JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nejmeddine, M.
Right arrow Articles by Cohen, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nejmeddine, M.
Right arrow Articles by Cohen, J.

 Previous Article  |  Next Article 

Journal of Virology, April 2000, p. 3313-3320, Vol. 74, No. 7
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Rotavirus Spike Protein VP4 Is Present at the Plasma Membrane and Is Associated with Microtubules in Infected Cells

M. Nejmeddine,1,2 G. Trugnan,2 C. Sapin,2 E. Kohli,3 L. Svensson,4 S. Lopez,5 and J. Cohen1,*

Laboratoire de Virologie et d'Immunologie Moléculaire, INRA, 78352 Jouy-en-Josas Cedex,1 INSERM U538, Faculté de Médecine Saint-Antoine, 75012 Paris,2 and Microbiologie Médicale et Moléculaire, Facultés de Médecine et Pharmacie, 21034 Dijon Cedex,3 France; Department of Virology, Swedish Institute for Infectious Disease Control, Karolinska Institute, 171 82 Solna, Sweden4; and Instituto de Biotecnologia, UNAM, Cuernavaca, Morelos 62271, Mexico5

Received 11 August 1999/Accepted 30 December 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

VP4 is an unglycosylated protein of the outer layer of the capsid of rotavirus. It forms spikes that project from the outer layer of mature virions, which is mainly constituted by glycoprotein VP7. VP4 has been implicated in several important functions, such as cell attachment, penetration, hemagglutination, neutralization, virulence, and host range. Previous studies indicated that VP4 is located in the space between the periphery of the viroplasm and the outside of the endoplasmic reticulum in rotavirus-infected cells. Confocal microscopy of infected MA104 monolayers, immunostained with specific monoclonal antibodies, revealed that a significant fraction of VP4 was present at the plasma membrane early after infection. Another fraction of VP4 is cytoplasmic and colocalizes with beta -tubulin. Flow cytometry analysis confirmed that at the early stage of viral infection, VP4 was present on the plasma membrane and that its N-terminal region, the VP8* subunit, was accessible to antibodies. Biotin labeling of the infected cell surface monolayer with a cell-impermeable reagent allowed the identification of the noncleaved form of VP4 that was associated with the glycoprotein VP7. The localization of VP4 was not modified in cells transfected with a plasmid allowing the expression of a fusion protein consisting of VP4 and the green fluorescent protein. The present data suggest that VP4 reaches the plasma membrane through the microtubule network and that other viral proteins are dispensable for its targeting and transport.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Rotaviruses are the most important etiologic agents of severe dehydrating infantile gastroenteritis in developed and developing countries (17). They are responsible for more than 850,000 deaths per year (14). As a member of the Reoviridae family, rotavirus has a segmented double-stranded RNA genome, enclosed in a viral capsid constituted of three concentric protein layers (37). Electron microscopy studies show that viral morphogenesis begins in cytoplasmic inclusions, termed viroplasms, where the central core and single-shelled particles are assembled (3, 10). VP4 is an unglycosylated protein and forms spikes that project from the outer layer of mature virions, which is mainly constituted by the glycoprotein VP7 (1, 34). VP4 has been implicated in several important functions, such as cell attachment, penetration, hemagglutination, neutralization, virulence, and host range (5, 12, 18, 23). It has been shown that the infectivity of rotaviruses is increased and is probably dependent on trypsin treatment of the virus (11). This proteolytic treatment results in the specific cleavage of VP4 to polypeptides VP8* and VP5*, which represent, respectively, the amino- and carboxyl-terminal regions of the protein (22). VP4 possesses a conserved hydrophobic region located between amino acids 384 and 401 that shares some homology with the internal fusion sites of Semliki Forest virus and Sindbis virus E1 spike proteins (25). Recently, it has been shown that VP5*, which includes this hydrophobic domain, is a specific membrane-permeabilizing protein and could play a role in the cellular entry of rotaviruses (7). The site of viral protein synthesis in epithelial infected cells has been examined by ultrastructural immunochemistry with monoclonal antibodies (MAbs) and by studying intracellular distribution of proteins by immunofluorescence (IF) or cellular fractionation (16, 28-30, 32, 35). These studies, with rotavirus strain SA11, indicated that VP4 is located in the space between the periphery of the viroplasm and the outside of the endoplasmic reticulum (ER).

In order to better understand the role of VP4 in the life cycle of rotavirus, we have studied its cellular localization at the early stages of infection. The distribution of VP4 was examined in MA104 cells infected with a bovine rotavirus strain (RF) by confocal microscopy, flow cytometry, and labeling of cell surface proteins. We have shown that very early after infection, the VP4 protein can be detected on the cell plasma membrane in association with VP7 and that the subunit VP8* was accessible on the cell surface. Pathways of proteins to the cell membrane involve passage through successive steps of the exocytic machinery. After biosynthesis in the rough ER, proteins enter the Golgi apparatus and then reach the cell surface through the trans-Golgi network using vesicular carriers. Each of these steps is controlled by components of the cytoskeleton, especially microtubules that are involved in the ER-to-Golgi and Golgi-to-surface trafficking steps. In some instances, however, it has been demonstrated that part of the exocytic route could be shunted as, for example, in the case of rotavirus particles that reached the cell surface directly from the rough ER, bypassing the Golgi apparatus (15). We observed here that the early surface expression of VP4 was concomitant with the colocalization of a cytoplasmic fraction of VP4 with beta -tubulin and microtubules.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell culture and viral infection. Fetal rhesus monkey kidney cell lines (MA104) were grown to confluent monolayers in Eagle's minimal essential medium (MEM) (Life Technologies, Cergy-Pontoise, France) supplemented with 10% fetal calf serum and antibiotics. For IF experiments, cells were grown for 2 days on glass slides to approximately 80% confluence. MA104 monolayers were washed and inoculated with strain RF of bovine rotavirus at a multiplicity of infection (MOI) of 1 PFU per cell for microscopy experiments or 10 PFU per cell for flow cytometry or biotin-labeling experiments. Integrity of the cell membrane was evaluated either by trypan blue staining or by measuring the release of intracytoplasmic lactic dehydrogenase (CytoTox 96; Promega, Charbonnières, France).

Cell treatment with cycloheximide and nocodazole. After viral adsorption for 1 h at room temperature, cell monolayers were washed three times with serum-free MEM. Then, cells were treated either with 10 µg of nocodazole per ml or 20 µg of cycloheximide per ml and incubated for the desired time postinfection (p.i.) at 37°C. Drugs were purchased from Sigma, St. Quentin Fallavier, France.

Antibodies. For flow cytometry and IF experiments, we used a panel of murine MAbs directed against viral proteins. They include MAbs 5.73, 7.7, and 6.3 directed against VP8*. These three MAbs recognize different epitopes, and only MAb 7.7 is neutralizing. MAbs 2G4 and 1D8 directed, respectively, against VP5* and VP8* (4) were kindly provided by H. Greenberg (Stanford, Calif.). MAbs RV138 and RV133 are directed against viral inner capsid protein VP6 (33). We used also MAb M60, directed against viral outer capsid protein VP7 (38); MAb 164E22, directed against VP2 (36) and polyclonal antibody 8148F, directed against rotavirus structural proteins VP2, VP6, VP7, and VP4, obtained after the immunization of a rabbit with cesium chloride gradient-purified bovine rotavirus. Anti-CD13 (amino peptidase-neutral) antibodies were kindly provided by O. Noren (The Panum Institute, Copenhagen, Denmark), and anti-beta -tubulin (CY 3-conjugated) MAbs were obtained from Sigma.

Indirect IF staining for confocal microscopy. Infected cells were fixed at 6 h p.i. with 2% paraformaldehyde (PFA) for 30 min at room temperature. In some experiments, the fixation was done under cold conditions, resulting in a severe alteration in the network of microtubules. For intracellular IF staining, cells were permeabilized with 1% Triton X-100 in phosphate-buffered saline (PBS) for 10 min at room temperature. Cells were incubated with 5 of 10 µg of the desired MAbs per ml for 1 h at 37°C and then with 1 µg of Alexa-488 conjugated goat anti-mouse immunoglobulin G (IgG) heavy plus light chains (H+L) (Molecular Probes, Eugene, Oreg.) for 30 min at 37°C. Cells were then incubated with 1 mg of RNase A per ml for 10 min, and nucleic acids were stained with 2 µg of propidium iodide per ml for 5 min. Cells were washed three times between each step with PBS containing 50 mM NH4Cl. In some experiments, the cell surface was labeled with tetramethyl rhodamine isocyanate-conjugated wheat germ agglutinin (WGA). After the last wash, cells were incubated for 10 min with 100 mg of 1,4-diazabicyclo[2.2.2]octane antifading reagent (Sigma) per ml and mounted with Glycergel (Dako Corp., Carpinteria, Calif.).

Confocal microscope analysis was carried out using the TCS NT confocal imaging system (Leica Instruments, Heidelberg, Germany), equipped with a 63× objective (plan apo, numerical aperture = 1.4). For fluorescein isothiocyanate (FITC) or Alexa-488, tetramethyl rhodamine isocyanate, and CY 3, an argon-krypton ion laser adjusted to 488, 554, or 550 nm, respectively, was used. The signal was treated with line averaging to integrate the signal collected over four lines in order to reduce noise. The pinhole was adjusted to allow a field depth of about 1 µm, corresponding to the increment between two adjacent sections.

Flow cytometry. At various times p.i., cells were dissociated with 0.5 mM EDTA in PBS and suspended into aliquots of approximately 106 cells in 0.5 ml of MEM containing 3% fetal calf serum. Purified anti-rotavirus MAbs (20 µg/ml) were incubated with cells for 40 min at room temperature. Then cells were washed in MEM and 1 µg of FITC-conjugated goat anti-mouse IgG (H+L) (BioSys, Compiègne, France) was added to the cells and incubated for 20 min at room temperature. Before analysis of membrane fluorescence, cells were fixed with 2% PFA.

Immunoprecipitation of viral proteins. Cell lysate corresponding to 106 cells and prepared in 10 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), and 1% aprotinin (radioimmunoprecipitation assay [RIPA] buffer), was incubated with antibody overnight at 4°C. Then, 20 µl of protein A-Sepharose CL-4B beads (Pharmacia) was added to the mixture and incubated for 1 h at room temperature. Beads coupled to immune complexes were washed four times sequentially with RIPA; RIPA supplemented with 0.5 M NaCl; a 1:1 mixture of RIPA, 10 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA (TNE); and TNE. Finally, immune complexes were suspended in 40 µl of sample buffer containing 1% SDS and 200 mM dithiothreitol and then boiled for 5 min. Proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE) using the morpholinepropanesulfonic acid (MOPS)-Tris Novex system (Prolabo, Fontenay sous bois, France). This latter system allows the separation of VP2 and VP4 that are not resolved for bovine strain RF in the Laemmli system.

Isolation of biotinylated surface proteins from infected cells. Cell surface biotinylation was performed as described by Le Bivic et al. (20). Briefly, 6 h after infection at an MOI of 10, cell monolayers were washed three times with ice-cold PBS and incubated with 0.5 mg of sulfosuccinimidyl-6-(biotinamido)hexanoate (Pierce, Asnière, France) in biotinylation buffer (10 mM triethanolamine [pH 9], 150 mM NaCl, 0.1 mM CaCl2, 1 mM MgCl2) for 20 min on ice. Cells were then washed three times with ice-cold PBS, and free biotin was blocked with 50 mM NH4Cl in PBS for 10 min. Cells were lysed in situ with RIPA buffer for 10 min on ice. Lysates, corresponding to 106 cells, were incubated with 20 µl of streptavidin-agarose (Pierce) for 1 h at room temperature in order to isolate the biotinylated proteins. Streptavidin-agarose beads were then washed four times as described in the above paragraph and analyzed by SDS-PAGE. In some experiments, the proteins exposed on the surface of infected cells were removed by digestion with trypsin (200 µg/ml) treatment for 15 min at 37°C prior to biotinylation. Purified triple-layer particles (TLPs) (8 µg in PBS) were biotinylated with sulfo-NHS-LC-biotin (0.2 mg/ml) for 2 h on ice and used as a marker.

Construction of VP4-GFP and transfection of COS-7 cells. The VP4 full-length cDNA was obtained by reverse transcription-PCR from rotavirus (bovine strain RF) genomic RNA using primers corresponding to the 5' ends of both RNA strands plus the sequence of a BamHI site (5' GGGATCCGGCTATAAAATGGCTTCACTC 3' and 5' CCTAGGCCAGTGTAGGAGACAGTCATG 3') and then cloned in pBluescript plasmid at its BamHI site (pBSRF4). The BamHI fragment of pBSRF4 was subcloned in pcDNA3 under the control of the cytomegalovirus promoter (pcDNA3-VP4). To put gene 4 upstream of EGFP in pEGFP-N1, the stop codon of gene 4 in pcDNA3-VP4 was replaced by the PinAI site by site-directed mutagenesis (QuikChange; Stratagene). The modified VP4 cDNA was excised with SacII/PinAI and subcloned in phase into the pEGFP-N1 plasmid between the SacII and PinAI unique restriction sites, and the complete sequence of VP4 was sequenced to check for any modification introduced during PCR. COS-7 cells were grown for 2 days on a glass slide at 37°C and 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% FBS. Cells were then transfected with FuGeneTM6 reagent (Boehringer Mannheim) according to the manufacturer's instructions. Cells were fixed 48 h later and analyzed by confocal microscopy. Typically, 20 to 40% of cells expressed VP4 or VP4-GFP.

Immunoblot analysis. Separated proteins were electrotransferred to a polyvinylidene difluoride (PVDF) membrane (Immobilon; Millipore) at a constant voltage of 50 V in transfer buffer (10 mM cyclohexylaminosulfonic acid [CAPS] [pH 11], 10% methanol) at room temperature for 40 min. Dried blots were incubated for 1 h at room temperature with a primary antibody diluted at 1/1,000 in blocking buffer (1% bovine serum albumin, 0.05% Tween 20 in PBS), then washed twice with PBS, and incubated for 30 min at room temperature with alkaline phosphatase-labeled anti-mouse or anti-rabbit IgG (H+L) (BioSys). Staining was performed with a standard alkaline phosphatase substrate, 5-bromo-4-chloro-3-indoylphosphate (BCIP)-nitroblue tetrazolium (Life Technologies).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Detection of rotavirus VP4 at the surface of infected MA104 cells. Nonpermeabilized infected MA104 monolayers, stained with an anti-VP4 MAb (5.73 or 7.7) and observed by nonconfocal IF microscopy, revealed that VP4 was exposed at the cell surface. Extensive comparisons of parallel-stained, nonpermeabilized monolayers or monolayers after permeabilization with the same MAb and the same conjugate indicated that most or all of the infected cells presented VP4 at their plasma membranes. These comparisons also allowed us to very roughly estimate that the plasma membrane fluorescence represented more than 20% of the total signal. Subsequently, the cells were analyzed by confocal microscopy. Figure 1A shows a gallery of images corresponding to 1-µm optical sections of an infected cell. Propidium iodide was used to label the nucleus. In the top sections, the surface fluorescence of VP4 was clearly visible with no nucleus label. Subsequent sections displayed a progressive apparition of the nucleus. Analysis by YZ section of nonpermeabilized infected cells stained with both WGA, a cell surface marker lectin, and anti-VP4 showed a perfect colocalization between VP4 and the cell surface (Fig. 1B). This figure depicts cells fixed at 6 h p.i., but similar observations were made from 3 to 10 h p.i. Later, cytopathic effect was too important to allow a precise localization of viral antigen. In similar experiments using cross-reacting anti-VP7 and anti-VP5* MAbs, M60 and 2G4 respectively, there was no cell surface labeling in nonpermeabilized cells, even though a bright fluorescence could be seen within the permeabilized cells (results not shown). Qualitatively, these observations demonstrated that a fraction of VP4 was localized on the surface of MA104-infected cells at the early stage of rotavirus replication. They also demonstrated that the fluorescent signal detected at the plasma membrane did not result from the presence of viral particles, since particles presenting VP7 and VP5* are known to bind to MAbs M60 and 2G4.


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 1.   Immunostaining of VP4 at the plasma membrane of infected and nonpermeabilized cell. The cell monolayer was subjected to IF as described in Materials and Methods with specific anti-VP4 MAbs. The nucleus was stained with propidium iodide. Monolayers were analyzed by confocal microscopy with optical sectioning in 1-µm increments from the cell attachment to glass to the top. (A) Gallery of images corresponding to sequential sections in 1-µm increments from bottom to top. (B) Z sectioning showing localization of VP4 (green; bottom) and the plasma membrane that was stained with WGA and conjugated with rhodamine (red; middle); colocalization appears in yellow (top). Bar = 20 µm.

Detection of VP4 at the surface of transfected COS-7 cells. To evaluate the role of rotaviral proteins on the localization of VP4, we transfected COS-7 cells with the VP4-green fluorescent protein (GFP) fusion protein. Cells were fixed at 48 h posttransfection, and fluorescence was analyzed by confocal microscopy. As shown in Fig. 2, a bright signal was detected at the plasma membrane either in projection of all the optical sections or in individual optical sections (Fig. 2A and B). In contrast, GFP did not specifically localize to the cell membrane and was present throughout the cytoplasm and the nucleus in COS-7 cells transfected with a plasmid directing the expression of nonfused GFP (Fig. 2C). VP4-GFP was also recognized by several anti-VP4 MAbs (data not shown). Apparently, the fusion of GFP to the carboxy-terminal parts of VP4 does not interfere with the incorporation of the chimeric proteins to the plasma membrane in these cells.


View larger version (49K):
[in this window]
[in a new window]
 
FIG. 2.   Localization of VP4 expressed in COS-7 cells. COS-7 cells were transfected with pEGFP-N1 (C) or pEGFP-N1-VP4 (A and B) and fixed at 48 h posttransfection, and the fluorescence was analyzed by confocal microscopy. Projection of all optical sections (A and C) and three optical sections located at the top, middle, and bottom of the transfected cell (B) are shown. Bar = 20 µm.

Flow cytometry analysis of infected cells. In order to have a more quantitative approach of the presence of VP4 at the surface of infected cells, flow cytometry was used with a panel of MAbs directed against VP4. At 6 h p.i., the cell monolayer was gently dissociated by EDTA in PBS, and live cells were immunostained, then fixed, and analyzed. We determined by trypan blue staining and by detection of intracytoplasmic lactic dehydrogenase released in the medium that less than 1% of cells were dead just before fixation. As shown in Fig. 3, most of the infected cells presented a significant increase in surface fluorescence after staining with either anti-CD13 antibodies or an anti-VP4 MAb. Several MAbs (5.73, 1D8, 7.7, and 6.3) directed against VP8* were able to bind to infected cell surfaces, whereas the only anti-VP5* MAb available (2G4) did not (Fig. 3A, B, and C). To exclude the possibility that the signal detected on the rotavirus-infected cell surface was due to plasma membrane expression of a cellular protein induced by virus infection and recognized by anti-VP4 MAbs, we checked that the specific MAb 5.73, which only recognize the bovine strain RF, did not bind to the plasma membrane of rotavirus strain OSU-infected cells (Fig. 3D). Under the same experimental conditions, a MAb (RV133) directed against VP6 that binds to TLPs and double-layer particles and a cross-reacting MAb (M60) directed against outer capsid protein VP7 did not bind to the surfaces of rotavirus-infected cells (Fig. 3B and C and data not shown). These results showed that viral spike protein (VP4) was exposed to the surface of the cell membrane at 6 h p.i. and also that subunit VP8* was more accessible than subunit VP5*. The absence of signal with anti-VP5*, anti-VP7, and anti-VP6 MAbs that react with TLPs demonstrated that the plasma membrane immunostaining was due exclusively to the detection of VP4 and not to the release of virions. As shown in Fig. 4 (upper panel), from 0 to 1 h p.i., cell surface detection of VP4 and VP6 was not significantly different from cell autofluorescence. From 3 h p.i., the intensity of fluorescence due to cell surface detection of VP4 was significantly higher than cell autofluorescence and than the signal that was due to VP6 (Fig. 4, lower panel). This kinetics showed that only VP4, and not VP6, was detected on the plasma membrane at 3 h p.i., indicating that the molecules of VP4 present at the plasma membrane were neosynthesized and not of parental virus origin. This conclusion was confirmed by analyzing cells treated with cycloheximide just after infection. With such cells, there was no immunofluorescence signal at the cell membrane with an anti-VP4 MAb (data not shown).


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 3.   Cell surface detection of VP4. Flow cytometry was carried out as described in Materials and Methods. (A) MA104 mock-infected cells, stained with three MAbs, RV133, 5.73, and anti-CD13, directed against VP6, VP4, and CD13, respectively. (B) Infected cells stained with anti-VP6 MAb RV133 and anti-VP4 MAb 5.73 at 6 h p.i. (C) Infected cells stained with anti-VP4 MAbs (2G4, 5.73, 1D8, 7.7, and 6.3) and an anti-VP6 MAb (RV138). (D) Cells infected with porcine rotavirus strain OSU or with bovine rotavirus strain RF and stained with MAb 5.73 against bovine VP4. Peak C in panels A to C corresponds to noninfected cell autofluorescence.


View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4.   Kinetics of VP4 at the surface of infected MA104 cells between 0 and 6 h p.i. Each panel shows the result at a single time p.i. and with two MAbs. Cells were stained with anti-VP6 MAb RV138, which binds to TLPs, and with MAb 5.73 directed against spike viral protein VP4. Peak C in all panels corresponds to noninfected cell autofluorescence.

VP4 present at the plasma membrane is not cleaved and is associated with VP7. To establish whether VP4 was present on the infected cell membrane as a cleaved or a noncleaved form, we performed cell membrane labeling with sulfo-NHS-LC-biotin. This compound does not enter the cell membrane but adds biotin molecules to lysine residues accessible on cell surface proteins. At 6 h p.i., intact monolayers of infected MA104 cells were biotinylated. Cells were lysed, and the biotinylated proteins were precipitated with streptavidin-agarose, separated by SDS-PAGE, and characterized by Western blotting with a rotavirus antiserum and MAbs against VP4 and VP2. This assay allowed the detection of VP4 and of VP7 with the rotavirus antiserum (Fig. 5A). The absence of VP6 or VP2 (Fig. 5A) confirmed that the cells were intact during biotinylation and that labeling of VP4 and VP7 was not due to the entry of sulfo-NHS-LC-boitin in the cytoplasm of infected cells. As expected, VP4 was also recognized by MAb 5.73 (Fig. 5B). Detected bands did not correspond to mature virions that could have been biotinylated in the medium or at the cell surface, since the same Western blot assay performed with MAb 164E22 did not reveal VP2 (Fig. 5C). These results confirmed that VP4 was present at the plasma membranes of infected cells and demonstrated that the VP4 molecules detected by IF or by flow cytometry are not cleaved. Kinetic analysis showed that VP4 and VP7, or a complex of both, were biotinylated on the cell membrane as early as 3 h p.i., which is consistent with flow cytometry experiments (Fig. 4 and data not shown).


View larger version (44K):
[in this window]
[in a new window]
 
FIG. 5.   Identification of virus proteins associated with the cell membrane. Plasma cell membranes of MA104 cells infected with the RF strain of rotavirus (MOI = 10) were biotinylated at 6 h p.i. Then, cells were lysed as described in Materials and Methods, and biotinylated proteins were precipitated by streptavidin-agarose beads. Complexes from biotinylated infected cells (Inf*.) or mock infected biotinylated cells (M.Inf*.) or nonbiotinylated infected cells (inf.) were eluted by boiling in denaturing buffer sample and separated by SDS-PAGE (10% acrylamide; MOPS-Tris Novex system). Controls run on the same gel consisted of purified TLPs, and a total-cell lysate from infected cells (Total). Identical gels were blotted on a PVDF membrane and immunostained with polyclonal antibody 8148F directed against structural viral proteins (A), with MAb 5.73 directed against spike viral protein VP4 (B), or with MAb 164E22 directed against VP2 (C). Blots were revealed with anti-rabbit or anti-mouse alkaline phosphatase conjugate, respectively.

Experiments illustrated in Fig. 5 allowed the detection of a viral protein(s) that was either biotinylated at the cell surface or was making RIPA-resistant complexes with a biotinylated protein. To determine if VP7 is accessible to the biotinylation reagent on the cell surface, a symmetrical experiment was performed, changing the order of selection and selective staining of the biotinylated viral protein. Virus proteins were in a first-step immunoprecipitation from total-cell lysate of infected and biotinylated monolayers at 6 h p.i. by MAb 164E22 (anti-VP2), 5.73 (anti-VP4), M60 (anti-VP7) or a rotavirus antiserum (8148F). In a second step, the immunoprecipitated proteins separated by SDS-PAGE were blotted, and the biotinylated viral proteins were detected by a streptavidin-conjugated alkaline phosphatase. As shown in Fig. 6, of the viral proteins immunoprecipitated by polyclonal antibodies or MAbs, only VP4 was coupled to biotin, and VP7 was not. When cells were treated with trypsin before biotinylation, bands corresponding to VP4 and VP7 were not detected. These results, together with those illustrated in Fig. 5, demonstrated that uncleaved VP4 is at the surface of infected cells. They also suggest that VP7 is not exposed on the surface of the infected cells but associated with a protein that is accessible to biotinylation at the plasma membrane, possibly with VP4. Alternatively, it could be hypothesized that VP7 is at the plasma membrane but in a conformation that does not allow biotinylation.


View larger version (40K):
[in this window]
[in a new window]
 
FIG. 6.   Accessibility of viral proteins at the cell membrane. Cell monolayers were infected with rotavirus strain RF at an MOI of 10 (Inf.) or mock infected (M.Inf.). At 6 h p.i., an aliquot of infected cells was treated for 15 min with 200 µg of trypsin per ml (Inf.+Trypsin) at room temperature, and another aliquot was not treated (Inf.). Then, surface proteins were biotinylated, and aliquots of cell lysate corresponding to 106 cells were incubated overnight with specific antibodies. Complexes were immunoprecipitated by protein A-Sepharose and boiled in denaturing sample buffer for 5 min. Proteins were separated by SDS-PAGE (10% acrylamide; Bis-Tris Novex system) and blotted on a PVDF membrane, and virus proteins coupled to biotin were revealed by a streptavidin-alkaline phosphatase reaction. Immunoprecipitation by anti-VP2 164E22 (lane 1), anti-VP4 5.73 (lane 2), anti-RF 8148 (lane 3), and anti-VP7 M60 (lane 4). Lanes M and TLP correspond to molecular weight markers and biotinylated TLP, respectively.

Association of intracellular VP4 with the cytoskeleton. In order to study the localization of the fraction of VP4 that is cytoplasmic, we have used confocal microscopy and indirect IF staining techniques with specific MAbs 5.73 and 7.7 directed against VP4. A representative field of permeabilized cells fixed at 6 h p.i. demonstrated the intracellular localization of viral proteins (Fig. 7). Staining with anti-VP6 MAb RV138 used as a control showed that VP6 was localized in viroplasmic inclusions randomly distributed in cytoplasm (Fig. 7A). By contrast, when infected and permeabilized cells were stained with anti-VP4 MAb 7.7 or 5.73 (Fig. 7B and D), a homogeneous intracytoplasmic distribution was seen as a regular tubular staining. This distribution suggests that VP4 is associated with cellular structures similar to the cytoskeleton. The shape and organization of the stained structures evoke the microtubule network, but some fibrillar staining is also reminiscent of dynamic microtubules or stress fibers of actin. However, these filaments did not contain actin, since they are not stained with FITC-conjugated phalloidine (data not shown). Cell treatment with nocodazole, known to depolymerize microtubules, disturbs the cytoplasmic distribution of VP4 (Fig. 8). Further evidence for VP4 association with microtubules was provided by double labeling of infected cells with anti-VP4 MAb 7.7 (green) and anti-beta -tubulin coupled to CY 3 (red). As seen in Fig. 7D to F, the two proteins were colocalized all over the cytoplasm of infected cells. It can be noted that in some cells there are, along the fibrils, small annular spots stained with both antibodies that are reminiscent of small vesicles.


View larger version (59K):
[in this window]
[in a new window]
 
FIG. 7.   Laser confocal microscopy of MA104 cells infected with bovine rotavirus or COS-7 cells expressing VP4-GFP chimera. MA104 cells were grown on slides, infected at an MOI of 1, fixed 6 h later with 2% PFA, and finally permeabilized with 1% Triton X-100. Cytoplasmic viral antigens were immunostained with MAb RV138, specific to VP6 (A) and MAb 7.7, specific to VP4 (B, D, and F), followed by an anti-mouse IgG conjugated to Alexa-488 (green). Microtubules were stained with an anti-beta -tubulin MAb conjugated to CY 3 (red) (E to F). In panel F, both stains are superimposed, and colocalization appears in yellow. COS-7 cells fixed 48 h posttransfection with a plasmid directing the expression of the chimeric VP4-GFP protein were directly observed by confocal microscopy with the same excitation and emission wavelength used above for Alexia-488 (C). Bar = 20 µm.


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 8.   Effect of nocodazole on the localization of VP4. Cells were grown on slides, infected at an MOI of 1, not treated (A) or treated with 10 µg of nocodazole per ml (B), fixed 6 h later with 2% PFA, and finally permeabilized with 1% Triton X-100. Cells immunostained with anti-VP4 MAb 7.7 as described above were observed by confocal microscopy. Bar = 20 µm.

The pattern of cytoplasmic fluorescence of the fusion protein VP4-GFP showed that the chimeric proteins in COS-7 cells form tubular structures similar to those observed with VP4 in rotavirus-infected MA104 cells (Fig. 7C). However, the recombinant VP4 did not form the punctuated staining observed in the cytoplasm of rotavirus-infected MA104 cells. As described above, there was a perfect colocalization in infected cells between VP4-GFP and beta -tubulin in transfected COS-7 cells when beta -tubulin was stained with monoclonal anti-beta -tubulin coupled to CY 3 (results not shown).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In contrast with several rotavirus proteins, the localization of VP4 in infected cells has been poorly characterized. Processing of VP4 in the host cell and the mechanism by which it is assembled into infectious viral particles remains unclear. It is generally admitted that VP4 is located in the space between the periphery of the viroplasm where double-layer particles are assembled and the endoplasmic reticulum where the maturation of the virions by acquisition of the outer capsid takes place (10, 31). In this work, we studied the localization of VP4 in rotavirus-infected cells during the first steps of the viral life cycle. We clearly demonstrated that a major fraction of VP4 was cytoplasmic and colocalized with microtubules and that another significant fraction was at the plasma membrane of infected epithelial MA104 cells. A series of evidence, including flow cytometry analysis, confocal microscopy, and cell surface labeling, showed that the fraction of VP4 detected at the plasma membrane was neither of parental origin nor associated with the release of mature viral particles. Spike proteins found in the membrane were neosynthesized, since MAbs against VP4 did not bind to the cell surface either before 3 h p.i. or to cycloheximide-treated infected cells. Confocal microscopy analysis of nonpermeabilized cells showed a perfect colocalization between VP4 and the plasma membrane that was not due to the VP4 of neoformed viral particles budding at the cell surface or released in the medium and readsorbed at the cell surface. If that was the case, the MAb (2G4) that reacts with the tips of the VP4 spikes on viral particles (34) would have labeled the plasma membrane. Similarly, a colocalization of VP7 with the plasma membrane would have been detected if neoformed viral particles were at the cell surface, which was not the case with the cross-reactive anti-VP7 MAb M60. The presence of VP4-GFP chimera at the cell surface in transfected COS cells was consistent with observations of infected cells and indicated that (i) the targeting of VP4 to the plasma membrane is not strictly dependent of the presence of other viral protein, and (ii) the transport of VP4 to the membrane results in the interaction of VP4 with cellular protein(s).

Spike glycoproteins of enveloped viruses (e.g., E1 and E2 proteins of alphaviruses) are detected early at the plasma membrane of infected cells. To our knowledge, localization of spike proteins at the plasma membrane of nonenveloped virus-infected cells has not been reported to date. Most proteins that are exported to the cell surface possess signal sequences and are secreted via the Golgi apparatus. By contrast, a small group of proteins which, like rotavirus VP4, lack signal sequences has been reported to be transported by unknown Golgi-independent mechanisms, including VP22, a structural protein of HSV-1 (9). VP22 movement inside the cell involves the actin cytoskeleton and is sensitive to cytochalasin D treatment. Microtubule motors and microtubule-associated proteins were involved in transporting membrane proteins to the cell surface in MDCK cells (19). VP4 has not been shown to be glycosylated (10), and its colocalization with beta -tubulin strongly suggests that it is transported to the cell surface through the microtubule network.

In-situ labeling of infected MA104 cell membrane with biotin, followed by Western blot analysis, showed the noncleaved form of VP4 on the plasma membrane associated with the glycoprotein VP7. VP4 was biotinylated but VP7 was not, suggesting that VP7 was not accessible to biotin being either hidden by VP4 or in a conformation specific to its nonassembled state that hides sulfo-NHS-LC-biotin-reactive residues or localized at the cytoplasmic face of the plasma membrane. This latter hypothesis is consistent with the absence of immunostaining of nonpermeabilized cell membrane with anti-VP7 MAb and with the reported existence of hetero-oligomers of VP4, VP7, and NSP4 in the infected cell cytoplasm (24).

Analysis of VP4 distribution in cytoplasm by confocal microscopy proved that VP4 in infected cells colocalized with beta -tubulin. Similarly, VP4 was expressed in transfected, noninfected COS cells as a fusion protein with GFP colocalized with beta -tubulin. However, it seems that infection modified the microtubule network to tubular structures presenting some similarity in their organization with dynamic microtubules. These findings were obtained after gentle fixation of infected cells at room temperature to keep the cytoskeleton intact, since low temperature is known to depolymerize tubulin and disturb the microtubules. Previously, it was known from the work of Dales et al. (6) that reovirus could associate with microtubules in vivo, but the role of individual capsid protein implicated in this association is still not completely clarified (26). In vitro reovirus type 1 particles exhibit a high level of specific affinity for purified microtubules that correlated with the presence of type 1 cell attachment protein sigma 1 (2). Bluetongue virus particles are also associated with the cytoskeleton and possibly with intermediate filaments (8). In neurons, rotavirus not only binds to but also causes reorganization of microtubule-associated protein 2 (41). In epithelial cells (CV1), it causes selective vimentin reorganization (40). In this work, we have shown that in epithelial cells (MA104), rotavirus particles did not bind to microtubules; if such were the case, we would have seen a distribution of other capsid proteins (e.g., VP6) along the microtubules.

A number of enveloped virus glycoproteins are transported to the cell surface by microtubules, as described for the constitutive apical transport of the viral glycoproteins, type I protein F and type II protein HN of Sendai virus (39). In contrast, much less is known about in vivo interaction of microtubules with spike proteins or cell attachment proteins of nonenveloped virus. To our knowledge, none of these proteins, including reovirus sigma 1 or bluetongue VP2, has been identified at the plasma membrane. Microtubules have been implicated in many processes transporting nonglycosylated proteins to the plasma membrane of epithelial cells and to the apical pole of polarized cells (27). It can be hypothesized that VP4 is transported to the plasma membrane by microtubules, sometimes bypassing the Golgi apparatus and in association with vesicular structures corresponding to the fluorescent ring-shaped spots observed in rotavirus-infected cells after immunostaining with anti-VP4 or with anti-beta -tubulin antibodies (Fig. 7D to F).

VP4 proteins play a key role in rotavirus biology, particularly in virus entry (7, 13, 21). VP4 forms spikes that project from mature viral particles. In this study, VP4 was detected on the plasma membrane of MA104 cells. This localization could be an early step in virus release, because rotavirus is released from the apical pole of CaCo-2 polarized cells, and transport of viral particles bypass the classical secretory pathway (15). The results we have presented here disclosed new properties of VP4 during the virus life cycle: its association with microtubules and its accessibility to the cell surface. They suggest new functions for VP4 and address several questions, including which microtubule protein interacts with VP4 and which domain of VP4 is responsible for targeting the plasma membrane. These problems are currently being explored.


    ACKNOWLEDGMENTS

This work was supported in part by European Union grant INCO-DC (IC18-CT96-0027) and by the program PRFMMI of the Ministère de l'Education Nationale de la Recherche et de la Technologie.

We thank Annie Charpilienne for skillful technical assistance and P. Fontanges for help in confocal microscopy.


    FOOTNOTES

* Corresponding author. Mailing address: Laboratoire de Virologie et d'Immunologie Moléculaire, INRA, 78352 Jouy-en-Josas Cedex, France. Phone: 33(0)1 3465 2604. Fax: 33(0)1 3465 2621. E-mail: cohen{at}biotec.jouy.inra.fr.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Anthony, I. D., S. Bullivant, S. Dayal, A. R. Bellamy, and J. A. Berriman. 1991. Rotavirus spike structure and polypeptide composition. J. Virol. 65:4334-4340[Abstract/Free Full Text].
2. Babiss, L. E., R. B. Luftig, J. A. Weatherbee, U. R. Weihing, and B. N. Fields. 1979. Reovirus serotypes 1 and 3 differ in their in vitro association with microtubules. J. Virol. 30:863-874[Abstract/Free Full Text].
3. Bellamy, A. R., and G. W. Both. 1990. Molecular biology of rotaviruses. Adv. Virus Res. 38:1-34[Medline].
4. Burns, J. W., H. B. Greenberg, R. D. Shaw, and M. K. Estes. 1988. Functional and topographical analyses of epitopes on the hemagglutinin (VP4) of the simian rotavirus SA11. J. Virol. 62:2164-2172[Abstract/Free Full Text].
5. Crawford, S. E., M. Labbé, J. Cohen, M. H. Burroughs, Y.-J. Zhou, and M. K. Estes. 1994. Characterization of virus-like particles produced by the expression of rotavirus capsid proteins in insect cells. J. Virol. 68:5945-5952[Abstract/Free Full Text].
6. Dales, S., P. Gomatos, and K. Hsu. 1965. The uptake and development of reovirus in strain L cells followed with labeled viral ribonucleic acid and ferritin-antibody conjugates. Virology 25:193-211[CrossRef][Medline].
7. Denisova, E., W. Dowling, R. LaMonica, R. Shaw, S. Scarlata, F. Ruggeri, and E. R. Mackow. 1999. Rotavirus capsid protein VP5* permeabilizes membranes. J. Virol. 73:3147-3153[Abstract/Free Full Text].
8. Eaton, B. T., A. D. Hyatt, and J. R. White. 1987. Association of bluetongue virus with the cytoskeleton. Virology 157:107-116[CrossRef][Medline].
9. Elliott, G., and P. O'Hare. 1997. Intercellular trafficking and protein delivery by a herpesvirus structural protein. Cell 88:223-233[CrossRef][Medline].
10. Estes, M. K. 1989. Rotavirus replication, p. 1329-1352. In B. N. Fields, and D. H. Knipe (ed.), Virology. Raven Press, New York, N.Y.
11. Estes, M. K., D. Y. Graham, and B. B. Mason. 1981. Proteolytic enhancement of rotavirus infectivity: molecular mechanisms. J. Virol. 39:879-888[Abstract/Free Full Text].
12. Fiore, L., H. B. Greenberg, and E. R. Mackow. 1991. The VP8 fragment of VP4 is the rhesus rotavirus hemagglutinin. Virology 181:553-563[CrossRef][Medline].
13. Gilbert, J. M., and H. B. Greenberg. 1998. Cleavage of rhesus rotavirus VP4 after arginine 247 is essential for rotavirus-like particle-induced fusion from without. J. Virol. 72:5323-5327[Abstract/Free Full Text].
14. Glass, R. I., J. Gentsch, and J. C. Smith. 1994. Rotavirus vaccines: success by reassortment? Science 265:1389-1391[Free Full Text].
15. Jourdan, N., M. Maurice, D. Delautier, A. M. Quero, A. L. Servin, and G. Trugnan. 1997. Rotavirus is released from the apical surface of cultured human intestinal cells through nonconventional vesicular transport that bypasses the Golgi apparatus. J. Virol. 71:8268-8278[Abstract].
16. Kabcenell, A. K., M. S. Poruchynsky, A. R. Bellamy, H. B. Greenberg, and P. H. Atkinson. 1988. Two forms of VP7 are involved in assembly of SA11 rotavirus in endoplasmic reticulum. J. Virol. 62:2929-2941[Abstract/Free Full Text].
17. Kapikian, A. Z. 1996. Overview of viral gastroenteritis. Arch. Virol. 12(Suppl.):7-19.
18. Kirkwood, C. D., R. F. Bishop, and B. S. Coulson. 1998. Attachment and growth of human rotaviruses RV-3 and s12/85 in CaCo-2 cells depend on VP4. J. Virol. 72:9348-9352[Abstract/Free Full Text].
19. Lafont, F., J. K. Burkhardt, and K. Simons. 1994. Involvement of microtubule motors in basolateral and apical transport in kidney cells. Nature 372:801-803[Medline].
20. Le Bivic, A., F. X. Real, and E. Rodriguez-Boulan. 1989. Vectorial targeting of apical and basolateral plasma membrane proteins in a human adenocarcinoma epithelial cell line. Proc. Natl. Acad. Sci. USA 86:9313-9317[Abstract/Free Full Text].
21. Lizano, M., S. López, and C. F. Arias. 1991. The amino-terminal half of rotavirus SA114fM VP4 protein contains a hemagglutination domain and primes for neutralizing antibodies to the virus. J. Virol. 65:1383-1391[Abstract/Free Full Text].
22. Lopez, S., C. F. Arias, J. R. Bell, J. H. Strauss, and R. T. Espejo. 1985. Primary structure of the cleavage site associated with trypsin enhancement of rotavirus SA11 infectivity. Virology 144:11-19[CrossRef][Medline].
23. Ludert, J. E., N. G. Feng, J. H. Yu, R. L. Broome, Y. Hoshino, and H. B. Greenberg. 1996. Genetic mapping indicates that VP4 is the rotavirus cell attachment protein in vitro and in vivo. J. Virol. 70:487-493[Abstract].
24. Maass, D. R., and P. H. Atkinson. 1990. Rotavirus proteins VP7, NS28, and VP4 form oligomeric structures. J. Virol. 64:2632-2641[Abstract/Free Full Text].
25. Mackow, E. R., R. D. Shaw, S. M. Matsui, P. T. Vo, M. N. Dang, and H. B. Greenberg. 1988. The rhesus rotavirus gene encoding protein VP3: location of amino acids involved in homologous and heterologous rotavirus neutralization and identification of a putative fusion region. Proc. Natl. Acad. Sci. USA 85:645-649[Abstract/Free Full Text].
26. Mora, M., K. Partin, M. Bhatia, J. Partin, and C. Carter. 1987. Association of reovirus proteins with the structural matrix of infected cells. Virology 159:265-277[CrossRef][Medline].
27. Parczyk, K., W. Haase, and C. Kondor-Koch. 1989. Microtubules are involved in the secretion of proteins at the apical cell surface of the polarized epithelial cell, Madin-Darby canine kidney. J. Biol. Chem. 264:16837-16846[Abstract/Free Full Text].
28. Petrie, B. L., D. Y. Graham, H. Hanssen, and M. K. Estes. 1982. Localization of rotavirus antigens in infected cells by ultrastructural immunocytochemistry. J. Gen. Virol. 63:457-467[Abstract/Free Full Text].
29. Petrie, B. L., H. B. Greenberg, D. Y. Graham, and M. K. Estes. 1984. Ultrastructural localization of rotavirus antigens using colloidal gold. Virus Res. 1:133-152[CrossRef][Medline].
30. Poncet, D., P. Lindenbaum, R. Lharidon, and J. Cohen. 1997. In vivo and in vitro phosphorylation of rotavirus NSP5 correlates with its localization in viroplasms. J. Virol. 71:34-41[Abstract].
31. Poruchynsky, M. S., and P. H. Atkinson. 1991. Rotavirus protein rearrangements in purified membrane-enveloped intermediate particles. J. Virol. 65:4720-4727[Abstract/Free Full Text].
32. Poruchynsky, M. S., C. Tyndall, G. W. Both, F. Sato, A. R. Bellamy, and P. H. Atkinson. 1985. Deletions into an NH2-terminal hydrophobic domain result in secretion of rotavirus VP7, a resident endoplasmic reticulum membrane glycoprotein. J. Cell. Biol. 101:2199-2209[Abstract/Free Full Text].
33. Pothier, P., E. Kohli, E. Drouet, and S. Ghim. 1987. Analysis of the antigenic sites on the major inner capsid protein (VP6) of rotaviruses using monoclonal antibodies. Ann. Inst. Pasteur Virol. 138:285-295.
34. Prasad, B. V., J. W. Burns, E. Marietta, M. K. Estes, and W. Chiu. 1990. Localization of VP4 neutralization sites in rotavirus by three-dimensional cryo-electron microscopy. Nature 343:476-479[CrossRef][Medline].
35. Richardson, S. C., L. E. Mercer, S. Sonza, and I. H. Holmes. 1986. Intracellular localization of rotaviral proteins. Arch. Virol. 88:251-264[CrossRef][Medline].
36. Roseto, A., R. Scherrer, J. Cohen, M. C. Guillemin, A. Charpilienne, C. Feynerol, and J. Peries. 1983. Isolation and characterization of anti-rotavirus immunoglobulins secreted by cloned hybridoma cell lines. J. Gen. Virol. 64:237-240[Abstract/Free Full Text].
37. Shaw, A. L., R. Rothnagel, C. Q. Y. Zeng, J. A. Lawton, R. F. Ramig, M. K. Estes, and B. V. V. Prasad. 1996. Rotavirus structure: interactions between the structural proteins. Arch. Virol. Suppl. 12(Suppl.):21-27[Medline].
38. Shaw, R. D., P. T. Vo, P. A. Offit, B. S. Coulson, and H. B. Greenberg. 1986. Antigenic mapping of the surface proteins of rhesus rotavirus. Virology 155:434-451[CrossRef][Medline].
39. Tashiro, M., J. T. Seto, H. D. Klenk, and R. Rott. 1993. Possible involvement of microtubule disruption in bipolar budding of a Sendai virus mutant, F1-R, in epithelial MDCK cells. J. Virol. 67:5902-5910[Abstract/Free Full Text].
40. Weclewicz, K., K. Kristensson, and L. Svensson. 1994. Rotavirus causes selective vimentin reorganization in monkey kidney CV-1 cells. J. Gen. Virol. 75:3267-3271[Abstract/Free Full Text].
41. Weclewicz, K., L. Svensson, M. Billger, K. Holmberg, M. Wallin, and K. Kristensson. 1993. Microtubule-associated protein 2 appears in axons of cultured dorsal root ganglia and spinal cord neurons after rotavirus infection. J. Neurosci. Res. 36:173-182[CrossRef][Medline].


Journal of Virology, April 2000, p. 3313-3320, Vol. 74, No. 7
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nejmeddine, M.
Right arrow Articles by Cohen, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nejmeddine, M.
Right arrow Articles by Cohen, J.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Mol. Cell. Biol. Microbiol. Mol. Biol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS