Previous Article | Next Article 
Journal of Virology, April 2000, p. 3093-3104, Vol. 74, No. 7
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Protein Kinase Activity Associated with
Epstein-Barr Virus BGLF4 Phosphorylates the Viral Early Antigen EA-D
In Vitro
Mei-Ru
Chen,1,*
Shin-Jye
Chang,1
Hsiaowen
Huang,1 and
Jen-Yang
Chen1,2
Graduate Institute of Microbiology, College
of Medicine, National Taiwan University,1 and
Extramural Research Affairs Department, National Health
Research Institute,2 Taipei, Taiwan
Received 8 October 1999/Accepted 3 January 2000
 |
ABSTRACT |
The Epstein-Barr virus (EBV) open reading frame BGLF4 was
identified as a potential Ser/Thr protein kinase gene through the recognition of amino acid sequence motifs characteristic of conserved regions within the catalytic domains of protein kinases. In order to
investigate this potential kinase activity, BGLF4 was expressed in
Escherichia coli and the purified protein was used to
generate a specific antiserum. Recombinant vaccinia virus vTF7-3, which expresses the T7 RNA polymerase, was used to infect 293 and 293T cells
after transient transfection with a plasmid containing BGLF4 under the
control of the T7 promoter. Autophosphorylation of the BGLF4 protein
was demonstrated using the specific antiserum in an immune complex
kinase assay. In addition, EBNA-1-tagged BGLF4 and EBNA-1 monoclonal
antibody 5C11 were used to demonstrate the specificity of the kinase
activity and to locate BGLF4 in the cytoplasm of transfected cells.
Manganese ions were found to be essential for autophosphorylation of
BGLF4, and magnesium can stimulate the activity. BGLF4 can utilize GTP,
in addition to ATP, as a phosphate donor in this assay. BGLF4 can
phosphorylate histone and casein in vitro. Among the potential viral
protein substrates we examined, the EBV early antigen (EA-D, BMRF1), a DNA polymerase accessory factor and an important transactivator during
lytic infection, was found to be phosphorylated by BGLF4 in vitro.
Amino acids 1 to 26 of BGLF4, but not the predicted conserved catalytic
domain, were found to be essential for autophosphorylation of BGLF4.
 |
INTRODUCTION |
Protein kinases are known to be
involved in the regulation of a wide variety of eukaryotic cellular
functions including cell metabolism, cell cycle control, hormone
response, and control of transcription and translation. Studying viral
protein kinases might therefore lead to an understanding of the
mechanisms of virus replication and virus-cell interactions. Most of
the protein kinases of the retroviruses are Tyr protein kinases, such
as v-src and v-erb, which may contribute to the growth transformation
phenotype of the virally infected host cells (for a review, see
reference 32). The first protein kinase gene
demonstrated in a eukaryotic DNA virus was that contained in the unique
short (US) regions of the related human and porcine alphaherpesviruses,
herpes simplex virus type 1 (HSV-1), and pseudorabies virus
(20). Other protein kinases have been reported in DNA
viruses, including protein kinase B1 of the poxviruses (45,
46) and ORF9 of baculovirus (42).
Phosphorylation of cellular and viral proteins, which has been observed
during lytic infection of cells by herpesviruses, seems to be a common
phenomenon which involves a number of different protein kinase
activities (21). Two groups of viral protein kinase
activities, US3 and UL13, have been identified in alphaherpesviruses. The US3 gene of HSV-1 (37) and the VZV66 gene of
varicella-zoster virus (VZV) (19) were predicted to encode
protein kinases on the basis of their strong similarity to the family
of eukaryotic serine/threonine protein kinases. Mutation of US3 seemed
not to affect the replication of HSV-1 in vitro (44).
However, UL13 is responsible for the posttranslational processing
associated with phosphorylation of alpha-22 of HSV-1. In addition, it
was demonstrated that eukaryotic elongation factor 1
is
hyperphosphorylated by the protein kinase encoded by the UL13 gene
(27). This modification is believed to contribute to the
shutoff of host cell functions during HSV-1 infection. In beta- and
gammaherpesviruses, there is only one open reading frame that seems
likely to encode a protein kinase. UL13 homologues identified by
sequence homology searches include UL97 of cytomegalovirus (CMV), BGLF4
of Epstein-Barr virus (EBV) (5), 15R of human herpesvirus 6 (HHV-6) (31), and ORF36 of HHV-8 (47). This
family of proteins is evolutionarily more distant from the cellular
protein kinases than are the alphaherpesvirus US protein kinases. The
homologue encoded by CMV, UL97, has been shown to phosphorylate
ganciclovir (34). This finding illustrated the
mechanism through which human CMV (HCMV) is sensitive to this nucleoside analogue despite lacking a thymidine kinase. It was found
also that the resistance of certain strains of HCMV to ganciclovir was
attributable to a mutation in UL97 (52). Recently, ORF36, the UL13 homologue of HHV-8, also was shown to phosphorylate
ganciclovir in transfected cells (4). The functions of UL97
and ORF36 during virus infection have not been determined in these
studies. However, a recent report indicated that a recombinant HSV, in
which UL13 has been deleted and replaced by HCMV UL97, can restore the
activity of modifying cellular elongation factor 1
following virus
infection (26).
Based on these observations, we hypothesize that the high degree of
conservation, through the evolution of the herpesviruses, of these
predicted kinases can be attributed to their importance for the
replication of these viruses in their natural hosts and may contribute
to their pathogenesis. The BGLF4 gene was identified as a Ser/Thr
protein kinase-related gene using amino acid sequence alignment of
regions conserved within the catalytic domains of protein kinases
(5), and the BGLF4 kinase is the only potential protein
kinase identified in the EBV genome. BGLF4 gene-containing RNA
transcripts were detected by Northern blot analysis (9) and
seemed to be expressed early in lytic EBV infection. Because a protein
kinase activity has not yet been demonstrated for the BGLF4 protein, we
expressed the protein in prokaryotic and eukaryotic systems to evaluate
its potential kinase activity.
BGLF4 was detected by immunofluorescence in the cytoplasm of
transfected cells using an EBNA-1 tag system for immunoprecipitation and was shown to autophosphorylate. Since many EBV proteins, such as the lytic protein Zta (BZFL1) and early antigen, diffuse type (EA-D, BMRF1), are reported to be phosphorylated in infected cells (15, 28), we also examined the ability of BGLF4 to
phosphorylate other EBV proteins expressed in Escherichia
coli. Specific phosphorylation of EA-D was observed in vitro. EA-D
is a DNA polymerase accessory factor (33) and is also an
important transactivator during lytic infection (55). We
suggest that BGLF4 may be important for regulating EBV replication
through the phosphorylation of EA-D.
 |
MATERIALS AND METHODS |
Plasmid construction.
The BGLF4 open reading frame is
located between nucleotides 123614 and 122328 of the EBV genome (a
BamHI site is located at 122313). Therefore, a T7 promoter
primer (5'-TAATACGACTCACTATAGGG) and LMRC16
(GATCGGATCCATGGATGTGAATATG; containing the BGLF4
initiation codon) were used in PCR to amplify the BGLF4 sequence from
pGEM3Z-EBVBamHI G. For expression in E. coli, the
PCR product was then digested with BamHI and cloned into the
vector pRSETA (Invitrogen), which encodes an N-terminally His-tagged
protein under the control of the T7 promoter. Nucleotide sequences of
this clone were confirmed, and it was designated pSJC1. The same
BamHI DNA fragment was then cloned into pSG5 (Stratagene) to
generate pSJC2 for expression of BGLF4 in mammalian cells.
The vector pGH254 was used for expression of BGLF4 using recombinant
vaccinia virus. This is a derivative of pBD7 (18) and contains a T7 promoter sequence and a black beetle virus leader sequence to enhance protein expression levels. The BamHI DNA
fragment containing BGLF4 was subcloned into the BglII site
of pGH254, and then a PCR product, encoding amino acids 408 to 446 of
EBNA-1, was cloned upstream of BGLF4 as a tag for detection and
immunoprecipitation with monoclonal antibody 5C11 (8). This
construct was designated pSJC12(E1/BGLF4). In order to examine BGLF4
protein expression in transfected cells, a similar tag strategy was
used to clone the E1/BGLF4 DNA fragment into pSG5. The resultant clone,
pCF4, expresses BGLF4 under the control of the simian virus 40 (SV40) promoter.
Generation of BGLF4 mutants.
All the primers used for
generating point mutations or deletions within BGLF4 are summarized in
Table 1. The oligonucleotide LMRC16,
which anneals to the BGLF4 initiation codon, and T7 primer, which
anneals to the vector, served as outer primers for PCR mutagenesis. Recombinant PCRs with these outer primers and a pair of overlapping inner primers were used to generate pSJC13(K102M) containing a change
of codon 102 from a lysine to a methionine codon. The oligonucleotide LMRC36 (encoding a protein with a mismatch at amino acid 102) and BGLF4
5' primer LMRC16 were used to generate a DNA fragment encoding the N
terminus of BGLF4 using pGEM-BamHI G as the template and Pfu
polymerase (Stratagene). LMRC 37 and the T7 primer were used to amplify
the 3' DNA fragment of BGLF4 whose product has a mutation at amino acid
102. The two PCR products were then purified, denatured, annealed, and
again amplified with the outer primers. A similar strategy was used to
generate pSJC14(H193A, G195A), pSJC15(D129A,G221A), and pSJC16(D297A),
using LMRC39 and LMRC40, LMRC41 and LMRC42, and LMRC43 and LMRC44,
respectively, as internal primers.
A second set of small internal deletions of BGLF4 also was generated by
recombinant PCR using different sets of internal primers
containing
PstI restriction enzyme sites to loop out the desired
codons. pHH5(VF

35-65) was generated using LMRC73 and LMRC74,
pHH1(LQ

85-107) was generated using LMRC67 and LMRC68, and
pHH7(LQ

367-403)
was generated using LMRC76 and LMRC77.
Double-deletion mutant
pHH6(VF

35-65,LQ

85-107) was generated using
LMRC16 and LMRC68
to amplify the BGLF4 fragment which contained
VF

35-65 from pHH5
and using LMRC67 and the T7 promoter primer to
obtain the DNA
fragment LQ

85-107. These two fragments were then
purified and
used to generate pHH6(VF

35-65,LQ

85-107).
Three N-terminal truncation mutants of BGLF4 were generated using
pGEM3Z-EBV G as the template and 5' primers containing
BamHI
or
BglII sites which annealed to
different codons of BGLF4 and
T7 primer, which annealed to the vector
as 3' primers. The 5'
primer LMRC75 (GS27) annealed to codon 27 with
additional nucleotide
sequences encoding Gly and Ser for cloning.
Another two 5' primers
used were LMRC72 (for GS70) and LMRC26 (for
RS201). Individual
DNA fragments were cloned into pDL118A to obtain
pHH8(GS27-429),
pHH4(GS70-429), and pHH2(RS201-429).
Expression and purification of recombinant BGLF4.
pRSETA-BGLF4(pSJC1) was transformed into BL21(DE3), which encodes
T7 RNA polymerase under the control of the Tac promoter. The bacteria
were cultured in ampicillin-Luria broth (100 mg/ml) until the optical
density at 600 nm reached 0.6, and
isopropyl-
-D-thiogalactopyranoside (IPTG) was added to a
final concentration of 0.1 mM. The cells were then cultured for another
3 h, pelleted by centrifugation, resuspended in lysis buffer (100 µg of lysozyme/ml, 5 mM imidazole, 100 mM NaCl, 8 M urea, 20 mM
Tris-Cl, pH 7.4), and incubated on ice for 1 h. The cell lysate
was sonicated, and the insoluble fraction was clarified by
centrifugation before being loaded onto a nickel column. After the
binding, the column was washed with 100 mM imidazole buffer (100 mM
NaCl, 8 M urea, 20 mM Tris-Cl, pH 7.4) and eluted with 300 mM imidazole
buffer (100 mM NaCl, 8 M urea, 20 mM Tris-Cl, pH 7.4). Total lysate and
purified proteins were displayed on sodium dodecyl sulfate-10%
polyacrylamide gel electrophoresis (SDS-10% PAGE) gel, for analysis.
Antiserum and antibodies.
Purified BGLF4 was used to
immunize New Zealand White rabbits to generate anti-BGLF4 specific
antisera. The monoclonal antibody 5C11 specifically recognizes an
epitope between amino acids 408 and 446 of EBNA-1 (8).
Monoclonal antibodies antiphosphoserine (PSR-45, P3430) and
antiphosphothreonine (pTR-8, P-3555) were from Sigma, and
antiphosphotyrosine (4G10) was from Upstate Biotechnology.
In vitro coupled transcription and translation.
This
reaction was carried out essentially according to the protocol
suggested by the manufacturer (Promega). One microgram of template DNA
was mixed with 25 µl of TNT rabbit reticulocyte lysate, 2 µl of
reaction buffer, 1 µl of T7 RNA polymerase, 1 µl of amino acid
mixture, and 4 µl of [35S]methionine (10 mCi/ml) to
make a final volume of 50 µl. The reaction mixture was incubated at
30°C for 1.5 h.
Transfection and vaccinia virus infection.
Human 293 cells
were grown in Dulbecco's modified Eagle minimal essential medium
supplemented with 10% fetal calf serum. For transfection, 293 cells
were plated in 100-mm-diameter dishes at 1.5 × 106
cells per well the day before transfection and 10 µg of each DNA was
transfected using the calcium phosphate-BES
[N',N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid-buffered saline] procedure (6). Recombinant vaccinia
virus vTF7-3 (ATCC UR-2153), which encodes the T7 RNA polymerase, was used to infect the cells 24 h posttransfection. After being rinsed with phosphate-buffered saline (PBS), vTF7-3 viruses (multiplicity of
infection = 10) were resuspended in 1 ml of PBS-10 mM MgCl 2-0.01% bovine serum albumin and added to the transfected
cells and the mixture was incubated for 15 min. Then 2 ml of complete medium was added, and the mixture was incubated for another 30 min,
followed by a PBS rinse. The cells were incubated in complete medium at
37°C for 16 to 18 h and harvested by trypsinization. In later
experiments, we found that the 293T cell line, a derivative of 293 cells, anchors on slides more efficiently than 293 cells. Therefore,
293T cells were used in the transfection experiment to determine the
cellular location of the BGLF4 protein.
Immunoprecipitation.
The transfected cells were rinsed twice
with methionine-free medium at 4 to 6 h before trypsin treatment
and incubated in 3 ml of methionine-free RPMI 1640 containing
[35S]methionine (100 µCi/ml) and 10% dialyzed fetal
calf serum. The cells were then washed in PBS and lysed in 0.4 ml of
radio immunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl [pH
7.5], 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 50 µg of aprotinin/ml, 50 µg of leupeptin/ml, 1 mM
phenylmethylsulfonyl fluoride) on ice for 1 min and vortexed for
30 s. This was repeated three times. The lysate was spun at 14,000 rpm in a microcentrifuge to remove the debris and precleaned by
incubation with 50 µl of 20% protein A-Sepharose beads at 4°C for
30 min. Two hundred microliters of lysate was then incubated with 5 µl of BGLF4-specific antiserum or EBNA-1 monoclonal antibody 5C11 at
4°C for 1.5 h; then 50 µl of 20% protein A-Sepharose beads
was added, and the mixture was incubated at 4°C for another 1.5 h. The protein A beads were then spun and washed twice with 1 ml of
high-salt buffer (1 M NaCl, 10 mM Tris-HCl [pH 8.0], 0.2% NP-40),
once with 1 ml of low-salt buffer (0.1 M NaCl, 10 mM Tris-HCl [pH
8.0], 0.2% NP-40), and six times with RIPA buffer at 4°C. The
immunocomplex was then boiled in 20 µl of SDS sample buffer for 3 min
and displayed on an SDS-10% PAGE gel. After electrophoresis, the gel
was dried for autoradiography. For immune complex kinase assays, 293 cells were transfected and infected with recombinant vTF7-3, as
described previously, without the radiolabel.
Western immunoblotting.
For Western immunoblot analysis,
cells were lysed 40 h after transfection in 2× sample buffer (50 mM Tris, 4% SDS, 20% glycerol, 0.04% bromophenol blue, 200 mM
dithiothreitol) and sonicated briefly. Lysates were displayed on 10 or
12% polyacrylamide gels. After being blocked in Tris-buffered saline
(TBS)-5% nonfat dry milk-0.1% Tween 20 for 1 h, the filter was
incubated with 1:500-diluted rabbit anti-BGLF4 serum or EBNA-1
monoclonal antibody 5C11, diluted 1:50 in TBS-0.1% Tween 20 at room
temperature for 1 h. The filter was washed three times with
TBS-0.1% Tween 20 for 15 min each time and then incubated in a
1:5,000 dilution of horseradish peroxidase-conjugated secondary
antibody. The filter was washed three times and developed with an ECL
kit (Amersham Life Science) and then exposed to Kodak X-ray film.
Immune complex kinase assay.
Lysates containing 30 µg of
total protein were used for each immunoprecipitation. Protein
A-Sepharose beads containing immunoprecipitated protein kinase were
washed with high-salt, low-salt, RIPA, and kinase buffers (once each)
and resuspended in 50 µl of kinase buffer containing 5 µCi of
[
-32P]ATP. After incubation at 30°C for 30 min, the
immunocomplexes were washed with RIPA buffer and then resuspended in
2× SDS sample buffer and boiled for 5 min before SDS-PAGE analysis. To
optimize the conditions for kinase activity, conditions for various
protein kinases, such as VZV ORF47 (25 mM HEPES [pH 7.4], 10 mM
MnCl2, 50 mM KCl) (40), HSV UL13 (50 mM Tris
[pH 8.0], 50 mM MgCl2, 0.5 M NaCl, 0.1% NP-40, 1 mM
dithiothreitol) (14), and pp60c-src (50 mM HEPES
[pH 7.2], 1 mM MgCl2, 1 mM MnCl2, 150 mM
NaCl, 0.5% NP-40) (3), were tested first. The optimal
buffer conditions determined for the BGLF4 autophosphorylation activity
were 50 mM HEPES (pH 7.4)-10 mM MgCl2-10 mM
MnCl2-300 mM KCl-0.5% NP-40. Casein kinase II (CK II;
Promega) was included as a positive control in the heparin inhibition assay.
In the transphosphorylation assay, the partially purified BGLF4
immunocomplexes were washed with BGLF4 kinase buffer, without
NP-40,
twice and incubated with 1 µg of substrate in the presence
of 5 µCi
of [

-
32P]ATP in a volume of 70 µl at 30°C for 30 min. After incubation,
60 µl of supernatant was precipitated by
adding 20 µl of 24% trichloroacetic
acid (TCA) and 2 µl of 12 mM
sodium deoxycholate, incubated on
ice for 20 min, and centrifuged at
4°C for 10 min. The protein
pellet was rinsed with 95% ethanol,
dried, and resuspended in
2× SDS sample buffer for electrophoresis and
autoradiography.
Substrates used included histone (Sigma; H-7755, type
II-As; from
calf thymus), casein (Sigma; C-4765; from bovine milk), EBV
proteins
Zta and Rta (pRSETA-Rta; amino acids 8 to 357), DNase
(
54),
glutathione
S-transferase-EBNA-1 (amino
acids 408 to 641) (
7),
major DNA binding protein and diffuse
type early antigen EA-D
(
11).
IFA.
Forty-eight hours after transfection, cells were fixed
for immunofluorescence assay (IFA) staining with 50% acetone and 50% methanol for 20 min at
20°C. EBNA-1 monoclonal antibody 5C11 or
1:100-diluted rabbit anti-BGLF4 serum was added to the smears, and they
were incubated in a moist chamber at 37°C for 1 h. The smears
were then washed in PBS for 5, 10, and 15 min. Fluorescein isothiocyanate-conjugated goat anti-mouse serum was diluted 1:100 and
placed on the smears, and the smears were incubated at 37°C for
1 h. After incubation, the smears were washed as described above,
mounted in a 90% phosphate-buffered glycerol solution, and examined
under a UV microscope.
 |
RESULTS |
Expression of BGLF4 in E. coli and generation
of a specific antiserum.
According to the EBV genome sequence
deposited in GenBank (m80517.gb_vi), the BGLF4 open reading frame is
located between nucleotides 123692 and 122328. However, examination of
the sequence did not reveal an in-frame ATG within several hundred base
pairs upstream of this region. Therefore, a PCR product containing the first in-frame ATG (nucleotide 123,614) to nucleotide 122328 was first
cloned into pRSETA for expression in E. coli. The
recombinant clone was then transformed into BL21(DE3), and expression
was induced with IPTG. The recombinant protein (His-BGLF4) was visible on a Coomassie blue-stained SDS-PAGE gel. The additional band, which
appeared following IPTG induction, migrated at the predicted size of 52 kDa (Fig. 1A, lane 2), since the cloning
vector contains a 3.85-kDa polyhistidine coding sequence, which
facilitates the purification of recombinant protein. However, the
majority of the fusion protein appeared in insoluble form in the
E. coli cell lysate (Fig. 1B, lane 4). Therefore, the
bacterial pellet was solubilized in buffer containing 8 M urea and
purified through a nickel column. The protein was eluted with buffer
containing 300 mM imidazole (Fig. 1C, lane 4) and used to immunize a
rabbit to generate a polyclonal antiserum. The reactivities and
specificities of the polyclonal antibodies were examined by immunoblot
analysis as shown in Fig. 1D. The rabbit anti-BGLF4 antiserum
specifically recognized the 52-kDa protein in the E. coli
cell lysate (Fig. 1D, lane 1), and no signal was observed in the lysate
from the vector control (Fig. 1D, lane 2).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of His-BGLF4 in E. coli BL21(DE3)
and generation of BGLF4-specific antiserum. (A) Total cell lysate from
bacteria carrying vector control (pRSETA) or pSJC1 (His-BGLF4). Lysate
is shown uninduced (lanes 1 and 3) and after induction with IPTG (lanes
2 and 4) and was displayed on a 10% PAGE gel and stained with
Coomassie blue. The predicted molecular mass of BGLF4 is approximately
52 kDa, as indicated by the arrowhead. (B) After lysis with buffer
(lane 2; total lysate), the cell lysate was fractionated into soluble
proteins (lane 3) and pellet. Most of the BGLF4 product appeared in
insoluble form in E. coli (lane 4). V, vector control. (C)
The recombinant BGLF4 protein was dissolved in 8 M urea-5 mM
imidazole-100 mM NaCl and purified using a nickel column. After being
washed with binding buffer (lane 2) and 100 mM imidazole buffer (lane
3), the BGLF4 protein was eluted with buffer containing 300 mM
imidazole (lane 4). F, flowthrough. (D) Western immunoblotting
demonstrates the specificity of rabbit anti-BGLF4 antiserum. Total cell
lysates of E. coli carrying pSJC1 (lane 1) or pRSETA (lane
2) and purified BGLF4 (lane 3) were displayed on an SDS-10% PAGE gel,
transferred onto a membrane, and probed with rabbit anti-BGLF4
antiserum as described in Materials and Methods. M, molecular weight
markers.
|
|
Expression of BGLF4 in a eukaryotic system and autophosphorylation
of BGLF4.
The purified, bacterially expressed protein was
transferred onto a membrane and renatured for an in situ kinase assay
(22), but the result was negative (data not shown). It is
possible that the renaturation conditions used were not appropriate to
restore enzyme activity or that some modification of the protein was
required for kinase activity. We wished to express the BGLF4 protein
under the control of the SV40 or CMV promoter following transient
transfection in order to examine the kinase activity. However, the
protein was barely detectable by immunoblotting using the anti-BGLF4
rabbit serum (data not shown). Since the construct
pSJC2(pSG5-BGLF4) contains a T7 promoter upstream of the BGLF4
gene, it was transcribed and translated in a reticulocyte lysate system
to check the gene product (Fig. 2D, lane
1). This product can be immunoprecipitated by the anti-BGLF4 specific
antiserum (data not shown). We suggest that our inability to detect
BGLF4 in transfected cells may be attributable to a low level of
expression. In order to obtain sufficient protein, the recombinant
vaccinia virus vTF7-3, which carries the T7 RNA polymerase gene, was
used to infect 293 cells following transfection of pSJC2. Cell lysates
harvested 16 h postinfection were found to contain a protein of
approximately 48 kDa in a Western blot assay using polyclonal
anti-BGLF4 serum (Fig. 2A, lane 1). The identity of some
higher-molecular-mass protein species in this blot was not clear, which
could be due to the cross-reaction to cellular proteins induced by the
expression of BGLF4. Anti-BGLF4 antiserum can immunoprecipitate this
product as shown in Fig. 2C, lane 1. Thus, the vTF-7 system may be used
as a source of partially purified BGLF4 protein for kinase assays.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of BGLF4 (pSJC2) and E1/BGLF4 (pSJC12) in 293 cells after transfection and infection with recombinant vaccinia virus
vTF7-3, which carries a copy of the T7 RNA polymerase. (A) After
transfection and infection, cell lysates of pSG5 (vector),
pSJC2(pSG5-BGLF4), and pSJC12(pSG5-E1/BGLF4) were harvested, displayed
on an SDS-10% PAGE gel, and reacted with BGLF4-specific antiserum in
an immunoblotting assay. The 48-kDa product of BGLF4 and the 52-kDa
product of E1/BGLF4 can be seen in lanes 1 and 3, respectively. (B) The
cell lysates expressing BGLF4 and E1/BGLF4 were immunoblotted with
EBNA-1 monoclonal antibody 5C11. Arrowhead, E1/BGLF4. (C) After
transfection of BGLF4 or E1/BGLF4 expression plasmids and infection
with vTF7-3, the cells were labeled with [35S]methionine
for 4 h before lysis. The cell lysates were immunoprecipitated
with preimmunized-rabbit sera, BGLF4-specific antisera, or the 5C11
monoclonal antibody. Arrowhead, E1/BGLF4. (D) Autophosphorylation of
BGLF4. Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4
were incubated in kinase buffer in the presence of
[ -32P]ATP. Autophosphorylation of BGLF4 may be seen in
lane 4. Lane 1, in vitro transcription/translation product as a
marker.
|
|
The immunoprecipitated BGLF4 obtained following vTF-7 infection was
tested for autophosphorylation activity. Various experimental
conditions used previously for other protein kinases, such as
UL13 of
HSV, VZV ORF47, and c-Src, were tested in the initial
kinase assays.
Autophosphorylation of BGLF4 can be detected using
all of these
conditions, but the strongest activity was observed
in the buffer for
VZV ORF47 (25 mM HEPES [pH 7.4], 10 mM MnCl
2,
50 mM KCl)
(
40) (data not
shown).
EBNA-1 tag system for expression and immune complex kinase
assay.
Since most protein kinases share conserved motifs, it is
possible that anti-BGLF4 antiserum could bring down cellular protein kinases in the immune complex kinase immunoprecipitation assay. An
EBNA-1 monoclonal antibody tag system was therefore used to enhance the
specificity of the immunoprecipitation reaction. 5C11 recognizes an
epitope between amino acids 408 and 446 of EBNA-1, a region which
contains no serine or threonine residues, and was shown to react with
this sequence in both immunoprecipitation and Western immunoblot assays
(8). Therefore, EBNA-1(408-446) and BGLF4 were expressed as
a fusion protein using a derivative of pGH254 which contains a T7 RNA
promoter and a black beetle virus leader sequence to enhance
translation (18). Expression plasmid pSJC12 was transfected
into 293 cells, followed by infection with vTF7-3. The expressed
recombinant protein, E1/BGLF4, can be detected in Western immunoblot
assays by anti-BGLF4 antiserum (Fig. 2A, lane 3) and by EBNA-1
monoclonal antibody 5C11 (Fig. 2B, lane 2). The E1/BGLF4 protein also
can be immunoprecipitated by these two antibodies (Fig. 2C). The amount
of protein expressed from pSJC12 was roughly 3- to 10-fold greater than
that expressed from pSJC2 (Fig. 2A, lanes 1 and 3). The
immunoprecipitated E1/BGLF4 also was shown to possess an
autophosphorylation activity similar to that of BGLF4 (Fig. 2D).
Optimal conditions for BGLF4 kinase activity and use of GTP as a
phosphate donor.
The E1/BGLF4 product and EBNA-1 monoclonal
antibody were used to further characterize the BGLF4 kinase activity
and distinguish it from cellular kinases in terms of optimal pH,
dependence on monovalent and divalent cations, and the effect of
detergent in the kinase buffer. We first examined the effect of pH in
50 mM HEPES buffer at a range between pH 6.2 and 8.3. The
autophosphorylation products displayed on SDS-PAGE gel were quantitated
with a phosphorimager (STORM 842; Captain Biolabtech Co.). Similar
counts were obtained in the range from pH 6.5 to 8.0, whereas the
activities were about 10% lower in the reactions at pH 6.2 or 8.3 (Fig. 3A). We then investigated the
requirement of BGLF4 kinase activity for divalent cations (Fig. 3B).
The buffer contained 50 mM HEPES (pH 7.4), 150 mM NaCl, and various
concentrations of MgCl2 or MnCl2, as indicated.
Manganese was found to be essential for BGLF4 activity (Fig. 3B, lane
6), and the activity can be stimulated further by magnesium ions (Fig.
3B, lane 5). The effect of monovalent cations also was examined; the
presence of 300 mM KCl or NaCl gave increased activities (Fig. 3C,
lanes 6 and 9). We also observed that the presence of 0.5% Triton
X-100 or NP-40 can further enhance the autophosphorylation of BGLF4
(Fig. 3D). The final buffer conditions we chose for BGLF4
autophosphorylation were 50 mM HEPES (pH 7.4), 10 mM MgCl2,
10 mM MnCl2, 300 mM KCl, and 0.5% NP-40.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Optimal conditions for BGLF4 autophosphorylation.
Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4 were
incubated in various kinase buffers in the presence of
[ -32P]ATP. (A) Effect of pH on BGLF4 kinase activity.
The buffer containing 1 mM MnCl2, 1 mM MgCl2,
150 mM NaCl, 0.5% NP-40, and 50 mM HEPES was adjusted to different pHs
as indicated. The autophosphorylation activities are similar in the
range of pH 6.5 to 8.0, whereas the activities are lower at pH 6.2 and
pH 8.3. (B) Effects of divalent cations on BGLF4 kinase activity. The
buffer containing 50 mM HEPES (pH 7.4), 150 mM NaCl, and various
amounts of MgCl2 and MnCl2, as indicated.
Manganese is essential for BGLF4 activity (lane 6), which can be
further stimulated by magnesium (lane 5). (C) Effects of monovalent
cations on BGLF4 kinase activity. The buffer contained 50 mM HEPES (pH
7.4), 10 mM MgCl2, and 10 mM MnCl2, as
indicated, and different concentrations of NaCl or KCl. The maximal
activity was observed in the presence of 300 mM KCl (lane 6). (D)
Effect of detergent on the BGLF4 kinase activity. In addition to 50 mM
HEPES (pH 7.4), 10 mM MgCl2, 10 mM MnCl2, and
300 mM KCl, 0.5% NP-40 appeared to stimulate BGLF4 kinase activity.
The in vitro transcription/translation product of BGLF4 (I) is shown as
a marker. The immunoprecipitation product of pDL118-transfected cell
lysate was also used in the kinase assay as a negative control (V) in
each panel.
|
|
One of the important characteristics of UL13 of HSV and VZV 47 is that
they can use both ATP and GTP as phosphate donors.
Therefore, we
tested [

-
32P]GTP instead of [

-
32P]ATP
in the immune complex kinase reaction; autophosphorylation
was observed
using the authentic BGLF4 protein (data not shown)
or EBNA-1 tag system
(Fig.
4, lane 3).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Utilization of GTP as phosphate donor for BGLF4
autophosphorylation. The immunoprecipitation product of E1/BGLF4, as
described for Fig. 3, was used for autophosphorylation in the kinase
buffer containing [ -32P]GTP instead of
[ -32P]ATP (lane 3). I,
[35S]methionine-labeled in vitro
transcription/translation product; V, vector (pPDL118) control.
|
|
Kinetics of BGLF4 autophosphorylation using high-salt buffer-washed
immunocomplexes.
In addition to UL13 and US3, the large subunit of
ribonucleotide reductase (R1) of HSV has been reported to have protein
kinase activity (1, 12). The R1 protein kinase was
demonstrated to utilize a catalytic domain different from those of
other conserved protein kinases (36). However, the protein
kinase activity of the HSV ribonucleotide reductase large subunit was
recently claimed to be due to experimental contamination by casein
kinase (30). The autophosphorylation activity of R1 was
eliminated after washing the immune complexes with buffer containing 2 M NaCl. To eliminate potential contamination in our assay, we washed
the anti-EBNA-1-E1/BGLF4 immunocomplexes with buffer containing 1.0, 1.5, 2.0, 2.5, or 3.0 M NaCl before switching to the kinase buffer for
the assay. Similar relative activities were obtained after incubation
for 30 min (data not shown). We then compared the kinetics of BGLF4 autophosphorylation using E1/BGLF4 immunocomplexes washed with 1 and 3 M NaCl, as shown in Fig. 5. After
autophosphorylation with E1/BGLF4 complexes, the products were
displayed on SDS-PAGE gel and transferred to a Hybond-C membrane. The
radioactivity of the reaction mixtures in the upper portions of Fig. 5A
and B were quantitated and divided by the relative amounts of protein detected by Western blotting as shown in the lower portions. Although the amount of E1/BGLF4 protein in the immunoprecipitation reaction mixtures decreased after the 3 M NaCl wash, the kinetics of
autophosphorylation were very close to those of the immunocomplex
washed with 1 M NaCl. This result indicated that the phosphorylation of
BGLF4 was very likely to be autophosphorylation, unless there was a cellular enzyme strongly associated with BGLF4 which could tolerate washing with 3 M NaCl.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5.
Kinetics of immunoprecipitated BGLF4 autophosphorylation
using buffer containing 1 or 3 M NaCl to wash the immunocomplexes. Cell
lysate (30 µg) harvested from pSJC12-transfected and vTF7-3-infected
293T cells was used for immunoprecipitation. The immunocomplexes were
washed with 1 or 3 M NaCl buffer and incubated with
[ -32P]ATP in kinase buffer for various periods of
time, as indicated. The reaction mixture containing vector control (VC)
was incubated for 30 min. The products were displayed on SDS-10% PAGE
gel, transferred to Hybond-C membranes, and quantitated by
phosphorimager (A and B, top). The membranes were immunoblotted with
5C11 and developed with an ECL kit to demonstrate the relative amounts
of BGLF4 in each reaction mixture (A and B, bottom), and the exposed
films were scanned and quantitated with the Scion Imager (National
Institutes of Health) program. (C) The kinase activities of the
reaction mixtures were divided by the relative amount of protein in
each reaction mixture, and the averages of three independent
experiments were indicated as relative fold increases or decreases. The
kinase activity at 30 min was counted as 1.
|
|
Autophosphorylation of BGLF4 was not affected by the presence of
heparin or okadaic acid.
CK II is a well-known cellular kinase
which also can use GTP as a phosphate donor. Although the kinase
activity we observed in BGLF4 autophosphorylation is Mn2+
dependent, unlike that in CK II, we nonetheless examined the kinase
activity of BGLF4 in the presence of heparin (Fig. 6A to C). As a positive control, 10 U of CK II
was used to phosphorylate 10 µg of casein in BGLF4 buffer, and this
activity was completely blocked by 1 µg of heparin/µl in the
reaction mixture (Fig. 6A, lanes 7 and 8). However, the phosphorylation
activity of BGLF4 was not affected by the presence of 0.25 to 2 µg of
heparin/µl (Fig. 6C). In this property, BGLF4 is very similar to
VZV47. These experiments excluded the possibility that the
phosphorylation of BGLF4 we observed was due to the contamination of CK
II.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 6.
Autophosphorylation of BGLF4 was not affected in the
presence of heparin or okadaic acid. (A) Different concentrations of
heparin, as indicated, were included in the autophosphorylation
reaction mixture for E1/BGLF4 (lanes 2 to 6). Ten units of CK II
phosphorylated 1 µg of casein, and this phosphorylation was
completely blocked in the presence of heparin (lanes 7 and 8). VC,
vector control. (D) The addition of phosphatase inhibitor okadaic acid
(OA) did not increase the autophosphorylation of BGLF4. (B and E) The
same blots as in panels A and D were probed with 5C11 to show the
relative amounts of E1/BGLF4 in the reaction mixtures. (C and F) The
kinase activities of each reaction mixture were divided by the relative
amounts of protein in each reaction mixture, and the averages of three
independent experiments were indicated as relative fold increases or
decreases.
|
|
The kinetics of BGLF4 autophosphorylation were such that no plateau was
reached by 60 min (Fig.
5). In order to examine whether
a phosphatase
activity is present in the BGLF4 autophosphorylation
reaction, okadaic
acid, a potent inhibitor of phosphatases A,
2A, and 2B (
32),
was added to the reaction mixture. Relative
kinase activities,
calculated by dividing the
32P activity by the amount of
protein detected by immunoblotting
(Fig.
6E and F), were not affected
by the presence of 0.625 to
5 nM okadaic acid (Fig.
6D).
BGLF4 is phosphorylated on serine and threonine residues and is
expressed in the cytoplasm of transfected cells.
In order to
examine whether BGLF4 is a Ser/Thr protein kinase, as predicted by
amino acid homology, the kinase immunoprecipitation products were
displayed on SDS-10% PAGE gel, transferred to Hybond-C membranes, and
probed with antiphosphoserine, antiphosphothreonine, or
antiphosphotyrosine specific monoclonal antibodies. As shown in Fig.
7, only phosphoserine and
phosphothreonine were detected in BGLF4. In an attempt to
localize the cellular expression of BGLF4, anti-BGLF4 rabbit serum was
used in an immunofluorescence assay of
12-O-tetradecanoylphorbol-13-acetate (TPA)-induced P3HR1 and B95-8
cells. Unfortunately, the signal was not obvious, probably due to the
small amount of protein expressed in EBV-positive cells or the
insensitivity of the antiserum (data not shown). To avoid the
changes in cell morphology induced by vaccinia virus, E1/BGLF4 was
further subcloned into a pSG5-based vector to place it under the
control of the SV40 promoter. The amount of E1/BGLF4 expressed after
transfection was about 1/10 to 1/20 that of the vaccinia virus system;
however, the protein can be detected by 5C11 or anti-BGLF4 antiserum in
transfected cells. BGLF4 was principally detected in the cytoplasm of
pCF4 (E1/BGLF4)-transfected 293T cells (Fig.
8).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 7.
Analysis of the phosphoamino acids of BGLF4, using
phosphoamino acid-specific monoclonal antibodies. After the immune
complex kinase assay, the products were displayed on SDS-10% PAGE
gel, transferred onto Hybond-C membranes, and immunoblotted with
antiphosphoserine, antiphosphothreonine, or antiphosphotyrosine
specific monoclonal antibodies. Arrowheads, positions of BGLF4 and
immunoglobulin G (IgG). VC, vector control.
|
|

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 8.
BGLF4 expressed in the cytoplasm of pCF4-transfected
293T cells. (A) 293T cells transfected with pCF4 were fixed with 50%
methanol-50% acetone and reacted with 5C11 monoclonal antibody. (B)
Photograph of cells reacted with anti-BGLF4 under lower
magnification.
|
|
Transphosphorylation activity of BGLF4 in vitro.
In addition
to autophosphorylation, the ability of BGLF4 to catalyze the
phosphorylation of heterologous proteins was examined. The
immunocomplex containing E1/BGLF4 was incubated with 1 µg of casein
or histone in kinase buffer without NP-40. After the reaction, the
product was precipitated with TCA and displayed on SDS-10% PAGE gel.
The phosphorylation of histone and casein was observed (Fig.
9A). We then examined which viral
proteins can be phosphorylated by BGLF4. The EBV immediate-early gene
product, Zta, is a phosphoprotein and plays a key role in the switch
from latency to the lytic cycle. Serine-173 of Zta is required for DNA
binding and is a target for CK II phosphorylation (15, 29). Early antigen (EA-D) is another EBV protein which is highly
phosphorylated (33). In addition, UL12 of HSV-2 (alkaline
phosphatase) is phosphorylated by US3 (16, 17). Therefore we
tested a panel of E. coli-expressed recombinant proteins
including Zta, Rta, EA-D, major DNA binding protein, DNase, and EBNA-1
in the transphosphorylation reaction. Specific phosphorylation was only
observed for EA-D (Fig. 9B), which is an accessory factor of the EBV
DNA polymerase.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 9.
Transphosphorylation of BGLF4. Protein A-Sepharose beads
containing immunoprecipitated E1/BGLF4 were incubated with 1 µg of
individual protein in the presence of 5 µCi of
[ -32P]ATP. After incubation, the products were
precipitated with TCA and analyzed on an SDS-10% PAGE gel. (A) A
stronger signal was observed in the reaction of histone (lane 2) than
in that of casein (lane 4). V, cell lysate from vector control; B, cell
lysate from E1/BGLF4-transfected cells. (B) Purified bacterially
expressed EA-D was also phosphorylated by the 5C11-immunoprecipitated
E1/BGLF4 product. 4F10 is a monoclonal antibody against EBV DNase which
was used as a negative control in immunoprecipitation.
|
|
Amino acids 1 to 26 are important for BGLF4 autophosphorylation
activity.
Computer-assisted analysis of the predicted amino acid
sequence of EBV BGLF4 identified conserved catalytic motifs (5, 49), including motifs I and II (invariant Lys), which are
implicated in the activity of many other protein kinases. In order to
identify the functional domains for BGLF4 kinase activity, the amino
acid sequence of BGLF4 was aligned with those of human herpesvirus homologues HHV8 ORF36, HCMV UL97, HSV UL13, and VZV 47 using CLUSTALW software (25, 53). Regions containing conserved boxes I to IV are shown in Fig. 10A. A mutant with
a change of lysine to methionine (K102M) was generated to determine
whether Lys-102 functions as an invariant catalytic Lys. In addition,
H193A/D195A and D219A/G221A, which are changed in conserved box III or
IV, and D297A, which carries a mutation within a nonconserved region,
were generated and individual plasmids were transfected into 293T
cells, followed by infection with vTF7-3. The cell lysates were
harvested and examined for their abilities to autophosphorylate, as
shown in Fig. 11A. To our surprise,
these four mutants showed autophosphorylation activities very similar
to that of wild-type BGLF4 in the immune complex kinase assay, as shown
in Fig. 11C and 10B (right).

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 10.
(A) Sequence alignment of BGLF4 and its homologues
among other herpesviruses using the CLUSTALW program (25,
53). Amino acids conserved among herpesviruses relative to the N
terminus at amino acid 231 of BGLF4 are shaded. Conserved boxes I to IV
are underlined; *, amino acids chosen for mutation. (B) Summary of
BGLF4 mutants and their relative activities. The BGLF4 coding region
encodes 429 amino acids. The putative functional domains, based on
alignment of different kinases, are indicated at the top. Different
mutants were generated by PCR or recombinant PCR as described in
Materials and Methods. Amino acid changes to methionine (M) or alanine
(A) are indicated. Relative activities of autophosphorylation are
summarized on the right.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 11.
Relative autophosphorylation activities of BGLF4
mutants. All the plasmids were expressed in 293T cells by transfection
and infection of vTF7-3 and assayed for autophosphorylation activities
as described for Fig. 6. (A) The immune complex kinase products were
displayed on SDS-12% PAGE gel and transferred to a Hybond-C membrane
and exposed to X-ray film. The autophosphorylation level was
quantitated by STORM 842. (B) The Hybond-C membrane was then probed
with the 5C11 monoclonal antibody, and the specific bands were
quantitated with the Scion Imager program. (C) The kinase activities of
individual lanes were divided by the relative amount of protein in each
reaction mixture, and the averages of three independent experiments are
indicated as relative fold increases or decreases.
|
|
In order to map the important functional domain within BGLF4, we
generated mutants with small deletions consisting of the
whole putative
conserved catalytic domain of BGLF4 (LQ

85-107),
a domain which
contains hydrophobic amino acids and a lysine conserved
between BGLF4
and HHV8 ORF36 (VF35-65) or both regions (VF35-65,LQ

85-107).
Since
some protein kinases contain a pseudosubstrate region which
functions
as an autoregulation domain (
50), another mutant
(LQ

367-403)
was generated to examine whether the stretch of basic
amino acids
within BGLF4 might suppress the protein kinase activity. In
addition,
four N-terminal deletion mutants, GS27-429, GS70-429,
LQ108-429,
and RS201-429, were generated and tested for their abilities
to
autophosphorylate. In conclusion, deletion of amino acids 85 to
107 did not affect the autophosphorylation of BGLF4 but deletion
of amino
acids 35 to 65 stimulated the phosphorylation signal
approximately
twofold (Fig.
10B and
11C). Deletion of amino acids
367 to 403 did not
increase the kinase activity. An assay of N-terminal
deletion mutants
revealed that amino acids 1 to 26 are essential
for the
autophosphorylation of
BGLF4.
 |
DISCUSSION |
This is the first report demonstrating a protein kinase activity
of the EBV gene BGLF4, although the function of this gene was predicted
several years ago. The optimal conditions for BGLF4-associated kinase
activity, comprising 50 mM HEPES (pH 7.4), 10 mM MgCl2, 10 mM MnCl2, 300 mM KCl, and 0.5% NP-40, are very similar to
those of VZV 47 (39). The ability of the BGLF4 protein to
use both ATP and GTP as a phosphate donor is similar to that of HSV
UL13, VZV 47, and ubiquitous cellular kinase CK II. Unlike the cellular enzyme, the viral kinases are not inhibited by heparin (32). By detecting phosphoamino acids, we found that BGLF4 is phosphorylated on serine and threonine residues (Fig. 7). BGLF4 protein appeared to be
expressed principally in the cytoplasm of transfected cells (Fig. 8).
We found difficulty in detecting the expression of the BGLF4 protein in
TPA-induced B95-8 cells (data not shown), perhaps due to only a very
small amount of protein being expressed for a short period of time
during the viral replication cycle or to the insensitivity of the
rabbit antiserum. Therefore it is still possible that authentic BGLF4
might be associated with other viral proteins in EBV-infected cells and
might exhibit a different subcellular localization.
The BGLF4 expressed in E. coli was mostly in the insoluble
fraction, and our inability to demonstrate phosphorylation activity using a renaturation gel activity assay could imply that certain posttranslational modifications or a particular conformation is required for enzyme activity. In our original experiments, we used
BGLF4 expressed transiently in eukaryotic cells and BGLF4-specific antiserum in an immune complex kinase assay (data not shown). In order
to increase further the specificity of immunoprecipitation, an EBNA-1
tag system was used to demonstrate BGLF4 phosphorylation. Because a
recent study showed that herpesvirus ribonucleotide reductase R1 is a
good substrate for host cell protein kinases but is not a protein
kinase itself (30), we used immunocomplexes washed with 1 and 3 M NaCl in the kinase experiment and obtained similar kinetics of
kinase activity. Although it is difficult to believe that a noncovalent
bond between two molecules would tolerate a 3 M NaCl wash, we suggest
that the kinase activity must be important for the virus regardless of
whether BGLF4 is itself a protein kinase or whether the kinase activity
is derived from a strongly linked cellular kinase. Indeed, this is the
case for HSV R1. Although there are still arguments about the kinase activity of HSV R1, the PK domain of HSV-2 was demonstrated to be
required for immediate-early gene expression and virus growth (48).
In addition to autophosphorylation of BGLF4, phosphorylation of EA-D in
vitro supports our hypothesis of the significance of BGLF4 activity.
EA-D is a phosphorylated protein, and the degree of phosphorylation
increases as the lytic cycle of EBV replication progresses (28,
33). EA-D is a DNA polymerase accessory factor (33)
and is also an important transactivator during lytic infection (55). Since the effect of phosphorylation on EA-D is still
not clear, it will be interesting to determine the contribution of BGLF4 to the phosphorylation of EA-D in vivo.
The UL13 protein kinase of HSV-1 is expressed late in the replication
cycle and, directly or indirectly, phosphorylates ICP22, as
demonstrated by UL13 deletion mutants (13, 43). HSV UL13 protein is packaged into virions (41). Recently, it was
found that HSV UL13 and ICP22, which is a substrate of UL13, are both required for HSV-induced modification of the large subunit of RNA
polymerase II (Pol II) after viral infection (35). The
altered phosphorylation state of Pol II was demonstrated to promote
late viral transcription in some cell lines.
ORF47 and ORF66 of VZV were reported to be dispensable for propagation
of VZV in vitro, but a double mutant lacking both proteins grows to a
reduced titer (24, 51). ORF47 also phosphorylates ORF62, the
major immediate-early transactivator (40). In addition, a
recent study involving inoculation of knockout virus-infected human
thymus/liver or skin implants into SCID-hu mice showed that the ORF47
protein was required for virus growth in human T cells and skin
(38). In summary, the functions of UL13 homologs in herpesviruses include modifying viral transactivators and cellular macromolecular machinery.
For another DNA virus, vaccinia virus, B1, one of the two viral protein
kinases, is required for viral DNA replication (45). One of
the substrates for B1 kinase has been demonstrated in vitro to be the
viral single-stranded DNA binding protein (2). It will be
interesting to determine whether BGLF4 also plays a role in modifying
cellular transcriptional or DNA replication machinery during EBV infection.
Definition of catalytic domains of nine motifs was achieved by
alignment of 65 sequences by Hanks and Hunter (23). The nine conserved boxes of sequences were used by Chee et al. (5) in the identification of herpesvirus UL13 group protein kinases. The
so-called catalytic lysine, in the second subdomain sequence AXKXO
(where O denotes a hydrophobic residue), was found to be functionally
irreplaceable in some protein kinases (10). The lysine
residue of UL13 of pseudorabies virus was mutated by DeWind et al.
(20), and this mutant was shown to lose kinase activity. This region is highly conserved among alphaherpesviruses, but the
sequence of BGLF4 in this region, TVKLY, is less conserved. Furthermore, the distance between subdomain I (putative nucleotide binding site) and the lysine is four amino acids less in BGLF4 (Fig.
10A). The deletion mutant study demonstrated that amino acids 85 to 107 are dispensable for BGLF4 phosphorylation, whereas the sequence between
amino acids 35 and 65 is a possible inhibition domain or autoregulatory
domain. Deletion of amino acids 35 to 65 increased the phosphorylation
of BGLF4 about twofold (Fig. 11). The N terminus, amino acids 1 to 26, was found to be essential for BGLF4 phosphorylation, the amino acid
sequence in this region contains multiple serine residues and a
possible N-linked glycosylation site (Fig.
12). Further experiments using purified
BGLF4 in transphosphorylation assays need to be conducted to determine
whether this region is the major phosphorylation site of BGLF4 or is
required for catalytic activity.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 12.
The sequence of the first 26 amino acids of BGLF4
contains multiple serine residues and a possible glycosylation site
(underlined).
|
|
During the preparation of this paper, we noted that ORF36 of HHV-8,
another gammaherpesvirus, was reported to be more active than the
thymidine kinase homologue in phosphorylation of ganciclovir and
ganciclovir-mediated cell death (4). Since the amino acid sequences of BGLF4 and HHV-8 ORF36 have 50% homology, the possibility that BGLF4 can also phosphorylate ganciclovir is under investigation in
our laboratory.
 |
ACKNOWLEDGMENTS |
We thank Tim J. Harrison of the Royal Free and University College
School of Medicine (University College London) for critical reading of
the manuscript. We also thank Li Wha Huang for the P3 laboratory
facility for recombinant vaccinia virus infection and Yu-Fan Chen for photography.
This research was supported by the National Science Council, grants
NSC88-2314-B-002-154 and NSC89-2320-B002-045.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Graduate
Institute of Microbiology, College of Medicine, National Taiwan
University, No. 1, Jen-Ai Rd., 1st Section, Taipei, Taiwan. Phone:
886-2-23970800, ext. 8298. Fax: 886-2-23915180. E-mail:
mrc{at}ha.mc.ntu.edu.tw.
 |
REFERENCES |
| 1.
|
Ali, M. A.,
S. S. Prakash, and R. Jariwalla.
1992.
Localization of the antigenic sites and intrinsic protein kinase domain within a 300 amino acid segment of the ribonucleotide reductase large subunit from herpes simplex virus type 2.
Virology
187:360-367[CrossRef][Medline].
|
| 2.
|
Beaud, G.,
A. Sharif,
A. Topa-Masse, and D. P. Leader.
1994.
Ribosomal protein S2/Sa kinase purified from HeLa cells infected with vaccinia virus corresponds to the B1R protein kinase and phosphorylates in vitro the viral ssDNA-binding protein.
J. Gen. Virol.
75:283-293[Abstract/Free Full Text].
|
| 3.
|
Branch, D. R., and G. B. Mills.
1995.
pp60c-src expression is induced by activation of normal human T lymphocytes.
J. Immunol.
154:3678-3685[Abstract].
|
| 4.
|
Cannon, J. S.,
F. Hamzeh,
S. Moore,
J. Nicholas, and R. F. Ambinder.
1999.
Human herpesvirus 8-encoded thymidine kinase and phosphotransferase homologues confer sensitivity to ganciclovir.
J. Virol.
73:4786-4793[Abstract/Free Full Text].
|
| 5.
|
Chee, M. S.,
G. L. Lawrence, and B. G. Barrell.
1989.
Alpha-, beta- beta- and gammaherpesviruses encode a putative phosphotransferase.
J. Gen. Virol.
70:1151-1160[Abstract/Free Full Text].
|
| 6.
|
Chen, C., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752[Abstract/Free Full Text].
|
| 7.
|
Chen, M.-R.,
J.-F. Yang,
T.-Y. Hsu,
M.-Y. Liu,
J.-Y. Chen, and C.-S. Yang.
1996.
Use of bacterially expressed GST/EBNA-1 fusion proteins for detection of antibodies in sera from patients with nasopharyngeal carcinoma and healthy donors.
Chin. J. Microbiol. Immunol. (Taipei)
29:65-79.
|
| 8.
|
Chen, M. R.,
C. H. Tsai,
F. F. Wu,
S. H. Kan,
C. S. Yang, and J. Y. Chen.
1999.
The major immunogenic epitopes of Epstin-Barr virus (EBV) nuclear antigen 1 are encoded by sequence domains which vary among nasopharyngeal carcinoma biopsies and EBV-associated cell lines.
J. Gen. Virol.
80:447-455[Abstract].
|
| 9.
|
Chen, M. R.,
T. Y. Hsu,
J. Y. Chen, and C. S. Yang.
1990.
Molecular characterization of a cDNA clone encoding the Epstein-Barr virus (EBV) DNase.
J. Virol. Methods
29:127-142[CrossRef][Medline].
|
| 10.
|
Chen, W. S.,
C. S. Lazar,
M. Poenie,
R. Y. Tsien,
G. N. Gill, and M. G. Rosenfeld.
1987.
Requirement for intrinsic protein tyrosine kinase in the immediate and late actions of the EGF receptor.
Nature (London)
328:820-823[CrossRef][Medline].
|
| 11.
|
Chow, K. C.,
J. Ma,
L. S. Lin,
K. H. Chi,
S. H. Yen,
S. M. Liu,
W. T. Liu,
W. K. Chen,
T. H. Chang, and K. Y. Chen.
1997.
Serum responses to the combination of Epstein-Barr virus antigens from both latent and acute phases in nasopharyngeal carcinoma: complementary test of EBNA-1 with EA-D.
Cancer Epidemiol. Biomarkers Prev.
6:363-368[Abstract].
|
| 12.
|
Chung, T. D.,
J. P. Wymer,
C. C. Smith,
M. Kulka, and L. Aurelian.
1989.
Protein kinase activity associated with the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10).
J. Virol.
63:3389-3398[Abstract/Free Full Text].
|
| 13.
|
Coulter, L. J.,
H. W. M. Moss,
J. Lang, and D. J. McGeoch.
1993.
A mutant of herpes simplex virus type 1 in which the UL13 protein kinase gene is disrupted.
J. Gen. Virol.
74:387-395[Abstract/Free Full Text].
|
| 14.
|
Cunningham, C.,
A. J. Davison,
A. Dolan,
M. C. Frame,
D. J. McGeoch,
D. M. Meredith,
H. W. M. Moss, and A. C. Orr.
1992.
The UL13 virion protein of herpes simplex virus type 1 is phosphorylated by a novel virus-induced protein kinase.
J. Gen. Virol.
73:303-311[Abstract/Free Full Text].
|
| 15.
|
Daibata, M.,
R. E. Humphreys, and T. Sairenji.
1992.
Phosphorylation of the Epstein-Barr virus BZLF1 immediate-early gene product ZEBRA.
Virology
188:916-920[CrossRef][Medline].
|
| 16.
|
Daikoku, T.,
R. Kurachi,
T. Tsurumi, and Y. Nishiyama.
1994.
Identification of a target protein of US3 protein kinase of herpes simplex virus type 2.
J. Gen. Virol.
75:2065-2068[Abstract/Free Full Text].
|
| 17.
|
Daikoku, T.,
Y. Yamashita,
T. Tsurumi, and Y. Nishiyama.
1995.
The US3 protein kinase of herpes simplex virus type 2 is associated with phosphorylation of the UL12 alkaline nuclease in vitro.
Arch. Virol.
140:1637-1644[CrossRef][Medline].
|
| 18.
|
Dasmahapatra, D. B.,
E. J. Rozhan, and J. Schwarz.
1987.
BD7, a novel cell free expression vector with an efficient translation initiation signal.
Nucleic Acids Res.
15:3933[Free Full Text].
|
| 19.
|
Davison, A. J., and J. E. Scott.
1986.
The complete DNA sequence of varicella-zoster virus.
J. Gen. Virol.
67:1759-1816[Abstract/Free Full Text].
|
| 20.
|
DeWind, N.,
J. Domen, and A. Berns.
1992.
Herpesviruses encode an unusual protein-serine/threonine kinase which is nonessential for growth in cultured cells.
J. Virol.
66:5200-5209[Abstract/Free Full Text].
|
| 21.
|
Feighny, R. J.,
M. P. Farrell, and J. S. Pagano.
1980.
Polypeptide synthesis and phosphorylation in Epstein-Barr virus-infected cells.
J. Virol.
34:455-463[Abstract/Free Full Text].
|
| 22.
|
Glover, C. V., and C. D. Allis.
1991.
Enzyme activity dot blot assaying protein kinases.
Methods Enzymol.
85:85-90.
|
| 23.
|
Hanks, S. K., and T. Hunter.
1995.
Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification.
FASEB J.
9:576-596[Abstract].
|
| 24.
|
Heineman, T. C.,
K. Seidel, and J. I. Cohen.
1996.
The varicella-zoster virus ORF66 protein induces kinase activity and is dispensable for viral replication.
J. Virol.
70:7312-7317[Abstract/Free Full Text].
|
| 25.
|
Higgins, D. G.,
A. J. Bleasby, and R. Fuchs.
1992.
CLUSTAL V: improved software for multiple sequence alignment.
Comput. Appl. Biosci.
8:189-191[Abstract/Free Full Text].
|
| 26.
|
Kawaguchi, Y.,
T. Matsumura,
B. Roizman, and K. Hirai.
1999.
Cellular elongation factor 1 is modified in cells infected with representative alpha-, beta-, or gammaherpesviruses.
J. Virol.
73:4456-4460[Abstract/Free Full Text].
|
| 27.
|
Kawaguchi, Y.,
C. Van Sant, and B. Roizman.
1998.
Eukaryotic elongation factor 1 is hyperphosphorylated by the protein kinase encoded by the UL13 gene of herpes simplex virus 1.
J. Virol.
72:1731-1736[Abstract/Free Full Text].
|
| 28.
|
Kiehl, A., and D. I. Dorsky.
1991.
Cooperation of EBV DNA polymerase and EA-D(BMRF1) in vitro and colocalization in nuclei of infected cells.
Virology
182:330-340.
|
| 29.
|
Kolman, J. L.,
N. Taylor,
D. R. Marshak, and G. Miller.
1993.
Serine-173 of the Epstein-Barr virus ZEBRA protein is required for DNA binding and is a target for casein kinase II phosphorylation.
Proc. Natl. Acad. Sci. USA
90:10115-10119[Abstract/Free Full Text].
|
| 30.
|
Langelier, Y.,
L. Champoux,
M. Hamel,
C. Guilbault,
C. Lamarche,
P. Gaudreau, and B. Mawwie.
1998.
The R1 subunit of herpes simplex virus ribonucleotide reductase is a good substrate for host cell protein kinases but is not itself a protein kinase.
J. Biol. Chem.
273:1435-1443[Abstract/Free Full Text].
|
| 31.
|
Lawrence, G. L.,
M. Chee,
M. A. Craxton,
U. A. Gompels,
R. W. Honess, and B. G. Barrell.
1990.
Human herpesvirus 6 is closely related to human cytomegalovirus.
J. Virol.
64:287-299[Abstract/Free Full Text].
|
| 32.
|
Leader, D. P.
1993.
Viral protein kinases and protein phosphatases.
Pharmacol. Ther.
59:343-389[CrossRef][Medline].
|
| 33.
|
Li, J. S.,
B. S. Zhou,
G. E. Dutschman,
S. P. Grill,
R.-S. Tan, and Y.-C. Chen.
1987.
Association of Epstein-Barr virus early antigen diffuse component and virus-specified DNA polymerase activity.
J. Virol.
61:2947-2949[Abstract/Free Full Text].
|
| 34.
|
Littler, E.,
A. D. Stuart, and M. S. Chee.
1992.
Human cytomegalovirus UL97 open reading frame encodes a protein that phosphorylates the antiviral nucleoside analog ganciclovir.
Nature
358:160-162[CrossRef][Medline].
|
| 35.
|
Long, M. C.,
V. Leong,
P. A. Scharrer,
C. A. Spencer, and S. A. Rice.
1999.
ICP22 and UL13 protein kinase are both required for herpes simplex virus-induced modification of the large subunit of RNA polymerase II.
J. Virol.
73:5593-5604[Abstract/Free Full Text].
|
| 36.
|
Luo, J. H., and L. Aurelian.
1992.
The transmembrane helical segment but not the invariant lysine is required for the kinase activity of the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10).
J. Biol. Chem.
267:9645-9653[Abstract/Free Full Text].
|
| 37.
|
McGeoch, D. J., and A. J. Davison.
1986.
Alphaherpesviruses possess a gene homologous to the protein kinase gene family of eukaryotes and retroviruses.
Nucleic Acids Res.
14:1765-1777[Abstract/Free Full Text].
|
| 38.
|
Moffat, J. F.,
L. Zerboni,
M. H. Sommer,
T. C. Heineman,
J. I. Cohen,
H. Kaneshima, and A. M. Arvin.
1998.
The ORF47 and ORF66 putative protein kinases of varicella-zoster virus determine tropism for human T cells and skin in the SCID-hu mouse.
Proc. Natl. Acad. Sci. USA
95:11969-11974[Abstract/Free Full Text].
|
| 39.
|
Ng, T. I., and C. Grose.
1992.
Serine protein kinase associated with varicella-zoster virus ORF47.
Virology
191:9-18[CrossRef][Medline].
|
| 40.
|
Ng, T. I.,
L. Keenan,
P. R. Kinchington, and C. Grose.
1994.
Phosphorylation of varicella-zoster virus open reading frame (ORF) 62 regulatory product by viral ORF 47-associated protein kinase.
J. Virol.
68:1350-1359[Abstract/Free Full Text].
|
| 41.
|
Overton, H. A.,
D. J. McMillan,
L. S. Klavinskis,
L. Hope,
A. J. Ritchie, and P. Wong-kai-in.
1992.
Herpes simplex virus type 1 gene UL13 encodes a phosphoprotein that is a component of the virion.
Virology
190:184-192[CrossRef][Medline].
|
| 42.
|
Possee, R. D.,
T. P. Sun,
S. C. Howard,
M. D. Ayres,
M. Hill-Perkins, and K. L. Gearing.
1991.
Nucleotide sequence of the Autographa californica nuclaer polyhedrosis 9.4 kbp EcoRI-I and -R (polyhedrin gene) region.
Virology
185:229-241[CrossRef][Medline].
|
| 43.
|
Purves, F. C.,
W. O. Ogle, and B. Roizman.
1993.
Processing of the herpes simplex virus regulatory protein 22 mediated by the UL13 protein kinase determines the accumulation of a subset of and mRNAs and proteins in infected cells.
Proc. Natl. Acad. Sci. USA
90:6701-6705[Abstract/Free Full Text].
|
| 44.
|
Purves, F. C., and B. Roizman.
1992.
The UL13 gene of herpes simplex virus 1 encodes the functions for posttranslational processing associated with phosphorylation of the regulatory protein 22.
Proc. Natl. Acad. Sci. USA
89:7310-7314[Abstract/Free Full Text].
|
| 45.
|
Rempel, R. E.,
M. K. Anderson,
E. Evans, and P. Traktman.
1990.
Temperature-sensitive vaccinia virus mutants identify a gene with an essential role in viral replication.
J. Virol.
64:574-583[Abstract/Free Full Text].
|
| 46.
|
Rempel, R. E., and P. Traktman.
1992.
Vaccinia virus B1 kinase: phenotypic analysis of temperature-sensitive mutants and enzymatic characterization of recombinant proteins.
J. Virol.
66:4413-4426[Abstract/Free Full Text].
|
| 47.
|
Russo, J. J.,
R. A. Bohenzky,
M. C. Chien,
J. Chen,
M. Yan,
D. Maddalena,
J. P. Parry,
D. Peruzzi,
I. S. Edelamn,
Y. Chang, and P. S. Moore.
1996.
Nucleotide sequence of the Kaposi sarcoma-associated herpes virus (HHV8).
Proc. Natl. Acad. Sci. USA
93:14862-14867[Abstract/Free Full Text].
|
| 48.
|
Smith, C. C.,
T. Peng,
M. Kulka, and L. Aurelian.
1998.
The PK domain of the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10) is required for immediate-early gene expression and virus growth.
J. Virol.
72:9131-9141[Abstract/Free Full Text].
|
| 49.
|
Smith, R. F., and T. F. Smith.
1989.
Identification of new protein kinase-related genes in three herpesviruses, herpes simplex virus, varicella-zoster virus, and Epstein-Barr virus.
J. Virol.
63:450-455[Abstract/Free Full Text].
|
| 50.
|
Soderling, T. R.
1993.
Protein kinases and phosphatases: regulation by autoinhibitor domains.
Biotechnol. Appl. Biochem.
18:185-200.
|
| 51.
|
Stevenson, D.,
K. L. Colman, and A. J. Davison.
1994.
Characterization of the putative protein kinases specified by varicella-zoster virus genes 47 and 66.
J. Gen. Virol.
75:317-326[Abstract/Free Full Text].
|
| 52.
|
Sullivan, V.,
C. L. Talarico,
S. C. Stanat,
M. Davis,
D. M. Coen, and K. K. Biron.
1992.
Protein kinase homologue controls phosphorylation of ganciclovir in human cytomegalovirus-infected cells.
Nature
358:162-164[CrossRef][Medline].
|
| 53.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weigh matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 54.
|
Tsai, C.-H.,
M.-T. Liu,
M.-R. Chen,
J. Lu,
H.-L. Yang,
J.-Y. Chen, and C.-S. Yang.
1997.
Characterization of monoclonal antibodies to the Zta and DNase proteins of Epstein-Barr virus.
J. Biomed. Sci.
4:69-77[CrossRef][Medline].
|
| 55.
|
Zhang, Q.,
E. Holley-Guthrie,
J.-Q. Ge,
D. Dorsky, and S. Kenney.
1997.
The Epstein-Barr virus (EBV) DNA polymerase accessory protein, BMRF1, activates the essential downstream component of the EBV oriLyt.
Virology
230:22-34[CrossRef][Medline].
|
Journal of Virology, April 2000, p. 3093-3104, Vol. 74, No. 7
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Iwahori, S., Murata, T., Kudoh, A., Sato, Y., Nakayama, S., Isomura, H., Kanda, T., Tsurumi, T.
(2009). Phosphorylation of p27Kip1 by Epstein-Barr Virus Protein Kinase Induces Its Degradation through SCFSkp2 Ubiquitin Ligase Actions during Viral Lytic Replication. J. Biol. Chem.
284: 18923-18931
[Abstract]
[Full Text]
-
Asai, R., Kato, A., Kawaguchi, Y.
(2009). Epstein-Barr virus protein kinase BGLF4 interacts with viral transactivator BZLF1 and regulates its transactivation activity. J. Gen. Virol.
90: 1575-1581
[Abstract]
[Full Text]
-
Zhu, J., Liao, G., Shan, L., Zhang, J., Chen, M.-R., Hayward, G. S., Hayward, S. D., Desai, P., Zhu, H.
(2009). Protein Array Identification of Substrates of the Epstein-Barr Virus Protein Kinase BGLF4. J. Virol.
83: 5219-5231
[Abstract]
[Full Text]
-
Wang, J.-T., Doong, S.-L., Teng, S.-C., Lee, C.-P., Tsai, C.-H., Chen, M.-R.
(2009). Epstein-Barr Virus BGLF4 Kinase Suppresses the Interferon Regulatory Factor 3 Signaling Pathway. J. Virol.
83: 1856-1869
[Abstract]
[Full Text]
-
Lee, C.-P., Huang, Y.-H., Lin, S.-F., Chang, Y., Chang, Y.-H., Takada, K., Chen, M.-R.
(2008). Epstein-Barr Virus BGLF4 Kinase Induces Disassembly of the Nuclear Lamina To Facilitate Virion Production. J. Virol.
82: 11913-11926
[Abstract]
[Full Text]
-
Yang, P.-W., Chang, S.-S., Tsai, C.-H., Chao, Y.-H., Chen, M.-R.
(2008). Effect of phosphorylation on the transactivation activity of Epstein-Barr virus BMRF1, a major target of the viral BGLF4 kinase. J. Gen. Virol.
89: 884-895
[Abstract]
[Full Text]
-
Lu, C.-C., Chen, Y.-C., Wang, J.-T., Yang, P.-W., Chen, M.-R.
(2007). Xeroderma pigmentosum C is involved in Epstein Barr virus DNA replication. J. Gen. Virol.
88: 3234-3243
[Abstract]
[Full Text]
-
Gershburg, E., Raffa, S., Torrisi, M. R., Pagano, J. S.
(2007). Epstein-Barr Virus-Encoded Protein Kinase (BGLF4) Is Involved in Production of Infectious Virus. J. Virol.
81: 5407-5412
[Abstract]
[Full Text]
-
Lee, C.-P., Chen, J.-Y., Wang, J.-T., Kimura, K., Takemoto, A., Lu, C.-C., Chen, M.-R.
(2007). Epstein-Barr Virus BGLF4 Kinase Induces Premature Chromosome Condensation through Activation of Condensin and Topoisomerase II. J. Virol.
81: 5166-5180
[Abstract]
[Full Text]
-
Kudoh, A., Daikoku, T., Ishimi, Y., Kawaguchi, Y., Shirata, N., Iwahori, S., Isomura, H., Tsurumi, T.
(2006). Phosphorylation of MCM4 at Sites Inactivating DNA Helicase Activity of the MCM4-MCM6-MCM7 Complex during Epstein-Barr Virus Productive Replication.. J. Virol.
80: 10064-10072
[Abstract]
[Full Text]
-
Heston, L., El-Guindy, A., Countryman, J., Dela Cruz, C., Delecluse, H.-J., Miller, G.
(2006). Amino Acids in the Basic Domain of Epstein-Barr Virus ZEBRA Protein Play Distinct Roles in DNA Binding, Activation of Early Lytic Gene Expression, and Promotion of Viral DNA Replication.. J. Virol.
80: 9115-9133
[Abstract]
[Full Text]
-
Asai, R., Kato, A., Kato, K., Kanamori-Koyama, M., Sugimoto, K., Sairenji, T., Nishiyama, Y., Kawaguchi, Y.
(2006). Epstein-Barr Virus Protein Kinase BGLF4 Is a Virion Tegument Protein That Dissociates from Virions in a Phosphorylation-Dependent Process and Phosphorylates the Viral Immediate-Early Protein BZLF1.. J. Virol.
80: 5125-5134
[Abstract]
[Full Text]
-
Daikoku, T., Kudoh, A., Sugaya, Y., Iwahori, S., Shirata, N., Isomura, H., Tsurumi, T.
(2006). Postreplicative Mismatch Repair Factors Are Recruited to Epstein-Barr Virus Replication Compartments. J. Biol. Chem.
281: 11422-11430
[Abstract]
[Full Text]
-
Wang, J.-T., Yang, P.-W., Lee, C.-P., Han, C.-H., Tsai, C.-H., Chen, M.-R.
(2005). Detection of Epstein-Barr virus BGLF4 protein kinase in virus replication compartments and virus particles. J. Gen. Virol.
86: 3215-3225
[Abstract]
[Full Text]
-
Yue, W., Gershburg, E., Pagano, J. S.
(2005). Hyperphosphorylation of EBNA2 by Epstein-Barr Virus Protein Kinase Suppresses Transactivation of the LMP1 Promoter. J. Virol.
79: 5880-5885
[Abstract]
[Full Text]
-
Gonnella, R., Farina, A., Santarelli, R., Raffa, S., Feederle, R., Bei, R., Granato, M., Modesti, A., Frati, L., Delecluse, H.-J., Torrisi, M. R., Angeloni, A., Faggioni, A.
(2005). Characterization and Intracellular Localization of the Epstein-Barr Virus Protein BFLF2: Interactions with BFRF1 and with the Nuclear Lamina. J. Virol.
79: 3713-3727
[Abstract]
[Full Text]
-
Gershburg, E., Marschall, M., Hong, K., Pagano, J. S.
(2004). Expression and Localization of the Epstein-Barr Virus-Encoded Protein Kinase. J. Virol.
78: 12140-12146
[Abstract]
[Full Text]
-
Makhov, A. M., Subramanian, D., Holley-Guthrie, E., Kenney, S. C., Griffith, J. D.
(2004). The Epstein-Barr Virus Polymerase Accessory Factor BMRF1 Adopts a Ring-shaped Structure as Visualized by Electron Microscopy. J. Biol. Chem.
279: 40358-40361
[Abstract]
[Full Text]
-
Gershburg, E., Hong, K., Pagano, J. S.
(2004). Effects of Maribavir and Selected Indolocarbazoles on Epstein-Barr Virus Protein Kinase BGLF4 and on Viral Lytic Replication. Antimicrob. Agents Chemother.
48: 1900-1903
[Abstract]
[Full Text]
-
Feng, W.-h., Hong, G., Delecluse, H.-J., Kenney, S. C.
(2004). Lytic Induction Therapy for Epstein-Barr Virus-Positive B-Cell Lymphomas. J. Virol.
78: 1893-1902
[Abstract]
[Full Text]
-
Kato, K., Yokoyama, A., Tohya, Y., Akashi, H., Nishiyama, Y., Kawaguchi, Y.
(2003). Identification of protein kinases responsible for phosphorylation of Epstein-Barr virus nuclear antigen leader protein at serine-35, which regulates its coactivator function. J. Gen. Virol.
84: 3381-3392
[Abstract]
[Full Text]
-
Krosky, P. M., Baek, M.-C., Jahng, W. J., Barrera, I., Harvey, R. J., Biron, K. K., Coen, D. M., Sethna, P. B.
(2003). The Human Cytomegalovirus UL44 Protein Is a Substrate for the UL97 Protein Kinase. J. Virol.
77: 7720-7727
[Abstract]
[Full Text]
-
Porcu, P., Eisenbeis, C. F., Pelletier, R. P., Davies, E. A., Baiocchi, R. A., Roychowdhury, S., Vourganti, S., Nuovo, G. J., Marsh, W. L., Ferketich, A. K., Henry, M. L., Ferguson, R. M., Caligiuri, M. A.
(2002). Successful treatment of posttransplantation lymphoproliferative disorder (PTLD) following renal allografting is associated with sustained CD8+ T-cell restoration. Blood
100: 2341-2348
[Abstract]
[Full Text]
-
Baek, M.-C., Krosky, P. M., He, Z., Coen, D. M.
(2002). Specific Phosphorylation of Exogenous Protein and Peptide Substrates by the Human Cytomegalovirus UL97 Protein Kinase. IMPORTANCE OF THE P+5 POSITION. J. Biol. Chem.
277: 29593-29599
[Abstract]
[Full Text]
-
Marschall, M., Stein-Gerlach, M., Freitag, M., Kupfer, R., van den Bogaard, M., Stamminger, T.
(2002). Direct targeting of human cytomegalovirus protein kinase pUL97 by kinase inhibitors is a novel principle for antiviral therapy. J. Gen. Virol.
83: 1013-1023
[Abstract]
[Full Text]
-
Feng, W.-h., Israel, B., Raab-Traub, N., Busson, P., Kenney, S. C.
(2002). Chemotherapy Induces Lytic EBV Replication and Confers Ganciclovir Susceptibility to EBV-positive Epithelial Cell Tumors. Cancer Res.
62: 1920-1926
[Abstract]
[Full Text]
-
Gershburg, E., Pagano, J. S.
(2002). Phosphorylation of the Epstein-Barr Virus (EBV) DNA Polymerase Processivity Factor EA-D by the EBV-Encoded Protein Kinase and Effects of the L-Riboside Benzimidazole 1263W94. J. Virol.
76: 998-1003
[Abstract]
[Full Text]
-
Moore, S. M., Cannon, J. S., Tanhehco, Y. C., Hamzeh, F. M., Ambinder, R. F.
(2001). Induction of Epstein-Barr Virus Kinases To Sensitize Tumor Cells to Nucleoside Analogues. Antimicrob. Agents Chemother.
45: 2082-2091
[Abstract]
[Full Text]
-
Marschall, M., Stein-Gerlach, M., Freitag, M., Kupfer, R., van den Bogaard, M., Stamminger, T.
(2001). Inhibitors of human cytomegalovirus replication drastically reduce the activity of the viral protein kinase pUL97. J. Gen. Virol.
82: 1439-1450
[Abstract]
[Full Text]
-
Kato, K., Kawaguchi, Y., Tanaka, M., Igarashi, M., Yokoyama, A., Matsuda, G., Kanamori, M., Nakajima, K., Nishimura, Y., Shimojima, M., Phung, H. T. T., Takahashi, E., Hirai, K.
(2001). Epstein-Barr virus-encoded protein kinase BGLF4 mediates hyperphosphorylation of cellular elongation factor 1{{delta}} (EF-1{{delta}}): EF-1{{delta}} is universally modified by conserved protein kinases of herpesviruses in mammalian cells. J. Gen. Virol.
82: 1457-1463
[Abstract]
[Full Text]
-
Yokoyama, A., Tanaka, M., Matsuda, G., Kato, K., Kanamori, M., Kawasaki, H., Hirano, H., Kitabayashi, I., Ohki, M., Hirai, K., Kawaguchi, Y.
(2001). Identification of Major Phosphorylation Sites of Epstein-Barr Virus Nuclear Antigen Leader Protein (EBNA-LP): Ability of EBNA-LP To Induce Latent Membrane Protein 1 Cooperatively with EBNA-2 Is Regulated by Phosphorylation. J. Virol.
75: 5119-5128
[Abstract]
[Full Text]
-
Chan, S. R., Chandran, B.
(2000). Characterization of Human Herpesvirus 8 ORF59 Protein (PF-8) and Mapping of the Processivity and Viral DNA Polymerase-Interacting Domains. J. Virol.
74: 10920-10929
[Abstract]
[Full Text]