysis against Tris-buffered saline [25 mM Tris-HCl, pH 7.4, 136 mM NaCl, 2.7 mM KCl]), and 50 µCi of [32P]orthophosphate per ml. Labeling was usually performed from 3 to 17 hpi. Cells were harvested and rinsed once with PBS; lysates were then prepared and analyzed by immunoprecipitation.
(ii) Metabolic labeling with [35S]methionine. At the times postinfection indicated in the figures, cultures were rinsed with methionine-free DMEM (ICN-Flow) supplemented with L-glutamine and then fed with methionine-free DMEM supplemented with L-glutamine and 100 µCi of [35S]methionine (EXPRESS label; NEN-Dupont) per ml. The durations of the labeling reactions are indicated in the text or figure legends.
Preparation of 32P-labeled wt and H1
virions.
Confluent monolayers of BSC40 cells were infected with
either wt virus or vindH1 at an MOI of 1. After adsorption
of the inoculum for 1 h, cultures were maintained in the absence
of IPTG in phosphate-free DMEM supplemented with
L-glutamine and 32PPi (50 µCi/ml). Cells were harvested at 24 hpi, and 32P-labeled
virions were purified by ultracentrifugation through sucrose cushions
and sucrose gradients (35).
One-dimensional phosphoamino acid analysis. The one-dimensional phosphoamino acid analysis procedure followed was essentially that described by the manufacturers of the Hunter Thin Layer Electrophoresis System, model HTLE-7000. 32P-labeled A14 was immunoprecipitated from metabolically labeled extracts. The immunoprecipitates were fractionated by SDS-PAGE and transferred to Immobilon P. The filter was exposed for autoradiography, and the film and filter were aligned to permit excision of the radiolabeled band from the filter. The protein was hydrolyzed in situ: the filter was rinsed in distilled water and then incubated at 110°C in 6 N constant boil HCI for 1 h. The liberated hydrolysate was collected by trichloroacetic acid precipitation. Samples were mixed with phosphoamino acid markers (20 nmol each) and spotted onto thin-layer cellulose F chromatography plates. Electrophoresis was performed in pyridine-glacial acetic acid-water (1:10:189) at 1,800 V for 25 min. The plates were dried, sprayed with ninhydrin, developed at 65°C, and exposed for autoradiography.
S1 nuclease mapping.
A 720-bp fragment containing the A14
ORF flanked by the TET operator, as well as upstream and downstream
sequences, was amplified by PCR as described above under
"Construction of vindA14." The fragment was cleaved with
AciI, treated with calf intestinal alkaline phosphatase, and
terminally labeled with [
-32P]ATP and polynucleotide
kinase. The fragment was then cleaved with BamHI, and the
resultant 613-bp fragment containing a single 5' radiolabel was
purified on glass beads and used as the probe for S1 nuclease analysis.
Total RNA was prepared from BSC40 cells (RNeasy midi kit; Qiagen,
Valencia, Calif.) 8 h after they were infected with
vtetR or vindA14 (MOI, 10) in the presence or
absence of TET (1 µg/ml). Purified RNA (10 µg) was mixed with 40 ng
of probe (22,000 cpm) in a 30-µl reaction mixture containing 40 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonic
acid)], 400 mM NaCl, and 1 mM EDTA. Samples were denatured by
incubation at 65°C for 10 min and then allowed to anneal for 3 h
at 37°C. Samples were then diluted 10-fold with a cocktail containing
280 mM NaCl, 30 mM NaAc, 4.5 mM ZnSO4, 5% glycerol, and
400 U of S1 nuclease per ml. The digestion was allowed to proceed for
30 min at 37°C. Samples were subjected to organic extraction and
ethanol precipitation and were then analyzed by electrophoresis on a
6% denaturing acrylamide gel followed by autoradiography.
Electron microscopy. (i) Transmission electron microscopy. Cells were prepared for electron microscopy as previously described (31, 53). Briefly, 60-mm-diameter dishes of BSC40 cells were infected with vindA14 in the absence or presence of TET (1 µg/ml) as indicated in the figures. At 17 hpi, the medium was removed and the cells were rinsed with PBS and then fixed in situ with 2% glutaraldehyde. Cells were then scraped from the dish, collected by sedimentation, and subjected to fixation with osmium tetroxide, dehydration, and embedding as previously described (53).
(ii) Immunoelectron microscopy. Cells were infected as described above and then fixed in situ with 4% paraformaldehyde-0.1% glutaraldehyde in PBS (see Fig. 4) or 0.1 M sodium cacodylate (pH 7.4) (see Fig. 9). Cells were then scraped from the dish, collected by sedimentation, overlaid with additional fixative, and subjected to graded dehydration and embedding in LR White resin, which was cured at 50 to 55°C. For Fig. 9, pellets were embedded in 4% agarose and then washed in 5% sucrose-0.1 M sodium cacodylate (pH 7.4) prior to dehydration. Sections were collected on nickel grids. The labeling procedure was as follows: sections were blocked with 1× TBS (137 mM NaCl, 2.7 mM KCl, 25 mM Tris [pH 7.4]) containing 5% FCS (see Fig. 4) or 5% bovine serum albumin (see Fig. 9) for 15 to 30 min prior to being incubated for 40 to 60 min with the clarified primary antiserum in 1× TBS supplemented with 1% of the blocking agent. Grids were then washed in 1× TBS four times for 5 min each time and then incubated for 40 to 60 min with 10-nm-diameter gold bead-conjugated goat anti-rabbit immunoglobulin G (Goldmark Biologicals, Phillipsburg, N.J. [for the results shown in Fig. 4], or Amersham Scientific [for the results shown in Fig. 9]) in 1× TBS supplemented with 1% of the blocking agent. Grids were then washed six times for 5 min each time in 1× TBS, fixed for 5 min in 1% glutaraldehyde, rinsed with 1× TBS [see Fig. 4], rinsed with distilled water, and then poststained with 2% uranyl acetate (aqueous) for 5 to 10 min. The grids were examined on a model JEOL 100XC-II or Hitachi H-600 microscope.
Preparation of the figures. Original data were scanned on a SAPHIR scanner (Linotype-Hell Co., Hauppauge, N.Y.) using Adobe Photoshop software (Adobe Systems, Inc., San Jose, Calif.). Labeling of the figures was performed with Canvas software (Deneba Systems, Inc., Miami, Fla.); graphs were prepared using SigmaPlot software (SPSS, Chicago, Ill.). Figures 8 and 9 were prepared photographically rather than digitally.
| |
RESULTS |
|---|
|
|
|---|
The 16-kDa protein hyperphosphorylated in H1-deficient virions is
the product of the A14 gene.
In order to identify substrates of
the H1 phosphatase among the proteins encapsidated in vaccinia virions,
we prepared 32P-labeled virions from cells infected with wt
virus or with vindH1 in the absence of IPTG. As shown in
Fig. 1A, three proteins of 11, 16, and 25 kDa were hyperphosphorylated in H1-deficient virions. When these
virions were treated with NP-40 plus dithiothreitol (DTT) in order to
prepare membrane and core fractions (13, 35), the 16-kDa
phosphoprotein was released into the solubilized membrane fraction (not
shown). Visualization of the membrane fraction by SDS-PAGE and silver
staining indicated that the 16-kDa protein appeared as a doublet in
H1-deficient virions and that this doublet was resolved to a single
band upon treatment of permeabilized virions with exogenous,
recombinant H1 phosphatase (Fig. 1B) but not upon treatment with a
catalytically inert mutant of H1 (C110S; not shown)
(35). These data confirmed that the 16-kDa phosphoprotein was indeed an H1 substrate.
|
A14 is hyperphosphorylated on serine residues when H1 phosphatase
expression is repressed.
Having identified the A14 protein as a
hyperphosphorylated component of H1-deficient virions, we were
interested in investigating its synthesis and posttranslational
modification further. Cells were infected with wt virus or
vindH1 and metabolically labeled with [35S]Met
for 1.5 h at various points after infection; cell lysates were
prepared and subjected to immunoprecipitation analyses. In Fig.
2A, the temporal profile of A14 synthesis
is shown. A14 is not expressed in the presence of an inhibitor of DNA
replication (araC) (lane 2), confirming that it is a late protein;
synthesis is evident, however, at 4.5 and 6 hpi (lanes 3 and 4) and
continues thereafter (not shown). Two additional species of 18 and 11 kDa are routinely seen in these immunoprecipitations. The 11-kDa
species comigrates with the F18 protein, as is evident when lanes 4 and 5 are compared; we have not determined the identity of the 18-kDa species. When similar immunoprecipitations were performed on extracts prepared from cells labeled for longer time periods or subjected to a
2.5-h chase period after a 45-min pulse, the 21-kDa, mature form of the
A17 protein (5) was routinely coimmunoprecipitated (not
shown).
|
|
A14 localizes to the virion membranes of crescents, IV, and IMV but
is not exposed on the external surface of IMV.
In our initial
identification of the A14 phosphoprotein, we found that it localized to
the membrane fraction of virions that had been subjected to NP-40 plus
DTT fractionation. Partitioning of A14 to the virion membrane was
confirmed by using Triton X-114 to prepare detergent-soluble and
aqueous fractions (data not shown). We also tested the accessibility of
encapsidated A14 to trypsin, chymotrypsin, or proteinase K treatment;
whereas the viral D8 protein was cleaved under these conditions, A14
was not (not shown). The conclusion that A14 is localized to an inner
face of the virion membrane is in agreement with observations published
by other investigators using different anti-A14 antisera (46,
48). As a final comparison to their studies, we performed
immunoelectron microscopy with our antiserum to visualize the
association of the A14 protein with the membranes of nascent virions.
As shown in the upper panels of Fig. 4,
the membranes of crescents (A), IV (B), and IMV (C) show distinct
labeling with anti-A14 serum. A14 is clearly associated with virion
membranes throughout their maturation. Although it is difficult to be
precise about the exact localization of the encapsidated A14 molecules,
the images obtained suggest that A14 is removed from the outermost edge
and occupies a more internal position within the virion membrane.
|
Construction of a new system for inducible gene expression in
vaccinia virus and utilization of the TET operator and repressor.
Temperature-sensitive mutants, drug-resistant mutants, and
IPTG-inducible recombinants have been invaluable tools in unraveling the functions of a growing number of vaccinia virus gene products. No
temperature-sensitive mutants carrying lesions in A14 have been
isolated, and the IPTG-inducible recombinant discussed by Rodriguez et
al. (47) had not yet been published at this point in our
study. As we initiated the construction of an inducible A14
recombinant, we envisioned the utility of being able to independently regulate the expression of more than one viral gene product in a given
recombinant. Therefore, we were interested in developing a second
system for inducible gene expression. We chose the TET operator and
repressor system (16, 17, 19) and generated a virus
expressing tetR under the regulation of the constitutive 7.5K promoter (vtetR). As an initial test of the efficacy of
the system, we constructed a plasmid in which
-Gal was placed under the regulation of the cowpox ATI promoter and the TET operator (pLate/op/
-gal). As a control, we used a second plasmid in which
-Gal was under the regulation of the G8 intermediate promoter (pInt/
-gal). Cells were infected with vtetR and then
transfected with pUC19, pInt/
-gal, or pLate/op/
-gal. Duplicate
infections were performed in the absence or presence of TET (1 µg/ml). At 24 hpi, cells were harvested and lysates were assayed for
-Gal activity. As shown in Fig. 5, the
expression of
-Gal from pLate/op/
-gal was indeed dependent on the
inclusion of TET in the culture medium; comparison of the values
obtained when 5-µl samples of the extracts were assayed indicated
that omission of TET reduced the level of
-Gal activity to 2.3% of
that seen when TET was included. As expected, expression from
pInt/
-gal was independent of TET.
|
Construction of vindA14, a viral recombinant in which expression of A14 is dependent upon the inclusion of TET in the culture medium. Having confirmed the efficacy of the system, we generated the vindA14 virus, in which the TET operator has been placed between the transcriptional and translational start sites of the endogenous A14 gene. The construct was generated using overlap PCR, and the recombinant virus was isolated using transient dominant selection, as described in Materials and Methods and used previously in our laboratory (31, 35).
The presence of the tetR gene (within the TK locus) and the TET operator (within the A14 gene) in the vindA14 genome was confirmed by PCR. To determine whether transcription of the A14 gene was in fact dependent upon TET, cultures were infected with vtetR or vindA14 in the absence or presence of TET; at 8 hpi, cells were harvested and total RNA was prepared. S1 nuclease protection was used to monitor the levels and start sites of A14 transcripts, as shown in Fig. 6. The drawing at the top of Fig. 6A illustrates the position of the terminally radiolabeled probe relative to those of the predicted A14 mRNA transcripts. The probe was derived from the operator-containing construct. Therefore, the complementarity between the probe and the wt transcript extends to the ATG of the translational start site, whereas the homology with the vindA14 transcript extends through the transcribed operator sequences to the transcriptional start site. The experimental results are shown in the lower box of panel A. The probe is shown in lane 1; its sensitivity to S1 nuclease digestion in the absence of RNA is evident in lane 2. Lanes 3 and 4 confirm that vtetR-infected cultures express a wt A14 transcript whether or not TET is included in the culture medium. In contrast, lanes 5 and 6 indicate that no A14 transcript is detectable when cultures are infected with vindA14 in the absence of TET; in the presence of TET, a transcript of the appropriate size (i.e., larger) is expressed. Quantitation of the protected fragments using a phosphorimager and ImageQuant software confirmed that the levels of mRNA transcripts that accumulate during infections performed in the absence of TET are <1 to 2% of those seen in induced infections. The level of A14 gene expression achieved during induced vindA14 infections appears comparable to that seen in vtetR-infected cells.
|
Repression of A14 expression abrogates plaque formation and reduces
the yield of infectious IMV by 3 orders of magnitude.
As a first
test of whether the repression of A14 expression compromised viral
infection, plaque assays were performed with vtetR and
vindA14 in the presence or absence of TET. As shown in Fig.
7A, plaque formation by vtetR
was unaffected by TET. In contrast, plaque formation by
vindA14 was completely abrogated in the absence of TET,
whereas wt-sized plaques developed in the presence of TET. We next
infected cultures with vtetR or vindA14 at an MOI
of 2 and harvested the infected cells at 24 hpi. The yield of virus was
then titrated in the presence of TET. This experiment was designed to
provide a more accurate quantification of the impact of A14 repression
on virus production. Moreover, this experiment allowed us to determine
whether A14 expression was required for the production of infectious
IMV or only for the further maturation of a subset of IMV into the
cell-associated and extracellular enveloped that lead to plaque
formation (6). We found that the production of IMV by
vindA14-infected cultures was reduced by 3 orders of
magnitude when TET was omitted from the culture medium (Fig. 7B); in
contrast, IMV production by vtetR-infected cells was not
affected by the omission of TET.
|
Repression of A14 synthesis leads to aberrant and abortive virion
morphogenesis.
Cultures infected with vindA14 in the
presence or absence of TET were examined by electron microscopy. In the
presence of TET, we observed all of the normal intermediates in virion
assembly: virosomes, crescents, and immature and mature virions (Fig.
8A and
B).
In the absence of TET, morphogenesis was clearly aberrant and
incomplete (Fig. 8C to F). There was a conspicuous absence of any
immature or mature virions. Dense virosomes were apparent and numerous.
Crescents (Fig. 8C and E) were seen surrounding some of the virosomes,
although their appearance was abnormal because of their apparent
emptiness. During wt infections, crescents appeared to associate with
and encircle the dense virosomal material. In the uninduced
vindA14-infected cultures, however, the crescents appeared
to be detached from the virosomal material. In addition, some of the
crescents appeared discontinuous (Fig. 8F), as if they represented an
accumulation of abutting but discrete vesicles. The most striking
feature of these infected cells, however, was the presence of a vast
number of what appeared to be membrane vesicles (Fig. 8C to F). These
vesicles were clustered in large groups that were often distant and
removed from the virosomes.
|
Immunolocalization of DNA-binding proteins and viral membrane
components in vindA14-infected cells.
To provide
further insight into the composition of the vesicle clusters and
electron-dense structures seen in cells infected nonpermissively with
vindA14, we performed immunoelectron microscopy. Cells were
labeled with antisera directed against the L4 (3, 4, 56, 57, 60,
61) or F18 (29, 30, 62) DNA-binding proteins or the D8
(23, 29) or A17 (5, 33, 44, 59) membrane
proteins. Representative images are shown in Fig.
9. As
seen in panels A and B, the electron-dense virosomes labeled robustly
with the anti-L4 serum whereas the nearby clusters of vesicles remained
unlabeled. Similarly, labeling with the anti-F18 serum was essentially
restricted to the virosomes (panel C), which labeled prominently with
this serum. The inverse of this pattern can be seen in panels D and E,
which represent sections labeled with anti-A17 serum, and F and G,
which represent sections labeled with anti-D8 serum. The clusters of
vesicles labeled heavily with both sera, whereas virtually no labeling
of the virosomes was seen. In panel D, labeling of the vesicular and
crescent membranes surrounding the virosome by the anti-A17 serum can
be seen. Together, these data provide compelling evidence that the
abundant and unusual clusters of vesicles found in cells infected
nonpermissively with vindA14 are indeed membranous in nature
and contain proteins that are well-characterized components of the
viral membrane. Furthermore, size comparison of the 10-nm-diameter gold
particles with the vesicles suggests that the vesicles have an average
diameter of approximately 25 nm.
|
| |
DISCUSSION |
|---|
|
|
|---|
We show in this report that the encapsidated A14 protein is one of the substrates of the H1 phosphatase. Hyperphosphorylation of A14 when H1 synthesis is repressed can clearly be seen by a dramatic elevation in the level of 32PPi that can be incorporated into A14. Moreover, the electrophoretic migration of the protein changes from a single band with an apparent molecular weight of 16K to a doublet created by the appearance of a more slowly migrating species. A14, A17, and F18 have now been shown to represent virion proteins which are hyperphosphorylated in H1-deficient virions (13, 35). Although hyperphosphorylation of A14, a component of the virion membrane, is unlikely to be responsible for the transcriptional incompetence and lack of infectivity of the H1-deficient virions, it might well contribute to the structural instability that we have previously reported (35). We noted that treatment of H1-deficient virions with NP-40 plus DTT released significant levels of proteins that normally remain tightly associated with the core, such as the DNA-binding proteins F18 and L4. Since, as mentioned above, we often find that F18 is coimmunoprecipitated with A14 during analyses of extracts prepared at late times of infection, the protein-protein interactions that stabilize virion integrity may be compromised by hyperphosphorylation. Although the interaction of the membrane protein A14 and the DNA-binding protein F18 was initially surprising, several lines of data suggest that they might well interact in vivo. First, our ultrastructural localization of the F18 protein within mature virions places it in a ring that surrounds the central, lucent core; in fact, the pattern of F18 localization within mature virions is quite similar to that seen for the A14 protein. Second, electron spectroscopic imaging of encapsidated DNA has also suggested that the genome may be localized in a ring that surrounds the central, lucent core of the virion (21). Taken together, these data suggest that the nucleoprotein complex may associate with proteins located on the inner face the viral membrane. These protein-protein interactions might provide an explanation for the puzzling observation that, in A32-deficient virions, the F18 protein can still be efficiently encapsidated even though the viral DNA is not (7).
Little was known about the A14 gene product when we first identified it as an encapsidated phosphoprotein and an H1 substrate. It had been identified as one of the structural components of the vaccinia virion and characterized as readily forming disulfide-linked dimers (26, 51). Indeed, we observed that the electrophoretic mobility of A14 was consistent with an apparent molecular weight of 25K in the absence of DTT but 16K in the presence of DTT. Since then, several investigators have published reports regarding the structure and function of the A14 protein (5, 46-48). There is general agreement that A14 is a component of membranes, that it tends to form disulfide-linked dimers, and that it is phosphorylated. Both our study and that of Salmons et al. (48) support the localization of A14 within the viral membrane in such a way that it is not exposed to proteolytic digestion. Further support for the conclusion that A14 is not exposed on the surfaces of virions was obtained by our demonstration that incubation of anti-A14 serum with IMV failed to neutralize viral infectivity (not shown). An association of A14 with the A17 protein was first demonstrated by Rodriguez et al. (46) and is supported by the work of Betakova et al. (5) and by our experiments (not shown).
Rodriguez et al. (46) proposed that A14 was likely to be phosphorylated on a particular threonine residue, but both our study and that of Betakova et al. (5) have shown that phosphorylation is exclusively on serine residues and appears to depend upon the F10 kinase. Although Betakova et al. (5) could easily detect the phosphorylation of A14 during wt infections, we found that 32P-labeling of A14 is difficult to detect under these conditions with our reagents and experimental protocols. Only when H1 synthesis is repressed can we see robust evidence of A14 phosphorylation; this difference may reflect a difference in the antisera used to detect A14 or other experimental variables. Our data do suggest, however, that the phosphorylation state of A14 is exquisitely sensitive to the levels of H1 phosphatase, which implies that A14 is either a poor substrate or an inaccessible one for cellular phosphatases.
Although Rodriguez et al. reported an essential role for the A14
protein in virion morphogenesis in 1997 (47), no such
information was available to us at the time that we identified the A14
phosphoprotein as an H1 substrate. Motivated by the need to create an
inducible recombinant in which A14 expression could be regulated, and
by the desire to augment the genetic tools available for the study of
vaccinia virus, we adapted the regulatory components of the TET operon
for use in the vaccinia virus genome. The TET system has several
advantages, including the nontoxicity of TET and the high affinity of
the repressor for the operator. We created the vtetR virus,
in which a p7.5-regulated TET repressor gene has been inserted within
the nonessential TK locus. (We have also created the
vtetRvlacI virus, in which both the TET and
lactose repressors are inserted within the TK locus (B. Unger and P. Traktman, unpublished data). We first demonstrated the utility of this
virus in transient-transfection assays by monitoring the expression of
a
-Gal gene regulated by the TET operator sequence. Expression was
minimal in the absence of TET and high in the presence of TET. Starting
with the parental virus vtetR, we then created
vindA14, in which the TET operator has been placed between
the transcriptional and translational start sites of the A14 gene.
(Alteration of the promoter sequence from TAAATG to
TAAATA, in order to avoid translational initiation upstream
of the operator sequence, is not predicted to exert a significant
effect on the transcriptional efficiency of the gene
[11]). Our data show that the accumulation of mRNA
transcripts and the synthesis and accumulation of the A14 protein are
dependent upon the inclusion of TET in the medium during
vindA14 infections; omission of TET represses gene
expression by 2 orders of magnitude. TET was not seen to have any
effect on the parental virus, vtetR. These data confirm that
the TET-inducible system provides an efficient means for regulating
gene expression in the context of vaccinia virus infection and so
represents a new approach to the generation of conditional mutants for
functional studies.
Using vindA14, we demonstrated that the repression of A14 synthesis abrogated plaque formation and reduced the 24-h yield of infectious virus by 3 orders of magnitude. No impact on the profile of viral gene expression was seen, although the proteolytic processing of the core proteins that usually accompanies virion maturation was absent. Our electron microscopic analysis revealed an interesting phenotype which is consistent with that observed by Rodriguez et al. in their study of an IPTG-inducible A14 recombinant (47). We observed no mature or immature virions. Electron-dense virosomes were plentiful, and "empty" crescents were often found at their periphery. These structures had the general shape of crescents, but they appeared detached from the virosome and did not enclose any of the electron-dense material that normally "fills" the crescent membrane. Some of these crescents were discontinuous, appearing as a string of contiguous vesicles. The most striking feature of the cells, however, was the accumulation of enormous numbers of vesicles in large clusters that were often removed from the virosomes. We confirmed that these vesicles contain the A17 and D8 proteins, known components of the virion membrane.
Vesicles have not previously been considered a normal intermediate in the biogenesis of the viral particle. Although crescents have been portrayed as emanating from the membranes of the intermediate compartment (49), a vesicular intermediate has not been given emphasis. However, it is clear that the hallmark of A14 repression is the accumulation of massive numbers of detached vesicles. In contrast, repression of A17 synthesis leads to the appearance of vesicles which form a corona around the virosome (M. Sauter and P. Traktman, unpublished data; 45, 59). When nonpermissive infections are performed with a temperature-sensitive mutant carrying lesions in the F10 kinase, however, no evidence of such vesicle accumulation is seen (53, 55). We propose, therefore, that vesicle diversion from the intermediate compartment is likely to be a normal step in virion biogenesis that is dependent on the F10 kinase but that the vesicles are short-lived in the presence of the A14 and A17 proteins due to their rapid maturation into crescents. In the absence of A14, the recruitment of vesicles to the virosome, their adhesion to the virosomal contents, and their apparent fusion into crescents are grossly deficient. In the absence of A17, recruitment to the virosome appears normal but maturation into crescents is never seen. This model, in the context of the numerous genetic and immunologic reagents that are now available, opens the way for mechanistic investigations of how F10, A14, and A17 work together in virion morphogenesis.
The implications of the involvement of a protein kinase and two phosphoproteins at these earliest stages of virion morphogenesis are inescapable. Analysis of the role of protein phosphorylation in regulating morphogenesis has been made more intriguing by the recent observations that A17 is phosphorylated on tyrosine as well as serine/threonine residues in a manner that is genetically dependent upon the F10 kinase (5, 13). Moreover, we have recently reported that F10 is likely to be a dual-specificity kinase, since bacteria induced to express F10 coordinately acquire significant amounts of phosphotyrosine on a number of proteins (13). The participation of protein kinases and phosphatases in cellular vesicle trafficking is now well documented. For example, at the onset of mitosis, the Golgi apparatus disassembles and vesiculates. The docking of vesicles derived from the endoplasmic reticulum and destined for the Golgi apparatus is blocked, primarily due to the phosphorylation of the GM130 protein on the Golgi membranes. GM130 phosphorylation impairs its interaction with the p115 protein found on the incoming vesicles (36, 38) and hence prevents the "consumption" of these vesicles by the Golgi apparatus. Cell cycle-regulated phosphorylation events that control the localization of p115 on vesicle membranes have also been reported (50). We suggest that the F10 kinase might mediate analogous phosphorylation events that facilitate the diversion of intracellular vesicles away from their normal trafficking pathway, enabling the maturation of these vesicles into virion membranes. Analysis of the details of this process should enhance our understanding of vaccinia virus biogenesis and resolve some of the controversy over the origin and number of the lipid bilayers surrounding mature viral particles (10, 22, 49). Moreover, this analysis should serve as a genetically tractable model for organelle biogenesis.
| |
ACKNOWLEDGMENTS |
|---|
We gratefully acknowledge the contribution of M. Sauter to the initial preparation of the anti-A17 serum and thank Poi Lee and B. Topaz for technical assistance in generating the anti-A14 and anti-A17 sera, respectively. The electron microscopic analyses would not have been possible without the superb guidance and technical support of Leona Cohen-Gould and Gang Ning.
This work was supported by a grant to P.T. from the NIH (2 R01 GM 53601) and by a special group of donors from the Dorothy Rodbell Cohen Foundation.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Dept. of Microbiology and Molecular Genetics, Medical College of Wisconsin, 8701 Watertown Plank Rd., Milwaukee, WI 53226. Phone: (414) 456-8253. Fax: (414) 456-6535. E-mail: ptrakt{at}mcw.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ausubel, F., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1997. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y. |
| 2. | Banham, A. H., and G. L. Smith. 1992. Vaccinia virus gene B1R encodes a 34-kDa serine/threonine protein kinase that localizes in cytoplasmic factories and is packaged into virions. Virology 191:803-812[CrossRef][Medline]. |
| 3. |
Bayliss, C. D., and G. L. Smith.
1997.
Vaccinia virion protein VP8, the 25 kDa product of the L4R gene, binds single-stranded DNA and RNA with similar affinity.
Nucleic Acids Res.
25:3984-3990 |
| 4. |
Bayliss, C. D.,
D. Wilcock, and G. L. Smith.
1996.
Stimulation of vaccinia virion DNA helicase I8R, but not A18R, by a vaccinia core protein L4R, an ssDNA binding protein.
J. Gen. Virol.
77:2827-2831 |
| 5. | Betakova, T., E. J. Wolffe, and B. Moss. 1999. Regulation of vaccinia virus morphogenesis: phosphorylation of the A14L and A17L membrane proteins and C-terminal truncation of the A17L protein are dependent on the F10L kinase. J. Virol. 3:3534-3543. |
| 6. |
Blasco, R., and B. Moss.
1992.
Role of cell-associated enveloped vaccinia virus in cell-to-cell spread.
J. Virol.
66:4170-4179 |
| 7. |
Cassetti, M. C.,
M. Merchlinsky,
E. J. Wolffe,
A. S. Weisberg, and B. Moss.
1998.
DNA packaging mutant: repression of the vaccinia virus A32 gene results in noninfectious, DNA-deficient, spherical, enveloped particles.
J. Virol.
72:5769-5780 |
| 8. |
Chakrabarti, S.,
K. Brechling, and B. Moss.
1985.
Vaccinia virus expression vector: coexpression of galactosidase provides visual screening of recombinant virus plaques.
Mol. Cell. Biol.
5:3403-3409 |
| 9. | Dales, S., V. Milanovanovitch, B. G. T. Pogo, S. B. Weintraub, T. Huima, S. Wilton, and G. McFadden. 1978. Biogenesis of vaccinia: isolation of conditional lethal mutants and electron microscopic characterization of their phenotypically expressed defects. Virology 844:403-428. |
| 10. | Dales, S., and E. H. Mosbach. 1968. Vaccinia as a model for membrane biogenesis. Virology 35:564-583[CrossRef][Medline]. |
| 11. | Davison, A. J., and B. Moss. 1989. The structure of vaccinia virus late promoters. J. Mol. Biol. 210:771-784[CrossRef][Medline]. |
| 12. |
DeMasi, J., and P. Traktman.
2000.
Clustered charge-to-alanine mutagenesis of the vaccinia virus H5 gene: isolation of a dominant, temperature-sensitive mutant with a profound defect in morphogenesis.
J. Virol.
74:2393-2405 |
| 13. |
Derrien, M.,
A. Punjabi,
M. Khanna,
O. Grubisha, and P. Traktman.
1999.
Tyrosine phosphorylation of A17 during vaccinia virus infection: involvement of the H1 phosphatase and the F10 kinase.
J. Virol.
73:7287-7296 |
| 14. |
Falkner, F. G., and B. Moss.
1990.
Transient dominant selection of recombinant vaccinia viruses.
J. Virol.
64:3108-3111 |
| 15. |
Fogelsong, P. D., and W. R. Bauer.
1984.
Effects of ATP and inhibitory factors on the activity of vaccinia virus type I topoisomerase.
J. Virol.
49:1-8 |
| 16. | Gatz, C., A. Kaiser, and R. Wendenburg. 1991. Regulation of a modified CaMV 35S promoter by the Tn10-encoded Tet repressor in transgenic tobacco. Mol. Gen. Genet. 227:229-237[CrossRef][Medline]. |
| 17. |
Gatz, C., and P. H. Quail.
1988.
Tn-10-encoded tet repressor can regulate an operator-containing plant promoter.
Proc. Natl. Acad. Sci. USA
85:1394-1397 |
| 18. | Goebel, S. J., G. P. Johnson, M. E. Perkus, S. W. David, J. P. Winslow, and E. Paoletti. 1990. The complete DNA sequence of vaccinia virus. Virology 179:247-266[CrossRef][Medline]. |
| 19. |
Gossen, M., and H. Bujard.
1992.
Tight control of gene expression in mammalian cells by tetracycline-responsive promoters.
Proc. Natl. Acad. Sci. USA
89:5547-5551 |
| 20. |
Grimley, P. M.,
E. N. Rosenblum,
S. J. Mims, and B. Moss.
1970.
Interruption by rifampin of an early stage in vaccinia virus morphogenesis: accumulation of membranes which are precursors of virus envelopes.
J. Virol.
6:519-533 |
| 21. | Harauz, G., D. H. Evans, D. R. Beniac, A. L. Arsenault, B. Rutherford, and F. P. Ottensmeyer. 1995. Electron spectroscopic imaging of encapsidated DNA in vaccinia virus. Can. J. Microbiol. 41:889-894[Medline]. |
| 22. |
Hollinshead, M.,
A. Vanderplasschen,
G. L. Smith, and D. J. Vaux.
1999.
Vaccinia virus intracellular mature virions contain only one lipid membrane.
J. Virol.
73:1503-1517 |
| 23. |
Hsiao, J. C.,
C. S. Chung, and W. Chang.
1999.
Vaccinia virus envelope D8L protein binds to cell surface chondroitin sulfate and mediates the adsorption of intracellular mature virions to cells.
J. Virol.
73:8750-8761 |
| 24. | Hu, X., L. J. Carroll, E. J. Wolffe, and B. Moss. 1996. De novo synthesis of the early transcription factor 70-kilodalton subunit is required for morphogenesis of vaccinia virions. J. Virol. 70:7669-7677[Abstract]. |
| 25. |
Hu, X.,
E. J. Wolffe,
A. S. Weisberg,
L. J. Carroll, and B. Moss.
1998.
Repression of the A8L gene, encoding the early transcription factor 82-kilodalton subunit, inhibits morphogenesis of vaccinia virions.
J. Virol.
72:104-112 |
| 26. |
Ichihashi, Y.,
M. Oie, and T. Tsuruhara.
1984.
Location of DNA-binding proteins and disulfide-linked proteins in vaccinia virus structural elements.
J. Virol.
50:929-938 |
| 27. | Johnson, G. P., S. J. Goebel, and E. Paoletti. 1993. An update on the vaccinia virus genome. Virology 196:381-401[CrossRef][Medline]. |
| 28. |
Kane, E. M., and S. Shuman.
1993.
Vaccinia virus morphogenesis is blocked by a temperature-sensitive mutation in the I7 gene that encodes a virion component.
J. Virol.
67:2689-2698 |
| 29. | Kao, S., E. Ressner, J. Kates, and W. R. Bauer. 1981. Purification and characterization of a superhelix binding protein from vaccinia virus. Virology 111:500-508[CrossRef][Medline]. |
| 30. | Kao, S. Y., and W. R. Bauer. 1987. Biosynthesis and phosphorylation of vaccinia virus structural protein VP11. Virology 159:399-407[CrossRef][Medline]. |
| 31. | Klemperer, N., J. Ward, E. Evans, and P. Traktman. 1997. The vaccinia virus I1 protein is essential for the assembly of mature virions. J. Virol. 71:9285-9294[Abstract]. |
| 32. | Koerner, T. J., J. E. Hill, A. M. Myers, and A. Tzagaloff. 1991. High-expression vectors with multiple cloning sites for construction of trpE fusion genes: pATH vectors. Methods Enzymol. 194:477-490[Medline]. |
| 33. |
Krijnse-Locker, J.,
S. Schleich,
D. Rodriguez,
B. Goud,
E. J. Snijder, and G. Griffiths.
1996.
The role of a 21-kDa viral membrane protein in the assembly of vaccinia virus from the intermediate compartment.
J. Biol. Chem.
271:14950-14958 |
| 34. |
Lin, S.,
W. Chen, and S. S. Broyles.
1992.
The vaccinia virus B1R gene product is a serine/threonine protein kinase.
J. Virol.
66:2717-2723 |
| 35. | Liu, K., B. Lemon, and P. Traktman. 1995. The dual-specificity phosphatase encoded by vaccinia virus, VH1, is essential for viral transcription in vivo and in vitro. J. Virol. 69:7823-7834[Abstract]. |
| 36. | Lowe, M., C. Rabouille, N. Nakamura, R. Watson, M. Jackman, E. Jamsa, D. Rahman, D. J. C. Pappin, and G. Warren. 1998. Cdc2 kinase directly phosphorylates the cis-Golgi matrix protein GM130 and is required for Golgi fragmentation in mitosis. Cell 94:783-793[CrossRef][Medline]. |
| 37. |
Mackett, M.,
G. L. Smith, and B. Moss.
1984.
General method for production and selection of infectious vaccinia virus recombinants expressing foreign genes.
J. Virol.
49:857-864 |
| 38. | Nakamura, N., M. Lowe, T. P. Levine, C. Rabouille, and G. Warren. 1997. The vesicle docking protein p115 binds GM130, a cis-Golgi matrix protein, in a mitotically regulated manner. Cell 89:445-455[CrossRef][Medline]. |
| 39. |
Niles, E. G., and J. Seto.
1988.
Vaccinia virus gene D8 encodes a virion transmembrane protein.
J. Virol.
62:3772-3778 |
| 40. |
Patel, D. D.,
C. A. Ray,
R. P. Drucker, and D. J. Pickup.
1988.
A poxvirus-derived vector that directs high levels of expression of cloned genes in mammalian cells.
Proc. Natl. Acad. Sci. USA
85:9431-9435 |
| 41. |
Ravanello, M. P., and D. E. Hruby.
1994.
Conditional lethal expression of the vaccinia virus L1R myristylated protein reveals a role in virion assembly.
J. Virol.
68:6401-6410 |
| 42. |
Rempel, R. E., and P. Traktman.
1992.
Vaccinia virus B1 kinase: phenotypic analysis of temperature-sensitive mutants and enzymatic characterization of recombinant proteins.
J. Virol.
66:4413-4426 |
| 43. |
Rochester, S. C., and Traktman.
1998.
Characterization of the single-stranded DNA binding protein encoded by the vaccinia virus I3 gene.
J. Virol.
72:2917-2926 |
| 44. | Rodriguez, D., M. Esteban, and J. R. Rodriguez. 1995. Vaccinia virus A17L gene product is essential for an early step in virion morphogenesis. J. Virol. 69:4640-4648[Abstract]. |
| 45. | Rodriguez, D., C. Risco, J. R. Rodriguez, J. L. Carrascosa, and M. Esteban. 1996. Inducible expression of the vaccinia virus A17L gene provides a synchronized system to monitor sorting of viral proteins during morphogenesis. J. Virol. 70:7641-7653[Abstract]. |
| 46. | Rodriguez, J. R., C. Risco, J. L. Carrascosa, M. Esteban, and D. Rodriguez. 1997. Characterization of early stages in vaccinia virus membrane biogenesis: implications of the 21-kilodalton protein and a newly identified 15-kilodalton envelope protein. J. Virol. 71:1821-1833[Abstract]. |
| 47. |
Rodriguez, J. R.,
C. Risco,
J. L. Carrascosa,
M. Esteban, and D. Rodriguez.
1998.
Vaccinia virus 15-kilodalton (A14L) protein is essential for assembly and attachment of viral crescents to virosomes.
J. Virol.
72:1287-1296 |
| 48. | Salmons, T., A. Kuhn, F. Wylie, S. Schleich, J. R. Rodriguez, D. Rodriguez, M. Esteban, G. Griffiths, and J. K. Locker. 1997. Vaccinia virus membrane proteins p8 and p16 are cotranslationally inserted into the rough endoplasmic reticulum and retained in the intermediate compartment. J. Virol. 71:7404-7420[Abstract]. |
| 49. |
Sodeik, B.,
R. W. Doms,
M. Ericsson,
G. Hiller,
C. E. Machamer,
W. van't Hof,
G. van Meer,
B. Moss, and G. Griffiths.
1993.
Assembly of vaccinia virus: role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks.
J. Cell. Biol.
121:521-541 |
| 50. |
Sohda, M.,
Y. Misumi,
A. Yano,
N. Takami, and Y. Ikehara.
1998.
Phosphorylation of the vesicle docking protein p115 regulates its association with the Golgi membrane.
J. Biol. Chem.
273:5385-5388 |
| 51. | Takahashi, T., M. Oie, and Y. Ichihashi. 1994. N-terminal amino acid sequences of vaccinia virus structural proteins. Virology 202:844-852[CrossRef][Medline]. |
| 52. |
Traktman, P.,
M. K. Anderson, and R. E. Rempel.
1989.
Vaccinia virus encodes an essential gene with strong homology to protein kinases.
J. Biol. Chem.
264:21458-21461 |
| 53. | Traktman, P., A. Caligiuri, S. A. Jesty, K. Liu, and U. Sankar. 1995. Temperature-sensitive mutants with lesions in the vaccinia virus F10 kinase undergo arrest at the earliest stage of virion morphogenesis. J. Virol. 69:6581-6587[Abstract]. |
| 54. |
Vogelstein, B., and D. Gillespie.
1979.
Preparative and analytical purification of DNA from agarose.
Proc. Natl. Acad. Sci. USA
76:615-619 |
| 55. | Wang, S., and S. Shuman. 1995. Vaccinia virus morphogenesis is blocked by temperature-sensitive mutations in the F10 gene, which encodes protein kinase-2. J. Virol. 69:6376-6388[Abstract]. |
| 56. | Wilcock, D., and G. Smith. 1996. Vaccinia virions lacking core protein VP8 are deficient in early transcription. J. Virol. 67:934-943. |
| 57. | Wilcock, D., and G. L. Smith. 1994. Vaccinia virus core protein VP8 is required for virus infectivity, but not for core protein processing or for INV and EEV formation. Virology 202:294-304[CrossRef][Medline]. |
| 58. |
Williams, O.,
E. J. Wolffe,
A. S. Weisberg, and M. Merchlinsky.
1999.
Vaccinia virus WR gene A5L is required for morphogenesis of mature virions.
J. Virol.
73:4590-4599 |
| 59. | Wolffe, E. J., D. M. Moore, E. J. Peters, and B. Moss. 1996. Vaccinia virus A17L open reading frame encodes an essential component of nascent viral membranes that is required to initiate morphogenesis. J. Virol. 70:2797-2808[Abstract]. |
| 60. | Yang, W.-P., and W. R. Bauer. 1988. Biosynthesis and post-translational cleavage of vaccinia virus structural protein VP8. Virology 167:585-590[Medline]. |
| 61. | Yang, W.-P., and W. R. Bauer. 1988. Purification and characterization of vaccinia virus structural protein VP8. Virology 167:578-584[Medline]. |
| 62. |
Zhang, Y., and B. Moss.
1991.
Vaccinia virus morphogenesis is interrupted when expression of a gene encoding an 11-kilodalton phosphorylated protein is prevented by the Escherichia coli lac repressor.
J. Virol.
65:6101-6110 |
| 63. | Zhang, Y., and B. Moss. 1992. Immature viral envelope formation is interrupted at the same stage by lac operator mediated repression of the vaccinia virus D13L gene and by the drug rifampicin. Virology 187:643-653[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»