Previous Article | Next Article 
Journal of Virology, March 2000, p. 2826-2839, Vol. 74, No. 6
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of a Boundary Domain Adjacent to the
Potent Human Cytomegalovirus Enhancer That Represses Transcription of
the Divergent UL127 Promoter
Ana
Angulo,1
David
Kerry,1
Huang
Huang,1
Eva-Maria
Borst,2
Alison
Razinsky,1
Jun
Wu,1,
Urs
Hobom,2
Martin
Messerle,2 and
Peter
Ghazal1,*
Department of Immunology and Molecular
Biology, Division of Virology, The Scripps Research Institute, La
Jolla, California 92037,1 and Max von
Pettenkofer Institute, Munich, Germany2
Received 7 September 1999/Accepted 13 December 1999
 |
ABSTRACT |
Transcriptional repression within a complex modular promoter may
play a key role in determining the action of enhancer elements. In
human cytomegalovirus, the major immediate-early promoter (MIEP) locus
contains a highly potent and complex modular enhancer. Evidence is
presented suggesting that sequences of the MIEP between nucleotide positions
556 and
673 function to prevent transcription activation by enhancer elements from the UL127 open reading frame divergent promoter. Transient transfection assays of reporter plasmids revealed repressor sequences located between nucleotides
556 and
638. The
ability of these sequences to confer repression in the context of an
infection was shown using recombinant viruses generated from a
bacterial artificial chromosome containing an infectious human
cytomegalovirus genome. In addition to repressor sequences between
556 and
638, infection experiments using recombinant virus mutants
indicated that sequences between
638 and
673 also contribute to
repression of the UL127 promoter. On the basis of in vitro
transcription and transient transfection assays, we further show that
interposed viral repressor sequences completely inhibit enhancer-mediated activation of not only the homologous but also heterologous promoters. These and other experiments suggest that repression involves an interaction of host-encoded regulatory factors
with defined promoter sequences that have the property of proximally
interfering with upstream enhancer elements in a chromatin-independent
manner. Altogether, our findings establish the presence of a boundary
domain that efficiently blocks enhancer-promoter interactions, thus
explaining how the enhancer can work to selectively activate the MIEP.
 |
INTRODUCTION |
The major immediate-early promoter
(MIEP) enhancer region of cytomegalovirus (CMV) is required for optimal
infection (3) and plays an important role in determining the
cell type tropism and state of activation in vivo (4, 5, 24,
28). The MIEP is highly complex and contains one of the most
potent transcriptional enhancers known to date (7;
reviewed in reference 20). Previous studies have
demonstrated the importance of a wide variety of positive
cis-acting enhancer modules in promoting high levels of
transcription from the human CMV (HCMV) MIEP. In addition, the viral
IE2 (IE86 and L40) proteins act as autorepressors of the HCMV MIEP by
binding the cis repression sequence (14, 30, 34, 39,
41, 42). The location of this sequence, between the initiation
site of transcription and the TATA box sequence, enables IE2 proteins
to competitively block the recruitment of RNA polymerase II at the MIEP
(31, 42). Repression is also predicted to be essential for
establishing stringent regulation of the MIEP enhancer, which is likely
to be an important feature in determining temporal and
cell-type-specific patterns of viral gene expression as well as
preventing promiscuous promoter interactions.
In the species-specific mouse CMV (MCMV), a similarly complex but
distinct enhancer/promoter region is involved in controlling expression
from its major immediate-early (MIE) genes (15). A divergent
promoter upstream from its MIEP drives the expression of the MCMV
ie2 gene (Fig. 1)
(37). This gene is dispensable for growth in tissue culture
and in vivo and comes under control of the nearby enhancer, thereby
displaying IE kinetics of expression (9, 35). The
observation that the MCMV enhancer plays a dual role in regulating
ie1 and ie2 expression is not unexpected since by
definition enhancers function equally well in either orientation. Similar to the organization of MCMV MIE locus, the genome sequence from
HCMV (11) identified a divergent open reading frame (ORF) (UL127) in close proximity to the enhancer (Fig. 1) and which overlaps
the modulator domain of the human MIEP (Fig.
2A).
While the HCMV UL127 ORF is dispensable for replication in tissue
culture, it does not appear to have any significant homology with the
mouse viral ie2 gene (36, 37). In contrast to the
MCMV ie2 gene, expression of UL127-encoding transcript is
not detected upon infection of human foreskin fibroblasts (HFF cells)
by HCMV (10). The UL127 promoter region contains an
excellent TATA box (10 out of 11 nucleotides [nt] match with the MIEP
TATA box [Fig. 1]) and binds CTF-1/NF-1 at the expected CAAT box
position (18). Thus, the observation for inactivity of this
divergent promoter is unexpected due to the strong potency of the CMV
enhancer and raises the question as to why the enhancer is unable to
influence expression of the UL127 promoter site. It is conceivable that
repressors stringently regulate the UL127 promoter. To investigate this
issue, we have examined the requirement of cis-acting
sequences in the promoter-proximal region of UL127 for limiting
enhancer action.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic diagrams of the HCMV and MCMV genomes.
Fragments containing the MIE regions are expanded below the
corresponding regions of the genomes. Locations and direction of
transcription of the ORFs for the MIE genes ie1,
ie2, and ie3 and the potential UL127 ORF are
indicated. The gray box depicts the enhancer. The TATA box sequences of
the different ORFs are shown. The diagram is not drawn to scale.
|
|


View larger version (1722K):
[in this window]
[in a new window]
|
FIG. 2.
NF-1 binding sites flanking the UL127 TATA box do not
mediate transcriptional repression. (A) Binding of various
transcription factors (marked by open boxes) to HCMV MIEP sequences
between 244 and 781 (based on DNase I footprinting data [reviewed
in reference 20]). Locations of the enhancer, usr,
NF-1 cluster, modulator, and UL127 TATA box are shown. Numbers refer to
nucleotide positions relative to the transcription start site (+1) of
the MIEP. CAT reporter constructs [pSnab-BamCAT, pSnab-Bam(HI)CAT,
pGACC( 673), and pGACC( 531] with various 5' and 3' deletion
endpoints are shown below. (B) HFF, HeLa, U373-MG, and NT-2/D1 cells
were transfected with 5 µg of the various promoter-CAT deletion
constructs shown in panel A together with 5 µg of the control plasmid
pRSV- -gal. Cell lysates were prepared 30 h after transfection
and assayed for -galactosidase and CAT activity. For the CAT assays,
cell extracts containing the same amount of -galactosidase activity
were used. A plot of the normalized percentage of CAT activity
calculated for each construct taking as 1 the activity presented by
pSnaB-BamCAT is shown. The CAT values shown represent the average ± standard deviation (bars) of three determinations.
|
|
Here, we present evidence that sequences located between
556 and
673 of the MIEP serve to completely block enhancer interactions with
the UL127 promoter site. This region therefore plays an important role
in defining the boundary of action of the MIEP enhancer in HCMV.
 |
MATERIALS AND METHODS |
Cells.
The cell lines U373-MG, HeLa, NT-2/D1, and MRC-5, as
well as the HFF cells, were grown in Dulbecco's modified Eagle medium supplemented with 2 mM glutamine, 100 U of penicillin per ml, 100 µg
of gentamicin per ml, and 10% (vol/vol) fetal bovine serum.
Plasmid constructions and transfections.
Plasmid
pSnaB-Bam(HI)CAT was constructed by inserting a
BamHI/SpeI fragment from pMIEP(HIB)CAT
(17) into BamHI/SpeI-digested pSnaB-BamCAT. Plasmid pSnaB-BamCAT contains regulatory sequences of the
HCMV MIE gene from nt
243 to
741 linked to the chloramphenicol acetyltransferase (CAT) gene. To construct pGACC(
531) and
pGACC(
673), recombinant plasmid pGACC was generated by inserting
annealed oligonucleotides G53
(5'-GATCCATTGGTTATATAGCATAACTAGTAAGCTTCTACGTAC-3') and G52
(5'-AGCTGTACGTAGAAGCTTACTAGTTATGCTATATAACCAATG-3'),
containing SnaBI, HindIII, and
SpeI sites, into
BamHI/HindIII-digested pMIEP(
66/+55)CAT (42). A HindIII/SnaBI fragment
from
1 and pR55 (kindly provided by B. Fleckenstein) was cloned into
pGACC digested with HindIII/SnaBI to create
pGACC(
531) and pGACC(
673), respectively. Plasmids pGACC(
531) and
pGACC(
673) were digested with SnaBI and
BamHI and ligated into
SmaI/BglII-digested pGL3-Basic (Promega, Madison, Wis.) to create pGL3(
531) and pGL3(
673), respectively. To construct pE(
66/+112)CAT and pEusr(
66/+112)CAT, a 190-bp
BamHI/HindIII fragment from pMIEP(
66/+112)
(44) that contains HCMV MIEP sequences from
66 to
+112 was inserted into
BamHI/HindIII-digested pGACC(
531) and pGACC(
598), respectively. Plasmids pGL3(
634), pGL3(
581), pGL3(
556), and pGL3(
531) were constructed using the PCR
primers promExt-1 (5'-TGTACGTAGATGTACTGCCAAGT-3'),
promExt-2 (5'-TGAAGCTTGGTCATTAGTTCATAGCCAT-3'), promExt-3 (5'-TGAAGCTTAGTTATTAATAGTAATCAATTAC-3'),
promExt-4 (5'-TGAAGCTTCATGTTGACATTGATTATTGA-3'), and promExt-5 (5'-TGAAGCTTTTTATATTGGCTCATGTCCAAC-3').
All PCRs were performed with pMIEP(
1145/+112)CAT
(19) and primer promExt-1. Primers promExt-2, promExt-3,
promExt-4, and promExt-5 were used to generate pGL3(
634),
pGL3(
581), pGL3(
556), and pGL3(
531), respectively. Primer
promExt-1 contains a 5' SnaBI linker, while primers
promExt-2, promExt-3, promExt-4, and promExt-5 contain a 5'
HindIII linker. The corresponding PCR products were
digested with SnaBI and HindIII and inserted
into SnaBI/HindIII pGACC(
531). The
SnaBI/BamHI fragments excised from the
recombinant plasmids generated were then inserted into
SmaI/BglII-digested pGL3-Basic to generate
plasmids pGL3(
634), pGL3(
581), pGL3(
556), and pGL3(
531). Plasmids pGL3(
531/
638) and pGL3(
531/
609) were made by
utilizing PCR primers promRev-1 (5'-TGGGATCCCATTGGTTATATA-3'),
promRev-2 (5'-TGTGATCACATATTATGATATGG-3'), and
promRev-3 (5'-TGTGATCAGTCAACATGGCGGT-3'). All PCRs were
performed with pMIEP(
1145/+112)CAT and primer promRev-1. Primer
promRev-2 was used to create pGL3(
531/
638), and promRev-3 was
used to generate pGL3(
531/
609). Primer promRev-1 contains a 5'
BamHI linker, while primers promRev-2 and promRev-3 contain a 5' BclI linker. The two PCR products generated were cloned
between the SpeI and the BamHI sites of
pGACC(
531). SnaBI/BamHI fragments were excised
from the two recombinant plasmids constructed and inserted into
SmaI/BglII-digested pGL3-Basic. The
-galactosidase expression vector pRSV-
-gal and the luciferase
expression vector pRL-tk (Promega) were used as internal controls in
transfection assays.
Transfections were performed by the calcium phosphate precipitation
method as described previously (
19). Cell lysates were
prepared 30 h after transfection.

-Galactosidase and CAT assays
were performed as previously described (
2). Luciferase
activity
was determined according to the Promega's Dual-Luciferase
reporter
assay system technical manual. The activity of the
experimental
luciferase reporters was normalized to the activity of the
internal
control pRL-tk. For CAT assays, cell extracts containing the
same
amount of

-galactosidase were used. CAT activity was
quantitated
by using a Molecular Dynamics PhosphorImager system with
ImageQuant
software.
BAC mutagenesis and virus construction.
For generation of
recombinant viruses UL127-GFP1, UL127-GFP10, and UL127-GFP7, three
plasmids were constructed that contained a green fluorescent protein
(GFP) reporter gene from pEGFP-C1 (Clontech, Palo Alto, Calif.)
downstream of the UL127 sequences which were isolated from reporter
plasmids pGACC(
673), pGACC(
531/
638), and pGACC(
531),
respectively (Fig. 2 and 6). Note that in these constructs the GFP gene
was inserted as a separate ORF upstream of the UL127 ORF but downstream
of the UL127 promoter sequences. Briefly, enhanced GFP (EGFP) primers
5'-GGCCTGCAGATCTGCTAGCGCTACCGGTCGCCA-3' and
5'-GGCCTGCAGTTTAAACTCACTTGTACAGCTCGTCCATGCC-3', containing BglII and PmeI sites, respectively, were used to
PCR amplify the EGFP gene. The resultant PCR fragment was digested with
PstI and inserted into the NsiI site at position
755 of pMIEP(
1145/+112)CAT. Next a BglII site
(introduced from the EGFP primer) and the SnaBI site of the
wild-type (wt) MIEP sequence (at position
243) were used to replace
the wt MIEP sequence with BamHI/SnaBI fragments containing the deletion mutations of pGACC(
673),
pGACC(
531/
638), and pGACC(
531), respectively. A tetracycline
resistance gene flanked with FRT sites was excised from plasmid pCP16
(13) and inserted into a unique PmeI site
downstream of the EGFP gene. The resulting constructs were digested
with PstI (
1145) and EagI (+78), generating
fragments that contained one of the three different MIEP sequences
each, the GFP gene, the tetracycline resistance gene, and 385 bp of
downstream sequences comprising the UL127 ORF. Recombination between
the linear fragments and the HCMV bacterial artificial chromosome (BAC)
plasmid pHB5 (6) was performed in the
recombination-proficient Escherichia coli strain JC8679 according to a recently described mutagenesis procedure
(44). Minipreparations of BAC DNA isolated from 10-ml
bacterial cultures were prepared and characterized by digestion with
restriction enzymes SpeI, SalI, and
SnaBI. HCMV BACs that had received the mutation were then
transformed in the recombination-deficient E. coli strain
DH10B. Excision of the tetracycline resistance cassette with Flp
recombinase was performed essentially as described elsewhere
(13) and confirmed by restriction enzyme analysis. In
addition, the regions of interest were sequenced in the different BACs.
Sequences were as expected for all recombinants except in BAC
UL127-GFP10 between nt
688 and
676 relative to the transcription start site of the MIEP that contain 10 mismatched nucleotides, disrupting the NF-1 site 5' proximal to the UL127 TATA box.
Midipreparations of BACs were used to transfect MRC-5 cells for
generation of infectious recombinant virus as described previously
(6). Infection of HFF cells was used to generate viral
stocks, and titers of infectious virus were determined by standard methods.
In vitro runoff transcription assay.
Transcription reactions
(25 µl) were performed with nuclear extracts prepared from HeLa cells
as described previously (18). The templates
pMIEP(
66/+112), pE(
66/+112), and pEusr(
66/+112) were linearized
with EcoRI and used in the transcription reactions at a
concentration of 25 µg/ml. Transcript products were analyzed by
electrophoresis on a denaturing (8.3 M urea) 6% polyacrylamide gel.
Relative levels of transcription were quantitated using a PhosphorImager (Molecular Dynamics). Poly(U) polymerase activity present in the nuclear extract was used as an internal standard to
account for variability between samples.
Reverse transcriptase (RT)-mediated PCR (RT-PCR).
HFF cells
were infected with the different recombinant viruses at a multiplicity
of infection (MOI) of 0.1 PFU/cell. Total RNA was isolated at 13 h
postinfection (hpi) by using the RNAzol B method (Tel-Test, Inc.,
Friendswood, Tex.) according to the manufacturer's protocol. RNA
samples were treated with RNase-free DNase I for 15 min at room
temperature, and the DNase was inactivated at 65°C for 15 min. The
RNA was reverse transcribed using oligo(dT) primers at 42°C for 50 min, and reactions were terminated by heating at 70°C for 15 min. The
reverse-transcribed products were treated with RNase H for 20 min at
37°C and amplified using the following primer sets. Primers TF-F
(5'TCCTGCTCGGCTGGGTCTTCGCCCAG3') and TF-R
(5'TGTTCGGGAGGGAATCACTGCTTGAACAGT3') were designed to
amplify a 601-bp product within the human tissue factor gene. Primer
GFP-R (5'TCGCCCTCGCCGGACACGCTGAACT3') within the EGFP gene
and primer GFP-F (5'CCACCATGGTGAGCAAGGGCGAGGAGC3') located
29 to 55 nt downstream of the predicted UL127 TATA box sequence were
designed to yield a 714-bp product. Primer GFP-R and primer
UL127-TATA (5'CTATATAACCAATGGATCTGCTAGCGC3'), located
within the predicted UL127 TATA box sequence, were designed to
either fail to detect a product if the predicted TATA box was used or
yield a 650-bp product in the case that an alternative TATA box
upstream the predicted UL127 TATA box was used. PCRs were optimized
using the HCMV recombinant BAC genomes as templates. Similar levels of
PCR products were obtained for all the HCMV recombinant BACs when
primer sets GFP-F/GFP-R and GFP-R/UL127 TATA were used (data not
shown). PCRs were performed under the following conditions: 1 cycle at
94°C for 3 min, 30 cycles of 1 min at 94°C, 1 min at 58°C, and 1 min at 72°C, and 1 cycle at 72°C for 10 min. Amplified products
were separated on a 1% agarose gel and visualized by ethidium bromide staining.
Flow cytometry.
HFF cells were infected with different HCMV
recombinants at an MOI of 0.5 PFU/cell. On day 3 after infection,
cultures were trypsinized, washed twice with phosphate-buffered saline
(PBS) and fixed with 1% formaldehyde in PBS. Fluorescence was measured by flow cytofluorometry (fluorescence-activated cell sorting [FACS]) using a FACScan (Becton Dickinson, Mountain View, Calif.). A total of
10,000 events were collected per sample. Uncompensated fluorescence values from FL1 (GFP fluorescence, 530-nm band pass filter) and FL2
(autofluorescence; a 585-nm band pass filter) were collected along with
forward angle light scatter (FSC) and side scatter (SSC) for every
event. The data files were subsequently gated employing a logical gate
drawn in a dot plot display of FSC versus SSC to exclude dead cells,
debris, and clumps. For each data file, the resultant gated data set
was displayed as a dot plot of FL2 versus GFP fluorescence and a static
second region drawn around the GFP-positive (GFP+) cells,
with a static third region drawn around the negative cells for the
purpose of calculating statistics among the data files. The spectral
differences among GFP+ and negative cells make them easy to
distinguish in the bivariate display, whereas the population overlap as
viewed from a single parameter histogram makes it difficult to
distinguish the dull GFP+ from high autofluorescence.
Confocal laser microscopy.
HFF cells seeded onto coverslips
were infected with the different HCMV recombinants at an MOI of 0.5 PFU/cell. On day 3 after infection, infected cells were fixed and
permeabilized with 4% paraformaldehyde, 0.2% glutaraldehyde, and
0.2% Triton X-100 in PBS. Cells were incubated with HCMV IE monoclonal
antibody 810 (dilution 1:60) for 1 h at 37°C. The coverslips
were extensively washed with PBS containing 1% bovine serum albumin
and incubated with a secondary antibody, tetramethyl rhodamine
isothiocyanate-(TRITC)-conjugated goat anti-mouse (dilution 1:400;
Sigma Immunochemicals). After a further 60-min incubation at 37°C,
the coverslips were washed again with PBS containing 1% bovine serum
albumin, rinsed with water, and mounted using Permount. Samples were
examined using a Zeiss Axioplan confocal microscope and a 63× oil
immersion objective lens. Data were collected at a resolution of 512 by
512 pixels. Data sets were processed using the MRC 1024 software and
then exported for preparation for printing using Adobe Photoshop.
 |
RESULTS |
Sequences upstream of the NF-1 cluster mediate transcriptional
repression of the UL127 promoter site.
Evidence for direct
repression of the MIEP by its own IE2 gene product has been provided to
account for the restricted expression of the IE genes in the later
stages of infection (14, 30, 31, 34, 38, 39, 42). This
repression system is defined by the competitive binding of the IE
repressor with the RNA polymerase II recruitment step (31,
42). Our previous studies indicated that a strict requirement for
this type of repression is that the position of the repressor binding
site should be in the vicinity of the transcription start site
(31). In other studies, binding sites 5' proximal to a TATA
box have also been shown to block the recruitment of an RNA polymerase
II complex (reviewed in reference 1). The UL127
promoter is located in the center of the NF-1 cluster in which one NF-1
binding site exists 14 bp downstream of the UL127 TATA box in the
immediate vicinity of the start site and another lies 10 bp upstream of
the TATA box (25, 27). It is possible that these particular
TATA proximal NF-1 sites may play a role in maintaining a repressed
state. To investigate whether these NF-1 sites are involved in
repression, we examined constructs in which promoter-proximal
downstream and upstream NF-1 binding sites have been eliminated.
Different cell types were cotransfected with an internal control
standard and reporter plasmids with the CAT gene under the control of
the UL127 promoter with or without the NF-1 binding sites. In the
transient transfection assays, the wt UL127 promoter construct
pSnaB-BamCAT (containing sequences between nt
243 and
741 of the
MIEP) did not show any significant CAT activity in a variety of cell
types (Fig. 2) despite the presence of the MIEP enhancer. The construct
pSnaB-Bam(HI)CAT lacking the downstream NF-1 binding site also failed
to develop significant promoter activity [Fig. 2; compare CAT
responses for pSnaB-BamCAT and pSnaB-Bam(HI)CAT]. In addition,
pGACC(
673), a reporter plasmid that contains neither downstream nor
upstream NF-1 sites, was found to be equally ineffective in developing detectable levels of reporter gene expression [Fig. 2; compare CAT
responses for pSnaB-BamCAT and pGACC(
673)]. While these experiments do not unequivocally exclude the possible involvement of NF-1, it
appears that repression is not due to promoter-proximal NF-1 binding
sites, indicating that additional cis-acting repression sequences might be involved. In agreement with this suggestion and in
marked contrast to deletion of the NF-1 sites described above, deletion
of sequences further upstream (to nt
531 relative to the MIEP
transcription start site) resulted in high levels of reporter gene
expression in a variety of different cell types [Fig. 2; compare CAT
responses for pSnaB-BamCAT and pGACC(
531)]. It is noteworthy that
the level of reporter gene activity is less than that observed with the
MIEP enhancer constructs (A. Angulo and P. Ghazal, unpublished data).
The reason for this lower activity is not known, but it may be due to
removal of positive elements in the deletion constructs and/or presence
of further repressor elements. Alternatively, the UL127 promoter may
require viral factors for maximal activity. Nevertheless, the results
of these experiments raise the possibility that sequences located
160-bp upstream of the UL127 promoter mediate strong repression of the UL127 promoter site.
UL127 promoter-proximal upstream sequences block enhancer
activation.
We next examined in more detail the UL127
promoter-proximal upstream sequences involved in mediating
transcriptional repression. Accordingly, a series of 5' and 3' deletion
mutants (from nucleotide positions between
531 and
691) were
constructed and tested for their effects on reporter (luciferase)
activity in transient transfection experiments. The locations of the
deletion endpoints are shown in Fig. 3A
in nucleotide positions relative to
the initiation site (+1) of the MIEP. In transient transfection assays,
deletion of sequences between
691 and
634, in pGL3(
634), did not
alter reporter activity in these cell lines [Fig. 3B; compare
luciferase responses for pGL3(
673) and pGL3(
634)]. When additional
sequences between
634 and
604 were deleted, an approximately
10-fold increase in reporter activity was detected [Fig. 3B; compare
luciferase responses for pGL3(
673) and pGL3(
604)]. Significantly,
when the construct pGL3(
581), which has an additional 23-bp region deleted, was analyzed in transient transfection assays, a further threefold increase in luciferase activity was observed [Fig. 3B; compare pGL(
581) and pGL(
604)]. Deletion of sequences between
581 and
556, in pGL3(
556), resulted in levels of reporter gene activity comparable to the ones exhibited by pGL3(
531), in which sequences from
691 to
531 were absent (Fig. 3). Altogether, these
results indicate that a region between nt
556 and
634 of the MIEP
mediates transcriptional repression of the UL127 promoter in a
cell-type-independent manner.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Identification of the sequences that mediate
transcriptional repression of the UL127 promoter. (A) Binding of
various transcription factors (marked by open boxes) to HCMV-MIEP
sequences between 244 and 710 (based on DNase I footprinting data
[reviewed in reference 20]). The location of the
UL127 TATA box is shown. Numbers refer to nucleotide positions relative
to the transcription start site (+1) of the MIEP. Luciferase (LUC)
reporter constructs with various 5' and 3' deletion endpoints are shown
below. (B) HeLa and NT-2/D1 cells were transfected with 5 µg of the
various promoter deletion luciferase constructs shown in panel A
together with 5 µg of the control plasmid pRL-tk. Cell lysates were
prepared 30 h after transfection and assayed for luciferase
activity. The activity of each promoter deletion reporter construct was
normalized to the activity of the internal control plasmid. A plot of
the normalized percentage of luciferase activity calculated for each
construct, taking as 100 the activity presented by pGL3( 531), is
shown. The luciferase values shown represent the average ± standard deviation (bars) of three determinations.
|
|
In good agreement with these results, a 107-bp internal deletion mutant
that eliminated sequences between nt

531 and

638,
pGL3(


531/

638), exhibited a 25- to 50-fold enhancement in the
transcriptional activity compared with pGL3(

673) (Fig.
3). To
verify
further the boundary of these
cis-acting repressor
sequences,
a mutant construct containing a shorter internal deletion of
78
bp (from nt

531 to

609) was generated (Fig.
3A). Consistent
with
the observed activity of pGL3(

604), this construct
[pGL3(


531/

609)]
presented a lower reporter activity than
pGL3(


531/

638), indicating
that sequences between

609 and

638
play a role in maintenance
of the repression state (Fig.
3B). We note
that these constructs
collectively accommodate spacing considerations.
For instance,
pGL(

604) has deleted 87 bp from the promoter region,
and the
spacing difference between the enhancer and promoter in
pGL(

531)
and pGL(

531/

609) is 82 bp. In all cases, in the absence
of repressor
sequence, the enhancer is capable of efficiently
activating the
UL127 promoter in a spacing-independent manner.
Altogether, we
conclude from these transient transfection results that
sequences
between nt

556 and

634 cooperate in mediating
transcriptional
repression of the UL127 promoter site. These
experiments thus
identify within the unique sequence region (usr) a
boundary domain
as the unit of transcriptional
repression.
To investigate whether these sequences could block enhancer activation
on a heterologous promoter, the UL127 TATA box region
was substituted
with a core promoter fragment (from nt

66 to
+112) containing the
MIEP TATA box. For these experiments, three
plasmids,
pMIEP(

66/+112)CAT, pE(

66/+112)CAT, and pEusr(

66/+112)CAT,
were constructed (Fig.
4A) and analyzed
in transient transfection
assays in a variety of different cells.
Figure
4 shows that the
pE(

66/+112)CAT reporter construct containing
the enhancer region
(from nt

240 to

531) upstream of the core
promoter resulted
in a marked increase (from 38- to 88-fold) in CAT
reporter activity
in comparison with the construct without the enhancer
[pMIEP(

66/+122)CAT].
Strikingly, the construct pEusr(

66/+112)CAT,
containing 67 bp
of additional sequence from the usr (nt

531 to

598) between
the enhancer and the MIEP TATA box, resulted in
approximately
90% inhibition of enhancer-mediated activation of
transcription
[Fig.
4B; compare CAT responses for pE(

66/+112)CAT and
pEusr(

66/+112)CAT].
These results support the conclusion that
boundary element sequences
are capable of mediating repression of
enhancer function on a
heterologous promoter.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
Boundary domain sequences within the UL127 promoter
confer repression on a heterologous promoter. (A) Schematic
representation of constructs pMIEP( 66/+112)CAT, pE( 66/+112)CAT, and
pEusr( 66/+112)CAT. Numbers refer to nucleotide positions relative to
the MIEP transcription start site (+1, indicated by an arrow). The
enhancer region, the boundary segment, and the core promoter containing
the MIEP TATA box are shown. (B) HFF, U373-MG, and NT-2/D1 cells were
transfected with 5 µg of either pMIEP( 66/+112)CAT,
pE( 66/+112)CAT, or pEusr( 66/+112)CAT along with 5 µg of the
control plasmid pRSV- -gal. Transfections and CAT assays were
performed as described in the legend to Fig. 2 and in Materials and
Methods. A plot of the normalized percentage of CAT activity calculated
for each construct, taking as 1 the activity presented by
pMIEP( 66/+112), is shown. The CAT values shown represent the
average ± standard deviation (bars) of three determinations.
|
|
We next sought to evaluate whether this mode of repression could also
be observed in in vitro transcription assays. In these
experiments,
reporter plasmids pMIEP(

66/+112)CAT, pE(

66/+112)CAT,
and
pEusr(

66/+112)CAT were resected with
EcoRI and assayed in
transcription runoff assays using HeLa cell nuclear extracts.
Transcription reactions were normalized to an internal control
standard, and the amount of specific initiation of transcription
was
quantified by PhosphorImager analysis. As shown in Fig.
5B,
the template with the MIEP core
promoter [pMIEP(

66/+112)CAT]
(lane 1) was transcribed at a much
(fivefold) reduced level in
comparison with the enhancer-containing
template, pE(

66/+112)CAT
(lane 2), indicating the ability of the CMV
enhancer to stimulate
transcription in vitro, albeit at a level much
lower than observed
in vivo. This level of enhancer-mediated activation
was significantly
lower than for transcription reactions using the
pEusr(

66/+112)CAT
template (compare lanes 2 and 3 in Fig.
5B).
Similar inhibition
results were obtained with different concentrations
of reporter
template (data not shown). These results suggest that
cis-acting
sequences within the usr repress enhancer
activated transcription
but do not appear to influence basal promoter
activity. This is
consistent with the HeLa cell transfection assay,
which indicated
a reduction of transcriptional activity by as much as
90% (Fig.
5A). These experiments indicate that it is possible to
recapitulate,
in part, repression by the boundary domain with the use
of an
in vitro transcription system, supporting the notion that these
sequences may interact with repressor proteins to promote the
process
of transcriptional repression.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5.
Boundary domain sequences within the UL127 promoter
mediate repression in an in vitro transcription system. (A) HeLa cells
were transfected with 5 µg of either pMIEP( 66/+112)CAT (lane 1),
pE( 66/+112)CAT (lane 2), or pEusr( 66/+112)CAT (lane 3) along with 5 µg of the control plasmid pRSV- -gal. Transfections and CAT assays
were performed as described in the legend to Fig. 2 and in Materials
and Methods. A plot of the normalized percentage of CAT activity
calculated for each construct, taking as 1 the activity presented by
pMIEP( 66/+112), is shown. (B) In vitro runoff transcription assays
with different DNA templates, pMIEP( 66/+112)CAT (lane 1),
pE( 66/+112)CAT (lane 2), and pEusr( 66/+112)CAT (lane 3), linearized
with EcoRI. The transcription reactions were performed,
processed, and subjected to polyacrylamide gel electrophoresis
(18). The 360-nt specific runoff transcript is indicated by
an arrow. The specific runoff transcripts were normalized to an
internal control, and the amount of transcript was determined by
PhosphorImager analysis (42). A plot of the normalized
percentage of specific transcription for each DNA template, taking as
100 the activity developed by pE( 66/+112)CAT, is shown.
|
|
UL127 promoter-proximal upstream sequences mediate repression of
transcription in the context of an HCMV infection.
To determine
whether this boundary domain is responsible for mediating repression of
the UL127 promoter in an HCMV-infected cell, we constructed a series of
HCMV recombinants containing coding sequences for the GFP under the
control of various UL127 promoter deletion mutants. To generate these
HCMV recombinants, we used the recently described HCMV BAC system
(6). In this system, the HCMV genome has been cloned and
maintained as a BAC in E. coli, whereby viral progeny can be
reconstituted after transfection of the HCMV BAC into eukaryotic cells
permissive for HCMV. For the purpose of these studies, we constructed
three independent HCMV BAC recombinant genomes, UL127-GFP1, UL127-GFP7,
and UL127-GFP10. A schematic representation of parental HCMV and the
HCMV BAC recombinants generated is shown in Fig.
6A. The recombinant virus, UL127-GFP1, contains the GFP ORF under the control of the UL127 promoter lacking sequences between nt
673 and
691, removing the 5' proximal NF-1 site. Note that in transient transfection assays, deletion of these
sequences did not result in any significant promoter activity. The
second recombinant HCMV BAC, UL127-GFP10, contains the GFP ORF under
the control of the UL127 promoter lacking sequences between nt
531
and
638 (Fig. 6A). Note that UL127-GFP10 also contains a disrupted
5'-proximal NF-1 site between nt
688 and
676 (see Materials and
Methods). The third HCMV recombinant, UL127-GFP7, contains the UL127
promoter lacking sequences between
531 and
691 (Fig. 6A). The
structure of the recombinant BACs generated was verified by extensive
restriction analysis (SalI, SnaBI, and
SpeI) and sequencing. Figure 6B shows the SalI
restriction patterns. The DNAs from the recombinant HCMV BACs were
identical to the DNA from the parental HCMV BAC pHB5 except for the
presence of a new SalI fragment (7.9 to 8.1 kb) in the place
of the natural SalI 7.4-kb fragment. This new fragment was
generated, as predicted, from the introduction of the GFP ORF
downstream of the mutant UL127 promoter sequences (Fig. 6A). These
results indicate that the expected recombination events occurred within
the UL127 region of the viral genome. MRC-5 cells were subsequently
transfected with the HCMV BAC recombinants. Plaques developed in the
cultures, and progeny mutant viruses were recovered from infected
cells.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
Construction of UL127-GFP HCMV BAC recombinant genomes.
(A) The top line represents the parental (wt) HCMV genome with the
SalI fragment (nt 169746 to 177147 [11])
containing the MIE region expanded below. Sequences corresponding to
the enhancer and usr (open rectangle) and the UL127 ORF (black box) are
indicated. Recombinant HCMV BAC genomes, UL127-GFP1, UL127-GFP10, and
UL127-GFP7, containing the GFP ORF (open rectangle) under the control
of the various UL127 promoter deletion mutants are shown. UL127
promoter deletions are indicated by black boxes, and the coordinates
for these deletions relative to the HCMV ie1/ie2
transcription start site are shown. The diagram is not drawn to scale.
(B) Ethidium bromide-stained agarose gels of SalI-digested
BAC plasmids UL127-GFP1, UL127-GFP10, UL127-GFP7, and parental HCMV BAC
(pHB5) after separation on a 0.5% agarose gel. Positions of size
markers are shown at the right; sizes of the natural and new
SalI fragments for each virus are shown with arrows.
|
|
We next sought to examine whether deletion of repressor sequences
within the UL127 promoter, identified in transient transfection
assays,
could also lead to an induction of transcription from
the UL127
promoter in the context of a viral infection. For these
experiments,
RT-PCR was performed using RNA from cells infected
with the recombinant
viruses under study. HFF cells were infected
at an equivalent MOI (0.1 PFU/cell) with the different recombinant
viruses and parental HCMV
RVHB5 reconstituted from the BAC plasmid
pHB5 as a negative control
(
6). RNA from infected cells was
harvested at 13 hpi,
treated with DNase, and reverse transcribed.
Two primer sets were
designed to detect the presence of the GFP
transcript. Both primer sets
contained a common 3' primer within
the GFP gene. In the first primer
set, the 5' primer was chosen
to anneal with sequences 29 to 55 bp
downstream the predicted
UL127 TATA box. This primer pair should detect
a 714-bp product
if GFP transcripts were present in infected cells. In
the second
primer set, the 5' primer was designed to anneal with the
predicted
UL127 TATA box. This second primer set should either fail to
detect
a product in infected cells if the predicted UL127 TATA box was
used to transcribe the GFP gene or yield a 750-bp product in the
case
of using an alternative TATA box upstream the predicted UL127
TATA box.
As expected, when cells were infected with the parental
virus RVHB5,
which does not contain the GFP gene, a specific PCR-amplified
product
was not detected with any of the two primer sets used
(Fig.
7A and B,
lane 2). Similarly, when cells were
infected with
UL127-GFP1, the recombinant virus in which sequences from

673
to

691 of the UL127 promoter were absent, amplified PCR
products
were not obtained (Fig.
7A and B, lanes 4). In marked
contrast,
in cells infected with UL127-GFP7 and

10, the expected
714-bp
PCR product resulting from amplification of GFP sequences using
the first primer set was easily detected (Fig.
7A, lanes 6 and
8).
However, RT-PCR performed on HFF cells infected with these
two viral
recombinants using the second primer set that contained
the primer
designed to anneal within the predicted UL127 TATA
box did not yield
significant levels of an amplified product (Fig.
7B, lanes 6 and 8).
These data show that sequences between

531
and

638 (relative to the
MIEP) play an important role in the
blockage of the UL127 promoter in
the context of a viral infection.
In addition, these results indicate
that transcription in cells
infected with recombinant viruses lacking
the boundary repressor
sequences predominantly originates approximately
30 bp downstream
the UL127 promoter TATA box. Interestingly,
transcripts derived
from the UL127 promoter are cycloheximide
sensitive, indicating
early expression kinetics instead of the
anticipated IE expression
(data not shown).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 7.
Detection of GFP transcripts in HFF cells infected with
UL127-GFP HCMV recombinants. HFF cells were infected at an MOI of 0.1 with parental HCMV (RVHB5; lanes 1 and 2), UL127-GFP1 (lanes 3 and 4),
UL127-GFP10 (lanes 5 and 6), and UL127-GFP7 (lanes 7 and 8). Total RNA
was harvested at 13 hpi, treated with DNase, and reverse transcribed by
using oligo(dT). PCR was performed using three different primer sets:
one containing a 3' primer that anneals within the GFP gene, GFP-R, and
a 5' primer situated 29 to 55 bp downstream the predicted UL127 TATA
box, GFP-F (A); one containing primer GFP-R and a 5' primer located
within the predicted UL127 TATA box, UL127-TATA (B), and one specific
for the human tissue factor gene (C). Amplified products were separated
on a 1% agarose gel and visualized by ethidium bromide staining. Shown
are products obtained in reactions containing RT (lanes 2, 4, 6, and 8)
and in control reactions in which RT was not added (lanes 1, 3, 5, and
7). Position of size markers are shown at the left; sizes of the
amplified products are indicated by arrows.
|
|
To further corroborate whether sequences within the UL127 promoter
repress transcription in the context of a viral infection,
we examined
GFP reporter activity using confocal microscopy and
FACS. In the first
experiments, HFF cells were infected at an
MOI of 0.5 PFU/cell with
recombinant viruses UL127-GFP1, UL127-GFP7,
and UL127-GFP10 and
parental HCMV RVHB5. On day 3 postinfection,
cells were fixed, prepared
for immunofluorescence analysis using
a monoclonal antibody specific
for the MIE proteins and a secondary
antibody conjugated to TRITC, and
visualized by confocal microscopy.
As expected, when cells were
infected with the parental virus
RVHB5, only nuclear staining due to
the expression of the MIE
proteins could be observed (Fig.
8, panels 1A
and 2A). When cells
were infected with
UL127-GFP1, with sequences from

673 to

691
of the UL127 promoter
deleted, GFP fluorescence was not detectable,
while cells were clearly
positive for expression of the MIE proteins
(compare panels 1B and 2B
in Fig.
8). In marked contrast, infection
of HFF with UL127-GFP7
and UL127-GFP10 resulted in significant
amounts of GFP expression.
Confocal microscopy images showed that
infected HFF cells
simultaneously exhibited nuclear staining due
to the MIE proteins and
expressed GFP in the nucleus and cytoplasm
(Fig.
8, panels C1 to -3 and
D1 to -3). Therefore, sequences between

531 and

638 (relative to
the MIEP) are sufficient in shutting
off the UL127 promoter in the
context of a viral infection in
cells where the divergent MIE promoter
is strongly active.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 8.
Confocal microscopy of HFF cells infected with UL127-GFP
HCMV recombinants. HFF cells were infected with parental HCMV (RVHB5;
A), UL127-GFP1 (B), UL127-GFP10 (C), and UL127-GFP7 (D) at an MOI of
0.5 PFU/cell. Three days after infection, cells were fixed,
permeabilized, and subjected to immunofluorescence using an HCMV IE
monoclonal antibody and a TRITC-anti-mouse secondary conjugate.
Expression of MIE proteins can be visualized in panels 1 (red),
expression of GFP is evident in panels 2 (green), and panels 3 show the
merge of panels 1 and 2. Magnification, ×63.
|
|
In the next set of experiments, we quantified the levels of reporter
activity by directly measuring GFP levels. For these
experiments, we
infected HFF cells at an MOI of 0.5 PFU/cell with
the different
recombinant viruses and measured fluorescence on
day 3 postinfection by
flow cytofluorometry. Figure
9 shows that
while all cells were GFP negative after infection with UL127-GFP1
(mean
fluorescence intensity with a signal-to-noise ratio of 1.3),
HFF cells
infected with UL127-GFP7 exhibited approximately twofold-higher
levels
of GFP in comparison with UL127GFP10-infected cells (compare
mean
fluorescence intensities with signal-to-noise ratios of 7.2
and 14.1 for UL127-GFP10 and UL127-GFP7, respectively). These
results indicate
that maximal derepression of the UL127 promoter
in the context of the
viral infection requires the removal of
sequences from

531 to

673.
Thus, these data are consistent with
the role of sequences between

556 and

638 of the UL127 promoter
as a repressor of gene expression
in transient transfection assays.
However, sequences between

638 and

673 also appear to contribute
to the level of repression of the UL127
promoter but only in the
context of an HCMV infection.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 9.
GFP expression from UL127 GFP HCMV recombinants. HFF
cells were infected with UL127-GFP1, UL127-GFP10, and UL127-GFP7 at an
MOI of 0.5 PFU/cell. On day 3 postinfection, cells were trypsinized and
fixed with 1% formaldehyde. Fluorescence was measured by flow
cytofluorometry as described in Materials and Methods. A histogram of
FL1 versus the log fluorescence intensity (detected at 530 nm) is
shown. A total of 10,000 events were collected for each sample. Mean
fluorescence intensities with signal-to-noise ratios of 25.4/19.8,
134.6/18.8, and 222.1/15.8 were obtained for UL127-GFP1, UL127-GFP10,
and UL127-GFP7, respectively.
|
|
 |
DISCUSSION |
We have presented evidence for the presence of a boundary domain
located within the usr of the HCMV MIEP, whereby the putative UL127
promoter is prevented from being activated by the potent CMV enhancer.
The borders of the boundary domain are positioned between the UL127
TATA box and the enhancer. Our experiments define a region between
556 and
638 (relative to the MIEP start site) that functions to
dramatically repress enhancer activation of transcription at the UL127
promoter site both in transient transfection assays and in the context
of virus infection. In addition, sequences between
638 and
673 were
found to contribute to the level of repression only in the context of
virus infection but not in transient transfection experiments.
Previously, DNase I protection experiments with DNA fragments
encompassing usr sequences demonstrated (18), on the basis of different chromatographic behavior, the interaction of multiple distinct factors. Later experiments identified one of these binding components as composed of a retinoic acid receptor-retinoid X receptor
(RAR-RXR) heterodimer (2). While DNA-bound RAR-RXR complexes
are known to recruit transcriptional corepressors in the absence of
bound ligand (12, 29), our mapping studies show that this
site is not required for mediating repression. Sequences immediately
adjacent to the RAR-RXR site, between nt
558 and
602 (relative to
the MIEP), interact with a complex of proteins that have similar
chromatographic behavior (18) (Fig.
10). These sequences resemble binding
sites for the forkhead/winged helix family of transcription factors
(8, 16, 32). Many members of this family are known to be
potent repressors of transcription. These observations suggest that one
of the candidate repressor elements may bind a cluster of winged helix
repressors, although our results indicate that the repression domain is
not limited to these sites alone (Fig. 10). For instance, the binding
site between
604 and
632 participates in mediating repression and is known to interact with a factor that shares characteristics of the
CTF family but is distinct from NF-1 (18) (Fig. 10). In addition, sequences (
638 to
673) between the CTF-like binding site
and the NF-1 site proximal to the UL127 TATA box also appear to
contribute to repression only in the context of the virus (Fig. 10).
This region is not known to interact strongly with any nuclear factors
but contains weak binding sites for YY1 (from nucleotide positions
675 to
663 and
655 to
642), a factor also known to mediate
transcriptional repression (T. Stamminger, personal communication).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 10.
Sites of protein-DNA interaction on MIEP sequences
between 538 and 738. Sequences between 556 and 638,
corresponding to the repressor region defined in transient transfection
assays, are marked by reverse print. Sequences from 638 to 673,
shown to contribute to repression of the UL127 promoter in the context
of the infection, are marked by a gray box. Black underlining
represents the extent of strong protection observed using the
phosphocellulose (p11) gel chromatography fractions P11 0.3, P11 0.6, and P11 1 (18). The cellular factors known to interact with
the protected sequences are indicated. The UL127 TATA box is shown.
Numbers refer to nucleotide positions relative to the transcription
start site (+1) of the MIEP.
|
|
Recently, Lundquist and coworkers presented work on the
characterization of a repressor region located upstream of the UL127 promoter (33). They found that sequences between
640 and
694 contribute to strong repression, while sequences between
583 and
640 effected repression to a much lesser extent in the context of
the viral infection. The results of our study are in agreement with
theirs regarding the presence of a repressor region but differ markedly
in the precise sequences shown to be important in mediating the shutoff
of UL127 expression. We believe that the conclusions drawn from these
two independent studies are complementary. In particular, it is likely
that the reason for the weaker repression observed by Lundquist et al.
(33) for the distal repression sequences (
583 to
640) is
that repression sequences between nt
556 and
583 were not removed.
Indeed, resection of sequences between
556 and
638 in the context
of an infection leads to a dramatic relief of repression (this study).
Also in agreement with the work by Lundquist et al. (33), we
found that sequences closer to the UL127 TATA box contribute to
repression but only in the context of the virus. However, we note that
removal of sequences between nucleotide positions
673 and
691 alone
was not sufficient, in our study, to effect activation of the UL127 promoter. Therefore, while our results are different and agree only in
part, they are highly complementary.
We note that the inability of the boundary region to repress the MIEP
over a relatively large distance is compatible with a short-range
repression mechanism (21). In this case, binding of
repressors to promoter-proximal elements results in the dominant inhibition of a promoter site by upstream activators. Boundary elements
have been identified in numerous drosophila and yeast genes (references
22, 26, and 40 and references
therein), but few if any have been formally characterized for mammalian genes. In drosophila, short-range repressors have been elegantly shown
to provide flexibility in controlling complex genetic loci. Indeed,
Gray and coworkers (23) proposed that short-range repression is central for the evolution of complex promoters that are composed of
multiple, autonomous regulatory elements as is prominently exhibited by
the CMV MIEPs. Although the nature of the enhancer-repressor-promoter interaction is unclear, the results of this study indicate that the
viral boundary domain blocks enhancer activation in a disproportional manner. In other words, there are far more activators bound to the
enhancer region than there are potential repressor binding sites in the
boundary region. There are several possible explanations for the
ability of a limited repressor complex to block many activators, some
of which challenge our view of how enhancers work. Perhaps the boundary
domain recruits by protein-protein interaction a multifactor repression
complex that is able to interfere with many activators. Alternatively,
it is possible that multiple activators present in the enhancer
coordinate communications with the basal transcription machinery by
interacting with a central switching (adapter/nodal) complex. In this
scenario, the boundary domain might disrupt the ability of the
adapter/node to interact with the promoter. It should be noted that
there is a precedent for a central switching unit in coordinating
interactions with all other cis-acting regulatory modules,
as demonstrated by the Endo16 system of the sea urchin embryo
(43). In this example, module A of the Endo16
cis-regulatory system communicates the status of the whole
regulatory system directly to the basal transcription machinery. All
upstream sites work through module A and in the endogenous arrangement
do not themselves interact directly with the basal transcription apparatus.
In conclusion, we have shown that repression can play an important role
in determining the ability of the enhancer to activate transcription.
Until now the usr was characterized as a positive control region for
the MIEP (2, 18). We now show that the ability of the HCMV
enhancer to bidirectionally activate transcription is stringently
regulated in a negative manner by a boundary domain. This work thus
provides a molecular explanation for limiting the action of the
enhancer to the MIEP. Restricting the boundary of action of the CMV
enhancer is likely to have important biological implications for
ensuring sequential and coordinate regulation of transcription. It may
not be advantageous or may even be deleterious to the virus to have
genes, other than select IE genes, influenced by the proximal and
long-range effects of an innately strong enhancer. The identification
of the repressor proteins and target sequences, the precise mechanism
for effecting inhibition, and the functional consequences of altered
physiological states on UL127 promoter activation are topics that
remain to be explored.
 |
ACKNOWLEDGMENTS |
We thank Fátima García del Rey for technical
assistance, Susanne Etteldorf for help with the confocal microscopy,
and Joe Trotter for help with the FACS analysis. We also thank Mark
Stinski for making the results of his group's study available prior to publication.
This work was supported by grants from the National Institutes for
Health and Novartis to P.G. A.A. was a fellow of the Ministerio de
Educación y Ciencia (Spain) and is currently supported by a
fellowship from the University of California Universitywide AIDS
Research Program. P.G. is a Scholar of the Leukemia Society of America.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Immunology and Molecular Biology, Division of Virology R307B, The
Scripps Research Institute, 10550 N. Torrey Pines Rd., La Jolla, CA
92037. Phone: (858) 784-8678. Fax: (858) 784-9272. E-mail:
ghazal{at}scripps.edu.
Publication 10492-IMM from The Scripps Research Institute.
Present address: Signal Pharmaceuticals, San Diego, Calif.
 |
REFERENCES |
| 1.
|
Adhya, S.,
M. Geanacopoulos,
D. E. Lewis,
S. Roy, and T. Aki.
1998.
Transcription regulation by repressosome and by RNA polymerase contact.
Cold Spring Harbor Symp. Quant. Biol.
63:1-9[CrossRef][Medline].
|
| 2.
|
Angulo, A.,
C. Suto,
R. A. Heyman, and P. Ghazal.
1996.
Characterization of the sequences of the human cytomegalovirus enhancer that mediate differential regulation by natural and synthetic retinoids.
Mol. Endocrinol.
10:781-793[Abstract/Free Full Text].
|
| 3.
|
Angulo, A.,
M. Messerle,
U. H. Koszinowski, and P. Ghazal.
1998.
Enhancer requirement for murine cytomegalovirus growth and genetic complementation by the human cytomegalovirus enhancer.
J. Virol.
72:8502-8509[Abstract/Free Full Text].
|
| 4.
|
Baskar, J. F.,
P. P. Smith,
G. S. Climent,
S. Hoffman,
C. Tucker,
D. J. Tenney,
A. M. Colberg-Poley,
J. A. Nelson, and P. Ghazal.
1996.
Developmental analysis of the cytomegalovirus enhancer in transgenic animals.
J. Virol.
70:3215-3226[Abstract].
|
| 5.
|
Baskar, J. F.,
P. P. Smith,
G. Nilaver,
R. A. Jupp,
S. Hoffmann,
N. J. Peffer,
D. J. Tenney,
A. M. Colberg-Poley,
P. Ghazal, and J. Nelson.
1996.
The enhancer domain of the human cytomegalovirus major immediate-early promoter determines cell-type-specific expression in transgenic mice.
J. Virol.
70:3207-3214[Abstract].
|
| 6.
|
Borst, E.,
G. Hahn,
U. H. Koszinowski, and M. Messerle.
1999.
Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: a new approach for construction of HCMV mutants.
J. Virol.
73:8320-8329[Abstract/Free Full Text].
|
| 7.
|
Boshart, M.,
F. Weber,
G. Jahn,
K. Dorsch-Hasler,
B. Fleckenstein, and W. Shaffner.
1985.
A very strong enhancer is located upstream of an immediate-early gene of human cytomegalovirus.
Cell
41:521-530[CrossRef][Medline].
|
| 8.
|
Bravieri, R.,
T. Shiyanova,
T. H. Chen,
D. Overdier, and S. Liao.
1997.
Different DNA contact schemes are used by two winged helix proteins to recognize a DNA binding sequence.
Nucleic Acids Res.
25:2888-2896[Abstract/Free Full Text].
|
| 9.
|
Cardin, R. D.,
G. B. Abenes,
C. A. Stoddart, and E. S. Mocarski.
1995.
Murine cytomegalovirus IE2, an activator of gene expression, is dispensable for growth and latency in mice.
Virology
209:236-241[CrossRef][Medline].
|
| 10.
|
Chambers, J.,
A. Angulo,
D. Amaratunga,
H. Guo,
Y. Jiang,
J. S. Wan,
A. Bittner,
K. Frueh,
M. R. Jackson,
P. A. Peterson,
M. G. Erlander, and P. Ghazal.
1999.
DNA microarrays of the complex human cytomegalovirus genome: profiling kinetic class with drug sensitivity of viral gene expression.
J. Virol.
73:5757-5766[Abstract/Free Full Text].
|
| 11.
|
Chee, M. S.,
A. T. Bankier,
S. Beck,
R. Bohni,
C. M. Brown,
R. Cerny,
T. Hornsnell,
C. A. Hutchinson III,
T. Kouzarides,
J. A. Martignetti,
E. Preddie,
S. C. Satchwell,
P. Tomlinson,
K. M. Weston, and B. G. Barrell.
1990.
Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169.
Curr. Top. Microbiol. Immunol.
154:125-169[Medline].
|
| 12.
|
Chen, J. D., and R. M. Evans.
1995.
A transcriptional co-repressor that interacts with nuclear hormone receptors.
Nature
377:454-457[CrossRef][Medline].
|
| 13.
|
Cherepanov, P. P., and W. Wackernagel.
1995.
Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant.
Gene
158:9-14[CrossRef][Medline].
|
| 14.
|
Cherrington, J. M.,
E. L. Khoury, and E. S. Mocarski.
1991.
Human cytomegalovirus ie2 negatively regulates gene expression via a short target sequence near the transcription start site.
J. Virol.
65:887-896[Abstract/Free Full Text].
|
| 15.
|
Dorsch-Hasler, K.,
G. M. Keil,
F. Weber,
M. Jasin,
W. Schaffner, and U. H. Koszinowski.
1985.
A long and complex enhancer activates transcription of the gene encoding for the highly abundant immediate early mRNA in murine cytomegalovirus.
Proc. Natl. Acad. Sci. USA
82:8325-8329[Abstract/Free Full Text].
|
| 16.
|
Freyaldenhoven, B. S.,
M. P. Freyaldenhoven,
J. S. Iacovoni, and P. K. Vogt.
1997.
Avian winged helix proteins CWH-1, CWH-2, and CWH-3 repress transcription from Qin binding sites.
Oncogene
15:483-488[CrossRef][Medline].
|
| 17.
|
Ghazal, P.
1989.
A rapid and selective method for generating deletions, insertions and clustered point mutations.
BioTechniques
7:8325-8329.
|
| 18.
|
Ghazal, P.,
H. Lubon,
C. Reynolds-Kohler,
L. Hennighausen, and J. A. Nelson.
1990.
Interactions between cellular regulatory proteins and a unique sequence region in the human cytomegalovirus major immediate-early promoter.
Virology
174:18-25[CrossRef][Medline].
|
| 19.
|
Ghazal, P., and J. A. Nelson.
1991.
Enhancement of RNA polymerase II initiation complexes by a novel DNA control domain downstream from the cap site of the cytomegalovirus major immediate-early promoter.
J. Virol.
65:2299-2307[Abstract/Free Full Text].
|
| 20.
|
Ghazal, P., and J. Nelson.
1993.
Transcription factors and viral regulatory proteins as potential mediators of human cytomegalovirus pathogenesis, p. 360-383.
In
Y. Becker, G. Darai, and E.-S. Huang (ed.), Molecular aspects of human cytomegalovirus diseases. Springer-Verlag Publishers, Heidelberg, Germany.
|
| 21.
|
Gray, S.,
H. Cai,
S. Barolo, and M. Levine.
1995.
Transcriptional repression in the Drosophila embryo.
Philos. Trans. R. Soc. Lond. B
349:257-262[Medline].
|
| 22.
|
Gray, S., and M. Levine.
1996.
Short-range transcriptional repressors mediate both quenching and direct repression within complex loci in Drosophila.
Genes Dev.
10:700-710[Abstract/Free Full Text].
|
| 23.
|
Gray, S.,
P. Szymanski, and M. Levine.
1994.
Short-range repression permits multiple enhancers to function autonomously within a complex promoter.
Genes Dev.
8:1829-1838[Abstract/Free Full Text].
|
| 24.
|
Grzimek, N. K.,
J. Podlech,
H. P. Steffens,
R. Holtappels,
S. Schmalz, and M. J. Reddehase.
1999.
In vivo replication of recombinant murine cytomegalovirus driven by the paralogous major immediate-early promoter-enhancer of human cytomegalovirus.
J. Virol.
73:5043-5055[Abstract/Free Full Text].
|
| 25.
|
Hennighausen, L., and B. Fleckenstein.
1986.
Nuclear factor 1 interacts with five DNA elements in the promoter region of the human cytomegalovirus major immediate-early gene.
EMBO J.
5:1367-1371[Medline].
|
| 26.
|
Huang, J. D.,
D. H. Schwyter,
J. M. Shirokawa, and A. J. Courey.
1993.
The interplay between multiple enhancer and silencer elements defines the pattern of decapentaplegic expression.
Genes Dev.
7:694-704[Abstract/Free Full Text].
|
| 27.
|
Jeang, K. T.,
D. R. Rawlins,
P. J. Rosenfeld,
J. H. Shero,
T. J. Kelly, and G. S. Hayward.
1987.
Multiple tandemly repeated binding sites for cellular nuclear factor 1 that surround the major immediate-early promoters of simian and human cytomegalovirus.
J. Virol.
50:1559-1570.
|
| 28.
|
Koedood, M.,
A. Fichtel,
P. Meier, and P. J. Mitchell.
1995.
Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.
J. Virol.
69:2194-2207[Abstract].
|
| 29.
|
Kurokawa, R.,
M. Soderstrom,
A. Horlein,
S. Halachmi,
M. Brown,
M. G. Rosenfeld, and C. K. Glass.
1995.
Polarity-specific activities of retinoic acid receptors determined by a co-repressor.
Nature
377:451-454[CrossRef][Medline].
|
| 30.
|
Lang, D., and T. Stamminger.
1994.
The 86-kilodalton IE-2 protein of human cytomegalovirus is a sequence-specific DNA-binding protein that interacts directly with the negative autoregulatory response element located near the cap site of the IE-1/2 transcriptional repressor.
Nucleic Acids Res.
22:3331-3338[Abstract/Free Full Text].
|
| 31.
|
Lee, G.,
J. Wu,
P. Luu,
P. Ghazal, and O. Flores.
1996.
Inhibition of the association of RNA polymerase II with the preinitiation complex by a viral transcriptional repressor.
Proc. Natl. Acad. Sci. USA
67:323-331.
|
| 32.
|
Li, J.,
H. Thurm,
H. W. Chang,
J. S. Iacovoni, and P. K. Vogt.
1997.
Oncogenic transformation induced by the Qin protein is correlated with transcriptional repression.
Proc. Natl. Acad. Sci. USA
94:10885-10888[Abstract/Free Full Text].
|
| 33.
|
Lundquist, C. A.,
J. L. Meier, and M. F. Stinski.
1999.
A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer.
J. Virol.
73:9039-9052[Abstract/Free Full Text].
|
| 34.
|
Macias, M., and M. F. Stinski.
1993.
An in vitro system for human cytomegalovirus immediate early 2 protein (IE2) mediated site dependent repression of transcription and direct binding of IE2 to the major immediate early promoter.
Proc. Natl. Acad. Sci. USA
90:707-711[Abstract/Free Full Text].
|
| 35.
|
Manning, C. M., and E. Mocarski.
1988.
Insertional mutagenesis of the murine cytomegalovirus genome: one prominent gene (ie2) is dispensable for growth.
Virology
167:477-484[Medline].
|
| 36.
|
Meier, J. L., and M. F. Stinski.
1997.
Effect of a modulator deletion on transcription of the human cytomegalovirus major immediate-early genes in infected undifferentiated and differentiated cells.
J. Virol.
71:1246-1255[Abstract].
|
| 37.
|
Messerle, M.,
G. M. Keil, and U. H. Koszinowski.
1991.
Structure and expression of murine cytomegalovirus immediate-early gene 2.
J. Virol.
65:1638-1643[Abstract/Free Full Text].
|
| 38.
|
Nelson, J. A.,
C. Reyonods-Kohler, and C. Smith.
1987.
Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene.
Mol. Cell. Biol.
7:4125-4129[Abstract/Free Full Text].
|
| 39.
|
Pizzorno, M. C., and G. S. Hayward.
1990.
The IE2 gene products of human cytomegalovirus specifically down regulate expression from the major immediate-early promoter through a target sequence located near the cap site.
J. Virol.
64:6154-6165[Abstract/Free Full Text].
|
| 40.
|
Small, S.,
R. Kraut,
T. Hoey,
T. Warrior, and M. Levine.
1991.
Transcriptional regulation of a pair-rule stripe in Drosophila.
Genes Dev.
5:827-839[Abstract/Free Full Text].
|
| 41.
|
Stenberg, R. M.,
J. Fortney,
S. W. Barlow,
B. P. Magrane,
J. A. Nelson, and P. Ghazal.
1990.
Promoter-specific trans activation and repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains.
J. Virol.
64:1556-1565[Abstract/Free Full Text].
|
| 42.
|
Wu, J.,
R. Jupp,
R. M. Stenberg,
J. A. Nelson, and P. Ghazal.
1993.
Site-specific inhibition of RNA polymerase II preinitiation complex assembly by human cytomegalovirus IE86 protein.
J. Virol.
67:7547-7555[Abstract/Free Full Text].
|
| 43.
|
Yuh, C. H.,
H. Bolouri, and E. H. Davidson.
1998.
Genomic cis-regulatory logic: experimental and computational analysis of a sea urchin gene.
Science
279:1896-1902[Abstract/Free Full Text].
|
| 44.
|
Zhang, Y.,
F. Buchholz,
J. P. Muyrers, and A. F. Stewart.
1998.
A new logic for DNA engineering using recombination in Escherichia coli.
Nat. Genet.
20:123-128[CrossRef][Medline].
|
Journal of Virology, March 2000, p. 2826-2839, Vol. 74, No. 6
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lashmit, P. E., Lundquist, C. A., Meier, J. L., Stinski, M. F.
(2004). Cellular Repressor Inhibits Human Cytomegalovirus Transcription from the UL127 Promoter. J. Virol.
78: 5113-5123
[Abstract]
[Full Text]
-
Chao, S.-H., Harada, J. N., Hyndman, F., Gao, X., Nelson, C. G., Chanda, S. K., Caldwell, J. S.
(2004). PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem.
279: 16111-16120
[Abstract]
[Full Text]
-
Swamynathan, S. K., Piatigorsky, J.
(2002). Orientation-dependent Influence of an Intergenic Enhancer on the Promoter Activity of the Divergently Transcribed Mouse Shsp/alpha B-crystallin and Mkbp/HspB2 Genes. J. Biol. Chem.
277: 49700-49706
[Abstract]
[Full Text]
-
Meier, J. L.
(2001). Reactivation of the Human Cytomegalovirus Major Immediate-Early Regulatory Region and Viral Replication in Embryonal NTera2 Cells: Role of Trichostatin A, Retinoic Acid, and Deletion of the 21-Base-Pair Repeats and Modulator. J. Virol.
75: 1581-1593
[Abstract]
[Full Text]
-
García-Ramírez, J. J., Ruchti, F., Huang, H., Simmen, K., Angulo, A., Ghazal, P.
(2001). Dominance of Virus over Host Factors in Cross-Species Activation of Human Cytomegalovirus Early Gene Expression. J. Virol.
75: 26-35
[Abstract]
[Full Text]