Previous Article | Next Article 
Journal of Virology, March 2000, p. 2219-2226, Vol. 74, No. 5
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Interactions of Viral Protein 3CD and Poly(rC)
Binding Protein with the 5' Untranslated Region of the Poliovirus
Genome
Andrea V.
Gamarnik
and
Raul
Andino*
Department of Microbiology and Immunology,
University of California, San Francisco, California 94143-0414
Received 7 July 1999/Accepted 24 November 1999
 |
ABSTRACT |
The poly(rC) binding protein (PCBP) is a cellular protein required
for poliovirus replication. PCBP specifically interacts with two
domains of the poliovirus 5' untranslated region (5'UTR), the 5'
cloverleaf structure, and the stem-loop IV of the internal ribosome
entry site (IRES). Using footprinting analysis and site-directed mutagenesis, we have mapped the RNA binding site for this cellular protein within the stem-loop IV domain. A C-rich sequence in a loop at
the top of this large domain is required for PCBP binding and is
crucial for viral translation. PCBP binds to stem-loop IV RNA with
six-times-higher affinity than to the 5' cloverleaf structure. However,
the binding of the viral protein 3CD (precursor of the viral protease
3C and the viral polymerase 3D) to the cloverleaf RNA dramatically
increases the affinity of PCBP for this RNA element. The viral protein
3CD binds to the cloverleaf RNA but does not interact directly with
stem-loop IV nor with other RNA elements of the viral IRES. Our results
indicate that the interactions of PCBP with the poliovirus 5'UTR are
modulated by the viral protein 3CD.
 |
INTRODUCTION |
The highly structured 5'
untranslated region (5'UTR) of picornaviruses plays an important role
in the regulation of both viral translation and RNA replication. The
regulatory function of this region is mediated by its interaction with
cellular and viral proteins (for a review, see references 1,
5, and 12). Using computer analysis and
genetic and biochemical tests, the 5'UTR of poliovirus (the prototype
member of the picornavirus family) can be divided into six well-defined
RNA domains (stem-loops I to VI) (29, 30, 34).
Stem-loop I, which folds into a cloverleaf-like structure
(30), is essential for viral RNA synthesis (2, 3, 17, 31, 37). This element forms a ternary RNP complex with the cellular poly(rC) binding protein (PCBP; also known as hnRNP E or
-CP) and the uncleaved precursor of the viral protease-polymerase, 3CD (15, 26). Mutations that disrupt complex formation,
either within the cloverleaf RNA or within 3CD, impair viral RNA
synthesis (3, 4, 31). The mechanism by which the ternary
complex participates in RNA replication is poorly understood, but it
was suggested that it catalyzes the initiation of positive strand RNA
synthesis in trans (2). More recent evidence
suggests that the ternary complex has a bifunctional role,
participating in both viral translation and RNA replication (14,
33). The binding of PCBP to stem-loop B of the cloverleaf
structure enhances viral translation 10-fold, while binding of 3CD
decreases translation and promotes negative-strand RNA synthesis
(14).
Viral translation is directed by an RNA element located within the
5'UTR (stem-loops II to VI) known as the internal ribosomal entry site
(IRES). This element allows ribosomes to enter the RNA without scanning
from the 5' end (21, 27, 36). The mechanism by which the
translation apparatus recognizes IRES sequences is still unknown, but
it has been proposed that several canonical initiation factors, as well
as other cellular proteins, participate in this process (24,
28). So far, four noncanonical factors that bind to the
poliovirus IRES have been identified: the polypyrimidine tract binding
protein (18), the La autoantigen (23), the
cellular protein PCBP (7), and the protein encoded by the
gene present upstream of N-ras, UNR (20).
PCBP was first identified as a component of the
-complex of the
human
-globin mRNA, which greatly increases mRNA stability (22). More-recent evidence implicates PCBP in controlling
the expression of numerous cellular and viral RNAs (for a review, see
reference 25). It has been shown that PCBP
specifically represses the expression of the late gene L2 in human
papillomavirus (10) and enhances hepatitis A
capindependent translation (16). However, the molecular
mechanism by which PCBP interacts with the translation apparatus
remains undefined. In poliovirus, PCBP specifically interacts with two
stem-loops of the 5'UTR: the cloverleaf structure and stem-loop IV
(7, 8, 15, 26). A number of observations suggest that PCBP
is required for poliovirus translation. In fact, alteration of PCBP
binding sites, depletion of PCBP from HeLa cell extracts, or
microinjection of anti-PCBP antibodies into Xenopus oocytes
inhibits poliovirus translation (8, 15).
In the present study, we further analyzed the interactions of 3CD and
PCBP with the poliovirus 5'UTR and the interplay between the RNP
complexes formed during the viral life cycle. Using footprinting analysis and mobility shift assays we found that PCBP forms RNP complexes with different affinities depending on the presence of the
viral protein 3CD. These findings may further our understanding of the
molecular mechanism by which PCBP and 3CD participate in viral
translation and RNA replication.
 |
MATERIALS AND METHODS |
Footprinting analysis.
RNase treatment, primer extension,
and gel electrophoresis were performed as previously described
(6). Poliovirus 5'UTR RNA was synthesized in vitro with T7
polymerase, and unincorporated nucleoside triphosphates were removed by
use of an RNeasy column (Qiagen). Binding reactions were performed for
10 min at room temperature with 1.5 µg of purified recombinant PCBP,
3 µg of partially purified 3CD, or 2 µg of bovine serum albumin in
a final volume of 40 µl. RNase T1 or RNase T2
(Sigma) was added to the binding reaction and incubated for 15 min at
room temperature. After RNase treatment, RNA was phenol extracted,
ethanol precipitated, used as template for primer extension, and
analyzed in 6% polyacrylamide-6 M urea sequencing gels. For the
analysis of stem-loop IV, primer 1 (TCACAACTAGCGTCCCATGGCGTTAGCCATAGGTAGGCCG) was used. The
recombinant proteins PCBP and 3CD were obtained as described below.
Production and purification of PCBP and 3CD.
PCBP2 was
expressed in Escherichia coli as a maltose-binding protein
(MBP) fusion, MBP-PCBP, as previously described (15). The
fusion protein was purified by affinity chromatography with amylose
resin and digested with factor X to cleave PCBP from MBP. The
recombinant 3CD protein used throughout this study contained a mutation
in the catalytic site of 3C (H40E). This mutation completely abolishes
3CD proteolytic activity (2). To produce recombinant 3CD, T7
expression plasmids were transformed into the E. coli BL21(DE3), which contained the T7 polymerase gene under the control of
the lacUV5 promoter. An overnight culture of freshly
transformed bacteria was diluted 1/10, and the culture was grown to an
optical density at 550 nm of 0.5 before IPTG
(isopropyl-
-D-thiogalactopyranoside) was added to a
final concentration of 0.4 mM. The induction was carried out for an
additional 2 h. Cells were harvested, washed once with
phosphate-buffered saline (PBS), and resuspended in lysis buffer (10 mM
HEPES [pH 7.9], 20 mM KCl, 25 mM EDTA, 5 mM dithiothreitol, 0.1 mM
phenylmethylsulfonyl fluoride, 1% Triton X-100). The suspension was
frozen and thawed three times, sonicated for about 30 s to reduce
viscosity, and centrifuged at 150,000 × g for 15 min
to remove debris. Glycerol was added to 20% final concentration, and
the supernatant was stored at
70°C.
RNA binding assays.
RNA binding reactions and
electrophoretic mobility shift assays were performed as previously
described (15). Briefly, uniformly 32P-labeled
RNA probes were generated by in vitro transcription by using T7 RNA
polymerase. The cloverleaf probe corresponded to the first 108 nucleotides, and the stem-loop IV probe corresponded to a fragment from
nucleotides 234 to 459 of the poliovirus genome. The mutated stem-loop
IV RNAs (mutants SL IV-23, SL IV-298, and SL IV-332) were generated by
use of overlapping PCR, and the product DNA was directly used as a
template for in vitro transcription by using T7 polymerase. Unlabeled
RNAs used as competitors corresponding to stem-loop I (nucleotides 1 to
108), stem-loop II-III (nucleotides 90 to 240), stem-loop IV
(nucleotides 234 to 459), stem-loop V (nucleotides 440 to 578), and
stem-loop VI (nucleotides 556 to 638) were synthesized by in vitro
transcription with DNA templates obtained by PCR amplification.
Dissociation constants were determined by quantifying the fraction of
RNA bound (
) with a PhosphorImager (Molecular Dynamics). The data
were fitted by using nonlinear-least-squares analysis as a function of
total PCBP concentration as follows:
= [PCBP]/[PCBP] Kd. For PCBP-stem-loop IV RNA, which gave two
band shifts, Kd values were calculated by
treating bound RNA as a single species equal to the sum of both bands.
Translation in HeLa cells.
To test the translation
efficiencies of wild-type and mutant Polio-Luc RNAs, 100-mm dishes
containing ~3 × 106 HeLa cells were trypsinized and
transfected by standard electroporation procedures by using 20 µg of
in vitro-transcribed RNA per plate. Cells were incubated at 37°C, and
time point data were taken every 30 min. The cells were washed with
PBS, scraped from the plates, and lysed in 200 µl of lysis buffer
(Promega). Luciferase activity was measured in 10 µl of extract by
using a luciferase system as recommended by the manufacturer (Promega)
and quantified by using an Optocomp I luminometer.
3CD binding to biotinylated RNA.
The 5'UTR stem-loops I to
VI, the IRES stem-loops II to VI, and the green fluorescent protein
(GFP) mRNA were transcribed in vitro in the presence of limiting
concentrations of biotin-16-UTP to incorporate two to three
biotinylated nucleotides per molecule of RNA. Then, 30 µg of this RNA
was incubated with 40 µl of streptoavidin beads and washed five times
with PBS. The RNA present in the washes was used to estimate the
efficiency of binding, which was 30 to 40% of the original amount of
RNA added. Then, 4 µg of partially purified recombinant 3CD protein
(2) was added together with 50 µl of the uninfected S10
HeLa fraction. The mix was incubated for 1 h on ice and, after
centrifugation, the beads were washed four times with 500 µl of wash
buffer (50 mM Tris-HCl, pH 7.4; 100 mM KCl; 0.2% NP-40). After the
washes, the beads were resuspended in sample buffer and analyzed by
Western blotting with anti-3CD antibodies.
 |
RESULTS |
Mapping the PCBP binding site within stem-loop IV of the poliovirus
genome.
The multiple interactions of the cellular protein PCBP
with the 5'UTR of the poliovirus genome are essential for viral
translation and RNA replication (8, 14, 15, 26). However,
many structural details and the precise mechanism by which PCBP
participates in these processes remain obscure. To further define the
binding site of PCBP within the poliovirus IRES, we performed RNA
footprinting analysis. The complete 5'UTR of the viral genome was
treated with RNase T1 or T2 in the presence or
absence of recombinant PCBP. The viral RNA was then analyzed by primer
extension by using primers to inspect the stem-loop IV sequence.
Several RNase-hypersensitive regions were detected within the core of
the IRES, corresponding to single-stranded regions of the RNA (Fig.
1A, compare lanes 5, 8, 9, and 12 with
lane 13). The presence of PCBP protects nucleotides 364 to 373 from
both RNase T1 and T2 digestion and nucleotides 296 to 301, 331 to 339, and 382 to 386 from RNase T2
digestion (Fig. 1A, lanes 5 to 12). According to the predicted
secondary structure of stem-loop IV, the cellular protein PCBP
specifically protects several regions located at the top of this large
domain (Fig. 1B, loop a, loop b, and bulge c).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
PCBP-RNA interactions within stem-loop IV of the
poliovirus IRES. (A) Footprinting analysis reveals that PCBP protects
several regions of the large stem-loop IV from RNase digestion. The
viral 5'UTR was treated with RNase T1 (lanes 5 to 8) or
RNase T2 (lanes 9 to 12). Lane 13 corresponds to untreated
RNA. RNase was added in the presence of bovine serum albumin ( ) or
PCBP protein, as indicated at the top of each lane. Primer extension
was performed by using a primer complementary to nucleotides 368 to
408. Lanes labeled C, T, A, and G correspond to dideoxy sequencing
lanes. Brackets indicate PCBP protected regions (a, b, and c). The
numbers on the left indicate the nucleotide position of the viral
genome in poliovirus type 1. (B) Predicted secondary structure of
stem-loop IV of the poliovirus type 1 genome. PCBP protected regions as
determined by footprinting analysis in panel A are indicated by black
lines (loop a, loop b, and bulge c).
|
|
Interestingly, loop a and loop b contain single-stranded C-rich
sequences which resemble the consensus RNA-binding site for
PCBP found
in several cellular mRNAs (
19). To analyze whether
these
C-rich sequences are directly involved in PCBP binding to
stem-loop IV,
we performed site-directed mutagenesis and studied
the ability of
wild-type and mutated RNAs to bind PCBP in vitro.
Three stem-loop IV
mutants were constructed: one in which the
sequence CCCCA at position
298 was replaced by GAGCG, another
in which the sequence AUCCC at
position 332 was replaced by GAGGA,
and a third mutant combining the
substitutions at positions 298
and 332 (Fig.
2A, SL
IV-298, SL IV-332, and SL IV-23, respectively).
The mutations
introduced in loop a and loop b did not alter the
predicted secondary
structure observed for stem-loop IV wild type.
RNA probes corresponding
to wild type and the three stem-loop
IV mutants were used in
electrophoretic mobility shift assays.
We employed PCBP purified from
HeLa cell extracts because this
protein binds RNA with six- to
eightfold- higher affinity than
the recombinant protein (data not
shown). The concentration of
PCBP in HeLa cells (100 nM) was estimated
by comparing cell extracts
with dilutions of purified recombinant PCBP
by Western blotting
(data not shown).


View larger version (3315K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of mutations within stem-loop IV on PCBP binding
and viral translation. (A) Position and sequence of mutations within
the predicted secondary structure of stem-loop IV. The C-rich loop a
and loop b are indicated with their wild-type and mutated sequences: SL
IV-23, SL IV-298, and SL IV-332. (B) RNA mobility shift analysis
showing the effect of mutations within stem-loop IV probe on PCBP
binding. RNA mobility shift experiments were performed with four
different probes: wild-type stem-loop IV (lanes 1 to 5), SL IV-23
(lanes 6 to 10), SL IV-298 (lanes 11 to 15), and SL IV-332 (lanes 16 to
20). Each probe was incubated with buffer ( ) or increasing
concentrations of cellular PCBP (0.2 ng to 0.1 µg), as indicated at
the top of the panel. Position of specific complexes I and II and the
stem-loop IV probe (Free Probe) are indicated by arrows. (C) Binding
affinity of PCBP to wild-type and mutated stem-loop IV RNAs. The
fraction of radiolabeled probe bound ( ) determined by mobility shift
assays is plotted against PCBP concentration. (D) Translation
efficiencies of wild type and stem-loop IV mutants in HeLa cells. At
the top, a schematic representation of the poliovirus replicon carrying
the luciferase reporter gene in place of the capsid proteins. The arrow
indicates a recognition site for cleavage by the viral 2A protease. At
the bottom, the translation of wild type and stem-loop IV mutants (SL
IV-23, SL IV-298, and SL IV-332) is measured as luciferase activity and
plotted as a function of the time after RNA transfections into HeLa
cells.
|
|
As previously described (
7,
15), PCBP interacts with the
stem-loop IV RNA forming two discrete RNP complexes, complex
I and
complex II (Fig.
2B). None of the stem-loop IV mutants formed
stable
complexes with the cellular protein (Fig.
2B, lanes 6 to
20). The
affinity of PCBP for the mutant SL IV-23 was about 60-fold
lower than
for the wild-type RNA, and the affinities for the mutants
SL IV-298 and
-332 were about 35- and 40-fold lower than for wild
type, respectively
(Fig.
2C). These results indicate that the
C-rich sequences in loop a
and loop b of the large stem-loop IV
of the viral IRES are important
determinants for binding of PCBP
in
vitro.
In agreement with our observations, a previous report indicated that an
insertion of three nucleotides at position 325, just
upstream of loop b
of stem-loop IV, abolished binding of PCBP
in vitro (
7),
presumably by altering the structure at the base
of loop b. This
interaction appears to be critical for replication,
because a
poliovirus RNA carrying the same mutation yields a nonviable
virus with
a major defect in translation (
13,
35). Having
defined more
precisely the PCBP binding site, we analyzed whether
the sequences of
loop a and loop b are functionally important
for viral translation. We
introduced the three mutations described
above (SL IV-298, SL IV-332,
and SL IV-23) into the genome of
a poliovirus subgenomic replicon in
which the capsid coding region
was replaced by the luciferase gene
(Fig.
2D). Translation efficiencies
were determined by measuring
luciferase activity as a function
of the time after RNA transfection
into HeLa cells. Translation
of the mutants SL IV-23 and SL IV-332 was
reduced 100- to 1,000-fold
compared with the wild-type RNA (Fig.
2D).
In contrast, translation
of the mutant SL IV-298 was close to wild-type
levels, suggesting
that not all the determinants for complex formation
observed in
mobility shift assays are functionally important for viral
translation.
In summary, we found that a highly conserved C-rich sequence (loop b)
present in stem-loop IV of the poliovirus IRES is an
important
determinant for PCBP binding and is essential for viral
translation.
The viral protein 3CD greatly enhances the binding affinity of PCBP
to the cloverleaf RNA, leading to a dissociation of PCBP from stem-loop
IV.
PCBP specifically interacts with two domains of the poliovirus
5'UTR: the cloverleaf and stem-loop IV. Since these two interactions appear to be important for viral translation and previous evidence suggested that PCBP dimerizes (15), we investigated whether this protein alone or together with other cellular proteins can bridge
the two RNA domains. First, we determined if the cloverleaf RNA
directly interacts with stem-loop IV RNA. Using gel shift analysis, we
observed that an excess of unlabeled cloverleaf RNA did not modify the
mobility of stem-loop IV in a native gel (Fig. 3, compare lanes 1 and
2), suggesting that these RNAs do not interact with each other in the
absence of proteins. In the presence of HeLa cell proteins, two
specific complexes identical to the ones observed with recombinant PCBP
protein were formed (15) (Fig. 3C, lane 3). Addition of
cloverleaf RNA did not alter the mobility of these complexes,
indicating that even in the presence of cellular proteins the
cloverleaf and stem-loop IV RNA structures do not interact with each
other. Interestingly, the cloverleaf RNA was a poor competitor for the
interaction of PCBP with stem-loop IV: 100-fold molar excess was
required to partially compete with complex I, whereas complex II was
not significantly reduced (Fig. 3, lanes 4 to
6). However, while 3CD by itself did not
modify the PCBP-stem-loop IV interaction (Fig. 3, lane 10), addition
of 3CD together with cloverleaf RNA effectively reduced the binding of
PCBP to stem-loop IV (Fig. 3, lanes 7 to 9). In these experiments we
used a bacterially expressed 3CD carrying a mutation at His 40 (H40E)
within the catalytic site of the protease 3C. This mutation abrogates
proteolytic activity and prevents cleavage of 3CD (2). When
similar experiments were performed using mutants either in loop D of
the cloverleaf or in the RNA binding domain of 3CD protein, the
competition for PCBP was not observed (data not shown). These findings
suggest that the binding of 3CD to the cloverleaf promotes dissociation of PCBP from stem-loop IV.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 3.
PCBP dissociates from stem-loop IV in the presence of
cloverleaf RNA and 3CD. Uniformly labeled stem-loop IV (5 ng) was
incubated with buffer, unlabeled cloverleaf RNA (500 ng, lane 2), S10
HeLa proteins (20 µg), and decreasing concentrations of unlabeled
cloverleaf (CL) RNA (500, 50, and 5 ng) (lanes 4 to 6 and lanes 7 to
9). Binding reactions were performed in the absence (lanes 3 to 6) or
in the presence (lanes 7 to 10) of 0.5 µg of recombinant 3CD. The
electrophoretic mobility of the two RNP complexes formed between PCBP
and stem-loop IV (complex I and complex II) and the free stem-loop IV
RNA (Free Probe) is indicated on the left.
|
|
It is possible that the binding of 3CD to the RNA stabilizes the
interaction of PCBP with the cloverleaf structure and, under
limiting
concentrations of PCBP, the cellular protein preferentially
binds to
the cloverleaf and not to stem-loop IV RNA. To test this
hypothesis, we
examined the binding affinity of PCBP either in
complex with the
cloverleaf or stem-loop IV in the presence or
absence of the viral
protein 3CD. The apparent dissociation constants
for PCBP-RNA complexes
were estimated from band shift titrations
by using radiolabeled
stem-loop IV or cloverleaf RNAs and cellular
PCBP as described for Fig.
2. The estimated dissociation constant
for PCBP-stem-loop IV RNA
complex was ~15 nM, and it was not significantly
affected by the
presence of 3CD (Fig.
4A). In contrast,
the binding
affinity of PCBP-cloverleaf increased 2 orders of magnitude
in
the presence of the viral protein, decreasing the dissociation
constant from ~95 to ~1 nM (Fig.
4B). These results indicate that
3CD stabilizes the interaction of PCBP with the cloverleaf structure.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of 3CD on the affinities of PCBP for stem-loop IV
and the cloverleaf. The fraction of radiolabeled probe bound ( ) for
stem-loop IV (A) and cloverleaf (B) is plotted against PCBP
concentration. The bands corresponding to free and bound probes in the
mobility shift assays were quantified in a PhosphorImager. The
experiment was performed in the absence ( ) or in the presence ( )
of 0.5 µg of recombinant 3CD protein.
|
|
Because the mobility shift analysis in Fig.
3 was performed using the
isolated RNA domains I and IV, we wanted to investigate
whether 3CD was
able to alter the interactions of PCBP with the
viral RNA in the
context of the complete 5'UTR. Thus, we employed
footprinting analysis
with the 750- nucleotide RNA in the presence
of 3CD and/or PCBP. 3CD by
itself did not alter consistently the
RNase digestion pattern within
the sequence of stem-loop IV (Fig.
5, lanes 1 to 4 and 13 to
16). However, when PCBP and 3CD were
added together to the binding reaction, PCBP no longer protected
the
RNA from the attack of the RNases (Fig.
5, compare lanes 5
to 8 with 9 to 12 and lanes 17 to 20 with 21 to 24). Taken together,
these results
indicate that binding of 3CD to the cloverleaf RNA
greatly increases
the affinity of PCBP for this RNA structure
and induces dissociation of
PCBP from stem-loop IV RNA.

View larger version (82K):
[in this window]
[in a new window]
|
FIG. 5.
Footprinting analysis reveals that 3CD induces
dissociation of PCBP from stem-loop IV. The footprinting analysis was
performed as described for Fig. 1A. The viral 5'UTR was treated with
RNase T1 (lanes 1 to 12) or RNase T2 (lanes 13 to 24). RNase was added in the presence of bovine serum albumin ( ),
3CD, PCBP, or 3CD plus PCBP proteins, as indicated on the top of each
lane. The numbers on the left indicate the nucleotide position in the
poliovirus type 1 genome.
|
|
Interaction of 3CD with the poliovirus 5'UTR.
Because 3CD is
able to downregulate poliovirus protein synthesis (14) and a
number of stem-loops within the IRES play a crucial role in translation
initiation, we investigated whether 3CD could interact with stem-loop
IV RNA or with other elements of the viral IRES (Fig.
6A). We first determined whether 3CD
binds to the complete 5'UTR or the IRES sequence. Immobilized RNA
molecules were incubated with recombinant 3CD (see Materials and
Methods) in the presence of HeLa cell extracts containing PCBP (which
enhance 3CD binding) and the amount of bound 3CD was determined by
Western blot analysis. The complete 5'UTR associates very efficiently with 3CD (Fig. 6C, lane 1). In contrast, the IRES (stem-loops II to
VI), as well as an unrelated RNA used as a control, were unable to
interact with the viral protein, suggesting that 3CD does not bind the
viral IRES under our experimental conditions. To confirm this
observation, we employed competition mobility shift assays. We used a
radiolabeled cloverleaf as probe, bacterially expressed 3CD, and
competitor RNAs corresponding to each of the predicted stem-loops I to
VI of the viral 5'UTR. The complex between 3CD and the cloverleaf RNA
was neither competed with nor modified by addition of stem-loops II,
III, IV, V, or VI, even when used at 500-fold excess relative to the
cloverleaf probe (Fig. 6C). Thus, these results further confirm that,
within the viral 5'UTR, 3CD interacts only with the cloverleaf
structure.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 6.
Interaction of 3CD with the 5'UTR of the poliovirus
genome. (A) Schematic representation of the poliovirus 5'UTR. Predicted
stem-loop I (cloverleaf) and stem-loops II to VI (IRES) are indicated.
AUG at position 743 represents the authentic poliovirus initiation
codon. (B) The viral protein 3CD does not interact with the poliovirus
IRES. Western blot analysis with anti-3CD antibodies shows the viral
protein precipitated by immobilized RNAs. The biotinylated RNA
molecules used, 5'UTR, IRES, and GFP (GFP mRNA), are indicated on the
top. In lane 4, no RNA was included in the reaction. The
electrophoretic mobility of 3CD is indicated on the left. (C) Mobility
shift competition experiments. Uniformly labeled cloverleaf RNA (1 ng,
30,000 cpm) was incubated with purified recombinant 3CD (0.5 µg) and
with each of the six predicted stem-loops of the poliovirus 5'UTR as
unlabeled competitors. Decreasing amounts of competitor RNAs (500, 50, and 1 ng) were used as indicated at the top of the gel with triangles.
The mobility of the RNP complex corresponding to cloverleaf-3CD
(RNP-b), and the free cloverleaf (Free Probe) is indicated on the
left.
|
|
 |
DISCUSSION |
In this study, we have mapped the RNA binding site of PCBP
within stem-loop IV of the poliovirus IRES. We found that a C-rich loop
located at the top of domain IV is an important determinant for protein
binding and that its sequence is essential for viral translation.
Furthermore, we showed that the interactions between PCBP and the 5'UTR
of the poliovirus genome are modulated by the viral protein 3CD. Since
the binding of PCBP to the viral RNA is important for translation and
genome replication (8, 14, 26), altering PCBP-RNA
interactions could represent a mechanism for regulating these viral processes.
How can PCBP and 3CD control viral translation?
The results
presented here together with previous observations indicate that the
interactions of PCBP with the cloverleaf RNA and the stem-loop IV are
required for IRES-mediated translation (7, 8, 14, 15, 26).
How these RNP complexes assist ribosomal entry is still unknown. It has
been postulated that RNA-protein interactions within the viral 5'UTR
induce the appropriate spatial arrangement along the RNA to be
recognized by the translation initiation machinery. We have previously
reported that the specific interaction of PCBP with the cloverleaf RNA
enhances viral translation 10-fold, while binding of the viral protein
3CD to the same RNA element has a negative effect on translation
(14). In the present study, we inspected the interactions of
PCBP and 3CD with the viral 5'UTR.
We showed that the binding of 3CD to stem-loop D of the cloverleaf RNA
greatly increases the binding affinity of PCBP, changing
the
dissociation constant from ~95 to ~1 nM (Fig.
4B). The molecular
basis of this effect is not yet clear. It could be caused by a
favorable change in the RNA upon 3CD binding, exposing a high-affinity
binding site for PCBP within the cloverleaf structure, or by direct
3CD-PCBP interaction. Regardless of the molecular basis of the
complex
formation, the interaction of 3CD with the PCBP-cloverleaf
complex
could induce structural changes that directly interfere
with the
ability of PCBP to enhance viral
translation.
Although in the presence of 3CD the affinity of PCBP for the cloverleaf
RNA increased dramatically (from
Kd values of
~95
to ~1 nM), its affinity for stem-loop IV was not affected
(~15
nM). This suggests that, in the presence of 3CD, PCBP will bind
preferentially the cloverleaf RNA. Indeed, the footprinting analysis
indicates that 3CD induces dissociation of PCBP from stem-loop
IV (Fig.
5). This dissociation appears to be mediated by direct
competition
between the cloverleaf and stem-loop IV, because an
excess of PCBP
restored complex formation (data not shown). We
estimated that the
overall cytoplasmic concentration of PCBP in
HeLa cells is about 100 nM, which could be sufficient to bind
both RNA targets simultaneously.
If this is the case, it would
be unlikely that the dissociation of PCBP
from stem-loop IV induced
by 3CD is the mechanism of downregulation of
translation. However,
because it is difficult to determine the local
PCBP concentration
where the viral RNA is translated, the
functional relevance of
the effect of 3CD within stem-loop IV warrants
further
investigation.
PCBP binding to picornavirus 5'UTRs.
The binding of PCBP to
the cloverleaf RNA was previously mapped, and the presence of three
cytosines in stem-loop B of the cloverleaf was shown to be essential
for protein recognition as well as for viral viability (2, 3,
17). The interaction of PCBP with stem-loop IV was first reported
by Blyn et al. (7). Here, we examined this interaction in
more detail and found that two C-rich loops at position 298 (loop a)
and 332 (loop b) of the large stem-loop IV are important determinants
for protein binding in vitro (Fig. 2). Interestingly, the in vivo
studies indicate that the sequence in loop b is crucial for poliovirus translation, while changing the sequence in loop a does not
significantly alter viral translation (Fig. 2D). The behavior of this
last mutant is intriguing. However, it is possible that loop a is
involved in stabilizing the complex with PCBP in vitro without
contributing to the in vivo binding site. In the context of the
full-length poliovirus genome, the tertiary structure of the RNA or the
presence of other factors could yield loop a inaccessible to PCBP.
Alternatively, PCBP could make multiple contacts with the stem-loop IV
RNA both in vivo and in vitro, but not all the interactions may be
functionally relevant for translation. Moreover, it is possible that in
vivo other RNA structures as well as cellular proteins contribute in the formation of a stable RNP complex with PCBP.
Importantly, the sequence of loop b, which is required for both binding
of PCBP and viral translation (Fig.
2), is widely
conserved among
entero- and rhinoviruses. In addition, IRES elements
of different
picornaviruses such as coxsackievirus B3, human rhinovirus
14, and
encephalomyocarditis virus efficiently compete with the
poliovirus RNA
for binding to a cellular protein later identified
as PCBP, suggesting
possible interactions of PCBP with those IRESs
(
11). More
recently, it was reported that PCBP is also required
for hepatitis A
virus cap-independent translation, but the specific
site for protein
binding in this IRES remains to be defined (
16).
Taken
together, these observations suggest that one or more binding
sites for
PCBP might be widely present in the 5'UTR of picornaviruses.
However,
more biochemical and functional studies are necessary
to establish
whether PCBP is indeed a general factor required
for viral internal
initiation of
translation.
Finally, it has been shown that picornavirus IRESs not only carry
signals for viral translation but also contain determinants
for RNA
synthesis (
9,
32). Using a bicistronic construct
to uncouple
the synthesis of nonstructural proteins from the poliovirus
IRES, it
was shown that disruption of the stem-loop encompassing
nucleotides 313 to 374 severely compromises viral RNA synthesis
(
9). Because
our findings indicate that PCBP interacts specifically
with part of
this structure, it will be important to determine
whether the
interaction of PCBP with the viral IRES is also involved
in RNA
synthesis.
 |
ACKNOWLEDGMENTS |
We are grateful to Nina Böddeker and Debbie Silvera for
useful comments on the manuscript and to Amy Corder for graphics.
This work was supported by funds provided by the Department of
Microbiology and Immunology, University of California, San Francisco,
and Public Health Service grant AI40085 to R.A.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Box 0414, University of California, 513 Parnassus Ave., San Francisco, CA 94143-0414. Phone: (415) 502-6358. Fax: (415) 476-0939. E-mail: andino{at}cgl.ucsf.edu.
Present address: ViroLogic, Inc., South San Francisco, CA 94080.
 |
REFERENCES |
| 1.
|
Andino, R.,
N. Boeddeker,
D. Silvera, and A. V. Gamarnik.
1999.
Intracellular determinants of picornavirus replication.
Trends Microbiol.
7:76-82[CrossRef][Medline].
|
| 2.
|
Andino, R.,
G. E. Rieckhof,
P. L. Achacoso, and D. Baltimore.
1993.
Poliovirus RNA synthesis utilizes an RNP complex formed around the 5'-end of viral RNA.
EMBO J.
12:3587-3598[Medline].
|
| 3.
|
Andino, R.,
G. E. Rieckhof, and D. Baltimore.
1990.
A functional ribonucleoprotein complex forms around the 5' end of poliovirus RNA.
Cell
63:369-380[CrossRef][Medline].
|
| 4.
|
Andino, R.,
G. E. Rieckhof,
D. Trono, and D. Baltimore.
1990.
Substitutions in the protease (3Cpro) gene of poliovirus can suppress a mutation in the 5' noncoding region.
J. Virol.
64:607-612[Abstract/Free Full Text].
|
| 5.
|
Belsham, G. J., and N. Sonenberg.
1996.
RNA-protein interactions in regulation of picornavirus RNA translation.
Microbiol. Rev.
60:499-511[Abstract/Free Full Text].
|
| 6.
|
Black, D. L., and A. L. Pinto.
1989.
U5 small nuclear ribonucleoprotein: RNA structure analysis and ATP-dependent interaction with U4/U6.
Mol. Cell. Biol.
9:3350-3359[Abstract/Free Full Text].
|
| 7.
|
Blyn, L. B.,
K. M. Swiderek,
O. Richards,
D. C. Stahl,
B. L. Semler, and E. Ehrenfeld.
1996.
Poly(rC) binding protein 2 binds to stem-loop IV of the poliovirus RNA 5' noncoding region: identification by automated liquid chromatography-tandem mass spectrometry.
Proc. Natl. Acad. Sci. USA
93:11115-11120[Abstract/Free Full Text].
|
| 8.
|
Blyn, L. B.,
J. S. Towner,
B. L. Semler, and E. Ehrenfeld.
1997.
Requirement of poly(rC) binding protein 2 for translation of poliovirus RNA.
J. Virol.
71:6243-6246[Abstract].
|
| 9.
|
Borman, A. M.,
F. G. Deliat, and K. M. Kean.
1994.
Sequences within the poliovirus internal ribosome entry segment control viral RNA synthesis.
EMBO J.
13:3149-3157[Medline].
|
| 10.
|
Collier, B.,
L. Goobar-Larsson,
M. Sokolowski, and S. Schwartz.
1998.
Translational inhibition in vitro of human papillomavirus type 16 L2 mRNA mediated through interaction with heterogenous ribonucleoprotein K and poly(rC)-binding proteins 1 and 2.
J. Biol. Chem.
273:22648-22656[Abstract/Free Full Text].
|
| 11.
|
Dildine, S. L., and B. L. Semler.
1992.
Conservation of RNA-protein interactions among picornaviruses.
J. Virol.
66:4364-4376[Abstract/Free Full Text].
|
| 12.
|
Ehrenfeld, E., and B. L. Semler.
1995.
Anatomy of the poliovirus internal ribosome entry site.
Curr. Top. Microbiol. Immunol.
203:65-83[Medline].
|
| 13.
|
Gamarnik, A. V., and R. Andino.
1996.
Replication of poliovirus in Xenopus oocytes requires two human factors.
EMBO J.
15:5988-5998[Medline].
|
| 14.
|
Gamarnik, A. V., and R. Andino.
1998.
Switch from translation to RNA replication in a positive-stranded RNA virus.
Genes Dev.
12:2293-2304[Abstract/Free Full Text].
|
| 15.
|
Gamarnik, A. V., and R. Andino.
1997.
Two functional complexes formed by KH domain containing proteins with the 5' noncoding region of poliovirus RNA.
RNA
3:882-892[Abstract].
|
| 16.
|
Graff, J.,
J. Cha,
L. B. Blyn, and E. Ehrenfeld.
1998.
Interaction of poly(rC) binding protein 2 with the 5' noncoding region of hepatitis A virus RNA and its effects on translation.
J. Virol.
72:9668-9675[Abstract/Free Full Text].
|
| 17.
|
Harris, K. S.,
W. Xiang,
L. Alexander,
W. S. Lane,
A. V. Paul, and E. Wimmer.
1994.
Interaction of poliovirus polypeptide 3CDpro with the 5' and 3' termini of the poliovirus genome. Identification of viral and cellular cofactors needed for efficient binding.
J. Biol. Chem.
269:27004-27014[Abstract/Free Full Text].
|
| 18.
|
Hellen, C. U.,
G. W. Witherell,
M. Schmid,
S. H. Shin,
T. V. Pestova,
A. Gil, and E. Wimmer.
1993.
A cytoplasmic 57-kDa protein that is required for translation of picornavirus RNA by internal ribosomal entry is identical to the nuclear pyrimidine tract-binding protein.
Proc. Natl. Acad. Sci. USA
90:7642-7646[Abstract/Free Full Text].
|
| 19.
|
Holcik, M., and S. A. Liebhaber.
1997.
Four highly stable eukaryotic mRNAs assemble 3' untranslated region RNA-protein complexes sharing cis and trans components.
Proc. Natl. Acad. Sci. USA
94:2410-2414[Abstract/Free Full Text].
|
| 20.
|
Hunt, S. L.,
J. J. Hsuan,
N. Totty, and R. J. Jackson.
1999.
unr, a cellular cytoplasmic RNA-binding protein with five cold-shock domains, is required for internal initiation of translation of human rhinovirus RNA.
Genes Dev.
13:437-448[Abstract/Free Full Text].
|
| 21.
|
Jang, S. K.,
H. G. Krausslich,
M. J. Nicklin,
G. M. Duke,
A. C. Palmenberg, and E. Wimmer.
1988.
A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation.
J. Virol.
62:2636-2643[Abstract/Free Full Text].
|
| 22.
|
Kiledjian, M.,
X. Wang, and S. A. Liebhaber.
1995.
Identification of two KH domain proteins in the alpha-globin mRNP stability complex.
EMBO J.
14:4357-4364[Medline].
|
| 23.
|
Meerovitch, K.,
Y. V. Svitkin,
H. S. Lee,
F. Lejbkowicz,
D. J. Kenan,
E. K. Chan,
V. I. Agol,
J. D. Keene, and N. Sonenberg.
1993.
La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate.
J. Virol.
67:3798-3807[Abstract/Free Full Text].
|
| 24.
|
Meyer, K.,
A. Petersen,
M. Niepmann, and E. Beck.
1995.
Interaction of eukaryotic initiation factor eIF-4B with a picornavirus internal translation initiation site.
J. Virol.
69:2819-2824[Abstract].
|
| 25.
|
Ostareck-Lederer, A.,
D. H. Ostareck, and M. W. Hentze.
1998.
Cytoplasmic regulatory functions of the KH-domain proteins hnRNPs K and E1/E2.
Trends Biochem. Sci.
23:409-411[CrossRef][Medline].
|
| 26.
|
Parsley, T. B.,
J. S. Towner,
L. B. Blyn,
E. Ehrenfeld, and B. L. Semler.
1997.
Poly (rC) binding protein 2 forms a ternary complex with the 5'-terminal sequences of poliovirus RNA and the viral 3CD proteinase.
RNA
3:1124-1134[Abstract].
|
| 27.
|
Pelletier, J.,
G. Kaplan,
V. R. Racaniello, and N. Sonenberg.
1988.
Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region.
Mol. Cell. Biol.
8:1103-1112[Abstract/Free Full Text].
|
| 28.
|
Pestova, T. V.,
I. N. Shatsky, and C. U. Hellen.
1996.
Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit are sufficient to mediate internal entry of 43S preinitiation complexes.
Mol. Cell. Biol.
16:6870-6878[Abstract].
|
| 29.
|
Pilipenko, E. V.,
V. M. Blinov,
L. I. Romanova,
A. N. Sinyakov,
S. V. Maslova, and V. I. Agol.
1989.
Conserved structural domains in the 5'-untranslated region of picornaviral genomes: an analysis of the segment controlling translation and neurovirulence.
Virology.
168:201-209[CrossRef][Medline].
|
| 30.
|
Rivera, V. M.,
J. D. Welsh, and J. V. Maizel, Jr.
1988.
Comparative sequence analysis of the 5' noncoding region of the enteroviruses and rhinoviruses.
Virology
165:42-50[CrossRef][Medline].
|
| 31.
|
Rohll, J. B.,
N. Percy,
R. Ley,
D. J. Evans,
J. W. Almond, and W. S. Barclay.
1994.
The 5'-untranslated regions of picornavirus RNAs contain independent functional domains essential for RNA replication and translation.
J. Virol.
68:4384-4391[Abstract/Free Full Text].
|
| 32.
|
Shiroki, K.,
T. Ishii,
T. Aoki,
M. Kobashi,
S. Ohka, and A. Nomoto.
1995.
A new cis-acting element for RNA replication within the 5' noncoding region of poliovirus type 1 RNA.
J. Virol.
69:6825-6832[Abstract].
|
| 33.
|
Simoes, E. A., and P. Sarnow.
1991.
An RNA hairpin at the extreme 5' end of the poliovirus RNA genome modulates viral translation in human cells.
J. Virol.
65:913-921[Abstract/Free Full Text].
|
| 34.
|
Skinner, M. A.,
V. R. Racaniello,
G. Dunn,
J. Cooper,
P. D. Minor, and J. W. Almond.
1989.
New model for the secondary structure of the 5' non-coding RNA of poliovirus is supported by biochemical and genetic data that also show that RNA secondary structure is important in neurovirulence.
J. Mol. Biol.
207:379-392[CrossRef][Medline].
|
| 35.
|
Trono, D.,
R. Andino, and D. Baltimore.
1988.
An RNA sequence of hundreds of nucleotides at the 5' end of poliovirus RNA is involved in allowing viral protein synthesis.
J. Virol.
62:2291-2299[Abstract/Free Full Text].
|
| 36.
|
Trono, D.,
J. Pelletier,
N. Sonenberg, and D. Baltimore.
1988.
Translation in mammalian cells of a gene linked to the poliovirus 5' noncoding region.
Science
241:445-448[Abstract/Free Full Text].
|
| 37.
|
Xiang, W.,
K. S. Harris,
L. Alexander, and E. Wimmer.
1995.
Interaction between the 5'-terminal cloverleaf and 3AB/3CDpro of poliovirus is essential for RNA replication.
J. Virol.
69:3658-3667[Abstract].
|
Journal of Virology, March 2000, p. 2219-2226, Vol. 74, No. 5
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Waggoner, S. A., Johannes, G. J., Liebhaber, S. A.
(2009). Depletion of the Poly(C)-binding Proteins {alpha}CP1 and {alpha}CP2 from K562 Cells Leads to p53-independent Induction of Cyclin-dependent Kinase Inhibitor (CDKN1A) and G1 Arrest. J. Biol. Chem.
284: 9039-9049
[Abstract]
[Full Text]
-
Paek, K. Y., Kim, C. S., Park, S. M., Kim, J. H., Jang, S. K.
(2008). RNA-Binding Protein hnRNP D Modulates Internal Ribosome Entry Site-Dependent Translation of Hepatitis C Virus RNA. J. Virol.
82: 12082-12093
[Abstract]
[Full Text]
-
Du, Z., Fenn, S., Tjhen, R., James, T. L.
(2008). Structure of a Construct of a Human Poly(C)-binding Protein Containing the First and Second KH Domains Reveals Insights into Its Regulatory Mechanisms. J. Biol. Chem.
283: 28757-28766
[Abstract]
[Full Text]
-
Kempf, B. J., Barton, D. J.
(2008). Poly(rC) Binding Proteins and the 5' Cloverleaf of Uncapped Poliovirus mRNA Function during De Novo Assembly of Polysomes. J. Virol.
82: 5835-5846
[Abstract]
[Full Text]
-
Amero, C. D., Arnold, J. J., Moustafa, I. M., Cameron, C. E., Foster, M. P.
(2008). Identification of the oriI-Binding Site of Poliovirus 3C Protein by Nuclear Magnetic Resonance Spectroscopy. J. Virol.
82: 4363-4370
[Abstract]
[Full Text]
-
Shen, M., Reitman, Z. J., Zhao, Y., Moustafa, I., Wang, Q., Arnold, J. J., Pathak, H. B., Cameron, C. E.
(2008). Picornavirus Genome Replication: IDENTIFICATION OF THE SURFACE OF THE POLIOVIRUS (PV) 3C DIMER THAT INTERACTS WITH PV 3Dpol DURING VPg URIDYLYLATION AND CONSTRUCTION OF A STRUCTURAL MODEL FOR THE PV 3C2-3Dpol COMPLEX. J. Biol. Chem.
283: 875-888
[Abstract]
[Full Text]
-
Kim, H. S., Kuwano, Y., Zhan, M., Pullmann, R. Jr., Mazan-Mamczarz, K., Li, H., Kedersha, N., Anderson, P., Wilce, M. C. J., Gorospe, M., Wilce, J. A.
(2007). Elucidation of a C-Rich Signature Motif in Target mRNAs of RNA-Binding Protein TIAR. Mol. Cell. Biol.
27: 6806-6817
[Abstract]
[Full Text]
-
Toyoda, H., Franco, D., Fujita, K., Paul, A. V., Wimmer, E.
(2007). Replication of Poliovirus Requires Binding of the Poly(rC) Binding Protein to the Cloverleaf as Well as to the Adjacent C-Rich Spacer Sequence between the Cloverleaf and the Internal Ribosomal Entry Site. J. Virol.
81: 10017-10028
[Abstract]
[Full Text]
-
Belov, G. A., Habbersett, C., Franco, D., Ehrenfeld, E.
(2007). Activation of Cellular Arf GTPases by Poliovirus Protein 3CD Correlates with Virus Replication. J. Virol.
81: 9259-9267
[Abstract]
[Full Text]
-
Perera, R., Daijogo, S., Walter, B. L., Nguyen, J. H. C., Semler, B. L.
(2007). Cellular Protein Modification by Poliovirus: the Two Faces of Poly(rC)-Binding Protein. J. Virol.
81: 8919-8932
[Abstract]
[Full Text]
-
de Sessions, P. F., Dobrikova, E., Gromeier, M.
(2007). Genetic Adaptation to Untranslated Region-Mediated Enterovirus Growth Deficits by Mutations in the Nonstructural Proteins 3AB and 3CD. J. Virol.
81: 8396-8405
[Abstract]
[Full Text]
-
Yin, J., Liu, Y., Wimmer, E., Paul, A. V.
(2007). Complete protein linkage map between the P2 and P3 non-structural proteins of poliovirus. J. Gen. Virol.
88: 2259-2267
[Abstract]
[Full Text]
-
Du, Z., Lee, J. K., Fenn, S., Tjhen, R., Stroud, R. M., James, T. L.
(2007). X-ray crystallographic and NMR studies of protein-protein and protein-nucleic acid interactions involving the KH domains from human poly(C)-binding protein-2. RNA
13: 1043-1051
[Abstract]
[Full Text]
-
Gerbasi, V. R., Link, A. J.
(2007). The Myotonic Dystrophy Type 2 Protein ZNF9 Is Part of an ITAF Complex That Promotes Cap-independent Translation. Mol. Cell. Proteomics
6: 1049-1058
[Abstract]
[Full Text]
-
Fenn, S., Du, Z., Lee, J. K., Tjhen, R., Stroud, R. M., James, T. L.
(2007). Crystal structure of the third KH domain of human poly(C)-binding protein-2 in complex with a C-rich strand of human telomeric DNA at 1.6 A resolution. Nucleic Acids Res
0: gkm139v1-10
[Abstract]
[Full Text]
-
Belov, G. A., Altan-Bonnet, N., Kovtunovych, G., Jackson, C. L., Lippincott-Schwartz, J., Ehrenfeld, E.
(2007). Hijacking Components of the Cellular Secretory Pathway for Replication of Poliovirus RNA. J. Virol.
81: 558-567
[Abstract]
[Full Text]
-
Bailey, J. M., Tapprich, W. E.
(2007). Structure of the 5' Nontranslated Region of the Coxsackievirus B3 Genome: Chemical Modification and Comparative Sequence Analysis. J. Virol.
81: 650-668
[Abstract]
[Full Text]
-
Kong, J., Sumaroka, M., Eastmond, D. L., Liebhaber, S. A.
(2006). Shared Stabilization Functions of Pyrimidine-Rich Determinants in the Erythroid 15-lipoxygenase and {alpha}-globin mRNAs. Mol. Cell. Biol.
26: 5603-5614
[Abstract]
[Full Text]
-
van Ooij, M. J. M., Glaudemans, D. H. R. F., Heus, H. A., van Kuppeveld, F. J. M., Melchers, W. J. G.
(2006). Structural and functional integrity of the coxsackievirus B3 oriR: spacing between coaxial RNA helices.. J. Gen. Virol.
87: 689-695
[Abstract]
[Full Text]
-
DeStefano, J. J., Titilope, O.
(2006). Poliovirus Protein 3AB Displays Nucleic Acid Chaperone and Helix-Destabilizing Activities. J. Virol.
80: 1662-1671
[Abstract]
[Full Text]
-
Mas, A., Alves-Rodrigues, I., Noueiry, A., Ahlquist, P., Diez, J.
(2006). Host Deadenylation-Dependent mRNA Decapping Factors Are Required for a Key Step in Brome Mosaic Virus RNA Replication. J. Virol.
80: 246-251
[Abstract]
[Full Text]
-
Du, Z., Lee, J. K., Tjhen, R., Li, S., Pan, H., Stroud, R. M., James, T. L.
(2005). Crystal Structure of the First KH Domain of Human Poly(C)-binding Protein-2 in Complex with a C-rich Strand of Human Telomeric DNA at 1.7 A. J. Biol. Chem.
280: 38823-38830
[Abstract]
[Full Text]
-
Raman, S., Brian, D. A.
(2005). Stem-Loop IV in the 5' Untranslated Region Is a cis-Acting Element in Bovine Coronavirus Defective Interfering RNA Replication. J. Virol.
79: 12434-12446
[Abstract]
[Full Text]
-
Fata-Hartley, C. L., Palmenberg, A. C.
(2005). Dipyridamole Reversibly Inhibits Mengovirus RNA Replication. J. Virol.
79: 11062-11070
[Abstract]
[Full Text]
-
Alvarez, D. E., Lodeiro, M. F., Luduena, S. J., Pietrasanta, L. I., Gamarnik, A. V.
(2005). Long-Range RNA-RNA Interactions Circularize the Dengue Virus Genome. J. Virol.
79: 6631-6643
[Abstract]
[Full Text]
-
Kim, K.-S., Tracy, S., Tapprich, W., Bailey, J., Lee, C.-K., Kim, K., Barry, W. H., Chapman, N. M.
(2005). 5'-Terminal Deletions Occur in Coxsackievirus B3 during Replication in Murine Hearts and Cardiac Myocyte Cultures and Correlate with Encapsidation of Negative-Strand Viral RNA. J. Virol.
79: 7024-7041
[Abstract]
[Full Text]
-
Franco, D., Pathak, H. B., Cameron, C. E., Rombaut, B., Wimmer, E., Paul, A. V.
(2005). Stimulation of Poliovirus Synthesis in a HeLa Cell-Free In Vitro Translation-RNA Replication System by Viral Protein 3CDpro. J. Virol.
79: 6358-6367
[Abstract]
[Full Text]
-
Harris, J. R., Racaniello, V. R.
(2005). Amino Acid Changes in Proteins 2B and 3A Mediate Rhinovirus Type 39 Growth in Mouse Cells. J. Virol.
79: 5363-5373
[Abstract]
[Full Text]
-
Pogany, J., White, K. A., Nagy, P. D.
(2005). Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication. J. Virol.
79: 4859-4869
[Abstract]
[Full Text]
-
Lee, C.-K., Kono, K., Haas, E., Kim, K.-S., Drescher, K. M., Chapman, N. M., Tracy, S.
(2005). Characterization of an infectious cDNA copy of the genome of a naturally occurring, avirulent coxsackievirus B3 clinical isolate. J. Gen. Virol.
86: 197-210
[Abstract]
[Full Text]
-
Du, Z., Yu, J., Chen, Y., Andino, R., James, T. L.
(2004). Specific Recognition of the C-rich Strand of Human Telomeric DNA and the RNA Template of Human Telomerase by the First KH Domain of Human Poly(C)-binding Protein-2. J. Biol. Chem.
279: 48126-48134
[Abstract]
[Full Text]
-
BEDARD, K. M., WALTER, B. L., SEMLER, B. L.
(2004). Multimerization of poly(rC) binding protein 2 is required for translation initiation mediated by a viral IRES. RNA
10: 1266-1276
[Abstract]
[Full Text]
-
Cornell, C. T., Perera, R., Brunner, J. E., Semler, B. L.
(2004). Strand-Specific RNA Synthesis Determinants in the RNA-Dependent RNA Polymerase of Poliovirus. J. Virol.
78: 4397-4407
[Abstract]
[Full Text]
-
Yang, Y., Rijnbrand, R., Watowich, S., Lemon, S. M.
(2004). Genetic Evidence for an Interaction between a Picornaviral cis-Acting RNA Replication Element and 3CD Protein. J. Biol. Chem.
279: 12659-12667
[Abstract]
[Full Text]
-
Kuyumcu-Martinez, N. M., Van Eden, M. E., Younan, P., Lloyd, R. E.
(2004). Cleavage of Poly(A)-Binding Protein by Poliovirus 3C Protease Inhibits Host Cell Translation: a Novel Mechanism for Host Translation Shutoff. Mol. Cell. Biol.
24: 1779-1790
[Abstract]
[Full Text]
-
Murray, K. E., Steil, B. P., Roberts, A. W., Barton, D. J.
(2004). Replication of Poliovirus RNA with Complete Internal Ribosome Entry Site Deletions. J. Virol.
78: 1393-1402
[Abstract]
[Full Text]
-
Waggoner, S. A., Liebhaber, S. A.
(2003). Identification of mRNAs Associated with {alpha}CP2-Containing RNP Complexes. Mol. Cell. Biol.
23: 7055-7067
[Abstract]
[Full Text]
-
Rieder, E., Xiang, W., Paul, A., Wimmer, E.
(2003). Analysis of the cloverleaf element in a human rhinovirus type 14/poliovirus chimera: correlation of subdomain D structure, ternary protein complex formation and virus replication. J. Gen. Virol.
84: 2203-2216
[Abstract]
[Full Text]
-
Konan, K. V., Giddings, T. H. Jr., Ikeda, M., Li, K., Lemon, S. M., Kirkegaard, K.
(2003). Nonstructural Protein Precursor NS4A/B from Hepatitis C Virus Alters Function and Ultrastructure of Host Secretory Apparatus. J. Virol.
77: 7843-7855
[Abstract]
[Full Text]
-
KIM, Y. K., LEE, S. H., KIM, C. S., SEOL, S. K., JANG, S. K.
(2003). Long-range RNA-RNA interaction between the 5' nontranslated region and the core-coding sequences of hepatitis C virus modulates the IRES-dependent translation. RNA
9: 599-606
[Abstract]
[Full Text]
-
Murray, K. E., Barton, D. J.
(2003). Poliovirus CRE-Dependent VPg Uridylylation Is Required for Positive-Strand RNA Synthesis but Not for Negative-Strand RNA Synthesis. J. Virol.
77: 4739-4750
[Abstract]
[Full Text]
-
Luo, G., Xin, S., Cai, Z.
(2003). Role of the 5'-Proximal Stem-Loop Structure of the 5' Untranslated Region in Replication and Translation of Hepatitis C Virus RNA. J. Virol.
77: 3312-3318
[Abstract]
[Full Text]
-
Nateri, A. S., Hughes, P. J., Stanway, G.
(2002). Terminal RNA Replication Elements in Human Parechovirus 1. J. Virol.
76: 13116-13122
[Abstract]
[Full Text]
-
Walter, B. L., Parsley, T. B., Ehrenfeld, E., Semler, B. L.
(2002). Distinct Poly(rC) Binding Protein KH Domain Determinants for Poliovirus Translation Initiation and Viral RNA Replication. J. Virol.
76: 12008-12022
[Abstract]
[Full Text]
-
Egger, D., Bienz, K.
(2002). Recombination of Poliovirus RNA Proceeds in Mixed Replication Complexes Originating from Distinct Replication Start Sites. J. Virol.
76: 10960-10971
[Abstract]
[Full Text]
-
Leonard, S., Chisholm, J., Laliberte, J.-F., Sanfacon, H.
(2002). Interaction in vitro between the proteinase of Tomato ringspot virus (genus Nepovirus) and the eukaryotic translation initiation factor iso4E from Arabidopsis thaliana. J. Gen. Virol.
83: 2085-2089
[Abstract]
[Full Text]
-
Cherkasova, E. A., Korotkova, E. A., Yakovenko, M. L., Ivanova, O. E., Eremeeva, T. P., Chumakov, K. M., Agol, V. I.
(2002). Long-Term Circulation of Vaccine-Derived Poliovirus That Causes Paralytic Disease. J. Virol.
76: 6791-6799
[Abstract]
[Full Text]
-
Harvala, H., Kalimo, H., Dahllund, L., Santti, J., Hughes, P., Hyypia, T., Stanway, G.
(2002). Mapping of tissue tropism determinants in coxsackievirus genomes. J. Gen. Virol.
83: 1697-1706
[Abstract]
[Full Text]
-
Kuyumcu-Martinez, N. M., Joachims, M., Lloyd, R. E.
(2002). Efficient Cleavage of Ribosome-Associated Poly(A)-Binding Protein by Enterovirus 3C Protease. J. Virol.
76: 2062-2074
[Abstract]
[Full Text]
-
Back, S. H., Kim, Y. K., Kim, W. J., Cho, S., Oh, H. R., Kim, J.-E., Jang, S. K.
(2002). Translation of Polioviral mRNA Is Inhibited by Cleavage of Polypyrimidine Tract-Binding Proteins Executed by Polioviral 3Cpro. J. Virol.
76: 2529-2542
[Abstract]
[Full Text]
-
Neeleman, L., Olsthoorn, R. C. L., Linthorst, H. J. M., Bol, J. F.
(2001). Translation of a nonpolyadenylated viral RNA is enhanced by binding of viral coat protein or polyadenylation of the RNA. Proc. Natl. Acad. Sci. USA
10.1073/pnas.251542798v1
[Abstract]
[Full Text]
-
Rust, R. C., Landmann, L., Gosert, R., Tang, B. L., Hong, W., Hauri, H.-P., Egger, D., Bienz, K.
(2001). Cellular COPII Proteins Are Involved in Production of the Vesicles That Form the Poliovirus Replication Complex. J. Virol.
75: 9808-9818
[Abstract]
[Full Text]
-
Rodriguez-Wells, V., Plotch, S. J., DeStefano, J. J.
(2001). Primer-dependent synthesis by poliovirus RNA-dependent RNA polymerase (3Dpol). Nucleic Acids Res
29: 2715-2724
[Abstract]
[Full Text]
-
Hellen, C. U.T., Sarnow, P.
(2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev.
15: 1593-1612
[Full Text]
-
Polacek, C., Lindberg, A. M.
(2001). Genetic characterization of the coxsackievirus B2 3' untranslated region. J. Gen. Virol.
82: 1339-1348
[Abstract]
[Full Text]
-
Martínez-Salas, E., Ramos, R., Lafuente, E., López de Quinto, S.
(2001). Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J. Gen. Virol.
82: 973-984
[Full Text]
-
Zhao, W. D., Wimmer, E.
(2001). Genetic Analysis of a Poliovirus/Hepatitis C Virus Chimera: New Structure for Domain II of the Internal Ribosomal Entry Site of Hepatitis C Virus. J. Virol.
75: 3719-3730
[Abstract]
[Full Text]
-
Gamarnik, A. V., Böddeker, N., Andino, R.
(2000). Translation and Replication of Human Rhinovirus Type 14 and Mengovirus in Xenopus Oocytes. J. Virol.
74: 11983-11987
[Abstract]
[Full Text]
-
Pilipenko, E. V., Pestova, T. V., Kolupaeva, V. G., Khitrina, E. V., Poperechnaya, A. N., Agol, V. I., Hellen, C. U.T.
(2000). A cell cycle-dependent protein serves as a template-specific translation initiation factor. Genes Dev.
14: 2028-2045
[Abstract]
[Full Text]
-
Neeleman, L., Olsthoorn, R. C. L., Linthorst, H. J. M., Bol, J. F.
(2001). Translation of a nonpolyadenylated viral RNA is enhanced by binding of viral coat protein or polyadenylation of the RNA. Proc. Natl. Acad. Sci. USA
98: 14286-14291
[Abstract]
[Full Text]