Previous Article | Next Article 
Journal of Virology, February 2000, p. 1451-1456, Vol. 74, No. 3
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Novel Truncated env Gene Isolated from
a Feline Leukemia Virus-Induced Thymic Lymphosarcoma
Yan
Shi1 and
Pradip
Roy-Burman1,2,*
Department of
Pathology1 and Department of
Biochemistry and Molecular Biology,2 University
of Southern California School of Medicine, Los Angeles, California
90033
Received 15 July 1999/Accepted 1 November 1999
 |
ABSTRACT |
We PCR amplified the exogenous feline leukemia virus (FeLV)-related
env gene species from lymphosarcomas induced by
intradermally administered plasmid DNA of either the prototype FeLV,
subgroup A molecular clone, F6A, or a new molecular clone, FeLV-A,
Rickard strain (FRA). Of the nine tumors examined, six showed the
presence of deleted env species of variable sizes in the
tumor DNA. One env mutant, which was detected in a
FRA-induced thymic lymphosarcoma, had a large internal deletion
beginning from almost the N-terminal surface glycoprotein (SU) up to
the middle region of the transmembrane (TM) protein of the
env gene. The deduced polypeptide of this truncated
env (tenv) retained the complete signal peptide
and seven amino acids of the N-terminal mature SU of FRA
env gene, followed by eight amino acids from the frameshift
in the TM region. To study the biological function of tenv,
we used a murine retrovirus vector to produce amphotropic virions.
Infection of feline fibroblasts (H927), human fibrosarcoma cells
(HT1080), or human B-lymphoma cells (Raji) led to pronounced
cytotoxicity, while the tenv virus did not induce
significant cytotoxicity to feline T-lymphoma cells (3201B) or human
T-lymphoma cells (CEM). Together, these results convincingly
demonstrated that the genetic events that led to truncation in the
env gene occurred de novo in FeLV lymphomagenesis and that
such a product, tenv could induce cytotoxicity to
fibroblastic and B-lymphoid cells but not to T-lymphoid tumor cells.
This type of selective toxicity might be potentially important in the
development of the neoplastic disease.
 |
INTRODUCTION |
Retroviruses are causative agents in
the induction of lymphoid malignancies (leukemia-lymphoma complex) in
mammals, including humans. In the domestic cat, an outbred species,
which has the highest incidence of lymphoid malignancies of any animal,
the disease is naturally associated with chronic feline leukemia virus (FeLV) infection (8, 18). There is solid evidence to
indicate that interactions between infectious FeLV and non-infectious
inherited endogenous FeLV elements generate recombinant viral
quasispecies which represent a variety of chimeric envelope
glycoproteins depending on the extent of amino terminal portion
replaced by the endogenous env sequences (9, 13,
24). The viral species with specific adaptive amino acid
mutations and with certain sites of recombination are rapidly selected
for replication efficiency and are over-represented at later time
points after infection (2, 3, 14). FeLVs with recombinant
env genes are detected with high frequency in naturally as
well as experimentally induced feline lymphosarcomas (2, 3, 10,
14, 23, 25). Evidence also exists to suggest that some defective
env genes detected in FeLV-induced lymphosarcomas may be
additional factors in the disease process (16, 23).
Although a previous study addressed the issue of in vivo derivation of
defective env genes from an FeLV, subgroup A (FeLV-A) molecular clone (16), administration of an inoculum prepared by propagating the virus in feline cell cultures could not eliminate the possibility of introducing defective FeLV contaminants along with
the replication-competent FeLV-A virus. In this report, we present data
demonstrating in vivo generation of defective env genes
which were detected in majority of lymphosarcomas induced by direct
delivery of proviral DNA of molecular clones of FeLV-A by intradermal
injection into specific-pathogen-free (SPF) cats. Detection of a
spectrum of truncated env genes, all beginning from an
inoculum of a single molecular species of FeLV and occurring in the
lymphosarcomas induced, suggests that products of some of these
defective env genes retained in tumor cells may have a role
in the multistep process of FeLV pathogenesis. In this regard, we
describe a highly truncated env gene product derived from
one of these lymphosarcomas which displayed a pattern of selective cytotoxicity.
 |
MATERIALS AND METHODS |
Cell culture.
H927 feline fibroblast and PA317 mouse
amphotropic packaging cell lines were maintained in the Dulbecco
modified Eagle medium high-glucose medium supplemented with 10% fetal
bovine serum. The human HT1080 fibrosarcoma cell line was cultured in
Eagle minimal essential medium with 10% fetal bovine serum. Raji and CEM cells and human B- and T-cell lines, respectively, were grown in
RPMI medium supplemented with 10% fetal bovine serum. Feline 3201B T
cells were maintained in 1:1 RPMI-Leibovitz's L-15 medium supplemented with 20% fetal bovine serum. All media were purchased from Irvine Scientific Co.
PCR analysis of exogenously related env genes in cat
tumor tissues.
Genomic DNA was isolated from tumors of six
pFRA-challenged cats, 5022, 5023, 5024, 5025, 5039, and 5041 (3); three pF6A-challenged cats, 5035, 5036, and 5051 (A. J. Phipps et al., unpublished data), and an SPF fetus tissue.
PCR reactions were performed with Taq DNA polymerase
(Gibco-BRL) to amplify env genes of FeLV-A and the
recombinants between FeLV-A and the endogenous env elements from these DNA samples. The 5' primer was made to the sequences conserved between FeLV-A and endogenous FeLV pol region
(H18) (3), and the 3' primer was complementary to the
exogenous 3' long terminal repeat (LTR) sequence of molecular clone
FeLV-A, Rickard strain (FRA), or F6A (H20) (3). The
env sequence was also amplified by using the same strategy
from the tumor of cat 4746-5, which was challenged with an FeLV-A
Rickard plasma preparation and a mixture of in vitro-generated
recombinant FeLVs (14, 24).
Construction of mutant or chimeric env-expressing
retroviral vector.
PCR products of full-length env
genes from tumors 4746-5, 5022, 5023, 5024, and 5025 and the 700-bp
deleted env gene from tumor 5023 were cloned into the pCR2.1
vector (Invitrogen). To study recombinant env species
harbored by these experimental tumors, the complete env
clones were then screened with the 5' primer RB53 (14)
corresponding to the endogenous-related FeLV env sequence and the 3' primer RB17 (14) complementary to the FeLV-A
env sequence.
A recombinant FeLV-B like env (clone 40) from cat 4746-5 and
the 700-bp env gene (designed tenv) were selected
to study their biological functions. By using the primer set of RB447,
the 3' primer with sequence complementary to FRA in the
env-LTR region (AGCCACGAATTCTGGAAATCATGGTCGGTC), and RB448, the
5' primer with the sequence in the FRA pol-env region
(GGTCCCGAATTCGATCCATCAAGATGGAA), PCR reactions
with Pfu DNA polymerase were employed to introduce EcoRI restriction sites (underlined sequences) into the
cloned env genes. The PCR products were then cloned into
pWZLneo vector, a Moloney murine leukemia virus (MuLV)-based retroviral
vector (6, 20). This vector contains an internal ribosome
entry site (IRES) from the encephalomyocarditis virus in front of the selection marker gene (NeoR) so as to produce a bicistronic
mRNA containing the gene of interest and NeoR.
RNA isolation and RT-PCR.
Total RNA was extracted from
thymic tumor and normal splenic tissues of the cat 5023 with a RNeasy
Kit (Qiagen). The reverse transcriptase (RT) reaction was performed
with 1 µg of RNA primed with oligo(dT). The sequences related to
exogenous FeLV env species were amplified from the cDNA by
using RB447 and RB448 primers. As a control, the GADPH
sequence was amplified from the same cDNA preparations with the primer
set RB581 (CCACCCATGGCAAATTCCATGGCA) and RB582
(TCTAGACGGCAGGTCAGGTCCAC). To ensure the absence of genomic
DNA contamination in the cDNA samples, experiments without RT enzyme
were simultaneously run.
Sequence analysis.
The cloned env genes in both
pCR2.1 vector and pWZLneo vector were sequenced by using the M13
reverse and RB693 primers, respectively. RB693 was made to represent a
complementary sequence to IRES of pWZLneo vector
(AAAAGACGGCAATATGGTGG). Automated fluorescence-based cycle
sequencing was conducted with the ABI Prism 377 DNA sequencer (Perkin-Elmer, Foster City, Calif.) and the ABI Prism Dye Terminator cycle-sequencing Kit (P/N 402080) as specified by the manufacturer.
Stable transfection of PA317 cells and conditioned medium
preparation.
To produce amphotropic viruses, the parental pWZLneo,
the FeLV-B-like recombinant env and the tenv
retroviral constructs were transfected into PA317 cells by use of
Lipofectamine (Gibco-BRL) according to the manufacturer's protocol.
After 48 h, the cells were split 1:10 and selected in
G418-containing medium (400 µg/ml) for 10 days. As the selection of
transfected cells was based on the expression of the G418-resistant
gene from the same bicistronic proviral DNA carrying the env
fragment, the use of WZLneo vector allowed virtually all selected
resistant cells to express the env protein. The growth
medium was changed every 3 days and G418-resistant colonies were
isolated and expanded for further study.
When G418-resistant cells reached 80% confluence, the G418-containing
growth medium was replaced by G418-free medium. The virus-containing
cell supernatant fluids were harvested, passed through 0.45 µm
(pore-size) filters (Gelman Sciences), and stored at
80°C for RT
activity assay and infection of cell cultures.
RT activity assay.
Titers of the viruses harvested were
estimated by RT activity assay (5, 19). M-MuLV RT and
GA-FeLV-B virus stock with known titers were included as standards.
Each sample was tested in triplicate. Filtered conditioned medium (25 µl) was mixed with 25 µl of a cocktail containing 50 nM Tris (pH,
8.3), 10 mM dithiothreitol, 10 mM MgCl2, 60 mM NaCl, 0.05%
NP-40, 2 µg of poly(rA-dT)12-18, and 3 µCi/ml
32P-dTTP. After 2 h at 37°C, 5 µl of the
reaction mixture was transferred to 2-by-2-cm squares of DE81
chromatographic paper (Whatman International, Ltd.) and allowed to dry.
The DE81 paper was washed twice with 2× SSC (1× SSC is 0.15 M NaCl
plus 0.015 M sodium citrate) for about 5 min each and then rinsed with
ethanol. The dried filter paper squares were then transferred to
scintillation vials for counting. The RT activity was used to obtain an
estimate of the number of infectious particles by comparing it with
that of a GA-FeLV-B preparation with a known virus titer.
Cell infection.
H927 and HT1080 cells were seeded in
six-well plates (2 × 105/well) the day before
infection. On day 2, the cells were infected with 1 ml of individual
virus preparations (approximately 5 × 105 infectious
units per ml). After 12 h, the conditioned medium was replaced
with G418-containing medium. The medium was changed every 3 days for up
to 10 days.
Aliquots (2 × 105) of Raji, CEM and 3201B cells were
primed with 28 µg of Polybrene in 1 ml for 24 h prior to
infection with conditioned medium containing approximately
106 infectious units per ml in the absence of Polybrene. At
12 h postinfection, the cells were resuspended with growth medium
with or without G418.
MTT assay.
Cytotoxic effect of the mutant env
protein to Raji cells was measured by MTT assay. MTT is the yellow
tetrazolium salt that can be converted to purple formazan dye by
metabolically active cells. After treatment with Polybrene, Raji cells
were mixed with conditioned medium as described above and transferred
to a 96-well plate (2.5 × 104 cells/well for the 24-h
postinfection measurement and 1.25 × 104 cells/well
for the 48-h postinfection measurement). The MTT assay was conducted
according to the manufacturer's protocol (Boehringer Mannheim) after
24 and 48 h of infection.
TUNEL assay.
An aliquot of Raji cell suspension (50 µl)
treated with conditioned medium was transferred to the plastic slides
at different time points after infection. Then the cells were fixed
with 10% paraformaldehyde and stored at
80°C. The TUNEL (terminal
deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling)
assay was performed according to the manufacturer's instructions
(Boehringer Mannheim). ACE (Vector Labs) was used as color substrate.
 |
RESULTS |
Detection of deleted env genes in experimentally
induced tumors.
To examine the env species in both
pFRA- and pF6A-induced tumors (3; Phipps et al.,
unpublished data), exogenous-related env genes were PCR
amplified by using a 5' primer homologous to the sequence conserved
between endogenous and exogenous pol gene, and a 3' primer
complementary to an exogenous LTR sequence. As expected, 2-kb
full-length env PCR products were detected in all nine
tumors tested, and no exogenous env gene was detected in normal SPF cat fetus tissue. In addition, four of six FRA tumors and
two of three F6A tumors exhibited PCR products smaller than the 2-kb
complete env (Fig. 1). In all
six tumors containing deleted env genes, one or more bands
corresponding to highly truncated env gene could be readily
detected. For example, a band of 700-bp was a major product amplified
from the tumor of cat 5023; four putative truncated env
species with sizes ranging from 500 to 850 bp were detected in tumor
5039, of which the 850-bp env product was the most prominent
species; and in tumor 5035, six smaller env species ranging
in sizes from 600 to 1050 bp were abundant. For the current work, the
deleted 700-bp product was chosen for further structural and functional
studies.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 1.
Detection of deleted env species in
lymphosarcomas in cats inoculated with FeLV-A proviral DNA. Genomic DNA
was isolated from six pFRA-induced tumors and three pF6A-induced
tumors. The exogenously related env genes were PCR amplified
with H18 and H20 primers. An SPF cat fetus DNA was included as a
negative control. Lanes: 1, H2O; 2, SPF cat fetus; 3, tumor
5022; 4, tumor 5023; 5, tumor 5024; 6, tumor 5025; 7, tumor 5039; 8, tumor 5041; 9, tumor 5035; 10, tumor 5036; and 11, tumor 5051. Molecular sizes are indicated on the right.
|
|
Analysis of tenv for nucleotide and deduced amino acid
sequence.
The 700-bp env species from cat tumor 5023, namely, tenv, was cloned and sequenced. The tenv
gene sequence was 100% homologous to FRA env
(3), except for a large internal deletion of 1519 bp that
shortened tenv. The deletion began from near the N-terminal surface glycoprotein (SU; 6099 of FRA) up to the mid-transmembrane (TM)
region (7617 of FRA). Both ends of deletion were flanked by a direct
repeat of six nucleotides (Fig. 2). In
addition, this deletion also resulted in a frameshift that gave rise to
a premature stop codon (7645 of FRA). Comparison of the deduced
polypeptide from this sequence to that of FRA indicated that it
retained the complete signal peptide and seven amino acids of the
N-terminal mature SU of FRA env protein, followed by a
sequence of eight altered amino acids resulting from the frameshift in
the TM region (Fig. 2).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleotide and deduced amino acid sequence of
tenv. Starting from FRA env ATG (positions 5968 to 5970), the deduced amino acids of tenv and comparison to
that of FRA env are depicted. The sequence in the dashed box
represents the signal peptide. The sequence in the solid box represents
the N-terminal portion of pFRA mature SU which is retained in
tenv. The sequence underlined indicates a relevant portion
of FRA mid-TM region which is altered in tenv. The deletion
junction is highlighted in gray. Asterisks indicate the same amino
acids between tenv and FRA env. The diamond
denotes the premature stop codon.
|
|
Induction of cell morphological changes and cell death by
tenv expression.
To study the biological function of
tenv, we used a vector (pWZLneo) to express the
tenv protein (Fig. 3). The
WZLneo vector is a Moloney MuLV-based retroviral vector that contains
an IRES sequence upstream of the aminoglycoside phosphotransferase
(Neor) gene. Existence of IRES allows selected
G418-resistant clones to express theoretically both tenv and
Neor genes from the same RNA. To confirm the expression of
tenv, RT-PCR was performed on tenv stably
transfected PA317 clones. The right size mRNA of tenv was
readily detected in the tenv-transduced cells but not
vector-transfected cells (data not shown). Cell free viral supernatant
fluids from the stably transfected clones of amphotropic PA317
packaging cell line were used to infect fibroblastic and lymphoid cell
lines.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 3.
Schematic representation of Moloney MuLV-based WZLneo
vector. The dashed boxes indicate the Moloney MuLV LTRs. The packaging
signal sequences ( +), ATG minus deleted gag
( gag), IRES, and the Neor gene are marked.
The tenv gene was cloned into EcoRI site shown as
E. The vertical arrows indicate the relative positions of ATG and the
premature stop codon (*).
|
|
The feline H927 fibroblasts and the human HT1080 fibrosarcoma cells
were infected with the tenv virus harvested and pooled from
two virus-producing PA317 clones. After 12 h of infection, cells
were placed in G418-containing medium and cultured for at least 6 days.
Unexpectedly, we failed to obtain any G418-resistant clones either from
H927 or HT1080 cells infected with the tenv virus. These
experiments were repeated twice, and the results were the same.
Microscopic examination of the cells revealed hallmarks of apoptosis
such as nuclear condensation and surface blebbing.
The tenv virus was also used to infect human Raji B cells.
In five independent experiments with virus preparations from two stably
transfected clones, we consistently observed formation of large
cellular aggregates which occurred as early as 4 h postinfection. The aggregates could be disrupted mechanically but reformed quickly even when the infected cells were cultured in the medium without viruses. As illustrated in Fig. 4, the
Raji cells treated with the tenv virus displayed cell
aggregations of 15 to 50 cells each, whereas the Raji cells infected
with vector or full-length env virus (data not shown) under
identical virus and cell concentrations for infection remained
primarily as single cells.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
Morphological changes in Raji cells induced by
tenv expression. Raji cells were treated with the
vector-containing virus or tenv-containing virus. At 24-hour
postinfection, the cells treated with tenv virus (panel B)
displayed formation of large aggregates, whereas the cells treated with
vector virus alone (panel A) remained primarily as single cells.
Magnification, ×31.
|
|
In contrast to the B cells, parallel studies with other lymphoid cells
such as CEM and 3201B cells and human and feline T-cell lines,
respectively, revealed no significant morphological changes or
cytotoxic effects. These results with different cell lines are
summarized in Table 1.
Quantification of tenv cytotoxicity to Raji cells.
Along with morphological changes in tenv-infected Raji
cells, we also repeatedly observed a decrease in viable cell numbers relative to those treated with vector or full-length recombinant env viruses. Thus, we wanted to further examine cell death
in tenv-transduced Raji cell clones after G418 selection as
described above for H927 and HT1080 cells. However, Raji cells were
quite resistant to G418 treatment. For example, in experiments with up
to 1,000 µg of G418 per ml, uninfected Raji cells remained viable
even after treatment. For that reason, we decided to use MTT assay to
quantify cytotoxic effects of tenv virus infection on Raji cells.
The same amount of Raji cells was infected with the same titer of
tenv or vector viruses. MTT converting activity was then measured at different time points after infection. As shown in Fig.
5, there was clearly a decrease in the
number of metabolically active cells when the cells were monitored for
up to 48 h after tenv virus infection. Compared to
vector-treated cells, there were 40% fewer tenv-infected
cells at 24 h postinfection. Furthermore, only 30% cells remained
in tenv-treated Raji cells compared to that of vector
control at 48 h postinfection (Fig. 5). Although the observed
cytotoxic effect was most likely related to the kinetics of
tenv protein expression, this issue could not be properly
evaluated because of the lack of appropriate antiserum against this
highly truncated env product with altered TM terminal
sequences.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
MTT assay of Raji cells infected with the
tenv virus. Cytotoxic effect of tenv on Raji
cells was measured by MTT assay at A595 at
24 h (A) and 48 h (B) postinfection. The open bars represent
the vector virus-treated cells, and the gray bars represent the
tenv-treated cells. The standard deviations are also
indicated.
|
|
Evidence for induction of apoptosis to Raji cells by
tenv expression.
Formation of cell aggregates was
previously reported for FeLV-C-treated 3201B feline T-lymphoid cells.
Such morphological changes were followed by induction of apoptosis
(15, 17). Similarly, we observed that clumping of Raji cells
was induced following infection with the tenv virus. To this
end, to examine induction of apoptosis in tenv-treated Raji
cells, we performed a TUNEL assay to assess levels of apoptosis in
vector virus- or tenv virus-infected Raji cells. TUNEL assay
is based on the detection of single- and double-stranded DNA breaks
occurring in apoptosis. Because at 24 hour postinfection massive cell
death (60% of vector-infected cells) was observed, Raji cells infected
with tenv or vector viruses were collected at 4, 8, and
18 h after infection for apoptosis assessment. For each slide,
three fields were counted for the total number of cells and the cells
that were stained positive. At 18 h postinfection, tenv
virus treatment resulted in approximately 45 ± 9% stained Raji
cells with dark red nuclei, whereas only about 8 ± 3% of the
cells treated identically with vector alone virus displayed this
characteristic of apoptosis. Representative results of this assay are
shown in Fig. 6.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 6.
TUNEL assay of Raji cells infected with the
tenv virus. Suspension of infected cells (50 µl) was
transferred to plastic slides and left until dry. Apoptosis was
detected with a red chromogenic substrate. Positively stained cells are
the cells with dark red nuclei. (A) Vector-treated cells. (B)
tenv-treated cells.
|
|
Analysis of tenv expression in the tumor tissue.
To determine whether the deleted env gene was indeed
expressed in the tumor cells from which tenv sequences were
isolated, we conducted RT-PCR of the total RNA obtained from the tumor
tissue and a normal tissue (spleen) from the 5023 tumored cat. As shown in Fig. 7, a PCR product was readily
detected in the tumor tissue but not in the spleen. The size of the
product corresponded well to the expected 453 bp from the
tenv gene sequence. The quality of the RNA derived form the
tissue was verified by the detection of the GADPH gene
product.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 7.
Detection of tenv gene expression in the
original tumor tissue. RT-PCR was performed on total RNA isolated from
normal (spleen) and thymic tumor tissues of cat 5023. While the
GADPH transcript was detected in both normal and tumor
samples, the tenv gene was only expressed in the tumor (lane
4). RT-PCR without RNA or without RT enzyme were included as negative
controls. Lanes: 1, RNA ( ); 2, spleen RT (+); 3, spleen RT ( ); 4, tumor RT (+); 5, tumor RT ( ). The upper panel shows the RT-PCR of
tenv, and the lower panel shows that of GADPH.
|
|
 |
DISCUSSION |
In analogy to murine retrovirus-induced disease processes, we
predicted that certain FeLV env recombinant or truncated
env glycoproteins would be involved in signal transduction
processes that regulate cell proliferation, cell death, or phenotypic
expression. The basis for this prediction was the presence of numerous
reports on functions of chimeric or truncated env
glycoproteins of MuLVs different from the primary role of cell receptor
recognition for entry into host cells. For example, infection of an
interleukin-2 (IL-2)-dependent T-lymphoma cell line, specifically with
the recombinant mink cell focus-forming (MCF) virus, confers
factor-independent growth (26). Another example is release
of a lymphoid cell line from the IL-2 requirement when MCF SU is
coexpressed in these cells along with either erythropoietin receptor
(EpoR) or the structurally related molecule, IL-2 receptor
(12). A chimeric env glycoprotein, gp55 of
polycythemia-inducing Friend spleen focus-forming virus (SFFV), which
is a product of MCF-derived extracellular SU domain fused to an
ecotropic-derived TM segment, is an abnormally processed defective
protein. This protein is needed to bind to EpoR to transform
erythropoietic cells in the virus-induced disease (11, 22).
To pursue this prediction in FeLV pathogenesis, we describe here
experiments that provided direct evidence for the first time for in
vivo generation of not only viruses with recombinant env glycoprotein (3; Phipps et al., unpublished data)
but also a spectrum of truncated glycoprotein genes, all beginning from an inoculum of a single molecular species of FeLV and occurring in the
lymphosarcomas induced. Since the proviral plasmid DNA was inoculated
intradermally into the cats, the composition of the inoculum could not
be questioned. Initially, we selected a single truncated species,
tenv, to examine its structure and function in cell
cultures. The deduced polypeptide of the cloned tenv gene indicates that besides the complete signal peptide and the first seven
amino acids of the mature SU of FRA, tenv does not contain any other SU sequence. The C-terminal portion of eight amino acids is
unique because of the large internal deletion (1,519 bp) and frameshift
in the TM region. The nucleotide sequence of the C-terminal region,
however, corresponds fully to the FRA TM sequence. Thus, it appears
that tenv is a direct derivative of the FRA parental virus
rather than of any recombinant generated in vivo. In some regards,
however, tenv displays structural similarity to SFFV gp55.
Besides the internal deletion of 585 bp, one striking feature in gp55
nucleotide sequence is a single-base-pair insertion that changes the
reading frame (1, 4, 27). Interestingly, although each SFFV
isolate may differ in the type or position of the base pair inserted,
the resulting SFFV env proteins all end with the same unique
five to six C-terminal amino acid sequence (21). There is
evidence that EpoR activation by gp55 is indeed dependent on sequences
at the C-terminal of the factor, while alterations in the N-amino
terminus do not appear to abolish gp55 activity (7).
For functional studies of tenv, we used a WZLneo retrovirus
vector to transduce this gene into a few different cell types. The
tenv virions were produced in amphotropic PA317 packaging cell line and used to infect a number of fibroblastic and lymphoid cell
lines. The findings were striking. While feline fibroblasts (H927),
human fibrosarcoma (HT1080), and human Raji B cells exhibited cytotoxic
response to tenv virus infection, the feline or human T-lymphoid tumor cells, namely, 3201B and CEM cells, did not manifest any significant cytopathicity. The differential cytotoxicity is interesting since all of the lymphoid cell lines were infected with the
same virus titer for the same amount of cells. The fibroblasts, H927
and HT1080 cells, even received less amount of virus. Still the
findings will be more convincing once reagents are available to
determine the levels of tenv protein expression in the
various cell lines tested. Additionally, it will be necessary to extend the study to other target cell lines and natural feline cell
populations to increase the significance of this cytotoxicity. It
should, however, be noted that in contrast to the observed effect of
tenv on the fibroblasts and B cells, infection of these
cells with a full-length recombinant env-containing murine
retroviruses or the vector viruses did not induce any morphological
changes or cytopathic effects. Thus, the changes observed were specific
for tenv expression and not due to nonspecific murine
retrovirus infection. Furthermore, there appears to be a target cell
specificity for tenv as well. In the limited study, the
morphological changes induced in H927, HT1080, and Raji cells by
tenv appeared to be similar to some of the hallmarks of
apoptosis. The results implied, but certainly did not prove, that the
de novo-generated tenv could be critical in lymphomagenesis.
Conceivably, while the T-tumor cells may be resistant to cell death by
expression of this novel protein, other cell types like B lymphoid
cells and stromal (fibroblasts) cells may be targets of selective
killing by this product. This type of selective cytopathic effect may
potentiate compensatory proliferation of the resistant cells in the
tumorigenic process.
In conclusion, we have documented conclusive proof for the in vivo
generation of truncated env genes in FeLV-induced neoplasia. Since the majority of the experimental tumors display one or more discrete species of variably truncated FeLV env genes, it is
quite likely that at least some of them will have functional
consequences. In this regard, the truncated version tested here
illustrates a cytotoxic property which is specific for cell types.
 |
ACKNOWLEDGMENTS |
This study was supported by Public Health Service grant CA51485
from the National Cancer Institute.
We thank W. C. Powell for help with this study and our
collaborators, L. E. Mathes, A. J. Phipps, and K. A. Hayes, at the Ohio State University for the in vivo lymphomagenesis work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathology, University of Southern California School of Medicine, 2011 Zonal Ave., Los Angeles, CA 90033. Phone: (323) 442-1184. Fax: (323)
442-3049. E-mail: royburma{at}hsc.usc.edu.
 |
REFERENCES |
| 1.
|
Amanuma, H.,
A. Katori,
M. Obata,
N. Sagata, and Y. Ikawa.
1983.
Complete nucleotide sequence of the gene for the specific glycoprotein (gp55) of Friend spleen focus-forming virus.
Proc. Natl. Acad. Sci. USA
80:3913-3917[Abstract/Free Full Text].
|
| 2.
|
Bechtel, M. K.,
L. E. Mathes,
K. A. Hayes,
A. J. Phipps, and P. Roy-Burman.
1998.
In vivo evolution and selection of recombinant feline leukemia virus species.
Virus Res.
54:71-86[CrossRef][Medline].
|
| 3.
|
Chen, H.,
M. K. Bechtel,
Y. Shi,
A. Phipps,
L. E. Mathes,
K. A. Hayes, and P. Roy-Burman.
1998.
Pathogenicity induced by feline leukemia virus, Rickard strain, subgroup A plasmid DNA (pFRA).
J. Virol.
72:7048-7056[Abstract/Free Full Text].
|
| 4.
|
Clark, S. P., and T. W. Mak.
1983.
Complete nucleotide sequence of an infectious clone of Friend spleen focus-forming provirus: gp55 is an envelope fusion glycoprotein.
Proc. Natl. Acad. Sci. USA
80:5037-5041[Abstract/Free Full Text].
|
| 5.
|
de Parseval, A.,
D. L. Lerner,
P. Borrow,
B. J. Willett, and J. H. Elder.
1997.
Blocking of feline immunodeficiency virus infection by a monoclonal antibody to CD9 is via inhibition of virus release rather than interference with receptor binding.
J. Virol.
71:5742-5749[Abstract].
|
| 6.
|
Freytag, S. O.,
D. L. Paielli, and J. D. Gilbert.
1994.
Ectopic expression of the CCAAT/enhancer-binding protein alpha promotes the adipogenic program in a variety of mouse fibroblastic cells.
Genes Dev.
8:1654-1663[Abstract/Free Full Text].
|
| 7.
|
Gomez-Lucia, E.,
Y. Zhi,
M. Nabavi,
W. Zhang,
D. Kabat, and M. E. Hoatlin.
1998.
An array of novel murine spleen focus-forming viruses that activate the erythropoietin receptor.
J. Virol.
72:3742-3750[Abstract/Free Full Text].
|
| 8.
|
Hardy, W. D., Jr.
1993.
Feline oncoretroviruses, p. 109-180.
In
J. A. Levy (ed.), The Retroviridae, vol. 2. Plenum Press, New York, N.Y.
|
| 9.
|
Kumar, D. V.,
B. T. Berry, and P. Roy-Burman.
1989.
Nucleotide sequence and distinctive characteristics of the env gene of endogenous feline leukemia provirus.
J. Virol.
63:2379-2384[Abstract/Free Full Text].
|
| 10.
|
Levy, L. S.,
P. A. Lobelle-Rich,
J. Overbaugh,
J. L. Abkowitz,
R. Fulton, and P. Roy-Burman.
1993.
Coincident involvement of flvi-2, c-myc, and novel env genes in natural and experimental lymphosarcomas induced by feline leukemia virus.
Virology
196:892-895[CrossRef][Medline].
|
| 11.
|
Li, J. P.,
A. D. D'Andrea,
H. F. Lodish, and D. Baltimore.
1990.
Activation of cell growth by binding of Friend spleen focus-forming virus gp55 glycoprotein to the erythropoietin receptor.
Nature
343:762-764[CrossRef][Medline].
|
| 12.
|
Li, J. P., and D. Baltimore.
1991.
Mechanism of leukemogenesis induced by mink cell focus-forming murine leukemia viruses.
J. Virol.
65:2408-2414[Abstract/Free Full Text].
|
| 13.
|
Overbaugh, J.,
N. Reidel,
E. A. Hoover, and J. I. Mullins.
1988.
Transduction of endogenous envelop genes by feline leukemia virus in vitro.
Nature
332:731-734[CrossRef][Medline].
|
| 14.
|
Pandey, R.,
M. K. Bechtel,
Y. Su,
A. K. Ghosh,
K. A. Hayes,
L. E. Mathes, and P. Roy-Burman.
1995.
Feline leukemia virus variants in experimentally induced thymic lymphosarcomas.
Virology
214:584-592[CrossRef][Medline].
|
| 15.
|
Pandey, R.,
A. K. Ghosh,
D. V. Kumar,
B. A. Bachman,
D. Shibata, and P. Roy-Burman.
1991.
Recombination between feline leukemia virus subgroup B or C and endogenous env elements alters the in vitro biological activities of the viruses.
J. Virol.
65:6495-6508[Abstract/Free Full Text].
|
| 16.
|
Rohn, J. L.,
M. L. Linenberger,
E. A. Hoover, and J. Overbaugh.
1994.
Evolution of feline leukemia virus variant genomes with insertions, deletions, and defective envelope genes in infected cats with tumors.
J. Virol.
68:2458-2467[Abstract/Free Full Text].
|
| 17.
|
Rojko, J. L.,
R. M. Fulton,
L. J. Rezanka,
L. L. Williams,
E. Copelan,
C. M. Cheney,
G. S. Reichel,
J. C. Neil,
L. E. Mathes,
T. G. Fisher, and M. W. Cloyd.
1992.
Lymphocytotoxic strains of feline leukemia virus induce apoptosis in feline T4-thymic lymphoma cells.
Lab. Investig.
66:418-426[Medline].
|
| 18.
|
Roy-Burman, P.
1996.
Endogenous env elements: partners in generation of pathogenic feline leukemia viruses.
Virus Genes
11:147-161.
|
| 19.
|
Roy-Burman, P.,
M. Dougherty,
B. K. Pal,
H. P. Charman,
V. Klement, and M. B. Gardner.
1976.
Assay for type C virus in mouse sera based on particulate reverse transcriptase activity.
J. Virol.
19:1107-1110[Abstract/Free Full Text].
|
| 20.
|
Rudra-Ganguly, N.,
J. Zheng,
A. T. Hoang, and P. Roy-Burman.
1998.
Downregulation of human FGF8 activity by antisense constructs in murine fibroblastic and human prostatic carcinoma cell systems.
Oncogene
16:1487-1492[CrossRef][Medline].
|
| 21.
|
Ruscetti, S., and L. Wolff.
1984.
Spleen focus-forming virus: relationship of an altered envelope gene to the development of a rapid erythroleukemia.
Curr. Top. Microbiol. Immunol.
112:21-44[Medline].
|
| 22.
|
Ruscetti, S. K.,
N. J. Janesch,
A. Chakraborti,
S. T. Sawyer, and W. D. Hankins.
1990.
Friend spleen focus-forming virus induces factor independence in an erythropoietin-dependent erythroleukemia cell line.
J. Virol.
64:1057-1062[Abstract/Free Full Text].
|
| 23.
|
Sheets, R. L.,
R. Pandey,
W.-C. Jen, and P. Roy-Burman.
1993.
Recombinant feline leukemia virus genes detected in naturally occurring feline lymphosarcomas.
J. Virol.
67:3118-3125[Abstract/Free Full Text].
|
| 24.
|
Sheets, R. L.,
R. Pandey,
V. Klement,
C. K. Grant, and P. Roy-Burman.
1992.
Biologically selected recombinants between feline leukemia virus (FeLV) subgroup A and an endogenous FeLV element.
Virology
190:849-855[CrossRef][Medline].
|
| 25.
|
Tsatsanis, C.,
R. Fulton,
K. Nishigaki,
H. Tsujimoto,
L. Levy,
A. Terry,
D. Spandidos,
D. Onions, and J. C. Neil.
1994.
Genetic determinants of feline leukemia virus-induced lymphoid tumors: patterns of proviral insertion and gene rearrangement.
J. Virol.
68:8296-8303[Abstract/Free Full Text].
|
| 26.
|
Tsichlis, P. N., and S. E. Bear.
1991.
Infection by mink cell focus-forming viruses confers interleukin 2 (IL-2) independence to an IL-2-dependent rat T-cell lymphoma line.
Proc. Natl. Acad. Sci. USA
88:4611-4615[Abstract/Free Full Text].
|
| 27.
|
Wolff, L.,
E. Scolnick, and S. Ruscetti.
1983.
Envelope gene of the Friend spleen focus-forming virus: deletion and insertions in 3' gp70/p15E-encoding region have resulted in unique features in the primary structure of its protein product.
Proc. Natl. Acad. Sci. USA
80:4718-4722[Abstract/Free Full Text].
|
Journal of Virology, February 2000, p. 1451-1456, Vol. 74, No. 3
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.