Previous Article | Next Article 
Journal of Virology, April 2000, p. 3642-3649, Vol. 74, No. 8
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of Amino Acid Residues in CD81 Critical for
Interaction with Hepatitis C Virus Envelope Glycoprotein E2
Adrian
Higginbottom,1
Elizabeth
R.
Quinn,2
Chiung-Chi
Kuo,2
Mike
Flint,3
Louise H.
Wilson,3
Elisabetta
Bianchi,4
Alfredo
Nicosia,4
Peter N.
Monk,1
Jane A.
McKeating,3,
and
Shoshana
Levy2,*
Department of Molecular Biology and Biotechnology,
University of Sheffield, Sheffield S10 2UH,1 and
School of Animal and Microbial Sciences, University of Reading,
Reading RG6 6AJ,3 United Kingdom;
Department of Medicine, Division of Oncology, Stanford
University Medical Center, Stanford, California
943052; and IRBM, 00040 Pomezia, Rome,
Italy4
Received 4 October 1999/Accepted 24 January 2000
 |
ABSTRACT |
Human CD81 has been previously identified as the putative receptor
for the hepatitis C virus envelope glycoprotein E2. The large
extracellular loop (LEL) of human CD81 differs in four amino acid
residues from that of the African green monkey (AGM), which does not
bind E2. We mutated each of the four positions in human CD81 to the corresponding AGM residues and expressed them as soluble fusion LEL proteins in bacteria or as complete membrane proteins in
mammalian cells. We found human amino acid 186 to be critical for the
interaction with the viral envelope glycoprotein. This residue was also
important for binding of certain anti-CD81 monoclonal antibodies. Mutating residues 188 and 196 did not affect E2 or antibody
binding. Interestingly, mutation of residue 163 increased both E2 and
antibody binding, suggesting that this amino acid contributes to
the tertiary structure of CD81 and its ligand-binding ability. These
observations have implications for the design of soluble high-affinity
molecules that could target the CD81-E2 interaction site(s).
 |
INTRODUCTION |
CD81 is a member of the tetraspanin
family. Tetraspanins are membrane proteins containing four
transmembrane domains, short intracellular domains and two
extracellular loops (8). Tetraspanins have been shown to be
involved in cell activation, proliferation, motility, and metastasis,
as well as in cell fusion (14). Although CD81 is widely
expressed, its level of expression varies in specific cell
lineages and during differentiation. Moreover, its association with
cell surface proteins differs in cell types of various lineages. In B
cells CD81 is a component of the CD19-CD21-CD81-Leu-13 molecular complex, which plays a role in B-cell activation (2),
whereas in T cells the molecule is associated with T-cell-specific
molecules, including CD4 and CD8 (5, 15). In addition to its
association with lineage-specific proteins, CD81 is associated with
integrins and other tetraspanins (8). As a consequence of
such protein associations, it is possible to activate multiple
adhesion/signaling pathways in different cell types by engaging CD81 at
their surface. For example, treatment of B-cell lines with a monoclonal
antibody (MAb) specific for CD81 induces changes in cell adhesion and
inhibits proliferation, whereas treatment of T-cell lines affects cell adhesion but not proliferation (10).
CD81 was recently reported to interact with the hepatitis C virus (HCV)
envelope glycoprotein (gp) E2 and hypothesized to act as a putative
viral receptor (12). We have confirmed this observation and
have shown that cell surface-expressed human CD81, but not murine or
monkey (Chlorocebus aethiops, African green monkey [AGM])
CD81, binds E2661, a truncated soluble version of the E2
gp. Furthermore, interaction of E2661 with the B-cell line Daudi had effects on cell adhesion and proliferation similar to the
effects induced by anti-CD81 antibodies (3). This
observation is of particular interest since in addition to causing
acute and chronic liver disease, HCV is the major cause for mixed
cryoglobulinemia (MC), a B-lymphocyte proliferative disorder. Recent
reports suggest that most patients (up to 98%) with MC types II and
III are infected with HCV (9). Conversely, approximately a
third of patients with chronic HCV infections have type II and III MC
(11).
A previous study by members of our group examined the interaction
between E2661 and CD81 and demonstrated that the second large extracellular loop (LEL) of human CD81 bound E2661.
(Prior to the identification of CD81 as the receptor for the HCV E2
ligand, the second extracellular domain was coined EC2; however, to
prevent confusion between E2 and EC2, we have opted to refer to this
region as the LEL.) A number of MAbs specific for linear epitopes
within E2661 were able to define two discontinuous regions
(amino acids 480 to 493 and 544 to 551) involved in CD81 binding
(3). Our present study was aimed at identifying the amino
acid residues in human CD81 critical for E2661
binding. Human CD81 differs from AGM CD81 at only four amino
acids within the LEL, which may directly affect the ability of
E2661 to bind COS cells. Alternatively, since CD81 is known
to associate with multiple proteins at the cell surface, differential
presentation of CD81 on COS cells may also affect E2661
binding. However, it should be noted that E2661 interacts
with human CD81 expressed on rat KM3 cells and various human cell types
with similar avidities, suggesting that additional human-specific cells
factors are not required for the initial interaction at the cell
surface (3). Since E2661 can interact with a
recombinant glutathione S-transferase (GST) fusion protein expressing the human CD81 LEL, we investigated the interaction of the
AGM CD81 LEL with the viral envelope protein. Recombinant CD81 proteins
derived from AGM CD81 and from human CD81 and variants containing amino acid changes at residues shown to be polymorphic between the human and AGM proteins were expressed both as recombinant fusion proteins and at the surfaces of KM3 cells. These CD81 proteins were tested for reactivity with E2661 and with a
panel of anti-human CD81 MAbs. These experiments identified a
single amino acid residue in human CD81 that is critical for binding
E2661 (and some anti-CD81 antibodies). Mutating human CD81
residue 186 (F186L) abolished its ability to bind
E2661. Unexpectedly, mutation T163A of human CD81 enhanced
E2661 binding. This observation has implications for the
design of molecular inhibitors with high affinity that would target the
CD81-E2 interaction sites.
 |
MATERIALS AND METHODS |
Cloning and expression of CD81 LEL fusion proteins.
A
diagram of the topological structure of CD81 is shown in Fig.
1. A fragment encoding amino acids 116 to
202 (LEL) of CD81 derived from the full-length human CD81 cDNA was
inserted into the pGEX-2T vector (Stratagene, La Jolla, Calif.), which
encodes a carboxyl-terminal fusion protein with GST as described
previously (3). Similarly, a fragment encoding amino acids
109 to 201 of mouse CD81 was inserted into the same vector. Using the
human LEL as a template, site-directed mutagenesis (QuikChange
site-directed mutagenesis kit; Stratagene) was performed to generate
three additional soluble GST fusion proteins containing the human LEL
with the following mutations: T163A, F186L plus E188K, and D196E
(codons underlined below).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
Structural model of CD81 and soluble GST-CD81 LEL fusion
proteins. Amino acid residues are shown as circles. Shaded circles
indicate coding by odd-numbered exons, and bolded circles mark the
positions of LEL cysteine residues evolutionarily conserved among
tetraspanins. Bars delineate amino acid residues fused to GST. Amino
acids that differ between human and AGM CD81 are numbered, with the
specific human residue on the left and the AGM residue on the right of
the number. SEL, small extracellular loop.
|
|
Primers used for the ACT

GCC change corresponding to position 163 were 5'GGC TCC AGC ACA CTG
GCC GCT TTG ACC ACC TCA G3'
(sense)
and 5'C TGA GGT GGT CAA AGC
GGC CAG TGT GCT
GGA GCC3'
(antisense).
Primers for the 186-plus-188 double mutation, TTC

CTC plus GAG

AAA,
were 5'C ATC AGC AAC CTC
CTC AAG
AAA GAC TGC
CAC CAG3'
(sense) and 5'CTG GTG GCA GTC
TTT CTT
GAG GAG GTT GCT GAT G3'
(antisense).
Primers used for the GAC

GAG change corresponding to position 196 were 5'CAC CAG AAG ATC GAT
GAG CTC TTC TCC GGG AAG C3'
(sense)
and 5'G CTT CCC GGA GAA GAG
CTC ATC GAT CTT CTG
GTG3'
(antisense).
PCR was performed for 16 to 18 cycles, and products were incubated with
DpnI to digest parental methylated plasmid DNA, as
recommended by the
manufacturer.
The AGM CD81 LEL fusion protein was constructed by "sticky-end" PCR
(
17) using sense primers
5'
GATCCAACAAGGACCAGATTGCCAAGGAT3'
and
5'
CAACAAGGACCAGATTGCCAAGGAT3' and antisense
primers 5'
CACAGCTTCCCGGAGAAGAGCTC3'
and
5'
AATTCACAGCTTCCCGGAGAAGAGCTC3'. These primers
created a
BamHI
restriction site at the 5' end and an
EcoRI restriction site at
the 3' end of the PCR product
(restriction sites are underlined).
The PCR product was cloned into the
BamHI and
EcoRI sites of expression
vector
pGEX-2T. Plasmids were first transformed into
Escherichia coli strain XL1-Blue. All constructs were sequenced using the
Big
Dye terminator method and analyzed on an ABI Prism 373 DNA
sequencer.
Subsequently,
E. coli strains SURE and BL2 were
transfected
with these plasmids for protein production. Bacteria
transformed
with the various CD81 LEL fusion constructs were induced
for 3
h at 32°C by the addition of 1 mM
isopropyl-

-
D-thiogalactopyranoside
(IPTG) and lysed by
sonication, and fusion proteins were recovered
by affinity
chromatography on a glutathione-Sepharose 4B column
according to the
manufacturer's protocols (Pharmacia Biotech,
Uppsala, Sweden).
Purified fusion proteins were analyzed by Western
blotting and by
immunoassays as described
below.
Cloning and expression of cell surface-expressed CD81
mutants.
The human CD81 cDNA insert (10) was
transferred from the pCDM8 vector by XhoI digestion, end
filling, and blunt ligation into the Sureclone vector (Pharmacia
Biotech, St. Albans, United Kingdom). Correct orientation was
ascertained by HindIII (vector site) and PstI
(CD81 restriction site) digestion. Correct clones were transferred via
the Sureclone restriction sites, HindIII and
EcoRI, into the expression vector pEE6hCMV.neo. Primers used for cloning of the human CD81 open reading frame (bolded below) into
pEE6 HindIII and EcoRI sites (underlined
below) were 5'TCT AGA AAG CTT GCC ACC ATG GGA GTG GAG
GGC T3' (sense) and 5'TCT AGA GAA TTC TCA GTA
CAC GGA GCT GTT3' (antisense).
The four point mutations (underlined below), T163A, F186L, E188K, and
D196E, were generated by overlap extension PCR (
4).
The
following primers were used for mutagenesis: for T163A, 5'C
ACA CTG
GCT GCT TT3' (sense) and 5'AA AGC AG
C CAG TGT
G3' (antisense);
for F186L, 5'AC CTC TT
A AAG GAG G3'
(sense) and 5'C CTC CTT
TAA
GAG GT3' (antisense); for
E188K, 5'TC TTC AAG
AAG GAC TGC3' (sense)
and 5'GCA GTC
CT
T CTT GAA GA3' (antisense); and for D196E, 5'ATC
GAT
GA
A CTC TTC TC3' (sense) and 5'GA GAA GAG
TTC
ATC GAT3'
(antisense).
All constructs were sequenced using the Big Dye terminator method and
analyzed on an ABI Prism 373
sequencer.
Generation of stable transfected cell lines.
The rat cell
line KM3 was routinely subcultured in RPMI 1640 containing 5% fetal
calf serum (FCS). The mutant constructs were transfected into the KM3
cell line as described previously (3). Briefly, 20 µg of
column-purified DNA (Nucleobond AX100; BioGene Ltd., Kimbolton, United
Kingdom) was electroporated by a single pulse at 250 V and 500 µF.
Selection was achieved by supplementing the medium with 125 µg of
G418 (Geneticin; Gibco BRL) per ml. CD81-expressing clones were
isolated using a fluorescein isothiocyanate (FITC)-labeled anti-human
CD81 MAb, 1.3.3.22 (Ancell, Bayport, Mich.), and the top 10% were
sorted twice on a Vantage FACsort (Becton Dickinson, Oxford, United Kingdom).
Expression of soluble truncated HCV E2661.
Expression of soluble secreted recombinant E2661 by
transient expression in HEK (293) cells has been described
previously (3). Briefly, a eukaryotic expression vector
encoding E2661 (p14.tE2.661.hiv) was transfected into 293 cells cultured in 100-mm-diameter dishes using the calcium phosphate
precipitation method. After 72 h of incubation at 37°C in medium
containing a low concentration (2%) of FCS, the medium was removed,
clarified by centrifugation, and used as a source of secreted
E2661. Supernatants from cells transfected with the vector
alone were utilized as a mock antigen in subsequent assays.
Enzyme immunoassays (EIAs).
CD81 LEL fusion proteins were
used to coat 96-well dishes at 5 µg/ml in phosphate-buffered saline
(PBS) overnight at 4°C, and plates were blocked for 1 h at room
temperature (RT) with 4% milk powder. E2661 (50 µl of 1 µg/ml) was diluted in eight wells in twofold dilutions and allowed to
bind overnight at 4°C. Bound E2661 was detected using the
E2-specific and conformation-dependent MAb H53 (mouse immunoglobulin G1
[IgG1]) (1) and horseradish peroxidase (HRP)-conjugated
goat anti-mouse IgG antibody (Southern Biotechnology Associates,
Birmingham, Ala.). Likewise, anti-CD81 MAbs were diluted in eight wells
twofold, allowed to bind for 2 h at RT, and visualized using
HRP-conjugated goat anti-mouse IgG antibody (Southern Biotechnology Associates).
Affinity elution EIAs with ammonium thiocyanate.
Assays were
performed as described above, with the following modification
(16). After binding of E2661 (100 µl of 1 µg/ml), anti-CD81 MAbs, or anti-GST MAbs, the plates were washed to
remove unbound protein and 100 µl of 0 to 3 M ammonium thiocyanate
(NH4SCN) in PBS was added. The plates were incubated for 15 min at RT, washed, and visualized as described above. The absorbance
reading in the absence of NH4SCN was defined as 100%. The
affinity index was defined as the molar concentration of thiocyanate
required to reduce the initial absorbance reading to 50%
(7).
Flow cytometric analysis of E2661 binding to
cells.
The interaction of E2661 gp with cells was
quantified using a fluorescence-activated cell sorter-based assay. In
brief, cells were washed twice in PBS-1% FCS-0.05% sodium azide
(WB) and resuspended at 2 × 106/ml.
A total of 2 × 10
5 cells were incubated with
E2
661 at RT for 1 h; unbound antigen was removed by
washing the cells twice in
WB. Cells were incubated with MAb H53 (1 µg/ml) for 1 h at RT.
Finally, cell-bound MAb was visualized
with an anti-mouse IgG-phycoerythrin
(PE) conjugate (Harlan Seralab,
Bicester, United Kingdom) and
analyzed with a fluorescence-activated
cell sorter (Becton Dickinson).
Median fluorescence intensities were
determined using Cellquest
software (Becton
Dickinson).
Determination of intracellular CD81 levels.
Cell
permeabilization was performed using a cell permeabilization kit
according to the manufacturer's instructions (Harlan Sera-lab,
Bicester, United Kingdom). Briefly, subconfluent adherent cells were
harvested using nonenzymatic solution, washed in balanced salt
solution-0.2% bovine serum albumin, resuspended at
106/ml, and plated at 100 µl/well in a 96-well plate. The
cells were then fixed with 10 µl of reagent A for 15 min at RT,
followed by two washes in PBS (pH 7.2). Surface expression was measured by adding saturating amounts of FITC-labeled anti-CD81 MAb (1.3.3.22), or an isotype control, in a volume of 20 µl (balanced salt
solution-bovine serum albumin). Total expression was measured by adding
FITC-labeled anti-CD81 or control MAb and 10 µl of lysis reagent B. Cells were mixed and incubated in the dark for 15 min at RT. Samples
were washed then fixed in 1% paraformaldehyde and analyzed on a
Coulter EPICS flow cytometer. Surface expression and total expression were first corrected for nonspecific binding (isotype control), and
intracellular expression levels were calculated by subtracting extracellular from total expression levels.
MAbs.
Anti-CD81 antibodies used in these studies have been
previously described (6). MAb 1.3.3.22 and anti-GST MAb were
obtained from Santa Cruz Biotechnology (Santa Cruz, Calif.); MAb
1.3.3.22 was also obtained from Ancell. H53, a conformation-dependent
anti-E2 MAb (1), was a generous gift from Jean Dubuisson.
Western blotting.
The CD81 LEL was analyzed by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis under reducing and
nonreducing conditions. After separation, the proteins were transferred
to nitrocellulose and visualized directly with anti-CD81 MAb 5A6 or
indirectly using E2661 protein and rat anti-E2 MAbs (7/16,
3/11, and 6/53). Bound IgG was detected via anti-mouse or anti-rat
HRP-conjugated secondary antibodies, ECL detection reagents (Amersham
Life Sciences), and exposure to photographic film.
Peptide synthesis.
Machine-assisted peptide synthesis was
performed on a Perseptive Perkin-Elmer Pioneer synthesizer by
9-fluorenylmethoxy carbonyl/t-Bu chemistry. The resin used was Novasyn
TGR; activation was achieved by HBTU-DIEA (1:2) or HATU-DIEA (1:2)
using a fivefold excess of acylants over the resin amino groups and a
coupling time of 30 min to 2 h. The peptides were cleaved with
88% trifluoroacetic acid (TFA)-5% phenol-2%
triisopropylsilane-5% water. Crude peptides were purified by
reversed-phase high-performance liquid chromatography on either a
Waters Delta-Pack C18 column (200 by 25 mm, 100Å, 15 µm)
or a Waters Delta-Pack C4 column (200 by 25 mm, 300Å, 15 µm), depending on size. The eluent system was H2O, 0.1%
TFA, and acetonitrile-0.1% TFA. Analytical high-performance liquid
chromatography was performed on an Ultrasphere C18 column
(250 by 4.6 mm, 80Å, 5 µm [Beckman]) or a Vydac C4
column (150 by 4.6 mm, 300Å, 5 µm). Purified (
90%) peptides were
characterized by mass spectrometry, 1H nuclear magnetic
resonance, and amino acid analysis.
 |
RESULTS |
Specificity of soluble-CD81-E2661
interactions.
To determine whether E2661 could
interact with soluble AGM CD81, a recombinant GST fusion protein
containing the AGM CD81 LEL (Fig. 1) was constructed, expressed in
bacteria, and purified as detailed in Materials and Methods. This
recombinant protein was able to bind a number of conformation-dependent
CD81 MAbs, suggesting that it was folded in a manner comparable to that
of the native molecule (Fig. 2B and data
not shown). Purified AGM CD81 LEL protein was compared for its ability
to bind E2661 with the homologous soluble proteins derived
from human and mouse CD81. The soluble AGM CD81 LEL protein was unable
to bind E2661 (Fig. 2A). This result is consistent with our
cell binding data (3), confirming that the block to cell
binding was at the protein-protein level. The coating of the AGM CD81
LEL protein on the plate was equal to that of the human protein, as
seen by their similar patterns of reactivity with the anti-CD81 MAb
JS64 (Fig. 2B) and with anti-GST MAb (Fig. 2D). Interestingly, some
anti-CD81 MAbs discriminated between the human and the AGM soluble CD81
proteins. Whereas JS64 bound human and AGM proteins similarly, other
anti-human CD81 MAbs, such as 4TM-1 (Fig. 2C and data not shown), did
not interact with the AGM protein. It is worth noting that all
anti-CD81 MAbs tested to date are able to block E2 binding to cell
surface-expressed CD81. MAbs able to discriminate between human and AGM
CD81 may interact with an epitope that overlaps the E2661
binding site.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Specificity of HCV E2661 and anti-CD81 MAb
interactions with CD81 LEL fusion proteins. EIA plates were coated with
recombinant CD81 LEL fusion proteins (5 µg/ml), and binding of 50 µl of the following proteins at their starting dilutions to soluble
HCV E2661 (1 µg/ml) (A), anti-human CD81 MAb JS64 (0.1 µg/ml) (B), anti-human CD81 MAb 4TM-1 (1 µg/ml) (C), and anti-GST
MAb B-14 (1 µg/ml) (D) was detected as described in Materials and
Methods. OD, optical density.
|
|
Conformation of the E2661 binding region within
CD81.
Both soluble human and mouse GST-CD81 LEL proteins reacted
with an anti-GST MAb (Fig. 3A). This
antibody recognized the full-length protein and lower-molecular-weight
products. The highest 36-kDa molecular band of the human, but not the
mouse, fusion protein reacted with anti-CD81 MAb (Fig. 3B). This
antibody also reacted with nonreduced aggregated forms of the protein,
which collapsed to a single band upon reduction. It should be noted
that the reactivity of the antibody with the reduced soluble CD81 was
much weaker than that seen with the nonreduced product. Indeed,
recognition of CD81 by the majority of anti-CD81 MAbs is dependent upon
correct folding of S-S bonds, since these MAbs recognize the native,
cellular, nonreduced form of the protein. These results suggest that
the native conformation of CD81 depends on S-S bonds (6).
Similarly, E2661 was found to interact only with the
nonreduced form of CD81 by Western blotting (Fig. 3C). It is
interesting that anti-CD81 MAb 5A6 recognizes reduced and
higher-molecular-weight forms of human CD81 LEL proteins seen under
nonreducing conditions (Fig. 3B), whereas E2 recognizes only the
monomeric nonreduced form of CD81 (Fig. 3C). Likewise,
E2661 reacted in EIA with native human CD81 LEL proteins,
but not with a reduced form of the soluble molecule or with reduced
synthetic peptides corresponding to defined regions within the human
CD81 LEL (Tables 1 and
2). Similarly, all of the anti-human MAbs
tested, with the exception of 1D6, failed to bind the CD81 peptides
(Table 1 and data not shown). Since MAb 1D6 can inhibit E2 interaction
with CD81, we were interested in defining its minimal epitope. A series
of peptides were synthesized and tested for the ability to bind 1D6 and
E2661. 1D6 bound to all of the peptides tested, with the
exception of peptides 1077 and 1084, with various affinities. The
minimal region recognized by this antibody comprised amino acids 179 to
193, corresponding to peptide 1108 (Table 1). In contrast, E2 failed to
interact with the peptides, with optical density signals of <0.2,
despite showing good binding in the same assay to GST-human CD81 (Table 1).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 3.
Interaction of E2661 with recombinant CD81.
Purified recombinant human CD81 LEL (h) and mouse CD81 LEL (m) proteins
were analyzed by reducing (R) or nonreducing (NR) sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and detected with anti-GST
MAb (A); anti-CD81 MAb 5A6 (B); E2661, followed by anti-E2
MAbs (C); and supernatant from mock-transfected cells, followed by
anti-E2 MAbs (D). Numbers at the left indicate molecular mass, in
kilodaltons.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Native but not reduced human CD81 LEL protein binds
E2661, while anti-CD81 MAb 1D6 binds a defined reduced
peptide within the LEL
|
|
Identification of CD81 residues critical for E2661
binding.
To define amino acid residues in CD81 critical for
E2661 binding, human CD81 LEL mutants were constructed,
expressed in bacteria, immobilized on EIA plates, and tested for the
ability to bind E2661. The CD81 variants were tested for
binding serially diluted E2661 and detected by MAb H53.
This is a conformation-dependent anti-E2661 antibody that
binds the E2661-CD81 complex (3). As seen
earlier (Fig. 2A), human but not AGM CD81 LEL protein bound
E2661. The D196E mutation of human CD81 reduced
E2661 binding, while human CD81 LEL protein containing both
mutations F186L and E188K was unable to bind E2661,
suggesting that either or both of these residues are critical for
interaction with E2661 (Fig. 4). Surprisingly, human CD81 LEL protein
expressing the T163A mutation demonstrated enhanced binding to
E2661 (Fig. 4). All these GST-CD81 LEL fusion proteins were
equally coated on the plates, as determined by their reactivities with
the nondiscriminating antibody JS64 (Fig. 2B) and with an
anti-GST MAb (Fig. 2D). Human CD81 LEL protein and the variant
proteins were tested for the ability to block E2661 binding
to cell surface-expressed CD81 as described above. The human CD81-LEL
T163A mutant completely blocked E2661 binding and the D196E
mutant partially blocked the interaction, whereas neither AGM CD81
LEL protein nor the F186L-E188K double mutant competed with cellular
CD81 for E2661 binding (data not shown).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
HCV E2661 binding to CD81 LEL fusion
proteins. E2661 starting at 1 µg/ml was serially diluted
and allowed to bind to EIA plates coated with 5 µg of each of the
recombinant CD81 LEL fusion proteins per ml as described in the legend
to Fig. 2A. Bound E2661 was detected using the E2-specific
MAb H53 and goat anti-mouse IgG-HRP. OD, optical density.
|
|
To compare the relative avidities of soluble mutant CD81 proteins with
E2
661, the complexes were exposed to increasing salt
concentrations using previously described methods (
7,
16).
CD81-E2
661 complexes were formed as described above,
exposed to
increasing concentrations of ammonium thiocyanate, and
washed;
the bound proteins were then detected. The avidity of
interaction
of the various mutant CD81 LEL proteins for
E2
661 is shown in
Fig.
5A.
This analysis revealed that 50% of E2
661 was bound to
the
parental human CD81 LEL protein at 0.7 M salt and that mutation
of
residue 196 mildly affected the binding avidity, since 50%
of the
initially bound material remained bound at a slightly lower
salt
concentration, 0.65 M. However, mutation at residue 163 increased
the
binding avidity of E2
661 such that 50% of
E2
661 remained bound
after the salt concentration was
doubled to 1.4 M. Furthermore,
the avidity of the binding of the human
CD81 LEL T163A mutant
to E2
661 was in the range of antibody
binding. This can be seen
in Fig.
5B, which shows the results of
testing for the avidity
of antibody binding to human CD81 LEL protein.
The MAbs displayed
different avidities for the protein; for example,
50% of the initial
bound anti-GST antibody remained bound after
treatment with 1.5
M salt, whereas the more avid anti-CD81 MAbs 5A6 and
1D6 required
2.0 M salt and the most avid anti-CD81 MAb, JS64, was
eluted at
2.75 M ammonium thiocyanate (Fig.
5B).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 5.
Affinity elution analysis of mutant CD81-LEL proteins
with NH4SCN. (A) EIA plates were coated with 5 µg of
recombinant human CD81-LEL fusion protein, CD81-LEL mutant T163A
protein, and CD81-LEL mutant D196E protein per ml, and
E2661 was allowed to bind as described in the Materials and
Methods. (B) EIA plates were coated with recombinant human CD81-LEL
fusion protein (5 µg/ml). Binding of anti-CD81 MAbs JS64 (0.5 µg/ml), 1D6, and 5A6 and anti-GST MAb B-14 (all at 1 µg/ml) was
detected as described in Materials and Methods. After binding of
E2661 or anti-CD81 MAbs, 100 µl of 1 to 3 M ammonium
thiocyanate was added. Plates were incubated for 15 min at RT, and
results were visualized as described in Materials and Methods. The
absorbance reading in the absence of NH4SCN was defined as
100%. The affinity index was defined as the molar concentration of
thiocyanate required to reduce the initial absorbance reading to
50%.
|
|
Identification of CD81 residues critical for E2661
binding to the cell surface.
We have shown that mutation of
residues known to be polymorphic between the human and AGM CD81
sequences affected E2661 binding to soluble CD81 (Fig. 4).
To investigate whether cell surface-expressed CD81 behaves in a similar
manner, proteins with single amino acid mutations were constructed and
stably transfected into rat KM3 cells. Cells expressing each of the
individual CD81 mutant proteins were tested for expression at the cell
surface by reactivity with anti-CD81 MAb 1.3.3.22 and
E2661. All of the CD81 proteins were expressed to different
extents at the cell surface, as follows: human CD81 > T163A
mutant > F186L mutant > E188K mutant = D196E mutant
(Fig. 6). Using a cell permeabilization
assay, we analyzed intracellular expression of the various CD81 mutants
in transfected KM3 cells. Negligible amounts of human and T163A mutant
CD81 were observed within cells; the F186L mutant was mostly expressed
at the cell surface, with less than 20% of the total protein being located within the cell. However, considerable amounts (44 and 35%,
respectively) of the E188K and D196E mutants were found within cells,
suggesting that these mutations may affect intracellular trafficking of
CD81.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 6.
Affinity of E2 for cell surface-expressed CD81 variants.
KM3 parental cells (solid graph) and transfectants expressing
heterologous human CD81 (hCD81) and various mutants were tested for the
ability to bind the anti-CD81 MAb 1.3.3.22 (5.0 µg/ml) (solid line)
and a subsaturating concentration of E2661 (0.5 µg/ml)
(shaded line). Bound E2 was visualized with MAb H53 and anti-mouse
IgG-PE. The results are from a single experiment, which are
representative of comparable data obtained in two independent
experiments.
|
|
To overcome differential expression levels of the CD81 mutants, a
subsaturating level of E2
661 (0.5 µg/ml) was used to
evaluate
the interaction, whereby E2
661 binding was not
dependent upon
the CD81 expression level(s). E2
661 bound
equivalently to parental
and E188K proteins, showed no interaction with
the F186L protein,
bound with an intermediate phenotype to the D196E
protein, and
showed enhanced interaction with the T163A protein (Fig.
6). Thus,
the results are comparable to those obtained with the soluble
GST-CD81 fusion proteins and identify residue 186 as being critical
for
the interaction with E2
661. The observations seen with a
single
concentration of E2
661 were dose dependent and
titrated in a linear
fashion dependent upon E2
661
concentration (Fig.
7). The similar
patterns of binding of E2 to soluble recombinant and cell
surface-expressed
CD81 (Fig.
4 and
7) suggest comparable folding of the
recombinant
and cell surface-expressed proteins. Moreover, the T163A
mutation
in either form of the protein enhanced the interaction with
E2
661.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 7.
Dose-dependent binding of E2 to cellular CD81.
Increasing dilutions of 1 µg of E2661 per ml were tested
for the ability to bind parental KM3 and cells expressing wild-type and
mutant human CD81 sequences. Bound E2 was visualized with MAb H53 and
anti-mouse IgG-PE. The results are from a single experiment and are
representative of data obtained in two independent experiments. F.I.,
fluorescence intensity.
|
|
Interestingly, anti-human CD81 MAbs produced against the native CD81
protein exhibited differential patterns of binding to
the various
mutant proteins. Like E2
661, all MAbs showed increased
binding to the T163A mutant and reduced binding to the F186L mutant
(data not shown). As observed with the soluble CD81 (Fig.
2C and
data
not shown), there was no binding of the F186L mutant to the
4TM-1 MAb.
The E188K and D196E mutants displayed reduced binding
to most of the
antibodies. The increased binding of the anti-human
MAbs and
E2
661 to the T163A mutant suggests that amino acid 163
contributes to the tertiary structure of CD81, which enables increased
binding to its natural
ligands.
 |
DISCUSSION |
The evolutionary divergence of CD81 is most pronounced in
exon 6 of the molecule. Yet, this exon encodes three of the cysteine residues that are conserved among tetraspanin molecules (8). Moreover, two of the cysteines encoded by exon 6 are adjacent and
embedded in the CCG motif conserved in all tetraspanins of schistosome,
nematode, Drosophila, and mammalian origins (8). Although the tertiary structure of tetraspanins has yet to be solved,
it is highly likely that the three conserved cysteine residues encoded
by exon 6 and the conserved cysteine encoded by exon 7 form S-S bridges
(Fig. 1). Such bridges would restrain the tertiary structure of the
protein and expose regions flanked by the bridging cysteines as
diagramed in Fig. 1.
Human CD81 and AGM CD81 differ in four amino residues, all encoded
within exons 6 and 7 (Fig. 1) and contained in the carboxyl-terminal region of the LEL, implicating one or more of these residues as important for HCV E2 binding (3, 12). To define which of these amino acid residues is most important for CD81-E2 interactions, we created both soluble and cell surface-expressed mutant CD81 proteins
and tested their interactions with the viral protein and with a panel
of anti-human CD81 MAbs. Soluble AGM CD81 LEL protein failed to react
with the HCV E2661 (Fig. 2A). This recombinant protein was
able to bind several anti-human CD81 MAbs, suggesting that the protein
was folded correctly and bound to the EIA plates as efficiently as the
human protein (Fig. 2B). The inability of E2661 to bind
soluble AGM protein was mirrored by several MAbs raised against native
human CD81. Thus, E2661 and a number of MAbs can
discriminate between human and AGM CD81 and may therefore bind
overlapping epitopes (Fig. 2C and data not shown).
Soluble, bacterially produced, human CD81 has previously been shown to
interact with recombinant E2 and with the virus (3, 12). The
soluble human CD81 LEL protein reacted with a panel of anti-human CD81
MAbs that were produced against native cell surface-expressed CD81
(data not shown). Thus, binding of all available anti-CD81 antibodies
to the soluble protein is indicative of its correct folding.
Furthermore, the majority of these antibodies react preferably with
unreduced native and soluble CD81 in EIA and Western analysis (data not
shown), indicating that appropriate S-S bridges are formed during
bacterial expression. Similarly, E2661 protein bound only
the full-length nonreduced form of soluble CD81 (Fig. 3 and Table 1),
suggesting that the E2 binding site on CD81 is conformation dependent.
In support of this conclusion, synthetic peptides containing the human
CD81 LEL sequence were unable to bind the viral protein (Table 1).
However, MAb 1D6 was able to bind several of the peptides, enabling us
to identify amino acids 179 to 193 as the minimal epitope (Table 1).
This particular antibody was derived by immunization with B cells that were pretreated with an anti-CD81 MAb (13). Preengagement of CD81 may have altered the tertiary structure of the protein, exposing the 1D6-reactive epitope. Recognition of a linear epitope by this antibody enables its reactivity with fixed and paraffin-embedded tissues (S. Levy and R. Wranke, unpublished observations).
To define the region within the CD81 LEL important for
E2661 binding, mutant soluble proteins were expressed in
bacteria and tested by EIA (Fig. 4). The F186L-E188K double mutant
failed to react with E2661, whereas the T163A mutant
demonstrated enhanced binding compared to that of the parental protein
(Fig. 4). The avidity of E2661 binding was further tested
by exposing the interacting proteins to increasing concentrations of
the chaotropic agent ammonium thiocyanate (7, 16). This
analysis confirmed that the increased binding of the T163A mutant to
E2661 was attributable to an increase in the avidity of the
interaction, whereby 50% of the protein remained bound to
E2661 after exposure to 1.4 M salt, compared with 0.7 M for
parental human CD81 LEL protein. The avidity of binding of the T163A
mutant to E2661 is very similar to that seen for the
interaction of the human CD81 LEL protein with the anti-GST MAb, of
which 50% remained bound at 1.5 M salt (Fig. 5B). This analysis also
demonstrated that monovalent E2661 does not bind the native
human CD81 LEL protein as avidly as bivalent anti-CD81 MAbs. It is not
surprising that the avidity of binding of the monovalent soluble
E2661 to GST-CD81 is lower than that of antibody binding.
However, it is possible to envisage that multiple E2 molecules
expressed within the context of E1E2 oligomers on the virion surface
may bind cellular CD81 with increased avidity.
Finally, it was important to determine whether mutations in CD81 could
indeed influence binding of soluble E2661 to the cell surface. We therefore constructed plasmids that encoded each of the
four amino acid changes and selected stable transfected KM3 cells
expressing these mutants. This experiment identified residue 186 as
being critical for the interaction with E2 since the protein with a
mutation of this residue did not bind E2661. The E188K mutant bound E2661 with an affinity comparable to that of
the parental human protein (Fig. 6 and 7). The enhanced binding of the
cell surface-expressed T163A mutant to E2661 confirmed the protein-protein interaction data. Moreover, the binding of E2 to the
cell surface-expressed CD81 variants (Fig. 7) was identical to that
observed with immobilized soluble CD81 mutants (Fig. 5). The
increased binding of the E2661 protein to the T163A mutant was not dependent on increased cell surface expression, as its level of expression was lower than that of parental human CD81. Nevertheless, the mutational analysis resulted in reduced expression of
some mutant CD81 proteins. It will be interesting to determine if these
mutant proteins demonstrate reduced association with cell surface
proteins needed for trafficking of the molecule to the cell surface.
Thus, we demonstrate that a single amino acid change, F186L, can
abrogate CD81 interaction with E2, whereas the T163A mutation
enhances the interaction.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grant CA-34233
(S.L.), by The Wellcome Trust and The Lister Institute for Preventive
Medicine (J.A.M.), and by British Heart Foundation grant PG/98163 and
Arthritis Research Campaign fellowship M0543 (P.N.M.).
We thank Jean Dubuisson for his generous gift of MAb H53.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medicine, Division of Oncology, Stanford University Medical Center,
Stanford, CA 94305. Phone: (650) 725-6425. Fax: (650) 725-1420. E-mail: levy{at}cmgm.stanford.edu.
Present address: Central Research, Pfizer Ltd., Sandwich, Kent
CT13 9NJ, United Kingdom.
 |
REFERENCES |
| 1.
|
Cocquerel, L.,
J. C. Meunier,
A. Pillez,
C. Wychowski, and J. Dubuisson.
1998.
A retention signal necessary and sufficient for endoplasmic reticulum localization maps to the transmembrane domain of hepatitis C virus glycoprotein E2.
J. Virol.
72:2183-2191[Abstract/Free Full Text].
|
| 2.
|
Fearon, D. T., and R. H. Carter.
1995.
The CD19/CR2/TAPA-1 complex of B lymphocytes: linking natural to acquired immunity.
Annu. Rev. Immunol.
13:127-149[CrossRef][Medline].
|
| 3.
|
Flint, M.,
C. Maidens,
L. D. Loomis-Price,
C. Shotton,
J. Dubuisson,
P. Monk,
A. Higginbottom,
S. Levy, and J. A. McKeating.
1999.
Characterization of hepatitis C virus E2 glycoprotein interaction with a putative cellular receptor, CD81.
J. Virol.
73:6235-6244[Abstract/Free Full Text].
|
| 4.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene
77:51-59[CrossRef][Medline].
|
| 5.
|
Imai, T.,
M. Kakizaki,
M. Nishimura, and O. Yoshie.
1995.
Molecular analyses of the association of CD4 with two members of the transmembrane 4 superfamily, CD81 and CD82.
J. Immunol.
15:1229-1239.
|
| 6.
|
Levy, S.,
S. C. Todd, and H. T. Maecker.
1998.
CD81 (TAPA-1): a molecule involved in signal transduction and cell adhesion in the immune system.
Annu. Rev. Immunol.
16:89-109[CrossRef][Medline].
|
| 7.
|
Macdonald, R. A.,
C. S. Hosking, and C. L. Jones.
1988.
The measurement of relative antibody affinity by ELISA using thiocyanate elution.
J. Immunol. Methods
106:191-194[CrossRef][Medline].
|
| 8.
|
Maecker, H. T.,
S. C. Todd, and S. Levy.
1997.
The tetraspanin superfamily: molecular facilitators.
FASEB J.
11:428-442[Abstract].
|
| 9.
|
Misiani, R.,
P. Bellavita,
D. Fenili,
G. Borelli,
D. Marchesi,
M. Massazza,
G. Vendramin,
B. Comotti,
E. Tanzi,
G. Scudeller, et al.
1992.
Hepatitis C virus infection in patients with essential mixed cryoglobulinemia.
Ann. Intern. Med.
117:573-577.
|
| 10.
|
Oren, R.,
S. Takahashi,
C. Doss,
R. Levy, and S. Levy.
1990.
TAPA-1, the target of an antiproliferative antibody, defines a new family of transmembrane proteins.
Mol. Cell. Biol.
10:4007-4015[Abstract/Free Full Text].
|
| 11.
|
Pawlotsky, J. M.,
F. Roudot-Thoraval,
P. Simmonds,
J. Mellor,
M. B. Ben Yahia,
C. Andre,
M. C. Voisin,
L. Intrator,
E. S. Zafrani,
J. Duval, et al.
1995.
Extrahepatic immunologic manifestations in chronic hepatitis C and hepatitis C virus serotypes.
Ann. Intern. Med.
122:169-173[Abstract/Free Full Text].
|
| 12.
|
Pileri, P.,
Y. Uematsu,
S. Campagnoli,
G. Galli,
F. Falugi,
R. Petracca,
A. J. Weiner,
M. Houghton,
D. Rosa,
G. Grandi, and S. Abrignani.
1998.
Binding of hepatitis C virus to CD81.
Science
282:938-941[Abstract/Free Full Text].
|
| 13.
|
Schick, M. R., and S. Levy.
1993.
The TAPA-1 molecule is associated on the surface of B cells with HLA-DR molecules.
J. Immunol.
151:4090-4097[Abstract].
|
| 14.
|
Tachibana, I., and M. E. Hemler.
1999.
Role of transmembrane 4 superfamily (TM4SF) proteins CD9 and CD81 in muscle cell fusion and myotube maintenance.
J. Cell Biol.
146:893-904[Abstract/Free Full Text].
|
| 15.
|
Todd, S. C.,
S. G. Lipps,
L. Crisa,
D. R. Salomon, and C. D. Tsoukas.
1996.
CD81 expressed on human thymocytes mediates integrin activation and IL-2-dependent proliferation.
J. Exp. Med.
184:2055-2060[Abstract/Free Full Text].
|
| 16.
|
Wong, C. P.,
C. Y. Okada, and R. Levy.
1999.
TCR vaccines against T cell lymphoma: QS-21 and IL-12 adjuvants induce a protective CD8+ T cell response.
J. Immunol.
162:2251-2258[Abstract/Free Full Text].
|
| 17.
|
Zeng, G.
1998.
Sticky-end PCR: new method for subcloning.
BioTechniques
25:206-208[Medline].
|
Journal of Virology, April 2000, p. 3642-3649, Vol. 74, No. 8
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Burlone, M. E., Budkowska, A.
(2009). Hepatitis C virus cell entry: role of lipoproteins and cellular receptors. J. Gen. Virol.
90: 1055-1070
[Abstract]
[Full Text]
-
Brazzoli, M., Bianchi, A., Filippini, S., Weiner, A., Zhu, Q., Pizza, M., Crotta, S.
(2008). CD81 Is a Central Regulator of Cellular Events Required for Hepatitis C Virus Infection of Human Hepatocytes. J. Virol.
82: 8316-8329
[Abstract]
[Full Text]
-
Russell, R. S., Meunier, J.-C., Takikawa, S., Faulk, K., Engle, R. E., Bukh, J., Purcell, R. H., Emerson, S. U.
(2008). Advantages of a single-cycle production assay to study cell culture-adaptive mutations of hepatitis C virus. Proc. Natl. Acad. Sci. USA
105: 4370-4375
[Abstract]
[Full Text]
-
von Hahn, T., Rice, C. M.
(2008). Hepatitis C Virus Entry. J. Biol. Chem.
283: 3689-3693
[Full Text]
-
Molina, S., Castet, V., Pichard-Garcia, L., Wychowski, C., Meurs, E., Pascussi, J.-M., Sureau, C., Fabre, J.-M., SaCunha, A., Larrey, D., Dubuisson, J., Coste, J., McKeating, J., Maurel, P., Fournier-Wirth, C.
(2008). Serum-Derived Hepatitis C Virus Infection of Primary Human Hepatocytes Is Tetraspanin CD81 Dependent. J. Virol.
82: 569-574
[Abstract]
[Full Text]
-
Tellinghuisen, T. L., Evans, M. J., von Hahn, T., You, S., Rice, C. M.
(2007). Studying Hepatitis C Virus: Making the Best of a Bad Virus. J. Virol.
81: 8853-8867
[Full Text]
-
Helle, F., Goffard, A., Morel, V., Duverlie, G., McKeating, J., Keck, Z.-Y., Foung, S., Penin, F., Dubuisson, J., Voisset, C.
(2007). The Neutralizing Activity of Anti-Hepatitis C Virus Antibodies Is Modulated by Specific Glycans on the E2 Envelope Protein. J. Virol.
81: 8101-8111
[Abstract]
[Full Text]
-
Flint, M., von Hahn, T., Zhang, J., Farquhar, M., Jones, C. T., Balfe, P., Rice, C. M., McKeating, J. A.
(2006). Diverse CD81 Proteins Support Hepatitis C Virus Infection. J. Virol.
80: 11331-11342
[Abstract]
[Full Text]
-
Owsianka, A. M., Timms, J. M., Tarr, A. W., Brown, R. J. P., Hickling, T. P., Szwejk, A., Bienkowska-Szewczyk, K., Thomson, B. J., Patel, A. H., Ball, J. K.
(2006). Identification of conserved residues in the e2 envelope glycoprotein of the hepatitis C virus that are critical for CD81 binding.. J. Virol.
80: 8695-8704
[Abstract]
[Full Text]
-
Helle, F., Wychowski, C., Vu-Dac, N., Gustafson, K. R., Voisset, C., Dubuisson, J.
(2006). Cyanovirin-N Inhibits Hepatitis C Virus Entry by Binding to Envelope Protein Glycans. J. Biol. Chem.
281: 25177-25183
[Abstract]
[Full Text]
-
Drummer, H. E., Boo, I., Maerz, A. L., Poumbourios, P.
(2006). A conserved gly436-trp-leu-ala-gly-leu-phe-tyr motif in hepatitis C virus glycoprotein e2 is a determinant of CD81 binding and viral entry.. J. Virol.
80: 7844-7853
[Abstract]
[Full Text]
-
Cocquerel, L., Voisset, C., Dubuisson, J.
(2006). Hepatitis C virus entry: potential receptors and their biological functions.. J. Gen. Virol.
87: 1075-1084
[Abstract]
[Full Text]
-
Bertaux, C., Dragic, T.
(2006). Different domains of CD81 mediate distinct stages of hepatitis C virus pseudoparticle entry.. J. Virol.
80: 4940-4948
[Abstract]
[Full Text]
-
Tscherne, D. M., Jones, C. T., Evans, M. J., Lindenbach, B. D., McKeating, J. A., Rice, C. M.
(2006). Time- and Temperature-Dependent Activation of Hepatitis C Virus for Low-pH-Triggered Entry. J. Virol.
80: 1734-1741
[Abstract]
[Full Text]
-
Ziyyat, A., Rubinstein, E., Monier-Gavelle, F., Barraud, V., Kulski, O., Prenant, M., Boucheix, C., Bomsel, M., Wolf, J.-P.
(2006). CD9 controls the formation of clusters that contain tetraspanins and the integrin {alpha}6{beta}1, which are involved in human and mouse gamete fusion. J. Cell Sci.
119: 416-424
[Abstract]
[Full Text]
-
Martin, F., Roth, D. M., Jans, D. A., Pouton, C. W., Partridge, L. J., Monk, P. N., Moseley, G. W.
(2005). Tetraspanins in Viral Infections: a Fundamental Role in Viral Biology?. J. Virol.
79: 10839-10851
[Full Text]
-
Levy, S., Shoham, T.
(2005). Protein-Protein Interactions in the Tetraspanin Web. Physiology
20: 218-224
[Abstract]
[Full Text]
-
Barth, H., Ulsenheimer, A., Pape, G. R., Diepolder, H. M., Hoffmann, M., Neumann-Haefelin, C., Thimme, R., Henneke, P., Klein, R., Paranhos-Baccala, G., Depla, E., Liang, T. J., Blum, H. E., Baumert, T. F.
(2005). Uptake and presentation of hepatitis C virus-like particles by human dendritic cells. Blood
105: 3605-3614
[Abstract]
[Full Text]
-
Stein, K. K., Primakoff, P., Myles, D.
(2004). Sperm-egg fusion: events at the plasma membrane. J. Cell Sci.
117: 6269-6274
[Abstract]
[Full Text]
-
McKeating, J. A., Zhang, L. Q., Logvinoff, C., Flint, M., Zhang, J., Yu, J., Butera, D., Ho, D. D., Dustin, L. B., Rice, C. M., Balfe, P.
(2004). Diverse Hepatitis C Virus Glycoproteins Mediate Viral Infection in a CD81-Dependent Manner. J. Virol.
78: 8496-8505
[Abstract]
[Full Text]
-
Heo, T.-H., Chang, J.-H., Lee, J.-W., Foung, S. K. H., Dubuisson, J., Kang, C.-Y.
(2004). Incomplete Humoral Immunity against Hepatitis C Virus Is Linked with Distinct Recognition of Putative Multiple Receptors by E2 Envelope Glycoprotein. J. Immunol.
173: 446-455
[Abstract]
[Full Text]
-
Cormier, E. G., Tsamis, F., Kajumo, F., Durso, R. J., Gardner, J. P., Dragic, T.
(2004). CD81 is an entry coreceptor for hepatitis C virus. Proc. Natl. Acad. Sci. USA
101: 7270-7274
[Abstract]
[Full Text]
-
Clark, K. L., Oelke, A., Johnson, M. E., Eilert, K. D., Simpson, P. C., Todd, S. C.
(2004). CD81 Associates with 14-3-3 in a Redox-regulated Palmitoylation-dependent Manner. J. Biol. Chem.
279: 19401-19406
[Abstract]
[Full Text]
-
Kaji, K., Kudo, A.
(2004). The mechanism of sperm-oocyte fusion in mammals. Reproduction
127: 423-429
[Abstract]
[Full Text]
-
Zhang, J., Randall, G., Higginbottom, A., Monk, P., Rice, C. M., McKeating, J. A.
(2004). CD81 Is Required for Hepatitis C Virus Glycoprotein-Mediated Viral Infection. J. Virol.
78: 1448-1455
[Abstract]
[Full Text]
-
Cocquerel, L., Kuo, C.-C., Dubuisson, J., Levy, S.
(2003). CD81-Dependent Binding of Hepatitis C Virus E1E2 Heterodimers. J. Virol.
77: 10677-10683
[Abstract]
[Full Text]
-
Balasubramanian, A., Ganju, R. K., Groopman, J. E.
(2003). Hepatitis C Virus and HIV Envelope Proteins Collaboratively Mediate Interleukin-8 Secretion through Activation of p38 MAP Kinase and SHP2 in Hepatocytes. J. Biol. Chem.
278: 35755-35766
[Abstract]
[Full Text]
-
Hsu, M., Zhang, J., Flint, M., Logvinoff, C., Cheng-Mayer, C., Rice, C. M., McKeating, J. A.
(2003). Hepatitis C virus glycoproteins mediate pH-dependent cell entry of pseudotyped retroviral particles. Proc. Natl. Acad. Sci. USA
100: 7271-7276
[Abstract]
[Full Text]
-
Nozaki, A., Ikeda, M., Naganuma, A., Nakamura, T., Inudoh, M., Tanaka, K., Kato, N.
(2003). Identification of a Lactoferrin-derived Peptide Possessing Binding Activity to Hepatitis C Virus E2 Envelope Protein. J. Biol. Chem.
278: 10162-10173
[Abstract]
[Full Text]
-
Zhu, G.-Z., Miller, B. J., Boucheix, C., Rubinstein, E., Liu, C. C., Hynes, R. O., Myles, D. G., Primakoff, P.
(2003). Residues SFQ (173-175) in the large extracellular loop of CD9 are required for gamete fusion. Development
129: 1995-2002
[Abstract]
[Full Text]
-
Kien, F., Abraham, J.-D., Schuster, C., Kieny, M. P.
(2003). Analysis of the subcellular localization of hepatitis C virus E2 glycoprotein in live cells using EGFP fusion proteins. J. Gen. Virol.
84: 561-566
[Abstract]
[Full Text]
-
Roccasecca, R., Ansuini, H., Vitelli, A., Meola, A., Scarselli, E., Acali, S., Pezzanera, M., Ercole, B. B., McKeating, J., Yagnik, A., Lahm, A., Tramontano, A., Cortese, R., Nicosia, A.
(2003). Binding of the Hepatitis C Virus E2 Glycoprotein to CD81 Is Strain Specific and Is Modulated by a Complex Interplay between Hypervariable Regions 1 and 2. J. Virol.
77: 1856-1867
[Abstract]
[Full Text]
-
Cocquerel, L., Quinn, E. R., Flint, M., Hadlock, K. G., Foung, S. K. H., Levy, S.
(2002). Recognition of Native Hepatitis C Virus E1E2 Heterodimers by a Human Monoclonal Antibody. J. Virol.
77: 1604-1609
[Abstract]
[Full Text]
-
Cook, G. A., Longhurst, C. M., Grgurevich, S., Cholera, S., Crossno, J. T. Jr, Jennings, L. K.
(2002). Identification of CD9 extracellular domains important in regulation of CHO cell adhesion to fibronectin and fibronectin pericellular matrix assembly. Blood
100: 4502-4511
[Abstract]
[Full Text]
-
Drummer, H. E., Wilson, K. A., Poumbourios, P.
(2002). Identification of the Hepatitis C Virus E2 Glycoprotein Binding Site on the Large Extracellular Loop of CD81. J. Virol.
76: 11143-11147
[Abstract]
[Full Text]
-
Triyatni, M., Saunier, B., Maruvada, P., Davis, A. R., Ulianich, L., Heller, T., Patel, A., Kohn, L. D., Liang, T. J.
(2002). Interaction of Hepatitis C Virus-Like Particles and Cells: a Model System for Studying Viral Binding and Entry. J. Virol.
76: 9335-9344
[Abstract]
[Full Text]
-
Lambot, M., Fretier, S., De Beeck, A. O., Quatannens, B., Lestavel, S., Clavey, V., Dubuisson, J.
(2002). Reconstitution of Hepatitis C Virus Envelope Glycoproteins into Liposomes as a Surrogate Model to Study Virus Attachment. J. Biol. Chem.
277: 20625-20630
[Abstract]
[Full Text]
-
Wellnitz, S., Klumpp, B., Barth, H., Ito, S., Depla, E., Dubuisson, J., Blum, H. E., Baumert, T. F.
(2002). Binding of Hepatitis C Virus-Like Particles Derived from Infectious Clone H77C to Defined Human Cell Lines. J. Virol.
76: 1181-1193
[Abstract]
[Full Text]
-
Yeh, C.-T., Lai, H.-Y., Chen, T.-C., Chu, C.-M., Liaw, Y.-F.
(2001). Identification of a Hepatic Factor Capable of Supporting Hepatitis C Virus Replication in a Nonpermissive Cell Line. J. Virol.
75: 11017-11024
[Abstract]
[Full Text]
-
Clark, K. L., Zeng, Z., Langford, A. L., Bowen, S. M., Todd, S. C.
(2001). PGRL Is a Major CD81-Associated Protein on Lymphocytes and Distinguishes a New Family of Cell Surface Proteins. J. Immunol.
167: 5115-5121
[Abstract]
[Full Text]
-
Seigneuret, M., Delaguillaumie, A., Lagaudriere-Gesbert, C., Conjeaud, H.
(2001). Structure of the Tetraspanin Main Extracellular Domain. A PARTIALLY CONSERVED FOLD WITH A STRUCTURALLY VARIABLE DOMAIN INSERTION. J. Biol. Chem.
276: 40055-40064
[Abstract]
[Full Text]
-
Hamaia, S., Li, C., Allain, J.-P.
(2001). The dynamics of hepatitis C virus binding to platelets and 2 mononuclear cell lines. Blood
98: 2293-2300
[Abstract]
[Full Text]
-
Takahashi, Y., Bigler, D., Ito, Y., White, J. M.
(2001). Sequence-Specific Interaction between the Disintegrin Domain of Mouse ADAM 3 and Murine Eggs: Role of {beta}1 Integrin-associated Proteins CD9, CD81, and CD98. Mol. Biol. Cell
12: 809-820
[Abstract]
[Full Text]
-
Patel, A. H., Wood, J., Penin, F., Dubuisson, J., McKeating, J. A.
(2000). Construction and characterization of chimeric hepatitis C virus E2 glycoproteins: analysis of regions critical for glycoprotein aggregation and CD81 binding. J. Gen. Virol.
81: 2873-2883
[Abstract]
[Full Text]
-
Meola, A., Sbardellati, A., Bruni ercole, B., Cerretani, M., Pezzanera, M., Ceccacci, A., Vitelli, A., Levy, S., Nicosia, A., Traboni, C., McKeating, J., Scarselli, E.
(2000). Binding of Hepatitis C Virus E2 Glycoprotein to CD81 Does Not Correlate with Species Permissiveness to Infection. J. Virol.
74: 5933-5938
[Abstract]
[Full Text]
-
Hemler, M. E.
(2001). Specific tetraspanin functions. JCB
155: 1103-1108
[Abstract]
[Full Text]