Previous Article | Next Article 
Journal of Virology, March 2000, p. 2694-2702, Vol. 74, No. 6
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Replication of Lengthened Moloney Murine Leukemia
Virus Genomes Is Impaired at Multiple Stages
Nam-Hee
Shin,1
Dennis
Hartigan-O'Connor,2
Julie
K.
Pfeiffer,1 and
Alice
Telesnitsky1,*
Department of Microbiology and
Immunology1 and Medical Scientist
Training Program,2 University of Michigan
Medical School, Ann Arbor, Michigan 48109-0620
Received 20 August 1999/Accepted 8 December 1999
 |
ABSTRACT |
It has been assumed that RNA packaging constraints limit the size
of retroviral genomes. This notion of a retroviral "headful" was
tested by examining the ability of Moloney murine leukemia virus
genomes lengthened by 4, 8, or 11 kb to participate in a single
replication cycle. Overall, replication of these lengthened genomes was
5- to 10-fold less efficient than that of native-length genomes. When
RNA expression and virion formation, RNA packaging, and early stages of
replication were compared, long genomes were found to complete each
step less efficiently than did normal-length genomes. To test whether
short RNAs might facilitate the packaging of lengthy RNAs by
heterodimerization, some experiments involved coexpression of a short
packageable RNA. However, enhancement of neither long vector RNA
packaging nor long vector DNA synthesis was observed in the presence of
the short RNA. Most of the proviruses templated by 12 and 16 kb vectors
appeared to be full length. Most products of a 19.2-kb vector contained
deletions, but some integrated proviruses were around twice the native
genome length. These results demonstrate that lengthy retroviral
genomes can be packaged and that genome length is not strictly limited
at any individual replication step. These observations also suggest that the lengthy read-through RNAs postulated to be intermediates in
retroviral transduction can be packaged directly without further processing.
 |
INTRODUCTION |
Regardless of whether a
particular type of retrovirus encodes only Gag, Pol, and Env or if it
also encodes additional proteins, most replication-competent retroviral
genomes are fairly similar in length
roughly 8 to 9.5 kb long
with
only a few outliers such as the 12.3-kb walleye dermal sarcoma virus
(15). This suggests that there may be a selective advantage
for retroviruses to maintain relatively small genomes, a notion
supported by the observation that most acute transforming retroviruses
acquired host-derived oncogenes at the expense of essential viral
coding regions rather than by lengthening their genomes
(23).
It has been suggested that retroviral genome size is limited at the
level of RNA packaging (10). Although some
replication-competent retroviral vectors with inserted sequences are
fairly stable (notably some in which the src region of Rous
sarcoma virus [RSV] is replaced by heterologous sequences
[26]), the observation that sequences added to other
replication-competent retroviruses are rapidly deleted during virus
passage has been cited as evidence for an upper size limit to
packageable retroviral RNAs (10, 20). However, these later
findings do not exclude the possibility that the additional sequences
may have been lost simply because there was no advantage in retaining
them, or that size limitations may be imposed at replication stages
other than packaging. In studies that examined the RNAs encapsidated by
an RSV derivative with a defective polyadenylation signal, most
encapsidated RNAs were not significantly longer than standard genome
length (14). Although differences in cellular and virion RNA
populations were not explored in that study, these findings were
interpreted as suggesting that longer read-through RNAs were
specifically excluded from encapsidation (14).
Retroviruses copackage two complete copies of their genomes joined
together in a noncovalent dimer linkage structure (2). Numerous genetic studies have shown that retroviruses can copackage two
RNAs that differ significantly from one another if the RNAs retain
compatible packaging and dimerization regions. Retroviruses can even
copackage a normal genome-length RNA with a much shorter RNA
(16). Experimental evidence suggesting that two RNA
dimers
a total of four RNAs
can be coencapsidated when viral RNAs are
short (32) is consistent with the notion that retroviruses
have fairly fixed packaging capacities which can be reached in ways
other than the copackaging of two same-length RNAs.
It is not clear why maintaining a two-RNA genome is advantageous for
retroviruses. Genetic studies have demonstrated that whereas both
retroviral RNAs can and often do participate in DNA synthesis, a single
RNA is sufficient to template retroviral DNA (17). Although
packaging may precede dimerization for at least some kinds of
retroviruses (reference 24 and citations therein), the close genetic linkage between genome regions implicated in dimerization and in packaging has been suggested to reflect that the
dimer may serve principally to provide the RNA structure required for
specific RNA encapsidation (30). A corollary of this
suggestion is that any RNA which could form a dimer with a viral RNA
might facilitate packaging of the viral RNA. Experiments in this report tested the notion that if packaging capacity were determined by the
total mass of RNA in a virion rather than by the length of individual
RNAs, then the packaging maximum could be reached by copackaging two
different-length RNAs, one of which could be much longer than the
native genome. The findings were not consistent with this initial
hypothesis but did demonstrate that lengthy RNAs can be encapsidated
into murine leukemia virus (MLV) virions.
 |
MATERIALS AND METHODS |
Plasmid construction.
Dystrophin cDNA-containing
gag-pol-puromycin gene (puro) expression plasmid
pGPP (also known as pNH 133-11) has been described elsewhere
(27). The version of pGPP used here (pD1012-9) differed from
pNH 133-11 by the inclusion of a polylinker between Moloney MLV (M-MLV)
sequences and the simian virus 40 promoter. This polylinker, which
introduced EcoRI, BclI, AscI,
BstBI, NgoMI, and SmaI/XmaI sites, was introduced by digesting a double-stranded oligonucleotide of
sequence 5'
CGGAATTCTGATCAGGCGCGCCTTCGAAGCCGGCCCGGGCAATTGGGGA with
EcoRI and MfeI and then ligating this into
EcoRI-cleaved pNH 133-11. Murine dystrophin cDNA fragments
of 3.86, 7.86, and 11.06 kb were generated by PCR from A1F1
(19), which contains the intact ~14-kb murine dystrophin
cDNA, and inserted into the polylinker of pD1012-9. The
oligonucleotides used to amplify dystrophin sequences were engineered
to contain XmaI sites at their termini; PCR products were
digested with XmaI and inserted into the NgoMI site of pD1012-9. All dystrophin PCR fragments shared a common 5' end
(starting in the fourth codon of the dystrophin coding region) and
differed in their 3' ends: the 3' end of dystrophin sequences in pGPP+4
was 5' AGAGAAAGCAAAC, in pGPP+8 it was 5' GATCACAGAAACC, and in pGPP+11 it was 5' GGAAGCCTTTTCC.
Dystrophin PCR products were not sequenced, and no attempt was
made to express the gene segments as proteins.
p
+hyg (pNH 359-2) contains upstream long terminal repeat
and packaging site regions of pBabe-puro and a PGK promoter,
hygromycin B phosphotransferase coding sequences, herpes simplex virus
thymidine kinase polyadenylation signal, and pUC19 plasmid backbone
sequences (21). It was constructed by ligating together a
1.8-kb BamHI-ScaI fragment of pBabe-puro and a
2.1-kb fragment of pPGK-hygro into a
ScaI-HindIII vector fragment of pUC19.
The RNA probe plasmid pD1040-2 was a derivative of pBluescript SK II+
(Stratagene) containing a 330-bp
MscI-
BsrBI
fragment
from the matrix region of MLV
gag. pB481-7 was a
derivative of
pBluescript SK II

that contained a 442-bp
SacII-
ClaI fragment
of the puromycin
gene.
p


MLV, which contains a packaging sequence deletion
between M-MLV nucleotides 215 and 368, has previously been described
(
27).
Animal cells and viruses.
D17 and NIH 3T3 cells and their
derivatives were grown in Dulbecco's modified Eagle's medium
supplemented with 10% calf serum (Gibco). ET cells (a 293T-based line
that expresses ecotropic env) (27) and derived
cells were grown in Dulbecco's modified Eagle's medium supplemented
with 10% fetal bovine serum (HyClone). Puromycin-resistant ET, D17,
and 3T3-derived cells were selected in 1, 2, or 6 µg, respectively,
of puromycin (Sigma) per ml.
NIH 3T3 cells that constitutively express gibbon ape leukemia virus
(GaLV) envelope (Env) were generated by transfection with
pJP49-2, a
plasmid containing GaLV
env (
41) driven by the
PGK promoter of pPNT (
37) with a histidinol
resistance gene from
pSV2his (
13). pJP49-2 was transfected
into NIH 3T3 cells by
using Lipofectamine (Gibco/BRL) according to the
manufacturer's
instructions. At 48 h after transfection, cells
were selected
in medium containing 5 mM
L-histidinol
(Sigma). Histidinol-resistant
colonies were single cell cloned, and
several individual clones
were functionally tested for the ability to
supply GaLV Env in
trans by transiently transfecting them
with pGPP and then testing
the resulting virus for the ability to
confer puromycin resistance
to 293T or D17 cells. The cell clone that
produced the highest
puromycin-resistant titer was used in subsequent
experiments.
Virion proteins were quantified by performing quantitative reverse
transcriptase assays as described elsewhere (
31). All
values
were confirmed by assaying more than one concentration
of enzyme, and
all samples used were at least 10-fold above uninfected
mock culture
medium values and were within the linear range of
the assay. All
virions in this study should be formed of identical
Gag-Pol precursors,
and hence the quantitative reverse transcriptase
assay is as good a way
to standardize virion protein content here
as measuring a Gag protein
would be. Note that relative amounts,
not absolute molar amounts, of
protein were
determined.
Transient transfections were performed by the calcium phosphate method
as previously described (
27), using ~60% confluent
cells.
Within each experiment, all plates were transfected with
the same mass
of plasmid DNA (10 µg per 60-mm-diameter plate)
and also with molar
equivalents of pGPP or derivative. Because
the mass per mole of the
larger derivatives is greater than that
for pGPP, appropriate amounts
of pUC19 DNA were added as carrier
DNA as necessary. Plasmids were
propagated in the Stbl2 strain
of
Escherichia coli
(Gibco/BRL), purified using Qiagen plasmid
maxi kits, and quantified by
UV spectrophotometry. Transfection
efficiency tests were performed by
including 0.125 µg of the cytomegalovirus
promoter-driven
lacZ expression plasmid pCH 110 (
12) in
transfection
mixtures for parallel control plates and then staining for
lacZ expression using standard procedures (
29)
48 h posttransfection.
The fraction of cells which took up plasmid
DNA varied by less
than a factor of 2 among plates in each experiment.
Controls in
which ET cells were transfected with pCH 110 serially
diluted
with pUC19 suggested that at least 20 to 100 plasmids were
cotransfected
into individual cells under the conditions used, and
hence virions
produced during cotransfection experiments were formed in
cells
which coexpressed GPP and
+hyg.
Infections were performed in the presence of 8 µg of Polybrene
(hexadimethrine bromide; Sigma) per ml for 2 h at 37°C. Titers
were determined by endpoint dilution. Puromycin was added directly
to
infected cells without cell passage. Well-separated puromycin-resistant
colonies were selected and expanded for study as clonal
integrants.
Purification and analysis of viral nucleic acids. (i) Cellular
RNA.
At 48 h posttransfection, medium was removed by
aspiration and 1 ml of Trizol reagent (Gibco/BRL) was added to each
60-mm-diameter plate of cells. Subsequent steps were performed
according to the manufacturer's instructions. Samples were suspended
in 100 µl of a mixture containing 25 mM Tris-Cl (pH 8), 50 mM
MgCl2, 5 mM dithiothreitol, 1.5 U of RNase-free DNase
(Boehringer Mannheim Biochemicals [BMB]) per ml, and 0.5 U of RNasin
(BMB) per ml, incubated 15 min at 37°C, and then stopped by addition
of 25 µl of 50 mM EDTA-1.5 M sodium acetate (pH 4.5)-1% sodium
dodecyl sulfate (SDS). Samples were extracted with an equal-volume
mixture of phenol plus chloroform-isoamyl alcohol (24:1, vol/vol) and ethanol precipitated. Dried pellets were resuspended in diethyl pyrocarbonate-treated distilled H2O.
Controls to ensure that DNase treatment reduced transfected plasmid DNA
in RNA preparations to below Northern blot or RNase
protection assay
detection levels involved processing samples
from parallel experiments
in which cells were transfected with
plasmids that contained
probe-complementary sequences but which
lacked polymerase II
promoters.
(ii) Viral RNA purification.
Virus-containing medium was
collected and filtered every 12 h starting 24 h
posttransfection and centrifuged at 500,000 × g in a
Sorvall RC M120EX ultramicrocentrifuge for 25 min at 4°C. Pellets
were suspended in 200 µl of 50 mM Tris (pH 7.5)-10 mM EDTA-1%
SDS-100 mM NaCl-50 µg of tRNA/ml-100 µg of proteinase K/ml.
Where appropriate, recovery marker RNA (see below) was added. Samples
were incubated at 37°C for 30 min, extracted with phenol plus
chloroform-isoamyl alcohol (24:1, vol/vol), and ethanol precipitated; they were then DNase treated and processed as described for cellular RNA.
RNA probes were prepared by cleaving pD1040-2 with
EcoRI and
transcribing with T3 RNA polymerase or by cleaving pB481-7 with
BssHII and transcribing with T7 RNA polymerase. The pD1040-2
406-base
runoff transcript protects 330 bases of
gag
sequences when annealed
to wild-type MLV RNA, while the 237-base
pB481-7 runoff transcript
protects 194b of
puro RNA.
Cleavage of pD1040-2 with
BsrGI and
divergent transcription
with T7 RNA polymerase yielded recovery
marker RNA. In
vitro-transcribed RNAs were generated using standard
approaches
(
1), with the inclusion of
32P-labeled CTP to
generate radiolabeled probes. Radiolabel was
omitted and higher
substrate concentrations were used to produce
recovery marker RNA.
Recovery marker was included in experiments
presented in Fig.
2,
3A,
and
3C. Recovery marker was not added
to RNA samples for experiments in
Table
1 and Fig.
3B, where
the only required measurement was the ratio
of escort and GPP-type
RNAs.
(iii) RNase protection assays.
Viral and cellular RNA and
radiolabeled RNA probes were prepared as indicated above, and the same
amount of RNA probe, which exceeded the total amount of sample to be
protected by a molar factor of 5 to 50, was used for all samples within
each experiment. Samples were hybridized, digested with RNases A and T,
processed, and separated on 5% polyacrylamide-8 M urea gels by using
standard techniques (1). Dried gels were exposed to film
and/or analyzed with a Molecular Dynamics PhosphorImager and ImageQuant
software. In experiments where molar ratios were determined, each
band's intensity as measured by PhosphorImager was divided by the
number of C residues (C was the radiolabeled substrate) in the
protected probe fragment before comparing values for that band to those for others.
For cellular RNA blots, ET cells which stably expressed escort RNA were
transfected with pGPP or derivatives and RNA was processed
as above.
RNA was separated on 0.7% formaldehyde-agarose gels,
gels were washed,
products were transferred to Hybond-N membranes
(Amersham) by capillary
action, and membranes were cross-linked
in a Stratalinker (Stratagene),
using standard approaches. Prehybridization
and hybridization were
conducted in 25 ml of 5× SSC (1× SSC is
0.15 M NaCl plus 0.015 M
sodium citrate)-5× Denhardt's solution-50%
(wt/vol) formamide-1%
(wt/vol) SDS at 65°C. Boiled herring sperm
DNA was added to 100 µg/ml along with radiolabeled probe prepared
using a random-primed
DNA labeling kit from BMB or Redi-Prime
kit from Amersham.
EcoRI-linearized pD1040-2 was used to make
RNA blot probes,
while puromycin resistance or dystrophin gene
fragments were used to
make probes for DNA
blots.
For viral RNA blots, two 6-cm-diameter plates of ET cells which stably
expressed escort were calcium phosphate transfected
with equimolar
amounts of each of the pGPP series plasmids, and
virus was collected at
12-h intervals for 2 days and then pooled.
Viral RNA was prepared as
described for RNase protection assays
and analyzed as described for
cellular RNA
blots.
For Southern blots, genomic DNA was harvested using a Wizard genomic
DNA purification kit (Promega). This DNA, which contained
integrated
proviruses, was restriction digested, separated on
0.7% agarose gels,
blotted, and probed using standard procedures
(
1). Probes
were random-primed DNA fragments labeled as above.
Probes used for the
Fig.
6 blots were a
BamHI-
ClaI puromycin gene
fragment from pBabe-puro (
21) (Fig.
6A and C) and a mixture
of three dystrophin gene fragments from pGPP+11 (the 8.5- and
2.4-kb
EcoRI fragments and the 1.5-kb
DraI fragment)
(Fig.
6B).
Except where indicated, numerical values presented for RNAs, proteins,
and titers reflect results from at least two experimental
repetitions
of each quantification procedure for each of at least
two completely
independent transfection
experiments.
 |
RESULTS |
Construction of large RNA genomes and small escort RNAs.
The
goal of this study was to assess effects of retroviral genome length on
RNA packaging and other replication steps. In the approach used, both
the encapsidated RNAs and all proteins necessary for the production of
virions were encoded by single expression plasmids. The parental
expression plasmid, pGPP, was an M-MLV provirus plasmid in which the
splice donor site was inactivated and the env coding region
was replaced with a puromycin resistance expression cassette
(27) (Fig. 1). This vector
encodes an 8.1-kb viral RNA, which is essentially the same length as
the native MLV genome (8.2 kb).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Structures of proviral clones and other constructs.
Virus coding regions are presented as shaded boxes. Restriction sites
indicated below pGPP+11 are those used to map reverse transcription
products in Fig. 6. The viral sequences in pD1040-2, an RNA probe
expression plasmid, are represented by a shaded box. PSV40,
simian virus 40 promoter; LTR, long terminal repeat; +,
packaging site; , deletion of packaging site.
|
|
We generated lengthened derivatives of pGPP (Fig.
1) that contained
fragments of murine dystrophin cDNA inserted between
pol and
the puromycin resistance gene cassette. Inserts of 3.9, 7.9,
and 11.1 kb were made to yield pGPP+4, pGPP+8, and pGPP+11, which
are predicted
to produce viral RNAs 12, 16, and 19.2 kb in length,
respectively.
p
+hyg, a plasmid that encodes a short packageable RNA,
was also
constructed to test the ability of short RNAs to
heterodimerize
with long viral RNAs and facilitate their encapsidation
(Fig.
1). Reflecting this postulated role of
+hyg RNA,
this short vector is herein referred to as an escort
RNA.
p
+hyg is a splice donor-defective derivative of an MLV
provirus
plasmid which contains a hygromycin B phosphotransferase
expression
cassette in place of the viral coding sequences, followed by
the
herpes simplex virus polyadenylation signal. Blotting analysis
revealed that expression of p
+hyg yielded intracellular
RNAs of the predicted ~3.1-kb length
(data not
shown).
The rationale for using a single construct to express both virion
proteins and genomic RNA was as follows. If an alteration
to GPP did
not affect packaging, then when that GPP derivative
was expressed in
mammalian cells, the relative amounts of RNA
which would be directed to
mRNA and to encapsidated genome functions
would remain the same as for
the parental GPP vector. In contrast,
if changes introduced into a GPP
derivative caused RNA encapsidation
defects, then the amount of RNA per
unit of viral protein in extracellular
virions would decrease. Hence,
comparing the molar amount of vector
RNA per unit extracellular virion
protein of the GPP vector to
values for its derivatives would provide a
way of examining effects
on
encapsidation.
Relative replication efficiency of large and small genomes.
As
an initial test of these vectors' ability to support a single
replication cycle, pGPP and its derivatives were transfected into ET
cells, which are human 293T-derived cells that stably express ecotropic
Env (27), and the resulting virion titers were determined.
Equimolar amounts of each pGPP-type plasmid were transfected into ET
cells. Parallel experiments aimed at examining the effects of the
+hyg escort RNA were also performed by transfecting
secondary plates of ET cells with the same amounts of pGPP-type
plasmids supplemented with equimolar p
+hyg. Fresh murine
cells were then infected with an equal volume of each virus stock, and
puromycin-resistant colony titers were determined.
Results from two such experiments are presented in Fig.
2A and
B. Titers are presented as
puromycin-resistant CFU per volume
of virus-containing medium,
standardized to the titer for the
parental GPP expressed in the absence
of
+hyg. The titer of the parental vector was roughly
10
4 puromycin-resistant CFU/ml. These initial trials
demonstrated
that product titers were around 5- to 10-fold lower for
large
retroviral vectors than for native-length ones generated in
experiments
where virus was produced from transiently transfected
cells. A
comparison of the data in Fig.
2A (no p
+hyg)
and 2B (cotransfection with p
+hyg) indicates that
+hyg did not increase the puromycin-resistant CFU of
long vectors
and may have decreased titers slightly. This finding
appears to
be inconsistent with the initial hypothesis that
+hyg might enhance packaging and the generation of
proviral products
when coexpressed with lengthy viral RNAs. Note that
although the
lengthened genomes all yielded lower titers than
native-length
GPP, there were no consistent size-related trends in
apparent
replication efficiency among lengthened genomes (GPP+4, GPP+8,
and GPP+11). Titers normalized to the amount of virion protein
in the
culture medium are presented in Fig.
2C and D. As assessed
by levels of
virus protein in the culture medium, the amount of
virus produced by
cells transfected with larger vector plasmids
was slightly (less than
twofold) lower than the amount produced
by cells transfected with the
parental pGPP. Whether this nominal
but reproducible decrease in virion
protein release from transfected
cells resulted from reduced
transfection efficiency for large
plasmids or an effect on viral
replication was not determined.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
Replication efficiencies of native-length and lengthened
genomes. (A and B) Puromycin-resistant CFU per unit volume of
virus-containing culture medium harvested from ET cells transiently
transfected with equimolar amounts of vector expression plasmids,
normalized to the value obtained for the parental pGPP plasmid. In
experiments that included the p +hyg escort plasmid,
equimolar p +hyg was added in place of some of the
carrier DNA used in the no-p +hyg transfections. (C and
D) Puromycin-resistant CFU per unit of virion protein in the culture
medium. (E and F) Packaging of viral RNA per unit virion protein in the
presence and absence of +hyg escort RNA. (G and H)
Puromycin-resistant CFU per unit of virion RNA in the presence and
absence of +hyg escort RNA. The values in panel B were
normalized to the GPP value in panel A. For all other panels, values
presented were normalized to values obtained for the parental GPP
vector in that panel and were determined from data such as those in
Fig. 3, using approaches described in Materials and Methods. In panels
E through H, "encapsidated RNA" refers to GPP, GPP derivative, or
 MLV RNA and does not include +hyg
escort RNA.
|
|
Assessing packaging biases between large and small genomes.
The stoichiometries of
+hyg and GPP-type RNAs within
cotransfected cells were compared to their ratios in virions. The value which described the molar amount of large GPP-type vector RNA per
+hyg RNA in virions relative to intracellular
stoichiometries of these two RNAs is referred to as the packaging
factor. It was assumed that if an RNA were defective in packaging, then
it would be less prevalent relative to
+hyg in virions
than in producer cells. Although no attempt was made to determine
whether proteins were limiting or RNA was expressed at saturating
concentrations, these measurements were interpreted as addressing the
ability of the lengthened RNAs to compete with short RNAs for the
packaging machinery.
The data were generated by cotransfecting ET cells with equimolar
amounts of p
+hyg and pGPP or its derivatives and then
determining RNA ratios
in both cells and virions by RNase protection
assays. The RNase
protection probe spanned the junction of sequences
that the GPP
vectors share with the
+hyg escort and
sequences in which they differ (Fig.
1, pD1040-2).
Thus, a single probe
could be used to detect both long vector
and short escort RNAs as
protected products of distinct sizes,
and the molar ratios of the two
RNAs could be determined by the
ratios of these protected bands. In
experiments that addressed
RNA packaging in the absence of
+hyg, packaging biases were examined by determining how
much RNA
was encapsidated per unit of extracellular virion protein.
Because
quantifying virion RNAs required several purification steps,
viral
RNA recovery was monitored by introducing an RNA recovery marker
early during virion RNA purification and then normalizing values
based
on the amount of recovery marker in the final product. The
recovery
marker was a nonradiolabeled in vitro transcript complementary
to a
short portion of the same RNase protection probe used to
detect
+hyg and GPP
RNAs.
Figure
3 shows the results of RNase
protection assays performed on cellular and virion RNA harvested from
producer cells transfected
with pGPP or related plasmid in the presence
or absence of p
+hyg. The intracellular ratios of
+hyg and each larger coexpressed RNA, the ratios of
these two types
of RNAs within virions, and the ratios of these two
values (the
packaging factor) are presented in Table
1. These values were
not corrected for
virion numbers but instead describe the relative
amounts of the
indicated RNAs. Controls were performed in which
a wild-type MLV
provirus plasmid (pNCA) (
6) or a packaging-defective
provirus plasmid (p


MLV [
27]) was
cotransfected with p
+hyg. As anticipated, encapsidation
of


packaging mutant RNAs was strongly disfavored
relative to
+hyg RNAs (Table
1, p


MLV).
The relative prevalence of the parental GPP RNA and the
+hyg escort in virions was very similar to that observed
intracellularly,
suggesting that GPP and
+hyg were
equally fit for encapsidation. In contrast, modest biases
against
packaging were observed for the dystrophin-containing
lengthened GPP
derivative RNAs, with each of these long RNAs around
half as prevalent
in virions as in cells relative to the amounts
of
+hyg
(Table
1).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
RNase protection assays to quantify vector RNAs. (A)
Assays of RNAs harvested from the culture medium of ET cells
cotransfected with pGPP or related plasmid and p +hyg.
Lanes: 1, size standards; 2, undigested probe; 3, no sample or recovery
marker control; 4, mock-transfected ET medium RNA; 5 to 10, RNA samples
purified from the virion-containing culture media from cells
transfected with pGPP+4, pGPP+8, pGPP+11, pGPP, p MLV,
and pNCA (an infectious M-MLV provirus clone), respectively. Migration
positions of protected bands diagnostic of each product are indicated
at the right. U, undigested probe; G, GPP-type product; E, escort
product; RM, recovery marker. (B) Assays of intracellular RNAs
harvested from transfected cells. Designations at the top indicate
which RNA is analyzed in each lane of panels B and C. (C) Assays of
RNAs harvested from the culture medium of ET cells transfected with
pGPP or related plasmid in the absence of p +hyg.
|
|
To address the contribution of
+hyg to this fairly
efficient encapsidation of long RNAs, levels of large RNAs in virions
produced
both in the presence and in the absence of
+hyg
were compared. An RNase protection assay of virion RNAs produced
in the
absence of
+hyg is shown in Fig.
3C. Amounts of viral
RNA per unit virion
proteins in the presence and in the absence of
+hyg escort are compared in Fig.
2E and F. These data
suggest that
coexpression of the short
+hyg escort RNA
did not facilitate long vector
packaging.
Examining viral RNAs designed to exceed wild-type length.
As
assayed above, long vector packaging appeared to be reduced less than
twofold relative to the native-length vector, while titers per unit
virion protein were decreased roughly four- or fivefold. It seemed
possible that some component of the decreased titer per unit RNA for
the lengthened GPP derivatives might have resulted if more of the RNAs
were incomplete in long vector virions than in those of native-length
vectors. For the data shown in Fig. 2E through H, RNAs were quantified
by RNase protection assays that used a probe complementary to a short
portion of RNA near 5' ends of the genomes, and no attempt was made to
determine the amount of 3' RNA sequences. Thus, to assess whether
virions may have differed in full-length RNA content, RNase protection
assays were performed on virion RNAs, using excess amounts of two
different probes in each reaction. One probe was complementary to
sequences near the 5' ends of the RNAs, and the other was complementary to puromycin gene sequences near the 3' ends. The results (Fig. 4) were quantified by a PhosphorImager.
The molar amount of each product was determined as described in
Materials and Methods, and then the molar ratios of the 5' and 3'
portions of the RNAs were compared. For GPP, the determined molar ratio
of 5' to 3' ends was 1.01; for GPP+4, the ratio was 0.98; for GPP+8, it
was 1.16; and for GPP+11, the ratio was 1.29. Thus, the molar ratio of
5' and 3' ends for native-length GPP did not differ greatly from values
for its lengthened derivatives. Similar results were obtained when a
single probe derived from the long terminal repeat which protected both
5' and 3' sequences, was used.

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 4.
RNase protection assay of 5' and 3' ends of GPP-type
RNAs. Lanes: 1, size standards; 2, undigested 3' (puro)
probe; 3, undigested 5' (gag) probe; 4, probe-alone control;
5, mock-transfected ET medium RNA; 6 to 10, RNA samples from the
virion-containing culture media from cells transfected with pGPP,
pGPP+4, pGPP+8, pGPP+11, and pNCA (which expresses wild-type MLV),
respectively. Migration positions of undigested probes and protected
bands diagnostic of each product are indicated at the right.
|
|
Because results in Fig.
4 did not differentiate between whether
full-length RNAs were packaged or if virions contained shortened
RNAs
generated by the use of cryptic splice sites or other unintended
genome
modifications, Northern blots were used to assess viral
RNA lengths
both in virus-producing cells and in extracellular
virions. Figure
5A shows a blot of total cellular RNA
from cells
expressing the GPP derivatives probed with a fragment of
gag.
To assess RNA lengths, samples were heat denatured and
separated
on denaturing gels. Using the mobilities of
+hyg and wild-type MLV RNA as size standards, this blot
shows that
RNAs of roughly the predicted lengths were generated in
cells
expressing GPP derivatives. Data for virion RNAs are shown in
Fig.
5B. At least some of the encapsidated RNAs for each vector
appeared to be of the full intended length, but significant smears
of
faster-mobility material were also detected. There were no
detectable
discrete-length RNAs among these shorter products,
suggesting that the
virion RNA was not dominated by specific unintended
spliced RNAs.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 5.
Denaturing Northern blots of vector RNAs. (A) Cellular
RNA extracted from ET cells transfected with pGPP and derivative
plasmids. Two amounts of RNA were loaded for each sample so that the
odd-numbered lanes contain 2.5-fold as much sample as the even-numbered
lanes. RNA was from cells expressing GPP (lanes 1 and 2), GPP+4 (lanes
3 and 4), GPP+8 (lanes 5 and 6), and GPP+11 (lanes 7 and 8). (B) Virion
RNA harvested from the culture medium of ET cells transfected as above.
Lanes: 1, GPP; 2, GPP+4; 3, GPP+8; 4, GPP+11. Numbers at the right
indicate the mobilities of RNA size standards of the indicated lengths
in kilobases. The identity of the faster-migrating band in lanes 1 and
2 of panel A was not determined.
|
|
Effects of genome length on efficiency of postpackaging steps.
Having obtained data suggesting that packaging defects were fairly
modest, it seemed possible that some of the observed titer decreases
for long genomes might reflect defects in postpackaging steps of the
viral replication cycle. Size-related defects might include disrupting
maturation of viral particles or RNA (9), altering the
stoichiometry of putative accessory factors such as nucleocapsid
(7), perturbing the higher-order structure required for
reverse transcription (17), or interfering with the
sustained synapsing of viral DNA ends required for integration (22).
To address whether length-related limitations were imposed during early
stages of retroviral replication, the titer of puromycin-resistant
proviruses formed per unit of encapsidated RNA were compared for
parental GPP and for GPP+4, GPP+8, and GPP+11. The results (Fig.
2G and
H) indicate that all of the lengthened vectors generated
roughly
threefold-fewer colonies per mole of encapsidated RNA
than did parental
GPP.
Proviral DNAs templated by lengthened vectors.
Clonal
integrated proviruses generated from GPP-type vectors were examined by
Southern blotting. The restriction digests used to analyze these
proviruses are indicated at the top of Fig.
6, and some of the blots used to analyze
clonal GPP+11 integrants are displayed below. Figure
6A shows a blot of ClaI
digests of genomic DNA from several individual GPP+11 proviral clones
which contained shorter-than-anticipated dystrophin segments. As
indicated at the top of Fig. 6, an intact GPP+11 provirus would be
predicted to yield a 10.5-kb band detectable on these blots. Note that
ClaI fragments detected for the GPP+11 integrants analyzed
in Fig. 6A varied in length, with several appearing to have products of the same altered mobility (Fig. 6A, lanes 4 to 6). The frequent occurrence of similar-sized products suggests that these may have had a
common origin such as an ~2-kb deletion which resulted from unintended splicing or from a hot spot for recombination during reverse
transcription. Genomic rearrangements such as deletions and insertions
frequently arise during reverse transcription (25, 28).
Figure 6B shows results of BstEII digestion of a GPP+11 provirus whose ClaI fragment appeared to be full length. The
observed restriction fragments of 6.3, 3.2, and 2.7 kb that are
detectable with dystrophin probes are consistent with the sizes
predicted for a full-length 19.8-kb provirus. Overall, these results
suggest that most products of GPP+11 contained deletions after a single round of replication.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 6.
Southern blot analysis of individual proviral products
of the GPP+11 vector. (Top) Schematic drawing of a GPP+11 provirus
showing the locations of restriction sites used to assess provirus
sizes. Because of the template switches during reverse transcription,
MLV-based vector DNAs should be 0.6 kb longer than their RNA templates
(11). ClaI restriction sites and the size (10.5 kb) of the ClaI restriction fragment predicted for an
unrearranged GPP+11 provirus are indicated, as are BstEII
site locations and the sizes predicted for BstEII digestion
(2.7, 3.2, and 6.3 kb). Drawing is not to scale. For abbreviations, see
the legend to Fig. 1. (Bottom) Southern blot analyses of integrated
vector proviruses. (A) GPP+11 clonal integrants that contain dystrophin
region deletions digested with ClaI. Lanes: 1, size
standards; 2, mock-infected cell DNA; 3 to 6, individual clonal
integrants. (B) Candidate full-length GPP+11 GM integrant DNA analyzed
with BstEII. Lanes: 1, size standards; 2, mock-infected cell
DNA; 3, clone 4-8 DNA. (C) Restriction analysis of GPP+11 vector
product sizes after a second round of replication. D17 clone DNAs were
digested with ClaI. Lanes: 1, marker; 2, mock-infected D17
cellular DNA; 3, second-round product generated by clone 16-6; 4 to 6, second-round products from 4-4, 4-8, and 4-14, respectively; 7, size
standards. Mobilities of DNA size standards are indicated at the left.
For each panel, arrows indicate provirus-specific products and indicates host-derived products detectable in both mock-infected and
transduced cells. First-replication-round products were analyzed in 3T3
cells that express GaLV Env; second-round products were analyzed in D17
cells.
|
|
Because GPP vectors contain
gag and
pol
sequences, a second round of replication was possible when virions shed
by cells transduced
with GPP proviruses were provided Env. This was
accomplished by
infecting 3T3 cells that expressed GaLV Env as the
endpoint of
the first replication round (see Materials and Methods) and
then
infecting fresh D17 cells with virions produced by these cells.
Integrated products of some GPP+11 proviruses generated during
a second
round of replication were examined by Southern blotting
(Fig.
6C).
Among the GPP+11 products, proviruses which were 12.8
and 14.3 kb long
after the first replication round generated progeny
which appeared to
maintain these lengths on secondary passage
(Fig.
6C, lanes 3, 4, and
6), but the tested product of a full-length
19.8 kb provirus was
reduced to an apparent length of 16.0 kb
during a second replication
round (Fig.
6C, lane
5).
Similar approaches were used to examine clonal GPP+4 and GPP+8
integrants (data not shown). All four GPP+4 progeny proviruses
tested
appeared to be full length, as did two of four GPP+8 integrants.
In
addition to the two GPP+8 integrants that yielded the restriction
patterns predicted for unrearranged proviruses, one yielded a
ClaI fragment approximately 2 kb longer than predicted for a
full-length
GPP+8 product, and the fourth contained a
ClaI
fragment about
2.3 kb shorter than
predicted.
 |
DISCUSSION |
In this report, the packaging efficiencies of native-length
retroviral RNAs were compared to those of RNAs significantly longer than wild type. The ability of lengthy RNAs to compete with short RNAs
for the MLV packaging machinery and the ability of long genomes to
participate in subsequent replication steps were examined. Overall,
replication of lengthened genomes was reduced 5- to 10-fold relative to
native-length genomes. This reduction was the product of modest defects
in virion production and in packaging, and somewhat greater defects in
subsequent stages, with large vector replication not absolutely
restricted at any one stage. RNAs twice the natural genome length could
become encapsidated and could template integration-competent DNA.
Although many of the resulting proviruses contained detectable defects
such as deletions, in some cases, progeny proviruses were able to form
infectious particles that could complete a subsequent round of
replication. These findings demonstrate that large genome replication
is impaired at several stages but that there are no absolute size
restrictions against genomes twice the normal length at any stage of
the MLV replication cycle.
A premise of this study had been that dimers of lengthy RNAs would be
excluded from packaging. Therefore, in some experiments, a short
packageable RNA,
+hyg, was coexpressed with the lengthy
vectors to test whether short RNA might facilitate long RNA packaging
by heterodimerization. Surprisingly, long RNAs were packaged fairly
well even in the absence of the
+hyg. No augmentation of
lengthy RNA packaging was observed in the presence of the
+hyg escort.
Some of the observed titer decrease for long genomes may have reflected
a decrease in the amount of intact template RNA for lengthy vectors.
Most lengthy vector virion RNAs did not appear intact on Northern
blots, but it is not uncommon for virion RNA to appear degraded
(5). This apparently is particularly an issue for denatured
RNAs like those analyzed in this report, because several groups have
published data showing fairly discrete bands for nondenatured
retroviral RNA but smears when the same virion-associated RNAs were
denatured (8, 18, 24). Note, however, that the presence of
sequences encompassing the full length of the RNAs would be required to
template full-length proviral DNAs. Thus, the observation here that
some full-length proviruses were generated implies that at least some
virions encapsidated the entire length of the RNAs, even for the
longest genomes.
How can the finding that lengthy genomes can complete a replication
cycle be reconciled with previous findings regarding the rapid loss of
insertions in replication-competent retroviruses? Most likely, the key
difference is that the present experiments examined a single
replication cycle and hence selective advantages were not assessed. As
retroviruses replicate, individual viruses with relatively modest
survival advantages can come to dominate populations rapidly
(4). In previously reported experiments, the inserted
sequences did not benefit virus replication (10, 34) and may
even have been lost for the simple reason that they increased genome
length and thus the time required for replication. Many types of
viruses generate deletion-containing defective interfering particles
during undiluted virus passage, and coding region-deleted genomes are
detectable in retroviral cultures during passage at high multiplicity
of infection (3, 33, 39, 40). It has long been recognized
that retroviral sequences that do not provide a selective advantage, as
is the case for src in culture-adapted RSV, are prone to
deletion even with a low multiplicity of infection (38). It
seems likely that the nonessential dystrophin insertions studied here
would be lost rapidly if the vectors replicated freely.
Regardless of their fates during sustained replication, this
demonstration of the packageability of long RNAs has important ramifications for rare retroviral replication events. For example, some
models for how retroviruses transduce cellular oncogenes envision
initial capture of the host gene as resulting from proviral insertion
near or within a host proto-oncogene (35, 36, 42). To
conform with prevailing notions of packaging limits, transduction models generally go on to postulate either a DNA-level deletion of the
downstream long terminal repeat or aberrant splicing of a read-through
RNA to prune a chimeric virus-host RNA to a packageable length. The
finding in this report of the encapsidation of RNAs more than twice the
native length demonstrates that lengthy read-through RNAs could be
packaged directly without further processing.
A possible practical application of encapsidating large retroviral
genomes would be the formation of longer integrated proviruses from
retroviral vectors. For such applications, only a single replication
cycle is generally required, and so competitive disadvantage would not
affect the outcome. However, the significant rate of errors observed
among product DNAs suggests that such large vectors would be useful
only in protocols that allowed screening of several integrants to
identify ones that had maintained integrity.
Many questions remain unanswered. Were the lengthy vectors encapsidated
as homodimers? As monomers? Might even the "unescorted" vectors
have become encapsidated in partnership with fortuitously 3' truncated
RNAs? Do coexpressed RNAs randomly copackage, or do biases for or
against copackaging of nonhomologous RNAs exist? With the 19.2-kb
vectors, has the upper size limit of packageable RNAs been reached or
can even longer RNAs be encapsidated? Further study is required to
address these and related questions.
 |
ACKNOWLEDGMENTS |
We thank Maribeth Eiden for providing GaLV env,
Jeffrey Chamberlin for providing dystrophin cDNA, and Oveta Fuller and
Thomas Glaser for other reagents. We thank Nancy Sullivan and M. J. Wieland for critical reading of the manuscript and the anonymous
reviewers whose comments improved the final version. We also thank
David Rekosh and Alan Engleman for advice and Heidi Ackerly, Deanna Kulpa Stom, and the Horace H. Rackham School of Graduate Studies for
assistance and support in early stages of this project.
This research was supported by NIH grant CA69300 and by the Searle
Scholars program of the Chicago Community Trust.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, University of Michigan Medical School,
5641 Medical Sciences Bldg. II, Ann Arbor, MI 48109-0620. Phone: (734) 936-6466. Fax: (734) 764-3562. E-mail: ateles{at}umich.edu.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. A. Smith, and K. Struhl (ed.).
1994.
Current protocols in molecular biology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 2.
|
Berkowitz, R.,
J. Fisher, and S. P. Goff.
1996.
RNA packaging.
Curr. Top. Microbiol. Immunol.
214:177-218[Medline].
|
| 3.
|
Clever, J. L., and T. G. Parslow.
1997.
Mutant human immunodeficiency virus type 1 genomes with defects in RNA dimerization or encapsidation.
J. Virol.
71:3407-3414[Abstract].
|
| 4.
|
Coffin, J. M.
1992.
Genetic diversity and evolution of retroviruses.
Curr. Top. Microbiol. Immunol.
176:143-164[Medline].
|
| 5.
|
Coffin, J. M.
1979.
Structure, replication, and recombination of retrovirus genomes: some unifying hypotheses.
J. Gen. Virol.
42:1-26[Abstract/Free Full Text].
|
| 6.
|
Colicelli, J., and S. P. Goff.
1988.
Sequence and spacing requirements of a retrovirus integration site.
J. Mol. Biol.
199:47-59[CrossRef][Medline].
|
| 7.
|
Darlix, J.-L.,
C. Yu,
L. Berthoux,
M. Ottmann,
N. Jullian, and B. Roques.
1995.
La nucleocapside du VIH-1: un paradigme pour la recherch et ses applications medicales.
Med. Sci.
11:420-429.
|
| 8.
|
Fu, W.,
R. J. Gorelick, and A. Rein.
1994.
Characterization of human immunodeficiency virus type 1 dimeric RNA from wild-type and protease-defective virions.
J. Virol.
68:5013-5018[Abstract/Free Full Text].
|
| 9.
|
Fu, W., and A. Rein.
1993.
Maturation of dimeric viral RNA of Moloney murine leukemia virus.
J. Virol.
67:5443-5449[Abstract/Free Full Text].
|
| 10.
|
Gelinas, C., and H. M. Temin.
1986.
Nondefective spleen necrosis-derived vectors define the upper size limit for packaging reticuloendotheliosis viruses.
Proc. Natl. Acad. Sci. USA
83:9211-9215[Abstract/Free Full Text].
|
| 11.
|
Gilboa, E.,
S. W. Mitra,
S. P. Goff, and D. Baltimore.
1979.
A detailed model of reverse transcription and tests of crucial aspects.
Cell
18:93-100[CrossRef][Medline].
|
| 12.
|
Hall, C. V.,
P. E. Jacob,
G. M. Ringold, and F. Lee.
1983.
Expression and regulation of Escherichia coli lacZ gene fusions in mammalian cells.
J. Mol. Appl. Genet.
2:101-109[Medline].
|
| 13.
|
Hartman, S. C., and R. C. Mulligan.
1988.
Two dominant-acting selectable markers for gene transfer studies in mammalian cells.
Proc. Natl. Acad. Sci. USA
85:8047-8051[Abstract/Free Full Text].
|
| 14.
|
Herman, S. A., and J. M. Coffin.
1987.
Efficient packaging of readthrough RNA in ALV: implications for oncogene transduction.
Science
236:845-848[Abstract/Free Full Text].
|
| 15.
|
Holzschu, D. L.,
D. Martineau,
S. K. Fodor,
V. M. Vogt,
P. R. Bowser, and J. W. Casey.
1995.
Nucleotide sequence and protein analysis of a complex piscine retrovirus, walleye dermal sarcoma virus.
J. Virol.
69:5320-5331[Abstract].
|
| 16.
|
Jones, J. S.,
R. W. Allan,
B. Seufzer, and H. M. Temin.
1994.
Copackaging of different-sized retroviral genomic RNAs: little effect on retroviral replication or recombination.
J. Virol.
68:4097-4103[Abstract/Free Full Text].
|
| 17.
|
Jones, J. S.,
R. W. Allan, and H. M. Temin.
1994.
One retroviral RNA is sufficient for synthesis of viral DNA.
J. Virol.
68:207-216[Abstract/Free Full Text].
|
| 18.
|
Lear, A. L.,
M. Haddrick, and S. Heaphy.
1995.
A study of the dimerization of Rous sarcoma virus RNA in vitro and in vivo.
Virology
212:47-57[CrossRef][Medline].
|
| 19.
|
Lee, C. C.,
J. A. Pearlman,
J. S. Chamberlain, and C. T. Caskey.
1991.
Expression of recombinant dystrophin and its localization to the cell membrane.
Nature
349:334-336[CrossRef][Medline].
|
| 20.
|
Miller, A. D.
1997.
Development and applications of retroviral vectors, p. 437-473.
In
J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 21.
|
Morgenstern, J. P., and H. Land.
1990.
Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line.
Nucleic Acids Res.
18:3587-3596[Abstract/Free Full Text].
|
| 22.
|
Murphy, J. E., and S. P. Goff.
1992.
A mutation at one end of Moloney murine leukemia virus DNA blocks cleavage of both ends by the viral integrase in vivo.
J. Virol.
66:5092-5095[Abstract/Free Full Text].
|
| 23.
|
Nevins, J. R., and P. K. Vogt.
1996.
Cell transformation by viruses, p. 27.
=67-310. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fundamental virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa.
|
| 24.
|
Ortiz-Conde, B. A., and S. H. Hughes.
1999.
Studies of the genomic RNA of leukosis viruses: implications for RNA dimerization.
J. Virol.
73:7165-7174[Abstract/Free Full Text].
|
| 25.
|
Pathak, V. K., and H. M. Temin.
1990.
Broad spectrum of in vivo forward mutations, hypermutations, and mutational hotspots in a retroviral shuttle vector after a single replication cycle: deletions and deletions with insertions.
Proc. Natl. Acad. Sci. USA
87:6024-6028[Abstract/Free Full Text].
|
| 26.
|
Petropoulos, C. J., and S. H. Hughes.
1991.
Replication-competent retrovirus vectors for the transfer and expression of gene cassettes in avian cells.
J. Virol.
65:3728-3737[Abstract/Free Full Text].
|
| 27.
|
Pfeiffer, J. K.,
R. Topping,
N.-H. Shin, and A. Telesnitsky.
1999.
Altering the intracellular environment increases the frequency of tandem repeat deletion during Moloney murine leukemia virus reverse transcription.
J. Virol.
73:8441-8447[Abstract/Free Full Text].
|
| 28.
|
Preston, B. D., and J. P. Dougherty.
1996.
Mechanisms of retroviral mutation.
Trends Microbiol.
4:16-21[CrossRef][Medline].
|
| 29.
|
Price, J.,
D. Turner, and C. Cepko.
1987.
Lineage analysis in the vertebrate nervous system by retrovirus-mediated gene transfer.
Proc. Natl. Acad. Sci. USA
84:156-160[Abstract/Free Full Text].
|
| 30.
|
Rein, A.
1994.
Retroviral RNA packaging: a review.
Arch. Virol. Suppl.
9:513-522[Medline].
|
| 31.
|
Robson, N. D., and A. Telesnitsky.
1999.
Effects of 3' untranslated region mutations on plus-strand priming during Moloney murine leukemia virus replication.
J. Virol.
73:948-957[Abstract/Free Full Text].
|
| 32.
|
Sakalian, M.,
J. W. Wills, and V. M. Vogt.
1994.
Efficiency and selectivity of RNA packaging by Rous sarcoma virus gag deletion mutants.
J. Virol.
68:5969-5981[Abstract/Free Full Text].
|
| 33.
|
Sakuragi, J.-I., and A. Panganiban.
1997.
Human immunodeficiency virus type 1 RNA outside the primary encapsidation and dimer linkage region affects RNA dimer stability in vivo.
J. Virol.
71:3250-3254[Abstract].
|
| 34.
|
Stuhlmann, H.,
R. Jaenisch, and R. C. Mulligan.
1989.
Construction and properties of replication-competent murine retroviral vectors encoding methotrexate resistance.
Mol. Cell. Biol.
9:100-108[Abstract/Free Full Text].
|
| 35.
|
Sugden, B.
1993.
How some retroviruses got their oncogenes.
Trends Biochem. Sci.
18:233-235[CrossRef][Medline].
|
| 36.
|
Swain, A., and J. M. Coffin.
1992.
Mechanism of transduction by retroviruses.
Science
255:841-845[Abstract/Free Full Text].
|
| 37.
|
Tybulewicz, V. L.,
C. E. Crawford,
P. K. Jackson,
R. T. Bronson, and R. C. Mulligan.
1991.
Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene.
Cell
65:1153-1163[CrossRef][Medline].
|
| 38.
|
Vogt, P. K.
1997.
Historical introduction to the general properties of retroviruses, p. 1-25.
In
J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 39.
|
von Magnus, P.
1954.
Incomplete forms of influenza virus.
Adv. Virus Res.
2:59-79[Medline].
|
| 40.
|
Voynow, S. L., and J. M. Coffin.
1985.
Evolutionary variants of Rous sarcoma virus: large deletion mutants do not result from homologous recombination.
J. Virol.
55:67-78[Abstract/Free Full Text].
|
| 41.
|
Wilson, C.,
M. S. Reitz,
H. Okayama, and M. V. Eiden.
1989.
Formation of infectious hybrid virions with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the Gag and Pol proteins of Moloney murine leukemia virus.
J. Virol.
63:2374-2378[Abstract/Free Full Text].
|
| 42.
|
Zhang, J., and H. M. Temin.
1993.
3' junctions of oncogene-virus sequences and the mechanisms for formation of highly oncogenic retroviruses.
J. Virol.
67:1747-1751[Free Full Text].
|
Journal of Virology, March 2000, p. 2694-2702, Vol. 74, No. 6
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Duggal, N. K., Goo, L., King, S. R., Telesnitsky, A.
(2007). Effects of Identity Minimization on Moloney Murine Leukemia Virus Template Recognition and Frequent Tertiary Template-Directed Insertions during Nonhomologous Recombination. J. Virol.
81: 12156-12168
[Abstract]
[Full Text]
-
Metzl, C., Mischek, D., Salmons, B., Gunzburg, W. H., Renner, M., Portsmouth, D.
(2006). Tissue- and Tumor-Specific Targeting of Murine Leukemia Virus-Based Replication-Competent Retroviral Vectors. J. Virol.
80: 7070-7078
[Abstract]
[Full Text]
-
Flynn, J. A., An, W., King, S. R., Telesnitsky, A.
(2004). Nonrandom Dimerization of Murine Leukemia Virus Genomic RNAs. J. Virol.
78: 12129-12139
[Abstract]
[Full Text]
-
An, W., Telesnitsky, A.
(2004). Human Immunodeficiency Virus Type 1 Transductive Recombination Can Occur Frequently and in Proportion to Polyadenylation Signal Readthrough. J. Virol.
78: 3419-3428
[Abstract]
[Full Text]
-
Baldeschi, C., Gache, Y., Rattenholl, A., Bouille, P., Danos, O., Ortonne, J.-P., Bruckner-Tuderman, L., Meneguzzi, G.
(2003). Genetic correction of canine dystrophic epidermolysis bullosa mediated by retroviral vectors. Hum Mol Genet
12: 1897-1905
[Abstract]
[Full Text]
-
Onafuwa, A., An, W., Robson, N. D., Telesnitsky, A.
(2003). Human Immunodeficiency Virus Type 1 Genetic Recombination Is More Frequent Than That of Moloney Murine Leukemia Virus despite Similar Template Switching Rates. J. Virol.
77: 4577-4587
[Abstract]
[Full Text]
-
Marzio, G., Vink, M., Verhoef, K., de Ronde, A., Berkhout, B.
(2002). Efficient Human Immunodeficiency Virus Replication Requires a Fine-Tuned Level of Transcription. J. Virol.
76: 3084-3088
[Abstract]
[Full Text]
-
Brincat, J. L., Pfeiffer, J. K., Telesnitsky, A.
(2002). RNase H Activity Is Required for High-Frequency Repeat Deletion during Moloney Murine Leukemia Virus Replication. J. Virol.
76: 88-95
[Abstract]
[Full Text]
-
Pfeiffer, J. K., Telesnitsky, A.
(2001). Effects of Limiting Homology at the Site of Intermolecular Recombinogenic Template Switching during Moloney Murine Leukemia Virus Replication. J. Virol.
75: 11263-11274
[Abstract]
[Full Text]
-
Logg, C. R., Logg, A., Tai, C.-K., Cannon, P. M., Kasahara, N.
(2001). Genomic Stability of Murine Leukemia Viruses Containing Insertions at the Env-3' Untranslated Region Boundary. J. Virol.
75: 6989-6998
[Abstract]
[Full Text]
-
Pfeiffer, J. K., Georgiadis, M. M., Telesnitsky, A.
(2000). Structure-Based Moloney Murine Leukemia Virus Reverse Transcriptase Mutants with Altered Intracellular Direct-Repeat Deletion Frequencies. J. Virol.
74: 9629-9636
[Abstract]
[Full Text]
-
Mouland, A. J., Mercier, J., Luo, M., Bernier, L., DesGroseillers, L., Cohen, E. A.
(2000). The Double-Stranded RNA-Binding Protein Staufen Is Incorporated in Human Immunodeficiency Virus Type 1: Evidence for a Role in Genomic RNA Encapsidation. J. Virol.
74: 5441-5451
[Abstract]
[Full Text]