Previous Article | Next Article 
Journal of Virology, March 2000, p. 2804-2813, Vol. 74, No. 6
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of Contact Residues and Definition of the
CAR-Binding Site of Adenovirus Type 5 Fiber Protein
Ian
Kirby,1
Elizabeth
Davison,1
Andrew J.
Beavil,2
Cecilia P. C.
Soh,1
Thomas J.
Wickham,3
Peter W.
Roelvink,3
Imre
Kovesdi,3
Brian J.
Sutton,2 and
George
Santis1,*
Department of Respiratory Medicine and
Allergy, The Guy's, King's College, and St. Thomas' Hospitals School
of Medicine,1 and The Randall Institute,
King's College London,2 London SE1 9RT, United
Kingdom, and GenVec Inc., Rockville, Maryland
208523
Received 30 September 1999/Accepted 13 December 1999
 |
ABSTRACT |
The binding of adenovirus (Ad) fiber knob to its cellular receptor,
the coxsackievirus and Ad receptor (CAR), promotes virus attachment to
cells and is a major determinant of Ad tropism. Analysis of the
kinetics of binding of Ad type 5 (Ad5) fiber knob to the soluble
extracellular domains of CAR together (sCAR) and each immunoglobulin
(Ig) domain (IgV and IgC2) independently by surface plasmon resonance
demonstrated that the IgV domain is necessary and sufficient for
binding, and no additional membrane components are required to confer
high-affinity binding to Ad5 fiber knob. Four Ad5 fiber knob mutations,
Ser408Glu and Pro409Lys in the AB loop, Tyr477Ala in the DG loop, and
Leu485Lys in
strand F, effectively abolished high-affinity binding
to CAR, while Ala406Lys and Arg412Asp in the AB loop and Arg481Glu in
strand E significantly reduced the level of binding. Circular
dichroism spectroscopy showed that these mutations do not disorder the
secondary structure of the protein, implicating Ser408, Pro409, Tyr477,
and Leu485 as contact residues, with Ala406, Arg412, and Arg481 being
peripherally or indirectly involved in CAR binding. The critical
residues have exposed side chains that form a patch on the surface,
which thus defines the high-affinity interface for CAR. Additional
site-directed mutagenesis of Ad5 fiber knob suggests that the binding
site does not extend to the adjacent subunit or toward the edge of the
R sheet. These findings have implications for our understanding of the
biology of Ad infection, the development of novel Ad vectors for
targeted gene therapy, and the construction of peptide inhibitors of Ad infection.
 |
INTRODUCTION |
Adenovirus (Ad) is a group of
nonenveloped double-stranded DNA viruses associated with a range of
respiratory, ocular, and gastrointestinal infections (15).
There is a tendency for virus types within the same subgroups to be
associated with similar host tissue tropism and pathogenicity (15,
28). Entry of human Ad into human cells is a stepwise process
(10). The primary event in this sequence is attachment that
involves an interaction between the Ad fiber protein and its
high-affinity cellular receptor (4, 12, 26). Internalization
of virus particles as well as cell membrane permeabilization is
subsequently mediated through a specific interaction of the viral
penton base protein with cell surface integrins (1, 2, 5, 17, 18,
31-33).
The coxsackievirus and Ad receptor (CAR) is a 46-kDa transmembrane
protein that was initially identified as a cellular receptor for
coxsackie B viruses, Ad type 2 (Ad2), and Ad5 (3, 27). In
addition to subgroup C Ad fibers, CAR was also shown to bind to
subgroup A, D, E, and F Ad fibers but not to subgroup B Ad fibers like
serotype 3 or to the short fiber of subgroup F Ad (24). The
CAR sequence predicts a structure related to the immunoglobulin (Ig)
superfamily with the extracellular domain consisting of two Ig-related
regions, the amino-terminal IgV and IgC2 domains (3). The
IgV domain appears sufficient for virus attachment and infection (8), while the transmembrane and intracellular regions
appear dispensable for these functions (30). Expression and
cellular localization of CAR correlate with Ad5 infection and is
therefore an important determinant of Ad tropism (3, 5, 20, 22, 27, 29). The major histocompatibility complex class I
2 domain was also proposed as a high-affinity receptor for Ad2 and Ad5 fibers
(14). Its role, however, remains uncertain since the major histocompatibility complex class I allele HLA-A*0201 permanently expressed in hamster cells failed to bind to Ad5 fiber knob with high
affinity and there was no evidence of cooperativity between the two
proteins (6).
The Ad5 fiber is a homotrimer with each subunit consisting of three
domains: the amino-terminal tail that associates with the penton base
protein (7, 21); the shaft, which consists of a motif of
approximately 15 residues that is repeated 22 times (11);
and the knob, which interacts with the cellular receptor. The structure
of Ad5 fiber knob monomer is an eight-stranded antiparallel
sandwich composed of two
sheets, with loops and turns connecting the
strands (13, 34).
We recently showed that
strands E and F in Ad5 fiber knob may
contain binding residues for CAR (16, 25) and that deletion of two consecutive amino acids in the DG loop of the protein abolished binding to CAR through disruption of local interactions
(16). In the present study, we demonstrate that Ser408 and
Pro409 in the AB loop, Tyr477 in the DG loop, and Leu485 in
strand
F are in direct contact with CAR and that they constitute at least part of the binding site which is located at the periphery of the protein.
 |
MATERIALS AND METHODS |
Site-directed mutagenesis of Ad5 fiber knob.
Ad5 fiber knob
and 15 residues of the terminal repeating unit of the shaft
(nucleotides 32197 to 32783) were cloned into pKK233-3, an
isopropyl-
-D-thiogalactopyranoside-inducible procaryotic
expression vector (Pharmacia), to generate plasmid pF5knob,
as previously described (16, 25). Plasmid
pF5knob was used as the basis for the mutagenesis of Ad5
fiber knob. Single amino acid substitutions were introduced in
pF5knob using a QuikChange site-directed mutagenesis kit
(Stratagene). All mutations and the integrity of the remaining sequence
were confirmed by DNA sequencing. The following pairs of
complementary oligonucleotide primers were used to define each mutation
in Ad5 fiber: Ala406Lys,
5'-ttgtggaccacaccaaaaccatctcctaactgt and
5'-acagttaggagatggttttggtgtggtccacaa; Ser408Glu,
5'-accacaccagctccagaacctaactgtagacta and
5'-tagtctacagttaggttctggagctggtgtggt; Pro409Lys,
5'-acaccagctccatctaagaactgtagactaaat and
5'-atttagtctacagttcttagatggagctggtgt; Arg412Asp,
5'-ccatctcctaactgtgacctaaatgcagagaaa and
5'-tttctctgcatttaggtcacagttaggagatgg; Asn414Lys,
5'-cctaactggagactaaaggcagagaaagatgct and
5'-agcatctttctctgcctttagtctccagttagg; His456Glu,
5'-acagttcaaagtgctgagcttattataagattt and
5'-aaatcttataataagctcagcactttgaactgt; Ile458Ala,
5'-caaagtgctcatcttgcgataagatttgacgaa and
5'-ttcgtcaaatcttatcgcaagatgagcactttg; Ile458Glu,
5'-caaagtgctcatcttgagataagatttgacgaa and
5'-ttcgtcaaatcttatctcaagatgagcactttg; Asn470Glu,
5'-ggagtgctactaaacgaatccttcctggaccca and
5'-tgggtccaggaaggattcgtttagtagcactcc; Phe472Ala,
5'-ctactaaacaattccgcactggacccagaatat and
5'-atattctgggtccagtgcggaaatgtttagtag; Phe472Lys,
5'-ctactaaacaattcaagactggacccagaatat and
5'-atattctgggtccagcttggaaatgtttagtag; Asp474Arg,
5'-aacaattccttcctgcggccagaatattggaac and
5'-gttccaatattctggccgcaggaaggaattgtt;
Tyr477Ala, 5'-ttcctggacccagaagcttggaactttagaaat and 5'-atttctaaagttccaagcttctgggtccaggaa;
Arg481Glu, 5'-gaatattggaactttgagaatggagatcttact and 5'-agtaagatctccattctcaaagttccaatattc;
Asn482Glu, 5'-attggaactttagagagggagatcttactgaa and 5'-ttcagtaagatctccctctctaaagttccaata;
Gly483Glu,
5'-tggaactttagaaatgaagatcttactgaaggc and
5'-gccttcagtaagatcttcatttctaaagttcca; Asp484Ala,
5'-aactttagaaatggagctcttactgaaggcaca and
5'-tgtgccttcagtaagagctccatttctaaagtt; Leu485Lys,
5'-tttagaaatggagataaaactgaaggcacagcc and
5'-ggctgtgccttcagttttatctccatttctaaa; Lys506Ala,
5'-ctatcagcatatccagcatctcacggtaaaact and
5'-agttttaccgtgagatgctggatatgctgatag; Ser507Ala,
5'-tcagcatatccaaaagctcacggtaaaactgcc and
5'-ggcagttttaccgtgagcttttggatatgctga; and
Lys510Glu+Lys506Ala, 5'-ctatcagcatatccagcatctcacggtgaaactgccaaaagtaac and
5'-gttacttttggcagtttcaccgtgagatgctgctggatatgctgatag.
Expression and purification recombinant proteins.
Expression
and purification of wild-type and mutated Ad5 fiber knobs in
Escherichia coli were performed as previously described (13, 16, 25, 34).
The baculovirus expression vector system was used to express the
soluble extracellular domains of CAR (sCAR) and each domain (IgV and
IgC2) alone. The FLAG-tagged CAR sequences (24) were cloned
into the pAcSG2 baculovirus transfer vector downstream of the promoter
in a XhoI/KpnI-restricted manner to generate
transfer vectors pAcSG2-sCAR, pAcSG2-IgV, and pAcSG2-IgC2. These were
cotransfected with BaculoGold (Pharmingen) DNA vector in Sf9 cells to
generate recombinant baculovirus vectors. Recombinant baculoviruses
were amplified three to four times to obtain a high-titer stock for protein purification.
CAR sequences corresponding to IgV, IgC2, and both domains together
(sCAR) (3) were synthesized by PCR on CAR DNA using the
following oligonucleotide primer pairs: IgV,
5'-ACTCTCGAGATGGTATCACTACTCCTGAAGAGATGATTG and
5'-TGAGGTACCCTACTTGTCGTCGTCGTCCTTATAGTCCGCACCTGAAGGCTT;
IgC2, 5'-ACTCTCGAGATGAGATGTTACGTTGATGGATCTGAAGAAATT and
5'-TGAGGTACCCTACTTGTCGTCGTCGTCCTTATAGACTGAAGGAGGGACAACG; and
sCAR, 5'-ACTCTCGAGATGGTATCACTACTCCTGAAGAGATGATTG
and 5'-TGAGGTACCCTACTTGTCGTCGTCGTCCTTATAGACTGAAGGAGGGACAACG.
Surface plasmon resonance (SPR) analysis of interactions between
wild-type and mutant Ad5 fibers and soluble CAR. (i) Preparation of SPR
sensor surface.
Purified recombinant sCAR, IgV, and IgC2 domains
were coupled to the CM5 sensor chip, using the amine coupling reaction
according to the manufacturer's instructions. Briefly, the CM5 sensor
chip was activated using a solution of 50 mM
N-hydroxysuccinimide and 200 mM
N-ethyl-N'-(dimethylaminopropyl)carbonide to
activate the esters on the chip surface. sCAR, IgV, and IgC2 were then
injected over the activated surface until a sufficient quantity had
bound to the activated esters on the chip surface. A wide range of
resonance units (RU) were tested, with immobilization densities of 600 to 800 RU used in all final experiments. Residual esters were
inactivated by an injection of 1 M ethanolamine hydrochloride (pH 8.5).
Purified soluble Ad5 fiber knob was also immobilized on the chip, using the same approach as described above. Biacore AB supplied the BIAcore
system, CM5 sensor chip, and amine coupling kit.
(ii) SPR analysis of wild-type and mutant Ad5 fibers.
SPR
analysis of immobilized CAR proteins with recombinant wild-type and
mutant Ad5 fiber knobs was performed as follows. All interactions were
carried out at 25°C, using HBS (10 mM HEPES [pH 7.4], 150 mM NaCl,
3 mM EDTA, 0.005% P-20 surfactant) as the continuous flow buffer at
different flow rates (5, 10, 20, and 40 µl/min). A wide range of
concentrations (10 nM to 5 µM) of each protein was used as analyte,
with the analyte diluted in HBS and injected for a 120-s association
phase followed by HBS for approximately 60 s to monitor
dissociation of the bound analyte. The chip was then regenerated with
two 2-µl pulses of 25 mM HCl to remove analyte bound to the chip
surface. Sample injections onto a sensor chip with immobilized bovine
serum albumin as an irrelevant protein assessed nonspecific binding of
the analyte; injection onto an uncoated sensor chip assessed
nonspecific binding to the sensor chip. Nonspecific binding (<1%) was
subtracted from total binding for each case.
(iii) Kinetic analysis of SPR data.
The association
(ka) and dissociation
(kd) rate constants for a monophasic model of
binding were obtained using the BIAevaluation analysis package (version
2.1). The ability of the models to describe the experimental data was
determined by examination of the residual plots, which were calculated
by subtracting the experimental data points from the fitted curve.
Residual was small and randomly distributed around zero (range between
0.5 to
0.5). Nonspecific binding (<1%) was subtracted from specific
binding prior to kinetic analysis.
Cell binding competition experiments.
The efficiency
and affinity of wild-type and mutant recombinant Ad5 mutant fibers to
functional receptors on CHO-CAR cells (3) was determined
from cell binding competition assays between Ad5Luc3 (Ad5Luc3, obtained
from P. Boulanger, is a replication-competent virus which contains the
luciferase gene under the control of the simian virus 40 early promoter
inserted in the E3 region of the Ad5 genome) and recombinant Ad5 fiber
knobs, using the level of luciferase gene expression as the endpoint assay.
Confluent monolayers CHO-CAR cells were preincubated with increasing
amounts of recombinant proteins (0 to 100 µg/ml [final concentration] in serum-free media) at 4°C for 10 min prior to the
addition of Ad5Luc3 at a multiplicity of infection (MOI) of 10. After
incubation for 1 h at 4°C, the monolayers were washed to remove
unabsorbed virus; the cell monolayers were covered with prewarmed
complete medium, transferred to 37°C, incubated at that temperature
for 18 h, and then processed for luciferase assay. Luciferase
activity, expressed in relative light units, was assayed in cell
lysates by using the Promega luciferase assay system. The efficiency
with which mutant Ad5 fiber bound to CHO-CAR cell receptors was
assessed by measuring the reduction in luciferase activity in the
presence of various concentrations of mutant fiber protein. The
relative affinities of wild-type and mutant fiber binding to CAR were
assessed by measuring the amount of each protein required to achieve
50% of maximal inhibition of luciferase activity (IC50).
The capacity of recombinant sCAR, IgV, and IgC2 domains to attach to
Ad5 binding domains was assessed in cell binding competition experiments. Ad5Luc3 (MOI of 50) were preincubated in the presence or
absence of recombinant CAR proteins (0.1 to 100 µg/ml [final concentration]) prior to application to CHO-CAR cells for 1 h at
4°C. Cells were washed to remove unattached viral particles. Luciferase activity was assayed as described above.
Phenotypic analysis of recombinant mutated fibers.
Circular
dichroism (CD) measurements were performed on Jobin-Yvon (Longjumeau,
France) CD6 spectrophotometer using cylindrical quartz cells of 0.2-cm
path lengths. The spectrophotometer was calibrated for wavelength and
ellipticity using d-10-camphorsulfonic acid. Samples were
measured in the concentration range 0.9 to 1.4 mg/ml in 50 mM sodium
perchlorate (pH 6.5) at constant temperature in thermostated cell
holder. The CD data were analyzed for percentage
helix and
sheet as previously described (23).
Cells and viruses.
CHO cells and CHO-CAR cells
(3) were maintained in alpha medium (Gibco) supplemented
with 10% fetal calf serum. Ad5Luc3 was plaque purified twice and
propagated in 293 cells in accordance with established methods
(9).
 |
RESULTS |
Selection of Ad5 fiber knob mutations.
Ad5 fiber knob mutants
deleted of two consecutive amino acids between residues 485 and 493 in
the DG loop of the protein abolished high-affinity binding to CAR
(16). These five deletion mutant fibers accumulated as
stable trimers, but their CD spectra indicated that although there was
no disruption of the overall folding and secondary structure of the
protein, local conformational changes had occurred (16).
This implied the involvement of residues in neighboring loop regions.
One candidate region was the segment containing the
strands E and F
and the turn between them (residues 479 to 486) because substitution of
this sequence with the corresponding sequence in Ad3 resulted in
reduced receptor binding (16).
In this study, the region between
strands E and F and the
connecting loop was analyzed further. All amino acid residues with
surface-exposed side chains were mutated to generate mutant Ad5 fiber
knobs Arg481Glu, Asn482Glu, Gly483Glu, Asp484Ala, and Leu485Lys. We
also mutated residues Asn414 in the AB loop, His456 and Iso458 in
strand D, and Asn470, Phe472, and Asp474 in the DG loop because we
hypothesized that the region defined by these residues may be
maintained in its correct structural conformation by
strands E and
F and the adjoining part of the DG loop. Subsequent mutagenesis was
based on information obtained from functional analysis of the above
mutants. Residues Ala406, Ser408, Pro409, Arg412, and Tyr477 have
exposed side chains in regions adjacent to
strands E and F
(Fig. 1a and b). In addition, mutations
were introduced in a region between residues Lys506 and Lys510 in the DG loop (Lys506Ala, Ser507Ala, His508Glu, and the double mutant Lys506Ala+Lys510Glu) since residues in this region are only 2 nm from
the EF region on the adjacent subunit (Fig. 1b).


View larger version (7884K):
[in this window]
[in a new window]
|
FIG. 1.
(a) Stereo image showing the course of the polypeptide
chain (Ca atoms only) within a subunit of the fiber knob protein, and
the residues implicated in CAR binding in this study. In yellow
are residues which, when mutated, profoundly affect the affinity for
CAR (Ser408 and Pro409 in the AB loop, Tyr477 in the DG loop, and
Leu485 in strand F) and implicated as contact residues. In orange
are residues that may be only peripherally or indirectly involved in
CAR binding (Ala406 and Arg412 in the AB loop, Arg481 in strand E
[this report], and Tyr491 in the DG loop [16]). In
green are locations of residues (Ca atoms only) which, when
mutated, have no effect on CAR binding (Asn414, His456, Ile458, Asn470,
Phe472, Asp474, Asn482, Gly483, Asp484, Lys506, Ser507, His508, and
Lys510 [this report]; Thr492, Asn493, and Val495
[16]; and Cys428, Thr451, Lys526, Gly538, and Glu566
[data not shown]). The four-stranded sheet known as the R sheet
(see text) can be seen edge-on at the top right. (Coordinates were
taken from the crystal structure [13, 34], and the
images were produced by INSIGHTII [Molecular Simulations Inc.,
Cambridge, United Kingdom]). (b) Space-filling image (showing all
nonhydrogen atoms) of the fiber knob subunit in the same orientation as
in panel a, together with the two other subunits that form the trimer.
The three subunits are distinguished by color (purple, magenta, and
maroon), but the residues investigated by mutagenesis are colored in
the same way as in panel a, in each subunit. Only the CAR binding site
in the purple subunit is visible in this orientation, in which the
trimer is viewed at 90° to the trimer axis with the shaft connection
at the bottom. (c) The trimeric fiber knob protein as shown in panel b,
rotated 90° and viewed along the threefold axis, from the side
connected to the shaft. All three CAR-binding sites are visible in this
orientation.
|
|
The nucleotide sequences of all mutant fibers were determined; each
contained the appropriate mutation without any additional sequence
alterations. All mutant fiber knobs were expressed as soluble proteins
at high levels in bacteria (~10 mg/liter).
The first extracellular domain of CAR is
responsible for binding to Ad5 fiber knob.
It was recently shown
that IgV domain of CAR formed complexes with Ad2 fiber knob in vitro
and was sufficient to inhibit Ad2 infection of HeLa cells
(8). The kinetics of binding for this interaction and for
the interaction between the IgC2 domain IgC2 and CAR were, however, not
assessed. Recombinant CAR proteins expressed in bacteria are produced
as mainly insoluble and aggregated proteins (8); we
therefore expressed the two extracellular domains of CAR together
(sCAR) and independently (IgV and IgC2) in insect cells. The biological
activity of purified recombinant sCAR, IgV, and IgC2 proteins was
assessed first in cell binding competition experiments. We found that
sCAR and IgV domains inhibited Ad5 infection of CHO-CAR cells with
similar efficiencies and that the IgC2 domain had no effect on Ad5
infection of these cells (data not shown).
The kinetics of the interaction between wild-type Ad5 fiber knob and
CAR was assessed by SPR. Assays were performed with sCAR and the IgV
and IgC2 domains alone immobilized on the sensor surface, and both the
association and dissociation phases of the response curve were well
fitted to monophasic models (residual values ranged between 0.06 and
0.06).
The SPR analyses indicate that binding of sCAR and IgV domains to Ad5
fiber knob was specific, saturable, and dose dependent (Fig.
2). There was no specific binding between
Ad5 fiber knob and the IgC2 domain at all concentrations used (data not
shown). Figure 2 shows sensograms for the interaction of Ad5 fiber knob with sCAR and IgV. The ka and
kd values for Ad5 fiber knob binding to sCAR
were similar to the ka and
kd values of Ad5 fiber knob binding to the IgV
domain (Fig. 2), which indicates that sequence determinants of binding
to Ad5 fiber knob are localized within the first extracellular domain
of CAR. The dissociation constant for Ad5 fiber knob binding to sCAR
(14.8 × 10
9 M) and IgV (10.4 × 10
9 M), as shown in Fig. 2, was also comparable to that
previously determined by Scatchard analysis for the interaction between
Ad5 fiber knob and full-length CAR expressed on the cell surface of hamster cells (CHO-CAR cells) (4.75 × 10
9 M)
(6). These values are also in keeping with the binding constants (Kd ~ 10
9 M) reported
for Ad5 fiber obtained from infected cells and KB and HeLa cell plasma
membranes (19). This suggests that CAR binding to Ad5 fiber
knob requires no additional membrane cofactors. Assays were also
performed with wild-type Ad5 fiber knob immobilized on the chip and
sCAR, IgV, and IgC2 domains used as the analyte, with similar results
(data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
SPR sensograms for wild-type Ad5 fiber knob interacting
with sCAR (A) and IgV domain alone (B). Ad5 fiber knob was injected
over the sensor surface at multiple concentrations in the range of 10 nM to 5 µM. A 90- to 120-s association phase was followed by a 60-s
dissociation phase with HBS buffer flowing over the sensor surface at
10, 20, 30, and 40 µl/min. Representative sensograms of Ad5 fiber
knob as analyte at concentrations of 200 nM, 400 nM, and 5 µM are
shown.
|
|
Leu485 in
strand F is critical for Ad5 fiber knob binding to
CAR.
We mutated all residues with surface-exposed side chains
within short
strands E and F and the turn between them (residues 479 to 486) in Ad5 fiber knob and assessed their effect on fiber knob
binding to CAR.
Mutant Ad5 fiber knob binding to sCAR was determined by analysis of the
sensograms generated for the interaction between each of the mutants
and immobilized sCAR (Fig. 3 and
4). First, the maximal association
responses at equilibrium (which was attained in all cases) and the
dissociation kinetics at a fixed time point (in RU) for each mutant
were compared to the response obtained for wild-type Ad5 fiber knob
bound to sCAR (Fig. 3). Second, the kinetics of binding of mutant Ad5
fiber knob proteins to immobilized sCAR was also determined from the
sensograms (Fig. 4). Finally, the capacity for cell attachment of
recombinant mutant fibers to functional receptors on CHO-CAR cells was
estimated from cell binding competition assays between Ad5Luc3 and
recombinant fibers, using the level of luciferase gene expression as
the endpoint assay (Fig. 5). This assay
was used extensively in our previous studies and was found to correlate
well with binding data obtained by SPR and direct binding studies using
125I-labeled Ad5 fiber proteins (16, 25).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
SPR analysis of interactions between sCAR and wild-type
and mutant Ad5 fiber knobs. sCAR was immobilized on the CM5 chip. The
filled bars represent the maximal association response at equilibrium
in RU, and the open bars represent the response at a fixed time point
(60 s) into the dissociation phase. This permits comparison to be made
between wild-type and mutant fiber knob proteins in relation to their
association and dissociation kinetics.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
SPR sensograms of wild-type Ad5 fiber knob (a) and of
mutant Ad5 fiber knobs Ala406Lys (b), Arg481Glu (c), and Arg412Asp (d)
binding to immobilized sCAR. The various Ad5 fiber ligands were
injected over the sensor surface at three different concentrations (10, 50, and 200 nM). A 2-min association phase was followed by a 1-min
dissociation phase with HBS buffer flowing over the sensor surface at
10, 20, 30, and 40 µl/min. Representative sensograms with wild-type
and mutant Ad5 fiber knob proteins at a concentration of 200 nM used as
analyte are shown.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
CHO-CAR cell binding competition experiments between
wild-type or mutant Ad5 fiber knobs and Ad5Luc3. Cells were infected
with Ad5Luc3 (MOI of 10) in the presence of large excess of recombinant
full-length Ad5 fiber proteins (100 µg/ml). Ad5Luc3 was preincubated
with recombinant proteins at room temperature, and the mixture was
added to CHO-CAR cells precooled on ice. After incubation for 1 h
at 0°C, unabsorbed virus was rinsed off; the cell monolayers were
covered with prewarmed medium, transferred to 37°C, further incubated
at that temperature for 18 h, and then processed for luciferase
assay. Luciferase activity, expressed in relative light units, was
assayed in cell lysates using luciferase substrate solution. Results
were expressed as percentage reduction in luciferase activity compared
to the control cells (i.e., no recombinant fiber = 0%). The data
presented are means and standard errors of the means (n = 3) of three representative experiments.
|
|
We found that Ad5 fiber mutant Leu485Lys failed to associate with sCAR
at all concentrations used (Fig. 3). Leu485Lys also failed to compete
efficiently with Ad at concentrations up to 100 µg/ml (Fig. 5), and
its IC50 (10 µg/105 cells) was 100-fold
higher than the IC50 of wild-type Ad5 fiber knob (0.095 µg/105 cells) for membrane-bound CAR. These findings
demonstrate that Leu485Lys dramatically reduced Ad5 fiber knob binding
to CAR.
Four additional exposed residues in
strands E and F were also
mutated. Arg481Glu bound to sCAR with approximately 10-fold-lower affinity than wild-type Ad5 fiber knob (Fig. 4 and Table
1), predominantly due to an effect on the
dissociation rate (1.2 × 10
2, compared to 2.8 × 10
3 of the wild-type protein), as shown in Table 1.
Although Arg481Glu competed efficiently with Ad5Luc3 for CHO-CAR cell
receptors (Fig. 5), its IC50 (1 µg/105 cells)
was 10-fold higher than the IC50 of Ad5 fiber knob (0.095 µg/105 cells), indicating that it binds to CHO-CAR cell
receptors with reduced affinity. Asn482Glu, Gly483Glu, and Asp484Ala
mutant proteins bound to sCAR with similar affinity as the wild-type
protein (Fig. 3 and Table 1) and competed for CHO-CAR cell receptors
with similar efficiency (Fig. 5) and affinity (IC50s of
0.1, 0.09, and 0.35 µg/105 cells, respectively) as
wild-type Ad5 fiber knob. This would indicate that Asn482, Gly483, and
Asp484 are not in direct contact with CAR. This and the fact that
residues with exposed side chains in the immediate vicinity of Arg481
interacted with CAR with the same affinity as the wild-type protein
(16) indicate that Arg481 may not itself be in direct
contact with CAR, but that it may have an indirect effect on the
conformation of nearby contact residues.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Summary of kinetic data for the interaction of wild-type
and mutant Ad5 fiber knob proteins with sCAR, as determined
by SPRa
|
|
Identification of further candidate contact residues in the
CAR-binding site of Ad5 fiber knob.
Following the identification
of Leu485 as a critical residue for the interaction of Ad5 fiber knob
with CAR, we obtained additional mutants in order to characterize the
CAR-binding site. Four residues, Ala406, Ser408, and Pro409 in the AB
loop and Tyr477 in the DG loop, have exposed side chains in the same
region as Leu485 (Fig. 1a and b). We found that Ser408, Pro409, and
Tyr477 failed to bind to sCAR at all concentrations used (Fig. 3) and
also failed to compete efficiently with Ad5Luc3 for CHO-CAR cell
receptors (Fig. 5). In addition, their IC50s were
strikingly higher than that of Ad5 fiber knob (for Tyr477Ala, 100 µg/105 cells; for Ser408Glu, >100 µg/105
cells; for Ser408Glu, >100 µg/105 cells). These results
demonstrate that Ser408, Pro409, and Tyr477 are critical for Ad5 fiber
knob binding to CAR. Two other mutants, Ala406Lys and Arg412Asp,
competed as efficiently as the wild-type protein for CHO-CAR cell
receptors (Fig. 5), but their IC50s (0.5 and 2.5 µg/105 cells) were 5- and 25-fold higher, respectively,
than the IC50 of Ad5 fiber knob. Ala406Lys and Arg412Asp
both exhibited significantly lower levels of binding to sCAR,
principally due to a higher dissociation rate in the case of Arg412Asp
at least (Table 1 and Fig. 4). These finding suggest that Ala406 and
Arg412 are likely to be peripheral to the binding site (Fig. 1b).
Residues in
strand D and the DG loop (residues Asn470 to Asn474
and Lys506 to Lys510) do not interact with CAR.
Our previous
findings indicated that deletions in the DG loop dramatically reduced
Ad5 fiber knob binding to CAR due to local conformational changes
(16). One possibility was that these conformational changes
had disrupted the interaction between neighboring residues in the R
sheet of the protein and CAR. We therefore mutated residues Asn414 in
the AB loop, His456 and Ile458 in
strand D, and Asn470, Phe472, and
Asn474 in the DG loop. All of these residues have exposed and
accessible side chains at the edge of the R sheet and in the region
between this sheet and those residues already identified as contact
residues (Fig. 1a).
No significant differences were observed between the sensograms of
wild-type Ad5 fiber knob and each of eight mutant fiber knobs (Fig. 3).
The numbers of RU recorded during the association and dissociation
phases of the interaction were similar to those obtained with the
wild-type protein (Fig. 3), and analysis of the kinetics showed that
the ka and kd of mutant
fiber knobs Asn414Lys, His456Glu, Ile458Glu, Asn470Glu, Phe472Lys, and
Asp474Arg were, within error, the same as those of wild-type Ad5 fiber
knob (Table 1). In addition, all eight mutant proteins competed with
the same efficiency (Fig. 5) and affinity for CHO-CAR cell receptors (the IC50 of each of these mutant fiber knobs was <0.1
µg/105 cells) as the wild-type protein. These findings
demonstrate that these residues are unlikely to be in direct contact
with CAR.
We also investigated the possibility that the CAR-binding region in Ad5
fiber knob may involve residues on adjacent subunits. We therefore
mutated four surface-exposed residues in the DG loop, between Asn500
and Lys510. These residues are approximately 2 nm away from
strands
E and F across the subunit interface (Fig. 1b). We found that mutant
fiber knobs Lys506Ala, Ser507Ala, and His508Glu and the double mutant
Lys510Glu+Lys506Ala bound to sCAR with comparable affinities as the
wild-type protein (Fig. 3 and Table 1). Also, all four mutants competed
with similar efficiency (Fig. 5) and affinity with Ad5Luc3 for CHO-CAR
cell receptors (their IC50s were <0.1 µg/105
cells). Based on these findings, we propose that the region of interaction between Ad5 fiber knob and CAR does not span adjacent subunits.
Five other mutations, Cys428Ser in
strand B at the bottom of the
central depression, Lys526Tyr in the rim of the central depression,
Thr451Arg in the CD loop, Gly538Cys in the HI loop, and Glu566Lys in
the IJ loop, were analyzed and found to bind to sCAR and membrane-bound
CAR with similar affinities as their wild-type counterpart (data not shown).
Analysis of wild-type mutant Ad5 fiber knob proteins by CD
spectroscopy.
The consequence each mutation on the folding and
secondary structure of the Ad5 fiber knob was analyzed by CD
spectroscopy and by the ability to form stable trimers.
The secondary structure of mutant fiber knobs was assessed by CD
spectroscopy. In this and a recent study (16), we show that
the positive signal at 203 nm and the negative signal at 215 nm
observed in the spectrum of the wild-type Ad5 fiber knob (Fig.
6) are in full agreement with the known
-sheet structure of the Ad5 fiber knob monomer (11, 34).
The CD spectra of all Ad5 fiber mutants were identical to that of the
wild-type protein over the entire recorded spectrum (Fig. 6 and data
not shown). All mutants formed stable trimers as determined by gel filtration chromatography and native gel electrophoresis at all concentrations used in the various assays (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 6.
Comparisons of the CD spectrum of wild-type Ad5 fiber
knob with those of mutant fiber knob proteins. All samples were
measured in the concentration range of 0.9 to 1.4 mg/ml in 50 mM sodium
perchlorate (pH 6.5) in a 0.2-cm path length cell at constant
temperature.
|
|
 |
DISCUSSION |
In this study, we set out to characterize the CAR-binding site in
Ad5 fiber knob and to identify specific residues that may be in direct
contact with CAR. This work built on our previous studies, which showed
that the segment containing
strands E and F and the turn between
them (residues 479 to 486) in Ad5 fiber knob might contain residues
that are critical for receptor recognition (16).
Before discussing individual mutations, the interaction between
wild-type Ad5 fiber knob and CAR needs to be addressed. We found that
the dissociation constant determined by SPR for wild-type Ad5 fiber
knob binding to sCAR was similar to that derived using conventional
binding assays on CAR-transfected hamster cells (6) and KB
and HeLa cells (19) and almost identical to the dissociation constant for Ad5 fiber knob binding to IgV alone. Since the IgC2 domain
failed to bind to Ad5 fiber knob at all concentrations used, it is
clear that the IgV domain of CAR is both necessary and sufficient for
binding. It is also clear that there is no requirement for additional
membrane components to confer high-affinity binding to Ad5 fiber knob.
These observations support and extend those of Freimuth et al.
(8).
Four mutations, Ser408Glu, Pro409Lys, Tyr477Ala, and
Leu485Lys, abolished specific binding to sCAR as assessed by SPR
and cell binding competition experiments. These findings indicate that
Ser408, Pro409, Tyr477, and Leu485 are critical residues in the Ad5
fiber knob-CAR binding interaction. Two other mutations, Ala406Lys and
Arg412Asp, had significant effects on binding kinetics, with
dissociation constants 5 and 16 times lower, respectively, than those
for their wild-type counterpart. The side chain of Ala406 lies very
close to those of Ser408, Pro409, Tyr477, and Leu485, whereas that of
Arg412 is further away (Fig. 1a). However, the long side chain of
arginine may allow sufficient flexibility of movement to bring it
closer to the other exposed side chains (Fig. 1a). All six mutant
proteins were analyzed by CD spectroscopy and found to be
indistinguishable from the wild-type Ad5 fiber knob. This, and the fact
that these proteins accumulated as stable trimers, would indicate that
these mutations did not alter the secondary or tertiary structure of
the protein. This leads us to propose that Ser408, Pro409, Tyr477, and
Leu485 are critical contact residues and together with Ala406 and
Arg412, which may be only peripherally involved, constitute at least
part of the high-affinity binding site for CAR. Determination of the
crystal structure of Ad5 fiber-CAR complex will resolve the precise
contribution of these residues in the binding interaction.
The only other residue in
strands E and F that, when mutated,
altered the binding kinetics significantly was Arg481. Replacement of
this residue with glutamic acid reduced the dissociation constant mainly through an increase in the rate of dissociation. In contrast, adjacent residues Asn482, Glu483, and Asp484 bound to CAR with similar
kinetics and overall affinity as wild-type protein. This and the fact
that the side chain of Arg481 is partially buried at the subunit
interface, with the head group exposed at a distance from the other
contact residues (Fig. 1), suggests that Arg481 is unlikely to be a
contact residue. However, it may well exert an indirect effect on
binding by causing a subtle local structural rearrangement.
Residues Ala406, Ser408, and Pro409 lie close to the interface between
adjacent subunits, raising the possibility that the binding site may
span two subunits. However, this was not supported by our findings,
which showed that Lys506Ala, Ser507Ala, His508Glu, and
Lys510Glu+Lys506Ala mutant fiber knobs bound to CAR with almost the
same affinity as their wild-type counterpart. These residues lie close
to residues Ala406, Ser408, and Pro409 across the subunit interface
(Fig. 1b and c). Another adjacent region that might include contact
residues for receptor binding lies toward and encompasses the edge of
the R sheet. The conformation of this could be affected by
strands
E and F and the adjoining part of the DG loop, which, when rearranged,
reduced Ad5 fiber binding to CAR. We therefore mutated Asn414 in the AB
loop, His456 and Iso458 in
strand D, as well as Asn470, Phe472, and
Asp474 in the DG loop, since all of these residues lie within this
region and have surface-exposed side chains. All fiber knob proteins with mutations in this region of the structure bound to CAR with the
same affinity as the wild-type protein, demonstrating that none of the
above residues is involved in the binding interaction and that the
boundaries of the binding patch do not extend toward this part of the R sheet.
Our findings are consistent with the known pattern of reactivity of
different Ad serotypes with CAR. Two of the proposed contact residues,
Ser408 and Pro409, are identically conserved in Ad2 and Ad9 fibers as
well as the long fibers of Ad40 and Ad41 that bind to CAR but are not
conserved in Ad3 fiber and the short fiber of Ad41 which do not bind to
CAR. Residues Tyr477 and Leu485 are either nonconservatively
substituted or have no counterpart at all in Ad3 fiber or the short
fiber of Ad41. Epitope mapping of two monoclonal antibodies that
neutralized Ad5 infection of HeLa cells by blocking the Ad5
fiber-binding site characterized two contiguous regions in Ad5 fiber
knob spanning residues 438 to 486 (14). The fact that
critical residues Arg477 and Leu485 are within a region spanned by one
of the two epitopes (residues 473 to 486) provides a molecular
explanation for those observations.
The three binding sites for CAR are located around the periphery of the
trimer (Fig. 1c). They are, however, disposed toward the underside of
the protein near the shaft domain and not, as had been speculated, on
the upper more exposed surface (Fig. 1a and b) (34). The
definition of the CAR binding site and the identification of individual
contact residues in Ad5 fiber knob have important implications for our
understanding of the molecular determinants of Ad tropism, will permit
modulation of the Ad-host cell interaction for the development of novel
target-specific Ad vectors for human gene therapy, and will allow the
development of peptide inhibitors of Ad infection.
 |
ACKNOWLEDGMENTS |
We thank J. M. Bergelson and R. W. Finberg for CHO-CAR
cells, and we thank S. S. Hong and P. Boulanger for Ad5Luc3.
This work was funded by grants from the Wellcome Trust and the Special
Trustees for Guy's and St. Thomas' Hospitals to G. Santis. B. J. Sutton and A. J. Beavil also thank the Wellcome Trust for support.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Respiratory Medicine and Allergy, 5th Floor, Thomas Guy House, Guy's Hospital, St. Thomas St., London SE1 9RT, United Kingdom. Phone: 44-171-9552758. Fax: 44-171-4038640. E-mail:
george.santis{at}kcl.ac.uk.
 |
REFERENCES |
| 1.
|
Bai, M.,
L. Campisi, and P. Freimuth.
1994.
Vitronectin receptor antibodies inhibit infection of HeLa and A549 cells by adenovirus type 12 but not by adenovirus type 2.
J. Virol.
68:5925-5932[Abstract/Free Full Text].
|
| 2.
|
Belin, M., and P. Boulanger.
1994.
Involvement of cellular adhesion sequences in the attachment of adenovirus to the HeLa cell surface.
J. Gen. Virol.
74:1485-1497[Abstract/Free Full Text].
|
| 3.
|
Bergelson, J. M.,
J. A. Cunningham,
G. Droguett,
E. A. Kurt-Jones,
A. Krithivas,
J. Hong,
M. S. Horwitz,
R. L. Crowell, and R. W. Finberg.
1997.
Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5.
Science
275:1320-1323[Abstract/Free Full Text].
|
| 4.
|
Chroboczek, J.,
R. W. Ruigrok, and S. Cusack.
1995.
Adenovirus fiber.
Curr. Top. Microbiol. Immunol.
199:163-200.
|
| 5.
|
Davison, E.,
R. M. Diaz,
I. R. Hart,
G. Santis, and J. F. Marshall.
1997.
Integrin 5 1-mediated adenovirus infection is enhanced by the integrin-activating antibody TS2/16.
J. Virol.
71:6204-6207[Abstract].
|
| 6.
|
Davison, E.,
I. Kirby,
T. Elliot, and G. Santis.
1999.
The human HLA-A0201 allele, when expressed in hamster cells, is not a high-affinity receptor for adenovirus type 5 fiber.
J. Virol.
73:4513-4517[Abstract/Free Full Text].
|
| 7.
|
Devaux, C.,
M. Adrian,
C. C. Berthet,
S. Cusack, and B. Jacrot.
1990.
Structure of adenovirus fibre. I. Analysis of crystals of fibre from adenovirus serotypes 2 and 5 by electron microscopy and X-ray crystallography.
J. Mol. Biol.
215:567-588[CrossRef][Medline].
|
| 8.
|
Freimuth, P.,
K. Springer,
C. Berard,
J. Hainfeld,
M. Bewley, and J. Flanagan.
1999.
Coxsackievirus and adenovirus receptor amino-terminal immunoglobulin V-related domain binds adenovirus type 2 and fiber knob from adenovirus type 12.
J. Virol.
73:1392-1398[Abstract/Free Full Text].
|
| 9.
|
Graham, F., and L. Prevec.
1992.
Adenovirus based expression vectors and recombinant veccines, p. 363-390.
In
R. Ellis (ed.), Vaccine: new approaches to immunological problems. Butterworth-Heinemann, Oxford, England.
|
| 10.
|
Greber, U. F.,
M. Willets,
P. Webster, and A. Helenius.
1993.
Stepwise dismantling of adenovirus 2 entry into cells.
Cell
75:477-486[CrossRef][Medline].
|
| 11.
|
Green, N. M.,
N. G. Wringley,
W. C. Russell,
S. R. Martin, and A. D. MacLachlan.
1983.
Evidence of a repeating cross- sheet structure in the adenovirus fibre.
EMBO J.
2:1357-1365[Medline].
|
| 12.
|
Hennache, B., and P. Boulanger.
1977.
Biochemical study of KB-cell receptor for adenovirus.
Biochem. J.
166:237-247[Medline].
|
| 13.
|
Henry, L. J.,
D. Xia,
M. E. Wilke,
J. Deisenhofer, and R. D. Gerard.
1994.
Characterization of the knob domain of the adenovirus type 5 fiber protein expressed in Escherichia coli.
J. Virol.
68:5239-5246[Abstract/Free Full Text].
|
| 14.
|
Hong, S. S.,
L. Karayan,
J. Tournier,
D. T. Curiel, and P. A. Boulanger.
1997.
Adenovirus type 5 fiber knob binds to MHC class I alpha 2 domain at the surface of human epithelial and B lymphoblastoid cells.
EMBO J.
16:2294-2306[CrossRef][Medline].
|
| 15.
|
Horwitz, M.
1990.
Adenoviruses, vol. 2.
Raven Press, New York, N.Y.
|
| 16.
|
Kirby, I.,
E. Davison,
A. J. Beavil,
C. P. C. Soh,
T. J. Wickham,
P. W. Roelvink,
I. Kovesdi,
B. J. Sutton, and G. Santis.
1999.
Mutations in the DG loop of adenovirus 5 fiber protein abolish high-affinity binding to its cellular receptor CAR.
J. Virol.
73:9508-9514[Abstract/Free Full Text].
|
| 17.
|
Mathias, P.,
M. Galleno, and G. R. Nemerow.
1998.
Interactions of soluble recombinant integrins v 5 with human adenoviruses.
J. Virol.
72:8669-8675[Abstract/Free Full Text].
|
| 18.
|
Mathias, P.,
T. Wickham,
M. Moore, and G. Nemerow.
1994.
Multiple adenovirus serotypes use V integrins for infection.
J. Virol.
68:6811-6814[Abstract/Free Full Text].
|
| 19.
|
Meager, A.,
T. D. Butters,
V. Mautner, and R. C. Hughes.
1976.
Interaction of KB cell glycoproteins with an adenovirus capsid protein.
Eur. J. Biochem.
61:345-355[Medline].
|
| 20.
|
Miller, C. R.,
D. J. Buchsbaum,
P. N. Reynolds,
J. T. Douglas,
G. Y. Gillespie,
M. S. Mayo,
D. Raben, and D. T. Curiel.
1998.
Differential susceptibility of primary and established human glioma cells to adenovirus infection: targeting via the epidermal growth factor receptor achieves fiber receptor-independent gene transfer.
Cancer Res.
58:5738-5748[Abstract/Free Full Text].
|
| 21.
|
Novelli, A., and P. A. Boulanger.
1991.
Deletion analysis of functional domains in baculovirus-expressed adenovirus type 2 fiber.
Virology
185:365-376[CrossRef][Medline].
|
| 22.
|
Pickles, R. J.,
D. McCarty,
H. Matsui,
P. J. Hart,
S. H. Randell, and R. C. Boucher.
1998.
Limited entry of adenovirus vectors into well-differentiated airway epithelium is responsible for inefficient gene transfer.
J. Virol.
72:6014-6023[Abstract/Free Full Text].
|
| 23.
|
Provencher, S. W., and J. Glockner.
1981.
Estimation of globular protein secondary structure from circular dichroism.
Biochemistry
20:33-37[CrossRef][Medline].
|
| 24.
|
Roelvink, P. W.,
A. Lizonova,
J. G. M. Lee,
Y. Li,
J. M. Bergelson,
R. W. Finberg,
D. E. Brough,
I. Kovesdi, and T. J. Wickham.
1998.
The coxsackie-adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, D, E, and F.
J. Virol.
72:7909-7915[Abstract/Free Full Text].
|
| 25.
|
Santis, G.,
V. Legrand,
S. Hong,
E. Davison,
I. Kirby,
C. Chartier,
A. Pavirani,
J. Bergelson,
M. Mehtali, and P. Boulanger.
1999.
Molecular determinants and serotype specificity of Ad5 fiber binding to its high affinity receptor CAR.
J. Gen. Virol.
80:1519-1527[Abstract].
|
| 26.
|
Svensson, U.,
R. Persson, and E. Everitt.
1981.
Virus-receptor interaction in the adenovirus system: identification of virion attachment proteins of the HeLa cell plasma membrane.
J. Virol.
38:70-81[Abstract/Free Full Text].
|
| 27.
|
Tomko, R.,
R. Xu, and L. Philipson.
1997.
HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses.
Proc. Natl. Acad. Sci. USA
94:3352-3356[Abstract/Free Full Text].
|
| 28.
|
Wadell, G.
1990.
Adenoviruses, p. 267-287.
In
A. J. Zuckerman, J. E. Banatvala, and J. R. Pattison (ed.), Principles and practice of clinical virology. John Wiley & Sons, Chichester, England.
|
| 29.
|
Walters, R.,
T. Grunst,
J. Bergelson,
R. Finberg,
M. Welsh, and J. Zabner.
1999.
Basolateral localization of fiber receptors limits adenovirus infection from the apical surface of airway epithelia.
J. Biol. Chem.
274:10219-10226[Abstract/Free Full Text].
|
| 30.
|
Wang, X., and J. M. Bergelson.
1999.
Coxsackievirus and adenovirus receptor cytoplasmic and transmembrane domains are not essential for coxsackievirus and adenovirus infection.
J. Virol.
73:2559-2562[Abstract/Free Full Text].
|
| 31.
|
Wickham, T. J.,
M. E. Carrion, and I. Kovesdi.
1995.
Targeting of adenovirus penton base to new receptors through the replacement of its RGD motif with other receptor-specific peptide motifs.
Gene Ther.
2:750-758[Medline].
|
| 32.
|
Wickham, T. J.,
E. J. Filardo,
D. A. Cheresh, and G. R. Nemerow.
1994.
Integrin v 5 selectively promotes adenovirus cell membrane permeability.
J. Cell Biol.
127:257-264[Abstract/Free Full Text].
|
| 33.
|
Wickham, T. J.,
P. Mathias,
D. A. Cheresh, and G. R. Nemerow.
1993.
Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment.
Cell
73:309-319[CrossRef][Medline].
|
| 34.
|
Xia, D.,
L. Henry,
R. Gerard, and J. Desenhofer.
1994.
Crystal structure of the receptor-binding domain of adenovirus type 5 fiber protein at 1.7 A resolution.
Structure
2:1259-1270[Medline].
|
Journal of Virology, March 2000, p. 2804-2813, Vol. 74, No. 6
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wang, H., Liaw, Y.-C., Stone, D., Kalyuzhniy, O., Amiraslanov, I., Tuve, S., Verlinde, C. L. M. J., Shayakhmetov, D., Stehle, T., Roffler, S., Lieber, A.
(2007). Identification of CD46 Binding Sites within the Adenovirus Serotype 35 Fiber Knob. J. Virol.
81: 12785-12792
[Abstract]
[Full Text]
-
Hesse, A., Kosmides, D., Kontermann, R. E., Nettelbeck, D. M.
(2007). Tropism Modification of Adenovirus Vectors by Peptide Ligand Insertion into Various Positions of the Adenovirus Serotype 41 Short-Fiber Knob Domain. J. Virol.
81: 2688-2699
[Abstract]
[Full Text]
-
Fok, P. T., Huang, K.-C., Holland, P. C., Nalbantoglu, J.
(2007). The Coxsackie and Adenovirus Receptor Binds Microtubules and Plays a Role in Cell Migration. J. Biol. Chem.
282: 7512-7521
[Abstract]
[Full Text]
-
Lord, R., Parsons, M., Kirby, I., Beavil, A., Hunt, J., Sutton, B., Santis, G.
(2006). Analysis of the interaction between RGD-expressing adenovirus type 5 fiber knob domains and {alpha}vbeta3 integrin reveals distinct binding profiles and intracellular trafficking. J. Gen. Virol.
87: 2497-2505
[Abstract]
[Full Text]
-
Marttila, M., Persson, D., Gustafsson, D., Liszewski, M. K., Atkinson, J. P., Wadell, G., Arnberg, N.
(2005). CD46 Is a Cellular Receptor for All Species B Adenoviruses except Types 3 and 7. J. Virol.
79: 14429-14436
[Abstract]
[Full Text]
-
Gaggar, A., Shayakhmetov, D. M., Liszewski, M. K., Atkinson, J. P., Lieber, A.
(2005). Localization of Regions in CD46 That Interact with Adenovirus. J. Virol.
79: 7503-7513
[Abstract]
[Full Text]
-
Excoffon, K. J. D. A., Traver, G. L., Zabner, J.
(2005). The Role of the Extracellular Domain in the Biology of the Coxsackievirus and Adenovirus Receptor. Am. J. Respir. Cell Mol. Bio.
32: 498-503
[Abstract]
[Full Text]
-
Zen, K., Liu, Y., McCall, I. C., Wu, T., Lee, W., Babbin, B. A., Nusrat, A., Parkos, C. A.
(2005). Neutrophil Migration across Tight Junctions Is Mediated by Adhesive Interactions between Epithelial Coxsackie and Adenovirus Receptor and a Junctional Adhesion Molecule-like Protein on Neutrophils. Mol. Biol. Cell
16: 2694-2703
[Abstract]
[Full Text]
-
Qin, M., Escuadro, B., Sharma, S., Batra, R. K.
(2005). Gene Transfer Mediated by Native versus Fibroblast Growth Factor-Retargeted Adenoviral Vectors into Lung Cancer Cells. Am. J. Respir. Cell Mol. Bio.
32: 211-217
[Abstract]
[Full Text]
-
Martin-Fernandez, M., Longshaw, S. V., Kirby, I., Santis, G., Tobin, M. J., Clarke, D. T., Jones, G. R.
(2004). Adenovirus Type-5 Entry and Disassembly Followed in Living Cells by FRET, Fluorescence Anisotropy, and FLIM. Biophys. J
87: 1316-1327
[Abstract]
[Full Text]
-
Burmeister, W. P., Guilligay, D., Cusack, S., Wadell, G., Arnberg, N.
(2004). Crystal Structure of Species D Adenovirus Fiber Knobs and Their Sialic Acid Binding Sites. J. Virol.
78: 7727-7736
[Abstract]
[Full Text]
-
Worgall, S., Busch, A., Rivara, M., Bonnyay, D., Leopold, P. L., Merritt, R., Hackett, N. R., Rovelink, P. W., Bruder, J. T., Wickham, T. J., Kovesdi, I., Crystal, R. G.
(2004). Modification to the Capsid of the Adenovirus Vector That Enhances Dendritic Cell Infection and Transgene-Specific Cellular Immune Responses. J. Virol.
78: 2572-2580
[Abstract]
[Full Text]
-
Qin, M., Chen, S., Yu, T., Escuadro, B., Sharma, S., Batra, R. K.
(2003). Coxsackievirus Adenovirus Receptor Expression Predicts the Efficiency of Adenoviral Gene Transfer into Non-Small Cell Lung Cancer Xenografts. Clin. Cancer Res.
9: 4992-4999
[Abstract]
[Full Text]
-
Molinier-Frenkel, V., Prevost-Blondel, A., Hong, S.-S., Lengagne, R., Boudaly, S., Magnusson, M. K., Boulanger, P., Guillet, J.-G.
(2003). The Maturation of Murine Dendritic Cells Induced by Human Adenovirus Is Mediated by the Fiber Knob Domain. J. Biol. Chem.
278: 37175-37182
[Abstract]
[Full Text]
-
Howitt, J., Bewley, M. C., Graziano, V., Flanagan, J. M., Freimuth, P.
(2003). Structural Basis for Variation in Adenovirus Affinity for the Cellular Coxsackievirus and Adenovirus Receptor. J. Biol. Chem.
278: 26208-26215
[Abstract]
[Full Text]
-
Nakamura, T., Sato, K., Hamada, H.
(2003). Reduction of Natural Adenovirus Tropism to the Liver by both Ablation of Fiber-Coxsackievirus and Adenovirus Receptor Interaction and Use of Replaceable Short Fiber. J. Virol.
77: 2512-2521
[Abstract]
[Full Text]
-
Gaden, F., Franqueville, L., Hong, S. S., Legrand, V., Figarella, C., Boulanger, P.
(2002). Mechanism of Restriction of Normal and Cystic Fibrosis Transmembrane Conductance Regulator-Deficient Human Tracheal Gland Cells to Adenovirus Infection and Ad-Mediated Gene Transfer. Am. J. Respir. Cell Mol. Bio.
27: 628-640
[Abstract]
[Full Text]
-
Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T.
(2002). Engineering of Adenovirus Vectors Containing Heterologous Peptide Sequences in the C Terminus of Capsid Protein IX. J. Virol.
76: 6893-6899
[Abstract]
[Full Text]
-
Bernal, R. M., Sharma, S., Gardner, B. K., Douglas, J. T., Bergelson, J. M., Dubinett, S. M., Batra, R. K.
(2002). Soluble Coxsackievirus Adenovirus Receptor Is a Putative Inhibitor of Adenoviral Gene Transfer in the Tumor Milieu. Clin. Cancer Res.
8: 1915-1923
[Abstract]
[Full Text]
-
Yu, Q., Que, L. G., Rockey, D. C.
(2002). Adenovirus-mediated gene transfer to nonparenchymal cells in normal and injured liver. Am. J. Physiol. Gastrointest. Liver Physiol.
282: G565-G572
[Abstract]
[Full Text]
-
Kim, J., Smith, T., Idamakanti, N., Mulgrew, K., Kaloss, M., Kylefjord, H., Ryan, P. C., Kaleko, M., Stevenson, S. C.
(2002). Targeting Adenoviral Vectors by Using the Extracellular Domain of the Coxsackie-Adenovirus Receptor: Improved Potency via Trimerization. J. Virol.
76: 1892-1903
[Abstract]
[Full Text]
-
Law, L. K., Davidson, B. L.
(2002). Adenovirus Serotype 30 Fiber Does Not Mediate Transduction via the Coxsackie-Adenovirus Receptor. J. Virol.
76: 656-661
[Abstract]
[Full Text]
-
Kirby, I., Lord, R., Davison, E., Wickham, T. J., Roelvink, P. W., Kovesdi, I., Sutton, B. J., Santis, G.
(2001). Adenovirus Type 9 Fiber Knob Binds to the Coxsackie B Virus-Adenovirus Receptor (CAR) with Lower Affinity than Fiber Knobs of Other CAR-Binding Adenovirus Serotypes. J. Virol.
75: 7210-7214
[Abstract]
[Full Text]
-
Tan, P. K., Michou, A.-I., Bergelson, J. M., Cotten, M.
(2001). Defining CAR as a cellular receptor for the avian adenovirus CELO using a genetic analysis of the two viral fibre proteins. J. Gen. Virol.
82: 1465-1472
[Abstract]
[Full Text]
-
Nalbantoglu, J., Larochelle, N., Wolf, E., Karpati, G., Lochmuller, H., Holland, P. C.
(2001). Muscle-Specific Overexpression of the Adenovirus Primary Receptor CAR Overcomes Low Efficiency of Gene Transfer to Mature Skeletal Muscle. J. Virol.
75: 4276-4282
[Abstract]
[Full Text]
-
YOUNG, L S, MAUTNER, V
(2001). The promise and potential hazards of adenovirus gene therapy. Gut
48: 733-736
[Full Text]
-
Jakubczak, J. L., Rollence, M. L., Stewart, D. A., Jafari, J. D., Von Seggern, D. J., Nemerow, G. R., Stevenson, S. C., Hallenbeck, P. L.
(2001). Adenovirus Type 5 Viral Particles Pseudotyped with Mutagenized Fiber Proteins Show Diminished Infectivity of Coxsackie B-Adenovirus Receptor-Bearing Cells. J. Virol.
75: 2972-2981
[Abstract]
[Full Text]
-
Soudais, C., Boutin, S., Hong, S. S., Chillon, M., Danos, O., Bergelson, J. M., Boulanger, P., Kremer, E. J.
(2000). Canine Adenovirus Type 2 Attachment and Internalization: Coxsackievirus-Adenovirus Receptor, Alternative Receptors, and an RGD-Independent Pathway. J. Virol.
74: 10639-10649
[Abstract]
[Full Text]
-
Russell, W. C.
(2000). Update on adenovirus and its vectors. J. Gen. Virol.
81: 2573-2604
[Full Text]