Previous Article | Next Article 
Journal of Virology, December 2000, p. 11881-11892, Vol. 74, No. 24
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Complex Formation by Human Cytomegalovirus Glycoproteins M
(gpUL100) and N (gpUL73)
M.
Mach,1,*
B.
Kropff,1
P.
Dal
Monte,2 and
W.
Britt3
Institut für Klinische und Molekulare
Virologie, Universität Erlangen-Nürnberg, Erlangen,
Germany1; Laboratorio di Virologia
Policlinico S. Orsola, Universita degli Studi di Bologna, Bologna,
Italy2; and Departments of
Pediatrics and Microbiology, The University of Alabama at
Birmingham, Birmingham, Alabama3
Received 10 July 2000/Accepted 14 September 2000
 |
ABSTRACT |
The envelope glycoproteins of human cytomegalovirus
(HCMV) virions are incompletely characterized. We have analyzed complex formation between glycoprotein M (gM or gpUL100) and a
second glycoprotein. gM-homologous proteins are conserved
throughout the herpesvirus family and represent type III membrane
proteins containing multiple hydrophobic sequences. In extracellular
HCMV particles, gM was found to be complexed through disulfide bonds to
a second protein with an apparent molecular mass of 50 to 60 kDa. The
50- to 60-kDa protein was found to be derived from reading frame UL73
of HCMV strain AD169. UL73-homologous genes are also conserved within
herpesviruses. When transiently expressed by itself, the UL73 gene
product consisted of a protein of 18 kDa. However, in the presence of
gM, the UL73 gene product was posttranslationally modified to the 50- to 60-kDa species. Thus, gM and the UL73 gene product, which represents
the gN homolog of herpesviruses, form a disulfide-linked complex in
HCMV virions. Transient expression of gM and gN followed by
fluorescence imaging with monoclonal antibodies against either protein
demonstrated that complex formation was required for transport of the
proteins from the endoplasmic reticulum to the Golgi and
trans-Golgi compartments. Finally, we tested the gM-gN
complex for reactivity with sera from HCMV-seropositive donors. Whereas
most sera failed to react with either gM or gN when expressed alone,
62% of sera were positive for the gM-gN complex. Because a murine
monoclonal antibody reactive with gN in the gM-gN complex efficiently
neutralizes infectious virus, the gM-gN complex may represent a major
antigenic target of antiviral antibody responses.
 |
INTRODUCTION |
Human cytomegalovirus (HCMV) infects
the majority of the population worldwide. Fortunately, this infection
usually remains clinically asymptomatic in immunocompetent individuals.
However, in immunocompromised hosts, such as infants infected in utero, transplant recipients, or patients with AIDS, HCMV infections can be
life threatening (1). Identification and characterization of
HCMV proteins that elicit a protective response will allow a more
thorough understanding of the control of infection and, eventually, the
design of strategies to limit disease in the infected host.
HCMV is the most genetically complex member of the family of human
herpesviruses. The laboratory-adapted strain AD169 encodes more than
200 open reading frames within its genome of 230,000 bp
(10). Low-passage clinical isolates contain an additional 15 kb of sequence potentially encoding an additional 20 proteins (9). Among herpesviruses, HCMV has the largest coding
capacity for glycoproteins; at least 57 potential
glycoproteins are encoded by AD169 and an additional 15 by
clinical isolates (9, 10).
The structural glycoproteins of the viral particle remain
incompletely defined. To date three major glycoprotein
complexes (designated gCI to -III) have been identified. The gCI
complex is formed by homodimeric molecules of glycoprotein
B (gB or gpUL55) linked by disulfide bonds (4, 6). gH
(gpUL75), gL (gpUL115), and gO (gpUL74) together represent the gCIII
complex. Again, the individual components are covalently linked through
disulfide bonds (16, 31). gCII has been reported to consist
of a heterogeneous family of glycoproteins with molecular
masses between 39 and more than 200 kDa (25). Components of
the gCII complex have been identified as heparin binding proteins of
the envelope, yet very little else is known about the components or the
characteristics of this complex (23, 24). A 48-kDa
polypeptide within this complex was identified as the product of open
reading frame UL100 (26). The gene product of UL100 was
first described by Lehner et al. (30) as a structural
component of HCMV virions and termed the integral membrane protein.
Subsequently, proteins from homologous reading frames were identified
in other herpesviruses, including the glycoprotein termed
gM in the herpes simplex virus. Following the recommendations for
nomenclature of HCMV glycoproteins, we will therefore
designate the UL100 gene product of HCMV as gM.
The gM-homologous proteins of herpesviruses represent type III membrane
proteins containing multiple (six to eight) transmembrane sequences.
They constitute components of the mature virus particle (3, 12,
39, 40, 46). Functions of gM have been described in fusion and/or
entry and cell-to-cell spread (28, 38). gM has been reported
to be nonessential for the in vitro replication of alphaherpesviruses
(herpes simplex virus type 1 [HSV-1] and pseudorabies virus [PRV])
and the gammaherpesvirus equine herpesvirus type 1 (2, 12,
38). However, viral mutants lacking gM replicate to lower titers
in tissue culture than the wild-type viruses and exhibit reduced
virulence in animal models or the natural host (11, 31, 34).
For a number of alpha- and gammaherpesviruses, complex formation of gM
with other viral proteins has been described. One protein in the
complex has been identified as gN, a protein which is also conserved
throughout the herpesvirus family (19, 29). The various gN
homologs have been reported to be small type I membrane proteins with
molecular masses in the range of 7 to less than 20 kDa (20, 29,
46). Previous studies have suggested that gN is nonessential for
the in vitro replication of alphaherpesviruses PRV, varicella-zoster
virus, and bovine herpesvirus type 1 (BHV-1) (19, 41, 46).
Mutant PRVs lacking gN replicate in noncomplementing cell lines to
slightly reduced titers, and their penetration into susceptible cells
is considerably delayed (19, 33). Despite the conservation,
description of the gN homologs indicates a variety of processing
differences, e.g., lack of glycosylation in the proteins from BHV-1 and
varicella-zoster virus (32, 41). Also, complex formation
with gM can be mediated through both noncovalent interactions and
covalent disulfide bonds (19, 29, 46). Viruses containing
double mutations in the gM and gN genes have not been described so far;
however, the absence of gN from virions derived from a gM-negative
mutant PRV indicates that both proteins can be absent from infectious
virions (19). In contrast to the results described above, gM
has been shown to be an essential protein for in vitro replication of
HCMV (15). Whereas considerable effort has been devoted
to understanding the molecular functions of gM-gN proteins, very little
is known about their immunogenicity during natural infection. As
glycoprotein components of the viral envelope, they are
potentially capable of inducing neutralizing antibodies.
We investigated the complex formation of gM of HCMV. We report here
that gM associates with a second protein of 50 to 60 kDa through
disulfide bonds and that both molecules represent major constituents of
mature virions. The 50- to 60-kDa protein is encoded by the UL73
reading frame of HCMV AD169, which represents the gN homolog of
herpesviruses. Processing of recombinant-derived gN appears to differ
only slightly from that of the native protein expressed in
virus-infected cells. In the absence of gM, the UL73 gene product is a
18-kDa polypeptide which, in the presence of gM, acquires complex
modifications resulting in the formation of a 50- to 60-kDa
glycoprotein. Fluorescence imaging experiments indicated
that complex formation between gM and gN was required for the
transport of both proteins from the endoplasmic reticulum (ER) to more
distal parts of the secretory pathway. Finally, we have provided
evidence that the gM-gN complex represents a highly immunogenic
structure for the humoral immune response during natural infection.
 |
MATERIALS AND METHODS |
Cell culture and virus production.
HCMV strain AD169 was
propagated in primary human foreskin fibroblasts grown in minimal
essential medium (Gibco BRL, Glasgow, Scotland) supplemented with 5%
fetal calf serum (FCS), glutamine (100 mg/liter), and gentamicin (350 mg/liter). Virions were isolated via glycerol-tartrate gradient
centrifugation as described previously (44). 293T cells were
cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco BRL)
supplemented with 10% FCS, glutamine, gentamicin, and 50-µg/ml G418
(Geneticin; Gibco BRL). Cos-7 cells were passaged in DMEM supplemented
with 10% FCS and antibiotics as described above.
MAbs.
Monoclonal antibody (MAb) IMP 91-3/1 was produced by
standard procedures. Briefly, a fusion protein (termed IMP12)
containing amino acids (aa) 300 to 372 of gM fused to aa 1 to 375 of
-galactosidase was expressed in Escherichia coli using
the vector pROS as described previously (13). The
recombinant protein was purified, and the viral polypeptide was
released by cleavage with blood coagulation factor Xa. The gM-specific
polypeptide was then purified by fast protein liquid chromatography. It
was injected intramuscularly into the hind limbs of adult BALB/c mice
by using complete Freund's adjuvant. Following two boosts with 50 µg
of protein emulsified in incomplete Freund's adjuvant, cells from the
draining lymph nodes were fused with the myeloma cell line Sp20
according to standard procedures. Wells containing hybridoma cells were
screened by indirect immunofluorescence using HCMV-infected cells. The remaining MAbs that were used in this study have been described previously: gB-specific MAb 27-287 (43) and gp65-specific
MAb 14-16A (5). Anti-Flag M2 was purchased from Sigma
(Deisenhofen, Germany).
Plasmids.
Plasmid pcIMP was constructed by inserting a
1.5-kb NciI fragment (nucleotides 144928 to 146466 of the
AD169 sequence) containing the entire UL100 reading frame into the
vector pcDNA3 (Invitrogen, Carlsbad, Calif.). The fragment was derived
from the plasmid pHM9 (30). pcUL73flag was constructed by
inserting the entire UL73 open reading frame (417 bp) into the vector
pcDNA3. To insert the FLAG epitope at the 3' end of the UL73 coding
sequence, the following primers were used: 73-forward
(5'ACCGAATTCATGGAGTGGAACACACTAGTATTAGG 3') and 73-reverse
(5'TCACTTGTCATCGTCGTCCTTGTAGTCCCATAGCCTTTGGTGGTGGTTGC3'), in
which the stop codon was moved to the end of the sequence encoding the
FLAG epitope. The FLAG epitope consists of the sequence DYKDDDK, which
is recognized by antibody M2 (Sigma).
DNA transfection.
293T cells were transfected with DNA using
Lipofectamine Plus reagent (Gibco BRL) according to the manufacturer's
suggestion, except that the transfection mixture consisted of 6.5 µg
of DNA, 1.5 ml of DMEM, and 46 µl of Lipofectamine Plus reagent. The
mixture was added to a petri dish (10-cm diameter) which had been
seeded with 3 × 106 cells 2 days earlier. After 48 to
55 h, cells were harvested, washed three times with
phosphate-buffered saline (PBS), and stored at
20°C until used. For
imaging experiments which used transfected cells, Cos-7 cells were
grown on 13-mm glass coverslips and transfected using calcium chloride
as described (39).
SDS-PAGE and immunoblotting.
To avoid the formation of
high-molecular-weight aggregates after boiling, extracellular HCMV
particles were incubated in sample buffer containing 15 mM Tris-Cl (pH
6.8), 8 M urea, 4% (wt/vol) sodium dodecyl sulfate (SDS), 2%
(vol/vol)
-mercaptoethanol, 10% (vol/vol) glycerol, and 0.01%
bromophenol blue for 2 to 3 h at room temperature. The separation
of proteins was carried out by using conventional 8 to 10%
polyacrylamide gel electrophoresis (PAGE), except that solutions for
stacking and separating gels contained 3 M urea and 0.5% (vol/vol)
Triton X-100 (final concentrations). All solutions containing urea were
prepared fresh. Gel electrophoresis and transfer of samples to
nitrocellulose membranes were carried out by standard procedures.
For the detection of antigen, antibodies were diluted in PBS containing
0.1% Tween 20. Antibody binding was detected using either horseradish
peroxidase-coupled anti-murine immunoglobulin and the enhanced
chemiluminescence detection system (Pharmacia Biotech, Freiburg,
Germany) or alkaline phosphate-coupled anti-murine
immunoglobulin and 5-bromo-4-chloro-3-indolylphosphate-Nitro Blue Tetrazolium. Removal of N-linked oligosaccharides was carried out
using recombinant peptide:N-glycosidase F and
endoglycosidase H (New England Biolabs, Beverly, Mass.) according to
the manufacturer's specifications, except that denaturation of samples
was carried out at room temperature for 2 to 3 h.
Immunoprecipitations.
All immunoprecipitations were carried
out using biotinylated antigen preparations. Extracellular virions were
biotinylated using Sulfo-NHS-Biotin (Pierce, Rockford, Ill.) according
to the manufacturer's suggestions. Briefly, 650 µg of HCMV particles was resuspended in 500 µl of PBS, 270 µg of biotin was added, and
the mixture was incubated for 30 min at room temperature with gentle
agitation. Particles were pelleted and resuspended in 30 ml of DMEM and
centrifuged for 70 min at 92,000 × g at 10°C. The pellet was resuspended in 150 µl of PBS and used for
immunoprecipitation. To biotinylate transfected cells, 1.2 × 107 cells were labeled using 250 µg of biotin in a
reaction volume of 500 µl. For immunoprecipitations, virions or
transfected cells were treated with buffer A (50 mM Tris-Cl [pH 8.0],
150 mM NaCl, 5 mM EDTA, 1% NP-40, 0.1 mM phenylmethylsulfonyl
fluoride) for 20 min at 4°C with gentle agitation. Lysates were
cleared by centrifugation (30,000 × g, 10 min, 4°C)
and incubated with protein A-Sepharose CL-4B (Sigma) precoated with MAb
for 2 h at 4°C with gentle agitation. Samples were washed three
times with buffer A, and precipitated proteins were dissociated from
the protein A-Sepharose by incubating samples for 2 to 3 h at room
temperature in sample buffer with or without 2-mercaptoethanol. The
precipitated proteins were then analyzed by SDS-PAGE as described
above. Precipitated proteins were detected in immunoblots by using
streptavidin peroxidase and the enhanced chemiluminescence system
(Amersham). In experiments in which MAb 14-16A was used as the
precipitating antibody, protein A-Sepharose was precoated with rabbit
anti-mouse immunoglobulin M (IgM) (Dako, Hamburg, Germany) for 3 h
at 4°C, washed once with buffer A, and resuspended in the same buffer.
Immunofluorescence.
Transfected cells were harvested, washed
with PBS, spotted on glass coverslips, air dried, and fixed for 10 min
with
20°C acetone. Human sera were diluted 1:50 in PBS-0.1% Tween
20 and incubated for 45 min at 37°C with the cells. After three
additional washes with PBS, 0.1% Tween 20 fluorescein
isothiocyanate-conjugated rabbit anti-human IgG (Dako) was added for 60 min at 37°C. Cells were washed twice with PBS and counterstained with
Evans blue (0.001%).
Imaging of transiently expressed gM and gN.
Cos-7 cells were
grown on 13-mm glass coverslips in 24-well plates and were transfected
with expression plasmids for gM(UL100), gNFLAG(UL73), or
gN(UL73) or were cotransfected with both gNFLAG and gM by
using calcium chloride as described previously (42). Forty-eight hours after transfection, the coverslips were fixed for 30 min at room temperature in 2% paraformaldehyde freshly prepared in PBS
(pH 7.4). Following several rinses with PBS, the cells were
permeabilized in cold PBS containing 0.05% NP-40 and 0.002% SDS for 5 min at 4°C. The coverslips were then rinsed several times with PBS
and blocked by incubation in PBS supplemented with 20% normal goat
serum for 60 min at room temperature. The coverslips were rinsed, and
then primary antibody was added and the coverslips were incubated for
60 min at 37°C. After rinsing, fluorochrome-conjugated secondary
antibody diluted in 20% normal goat serum was added and the coverslips
were incubated for 60 min at 37°C. The wells were washed and
postfixed in 2% paraformaldehyde. Following mounting in Slow Fade
(Molecular Probes, Eugene, Oreg.), the coverslips were viewed under a
Leitz Dialux epifluorescence microscope at a magnification of ×50 and
the images were captured with a digital camera (Photometrics, Tucson,
Ariz.). The images were processed with Image Pro software (Media
Cybernetics, Silver Spring, Md.). Deconvolution was accomplished with
Hazebuster (Vaytek, Fairfield, Iowa).
The antibodies which were used to identify cell markers in this study
included (i) anticalreticulin for the ER (Affinity BioReagents, Golden,
Colo.), (ii) anti-ERGIC53 for the ER-Golgi intermediate compartment
(ERGIC) (Peter Hauri, University of Basel, Basel, Switzerland), (iii)
anti-p115(TAP) for ERGIC (Elizabeth Sztul, University of Alabama,
Birmingham), (iv) anti-GM130 for the Golgi (Elizabeth Sztul), and (v)
Texas red-conjugated wheat germ agglutinin (WGA) for the
trans-Golgi network (TGN) (Molecular Probes). These reagents
were described in a recent publication (42).
 |
RESULTS |
Isolation and characterization of a MAb specific for gM.
To
further define the gCII complex, we initially generated gM murine MAbs
by immunizing mice with an E. coli-produced polypeptide which consisted of aa 300 to 372 of gM fused to aa 1 to 375 of
-galactosidase (termed IMP12). Immunization induced a readily detectable antibody response to gM, as measured by indirect
immunofluorescence of HCMV-infected fibroblasts (data not shown).
Several antibody-producing hybridoma cell lines were isolated, and
antibodies from one line (designated IMP 91-3/1) were further
characterized. The specificity of MAb IMP 91-3/1 was established in
immunoblots using fusion proteins derived from the UL100 open reading
frame. Antibody IMP 91-3/1 specifically reacted with fusion protein
IMP12 and not with sequences derived from other regions of gM, other
HCMV proteins, or the vector-encoded
-galactosidase moiety (data not
shown). The MAb IMP 91-3/1 was nonreactive in the enzyme-linked
immunosorbent assays and indirect immunofluorescence assays using
Epstein-Barr virus (EBV)- or HSV-infected cells or cell lysates (data
not shown). When extracellular virions were used in immunoblot assays,
IMP 91-3/1 reacted with a protein of 42 to 45 kDa, which was in
agreement with our previous results using a polyclonal antiserum
against gM (Fig. 1) (30). When
virions were treated with endoglycosidase F and analyzed by
immunoblotting, MAb IMP 91-3/1 reacted with a protein with an estimated
molecular mass of about 35 to 40 kDa. A control digestion using a
nonglycosylated viral protein, pp65(UL83), indicated that the decrease
in size of gM was not secondary to nonspecific proteolytic activity of
the endoglycosidase (Fig. 1). Treatment with endoglycosidase H failed
to alter the migration of the protein, indicating that virion gM
contained complex, N-linked sugars (Fig. 1).

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 1.
gM of HCMV is a structural protein containing complex
carbohydrates. Extracellular virus particles were purified by
centrifugation through a glycerol-tartrate gradient. Lysates were
digested with endoglycosidases (+) or left untreated ( ), separated by
SDS-PAGE, and analyzed in immunoblots using MAb IMP 91-3/1 (gM
specific). As a control for nonspecific proteolytic activity, pp65 was
precipitated from virions using MAb 28-77 and treated with
endoglycosidase F under identical conditions. Molecular weight (in
thousands) is on left of each gel.
|
|
gM forms a disulfide-linked complex with a second protein of 45 to
60 kDa.
To analyze potential complex formation between gM and
other viral proteins through intermolecular disulfide bonds, virions were solubilized in the presence and absence of the reducing agent 2-mercaptoethanol and analyzed by immunoblotting using MAb IMP 91-3/1.
In the presence of 2-mercaptoethanol, a single protein migrating at 42 to 45 kDa was detected by MAb IMP 91-3/1 (Fig. 2A). MAb 14-16A, which has previously
been shown to react with a highly glycosylated envelope protein with an
estimated molecular mass of 65 kDa (5), reacted with
protein(s) which migrated between 50 and 60 kDa (Fig. 2A). As a
control, MAb 27-287 detected the transmembrane component of gB, which
migrated with an estimated molecular mass of 58 kDa (Fig. 2A). When the
same virion preparations were subjected to SDS-PAGE in the absence of
the reducing agent, MAb IMP 91-3/1 reacted with two proteins which
migrated between 70 and 100 kDa and at 45 kDa (Fig. 2B). MAb 14-16A
reacted with a 50- to 60-kDa protein and 70- to 100-kDa proteins which
comigrated with the 70- to 100-kDa proteins detected by MAb IMP 91-3/1
(Fig. 2B). These results suggest that gM was complexed to a second
protein through both disulfide bonds and nonconvalent interactions and that MAb 14-16A was reactive with this second protein.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 2.
Viral gM and gp65 form a disulfide-linked complex.
Lysates from extracellular virions were subjected to Western blotting
(WB) or immunoprecipitation (IP) using MAbs specific for gM (IMP
91-3/1), gB (27-287), and gp65 (14-16A), respectively. SDS-PAGE was
performed following disruption of immune precipitates of the virion
lysates in the presence (A) or absence (B) of the reducing agent
2-mercaptoethanol (2-ME). The 70- to 100-kDa protein from nonreduced
samples was cut from the gel and chromatographed a second time under
reducing conditions (C). Co represents a control immunoprecipitation
without primary antibody. Molecular weight (in thousands) is on left of
each panel.
|
|
When lysates from extracellular virions were subjected to
immunoprecipitation with IMP 91-3/1 followed by SDS-PAGE under reducing
conditions, gM and an additional protein of 50 to 60 kDa were
precipitated (Fig.
2A). A protein which comigrated with pp65 was
also
present in the immunoprecipitates; however, the presence
of this
protein was thought to be secondary to nonspecific binding
of the pp65,
as a similar band was also seen in the immunoprecipitates
generated
with the anti-gB MAb 27-287 (Fig.
2A). Similarly, MAb
14-16A
specifically precipitated proteins with estimated molecular
masses of
50 to 60 kDa and 42 to 45 kDa from virions (Fig.
2A).
This MAb also
precipitated a band comigrating with pp65 as well
as
lower-molecular-mass proteins, which migrated more rapidly
than did the
45-kDa gM (Fig.
2A). If the immunoprecipitated samples
were analyzed in
the absence of

-mercaptoethanol, three major
bands of 42 to 45, 50 to 60, and 70 to 100 kDa were precipitated
by both MAbs IMP 91-3/1 and
14-16A (Fig.
2B). Again, both MAbs
precipitated lower-molecular-mass
proteins, which appeared not
to be disulfide linked to these complexes
(Fig.
2B). These data
suggest that gM was complexed through disulfide
bonds to a second
protein with a 50- to 60-kDa molecular mass and that
this complex
likely accounted for the 70- to 100-kDa species. Together,
these
data also suggest that gM was complexed with the virion envelope
protein identified by MAb 14-16A and that these two virion proteins
were present in the virion envelope, both as monomers and as a
disulfide-linked complex. To directly examine this possibility,
the gel
slice containing the 70- to 100-kDa species from samples
separated
under nonreducing conditions was treated with 2-mercaptoethanol
and
electrophoresed in a second gel. Although the 70- to 100-kDa
species
was incompletely dissociated with this treatment, reduction
of
disulfide bonds resulted in the appearance of both the 50-
to 60-kDa
and 42- to 45-kDa proteins (Fig.
2C). Taken together,
these results
strongly suggest that the gM envelope protein was
complexed with a
second virion protein of 50 to 60 kDa within
the envelope of
HCMV.
Cotransfection of plasmids expressing the UL73 and gM open reading
frames results in the formation of a protein complex recognized by MAb
14-16A.
gM molecules from other herpesviruses, including BHV and
PRV, have been shown to form a complex with a second
glycoprotein, termed gN. The UL73 open reading frame of
HCMV encodes the gN homolog. The predicted gene product of UL73 is a
protein of 138 aa, which has an expected molecular mass, without
posttranslational modifications, of approximately 15 kDa. To monitor
expression of the protein product of UL73, the expression plasmid
pc73FLAG was constructed by fusing the FLAG epitope to the
carboxyl terminus of the UL73 open reading frame. Expression of this
fusion protein could then be detected by reactivity with the M2 MAb.
Following transfection of the pc73FLAG into 293T cells,
cell lysates were analyzed by immunoblotting. By use of the M2-specific
antibody, a protein of 18 kDa and several faint bands between 20 and 35 kDa were detected (Fig. 3). Although we
initially believed that gN could represent the second protein in the gM
complex of HCMV, we failed to detect any reactivity of MAb 14-16A for
the forms of UL73FLAG transiently expressed in this
transfection (Fig. 3).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 3.
The UL73 reading frame is translated into an 18-kDa
protein in transfected cells. 293T cells were transfected with DNA
encoding UL73 (UL73FLAG) or the vector (pcDNA3) or left
untreated (no DNA). After 48 h cell lysates were analyzed by
immunoblotting. The blots were developed with either the anti-FLAG MAb
(M2) or MAb 14-16A. Lysates from extracellular HCMV virions were
included as control for MAb 14-16A reactivity (virus).
|
|
The correct folding, transport, and/or modification of at least one
protein partner of the HCMV envelope glycoprotein complex
consisting of gH-gL-gO has been suggested to require the simultaneous
expression of all three proteins (
16,
31). Based on this
model,
we next used immunoprecipitation experiments to investigate the
expression and posttranslational modifications of the respective
proteins and/or complexes which formed following cotransfection
of 293T
cells with gM- and gN-expressing plasmids. In cells transfected
only
with the plasmid for UL73
FLAG, an 18-kDa protein could be
precipitated using the M2-specific antibody (Fig.
4). In agreement
with our previous
findings, no specific signal was obtained with
either antibody IMP
91-3/1 or 14-16A (Fig.
4). In contrast to
these results, a
significantly reduced amount of the 18-kDa species
was precipitated
from cells cotransfected with UL73
FLAG and gM
(Fig.
4). As expected, a protein of 42 to 45 kDa was precipitated
with
antibody IMP 91-3/1, indicating that gM was expressed in
these
transfected cells (Fig.
4). The most abundant protein precipitated
from
these cell lysates by antibody M2 had an apparent molecular
mass of
approximately 40 to 52 kDa, based on its diffuse migration
(Fig.
4). A
protein of similar size was also precipitated by using
antibody 14-16A
(Fig.
4). These data indicate that cotransfection
of the genes encoding
gM and UL73 resulted in the production of
a diffusely migrating 42- to
55-kDa protein recognized by antibody
14-16A as well as antibody M2.
The estimated molecular mass of
the protein recognized by MAb 14-16A in
transfected cells was
less than the estimated mass of the corresponding
protein in virions,
suggesting that the protein expressed in
transfected 293T cells
was modified incompletely compared to the mature
form of the protein
(Fig.
4). Findings consistent with this
interpretation have been
provided by studies in virus-infected human
fibroblasts and transformed
astrocytoma cells (
27). In this
study, Kari and coworkers demonstrated
a marked difference in the
carbohydrate modifications, particularly
O-linked modifications, of
HCMV gB and proteins of the gCII complex
(
27). MAb 14-16A
also recognized the complex formed between
gM and the product of the
UL73 open reading frame without the
carboxyl-terminal FLAG epitope,
indicating that the presence of
the FLAG epitope was not required for
MAb 14-16A reactivity (data
not shown). These data were most consistent
with the interpretation
that gM and the product of the UL73 open
reading frame formed
a complex when coexpressed in cells and that the
complex formation
allowed intracellular transport and posttranslational
modifications
of the protein encoded by the UL73 open reading frame.
The recognition
of the complex between gM and the UL73-encoded protein
by MAb
14-16A suggested that this antibody was specific for a
determinant
which required a posttranslation modification of the
UL73-encoded
protein present in the mature glycoprotein
complex. Moreover,
the finding that the UL73 gene product formed a
complex with gM
provided evidence that the UL73 gene encoded the gN
homolog of
HCMV. Carbohydrate modifications of gN were determined by
digestion
of the protein in virions as well as of the protein expressed
in cotransfected cells with a number of different glycosidases.
However, with the exception of a reduction in size by 4 to 5 kDa
following digestion with endoglycosidase F, the molecule appeared
resistant to conventional endoglycosidase treatment (data not
shown).

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 4.
Cotransfection of gM and UL73 DNA results in a
14-16A-reactive protein. 293T cells were transfected with a plasmid for
UL73FLAG DNA (UL73) or a mixture of plasmids for UL73 plus
gM (UL73 + gM). Cell lysates were analyzed in immunoprecipitations
(IP) using MAbs specific for gM (IMP 91-3/1), the FLAG epitope of UL73
(M2), or gp65 (14-16A). Controls included an immunoblot (Blot) using
extracellular virus particles as antigen and MAbs specific for gB
(27-287), gM (IMP 91-3/1), and gp65 (14-16A).
|
|
The glycoprotein complex of gM and gN is recognized by
MAb 14-16A.
To further confirm that gN formed a complex with gM
and to define the intracellular compartment in which this association occurred, we utilized transient expression of gM and gN in Cos-7 cells,
followed by fluorescence imaging with antibodies directed against the
viral protein or against cellular markers of the secretory pathway.
When Cos-7 cells were transfected with an expression plasmid for UL100
(gM) or UL73FLAG (gN), we could not detect reactivity with
antibody 14-16A (Fig. 5). In contrast to
these results, when plasmids for gM and gNFLAG were
cotransfected into Cos-7 cells, we detected prominent staining with MAb
14-16A, which also demonstrated nearly complete colocalization with the
signal from the M2 MAb reactive with the protein encoded by
UL73FLAG (Fig. 5). Although there was considerable overlap
between the signals from MAbs 14-16A and IMP 91-3/1, this overlap was
consistently less than the nearly complete colocalization between the
signals from MAbs 14-16A and M2 present in cells cotransfected with
plasmids for both gM and gNFLAG (Fig. 5). These results
provide further support for the interpretation that antibody 14-16A was
directed at a determinant on gN, the protein product of UL73. Although
the nature of this antibody binding site remains undefined, this result
further confirms that MAb 14-16A recognized a conformation-dependent
determinant on gN which was formed following complex formation with gM,
perhaps secondary to posttranslational processing of the molecule (such as the addition of carbohydrate modifications).

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 5.
The gM-gN complex in transfected cells is recognized by
MAb 14-16A. Cos-7 cells were cotransfected with plasmids for gM and
gNFLAG, and protein expression was assayed by reactivity
with MAb 14-16A, IMP 91-3/1, or the anti-FLAG MAb M2. Reactivity with
MAb 14-16A was detected with a fluorescein
isothiocyanate-conjugated anti-mouse IgM secondary antibody, while
reactivity with MAb IMP 91-3/1 or M2 was detected with a Texas
red-conjugated anti-mouse IgG antibody. The appearance of yellow
indicates colocalization of the signal from the antibody. Note the
nearly complete overlap of the signals from MAbs 14-16A and M2.
|
|
We investigated the intracellular trafficking of gM and gN and the
gM-gN complex in an attempt to define the cellular compartment
in which
complex formation occurred. We initially defined the
intracellular
trafficking of gN and gM when expressed in cells
transfected with a
plasmid for only one of the glycoproteins.
The distribution
of UL73
FLAG(gN) was confined to the ER and the
ERGIC with
no obvious colocalization with markers of the Golgi
or TGN (Fig.
6). Similarly, when gM was expressed by
itself, the
protein colocalized only with markers of the ER and ERGIC
and
not of the Golgi or TGN (Fig.
7). In
contrast to these results,
when the expression plasmids for
gN
FLAG and gM were cotransfected
into Cos-7 cells,
reactivity for both gM and gN
FLAG could be detected
in the
major compartments of the secretory system (data not shown).
Cellular
trafficking of the complex was next analyzed using antibody
14-16A. The
complex could be shown to colocalize with markers
for the TGN with
minimal overlap of the signal with markers for
the Golgi (Fig.
8) (data not shown). Together these
results suggest
that complex formation was required for transport of
both gN and
gM to distal compartments of the secretory system and that
complex
formation was required for assembly of the antibody binding
site
defined by antibody 14-16A. Furthermore, the finding that the
molecular mass of gN increased from an apparent 18 kDa when expressed
alone to an apparent 42 to 45 kDa when coexpressed with gM was
consistent with its intracellular transport and posttranslational
modification, most likely carbohydrate addition. Lastly, the
specificity
of MAb 14-16A for the form of gN expressed in the complex
composed
of gN and gM in the virion and its restricted reactivity for
gN
found in distal compartments of the secretory system suggest that
this determinant was specific for a fully modified form of gN.

View larger version (85K):
[in this window]
[in a new window]
|
FIG. 6.
The product of the UL73 open reading frame, gN,
localizes in the ER and ERGIC in transfected cells. Cos-7 cells were
grown on glass coverslips and transfected with the plasmid for
gNFLAG. The coverslips were then processed for imaging as
described in Materials and Methods. The intracellular location of gN
was determined by comparing the signal from the FLAG-specific antibody
M2 (MAb anti-FLAG) with those of antibodies or lectins specific for
markers of cellular components of the secretory system. The cellular
markers and associated antibodies were as follows: ER,
anticalreticulin; ERGIC, anti-p115(TAP); Golgi, anti-GM130; and TGN,
WGA. The cellular markers were developed with Texas red and M2 antibody
binding by fluorescein isothiocyanate-conjugated anti-mouse IgG. Yellow
indicates colocalization of the signal.
|
|

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 7.
The product of the UL100 open reading frame, gM,
localizes in the ER and ERGIC in transfected cells. Cos-7 cells were
grown on glass coverslips and transfected with a plasmid for gM. The
coverslips were processed for imaging as described in Materials and
Methods. The intracellular location of gM was determined by comparing
the signal from the anti-gM antibody IMP 91-3/1 with those of
antibodies or lectins specific for markers of the cellular secretory
system. The cellular markers and associated antibodies were as follows:
ER, anticalreticulin; ERGIC, anti-p115(TAP); Golgi, anti-GM130; and
TGN, WGA. The antibodies reactive with the cellular markers were
developed with Texas red and anti-gM MAb binding by fluorescein
isothiocyanate-conjugated anti-mouse IgG. Yellow indicates
colocalization of the signal.
|
|

View larger version (114K):
[in this window]
[in a new window]
|
FIG. 8.
The gM-gN complex formation allows transport of the gM
and gN protein to distal compartments of the cellular secretory
pathway. Cos-7 cells grown on coverslips were cotransfected with
plasmids for gM and gNFLAG and processed as described in
Materials and Methods. The coverslips were fixed and then reacted with
antibodies against gM (MAb IMP 91-3/1), FLAG (MAb M2), or gN (MAb
14-16A). The TGN was detected with Texas red-conjugated WGA, which was
added for the final 10 min of incubation with the
fluorochrome-conjugated second antibody. Images were collected and
digitized as described in Materials and Methods. A yellow signal
indicates colocalization of the signal from the antibodies and
colocalization of the two proteins. Note that the signal from MAb
14-16A is restricted to the TGN.
|
|
Antibody recognition of the gM-gN complex following natural
infection.
In the final set of experiments we investigated the
immunogenicity of the gM-gN complex following natural infection. 293T cells were transfected with plasmids expressing gM and/or gN, and
indirect immunofluorescence was carried out using 34 human sera which
were seropositive for HCMV, as determined by a commercially available
assay of HCMV-specific antibody reactivity, and 5 negative control
sera. Whereas 6 and 32% of the sera were found positive for gN and
gM, respectively, 62% were positive for cells expressing both proteins
(Table 1). Thus, the gM-gN complex of
HCMV appeared to be antigenic in humans and was a target of antiviral
antibody responses following natural infection. The fact that antibody 14-16A neutralized infectious virus very efficiently suggested that antibodies reactive with the gM-gN complexes which are
present in human sera could also have virus-neutralizing activity.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Reactivity of IgG antibodies against gM, gN, and gM-gN
complex in sera from HCMV-seropositive and
-seronegative donorsa
|
|
 |
DISCUSSION |
Our results have demonstrated that HCMV open reading frames
UL100 and UL73 encode the gM and gN homologs of HCMV and that these
proteins form a disulfide-linked complex in virus-infected cells and in
extracellular virions. These results were consistent with previous
descriptions of the gM-gN complex in both alpha- and
gammaherpesviruses and indicated that the gM-gN protein complex is
conserved in alpha-, beta-, and gammaherpesviruses. In contrast to
descriptions of the gM-gN complex of EBV, we could demonstrate that a
significant amount of HCMV gM and gN was present as a disulfide-linked complex in the virion and the infected cell (29). This
finding was in agreement with those of studies of other herpesviruses, such as PRV and BHV-1, which have indicated that the gM-gN complex is
disulfide linked (19, 32). Thus, the importance of disulfide bonds in maintaining the gM-gN complex in herpesviruses remains incompletely defined. Interestingly, an appreciable amount of gM and gN
in the HCMV virion was also present in monomeric form, suggesting that
covalent disulfide bonding was not absolutely required for the
interaction between these proteins. However, formation of gM dimers, as
has been seen in other herpesviruses, seems not to occur in HCMV
(39). Furthermore, the noncovalent interaction between gM
and gN was sufficient to permit intracellular transport and folding of
gN, as evidenced by the recognition of the higher-molecular-weight gN
monomers by MAb 14-16A. These results suggest that gM and gN form a
complex through both covalent and noncovalent interactions and raise
the possibility that the stoichiometry of this complex could be
considerably more complex than a dimer containing a single molecule of
gM and gN.
Genes encoding gM and gN homologs appeared to be conserved in all
herpesviruses studied thus far, suggesting an important functional role
of this complex. Yet several reports have demonstrated that the gM-gN
complex is nonessential for virus replication in alphaherpesviruses in
vitro (2, 12, 19, 38). More recent studies have shown that
PRV gM deletion mutant viruses have reduced entry into permissive
cells, a phenotype which has been linked to decreased penetration but
not decreased attachment (19). However, this phenotype could
not be definitively assigned to gM because the second component of the
PRV gM-gN glycoprotein complex, gN, was also dependent on
the expression of gM for its intracellular transport and incorporation
into the virion. A PRV mutant virus in which the gN has been deleted
has been reported to be infectious, but its phenotype has not been as
extensively characterized as that of the gM-null virus (19).
In the case of EBV, it is unclear whether gM and gN are virion
proteins, but preliminary results have suggested that EBV gN may
be required for the infection of B lymphocytes (L. Hutt-Fletcher,
personal communication). Thus, the function of the gM-gN complex
might only be revealed by in vivo experiments. In fact, a PRV mutant which contained a deletion in the gM open reading frame and which failed to express the gM-gN complex demonstrated an attenuated phenotype in the natural host (11). Yet this mutant
exhibited spread within the central nervous systems of mice similar to
that of the wild-type virus (37). Not surprisingly, the
function of the envelope gM-gN complex in HCMV infection is not known, but previous reports have indicated that this protein complex could
bind heparin and suggested that this complex could have a possible role
in virion attachment (23). Earlier studies have clearly
shown that the gM-gN complex is abundantly expressed on the surface of
infectious virions and that in the presence of exogenous complement,
MAb 14-16A could very efficiently neutralize virus infectivity
(5). Thus, the function of the gM-gN complex in alpha and
gammaherpesvirus replication remains undefined, although recent studies
have indicated that in contrast to these groups of herpesviruses, the
glycoprotein complex containing gM is essential for HCMV
replication in vitro (15).
Previous studies by Gretch and colleagues described three
disulfide-linked complexes within the envelope of HCMV: gCI, gCII, and
gCIII (14). Reports from this and other laboratories
indicated that the gCI was composed of homodimers of gB and that gCIII
was composed of gH, gL, and gO (8, 16-18, 31). The
composition of gCII has remained undetermined, although it was
suggested that at least one component of this complex was gM
(26). The findings in the present study suggest that the
gM-gN complex was the HCMV gCII glycoprotein complex. The
migration of the several forms of the gCII complex in SDS-PAGE in both
the presence and absence of reducing agents was similar to the
migration of different forms of the gM-gN complex which are described
in this study (23, 25, 26). Of note was that several of the
previous studies failed to use solubilization and gel conditions which
could allow separation of the various forms of the gM-gN complex but
used heat to denature the immune complexes. Heating to 100°C has been shown to convert gM-gN complexes into insoluble aggregates, most of
which fail to enter the resolving gel under the conventional conditions
of SDS-PAGE (M. Mach and W. Britt, personal observations). As a result,
the initial description of some of the more slowly migrating components
of the gCII complex could represent an in vitro artifact consisting of
denatured aggregates of this complex. The use of MAb 14-16A to identify
native gM-gN complexes in virions has suggested that within the mature
particle, gM and gN formed a more limited number of complexes, of which
one was disulfide bonded. Finally, preliminary studies by Kari and
Gehrz using MAb 14-16A suggested that this MAb was reactive with the
protein complex described by these investigators as gCII (B. Kari,
personal communication). Thus, taken together, our data suggest that
the gCII complex of HCMV is composed of gM and gN.
Similar to what was noted in previous descriptions of the gM of HSV,
HCMV, and equine herpesvirus type 1, the HCMV gM-gN complex was highly
hydrophobic and aggregated readily when heated (3, 38). This biochemical property of the gM-gN complex delayed the characterization of this protein complex in other herpesviruses and, in the case of HCMV, initially led us to believe that this protein
complex represented a minor component of the virion envelope (5). By utilizing a denaturing SDS-PAGE system which
included urea and solubilization of immune complexes in 8 M urea at
room temperature, it was possible to separate the protein components of
the larger oligomers and aggregates of the gM-gN complex. Virions solubilized under these conditions allowed us to demonstrate that the
gM-gN complex was a relatively abundant component of the envelope of
purified virions, a finding which was also consistent with a
significant level of expression of the protein complex in infected cells. Analysis of virus-infected cells using MAb 14-16A and immune electron microscopy also indicated that the gM-gN complex was abundantly expressed on the surface of virions and infected cells (Britt, unpublished observations). In contrast to these findings, it
has been suggested that the EBV gM-gN complex can be solubilized as
well at 37°C as when the immunoprecipitated protein is heated to
100°C (29). It should be noted that these investigators
qualified their interpretation of these findings by suggesting that
under the specific experimental conditions used to study EBV gM-gN, it
was not possible to accurately quantify the amounts of soluble and
insoluble material (29). The gM of all herpesviruses thus far studied is a type III glycoprotein which contains
multiple, hydrophobic, membrane-spanning domains. These hydrophobic
domains likely contribute to the relative insolubility of the gM-gN
protein complex and the tendency towards aggregation following
denaturation. The lack of reactivity of MAb 14-16A for gN which was
present in heat-aggregated forms of the gM-gN complex further argues
that MAb 14-16A is specific for a conformational epitope present on mature, native forms of gN.
The structure of the carbohydrate modifications on HCMV gN remains to
be determined. Most likely the molecule carries a limited number of
N-linked and a large number of O-linked sugars, as indicated by (i) the
small decrease in size after digestion with endoglycosidase F; (ii) the
findings of Kari and Gehrz, who reported a large amount of O-linked
sugar modification of one of the proteins of the gCII complex
(21); and (iii) the presence of O-linked carbohydrates on gN
molecules from other herpesviruses (20, 29). It is
particularly interesting that this relatively small protein with a
predicted mass of 18 kDa contained well more than 30 kDa of
carbohydrate modifications, a characteristic consistent with the
observation that over one-third of the primary amino acid sequence was
either serine or threonine residues. The large amount of carbohydrate modifications present on HCMV gN was unique among herpesvirus gN and
greatly exceeded the quantity of carbohydrate present on other
herpesvirus gN molecules. The gNs of PRV and EBV appear to contain
approximately 7 to 8 kDa of carbohydrate modifications, amounts similar
to the predicted level of carbohydrate modifications of gN molecules
from other herpesviruses (20, 29). Interestingly, gNs from other herpesviruses have been reported to be nonglycosylated proteins (32). This difference between the structure of gN
of HCMV and the gNs of other herpesviruses was not reflected in the posttranslational modifications of HCMV gM. The gM of PRV has been
proposed to contain a single N-linked sugar modification (12). Our findings also suggest that HCMV gM contains a
single N-linked carbohydrate modification. The exact composition of the carbohydrate modifications on other herpesvirus gM molecules is unclear
because of the lack of reagents for characterization of these proteins;
however, the gM of EBV has been suggested to contain two predicted
N-linked glycosylation sites, of which at least one is used
(29). Thus, we can only speculate on the importance of the
extensive carbohydrate, likely O-linked, modifications of the gN
molecule of HCMV to the function of the HCMV gM-gN complex. However,
this finding could suggest a unique role for this
glycoprotein complex in the tissue and cell tropism of HCMV.
Complex formation between gM and gN likely occurred in the ER, based on
results from our imaging studies. When expressed by themselves, both gM
and gN remained localized to the ER and ERGIC. Coexpression of gN and
gM resulted in formation of a gM-gN complex that was distributed
throughout compartments of the cellular secretory pathway, as evidenced
by a signal overlap from antibodies directed against gN and gM.
Interestingly, MAb 14-16A recognized only a mature form of gN, perhaps
a form that had undergone terminal carbohydrate modifications. Although
biochemical evidence supporting this claim could not be obtained
because of the insensitivity of the mature gN to available
endoglycosidases, findings from imaging studies of cells transfected
with plasmids for both gM and gN provided convincing evidence for this
interpretation. Significant overlap was observed from signals from MAb
14-16A and markers for the TGN, and to a lesser extent, for the
Golgi. No overlap was observed with markers for the ER or ERGIC,
indicating that although gM-gN complexes were present in these
compartments, the epitope recognized by MAb 14-16A was not expressed by
gM-gN complexes localized to these compartments. Biochemical evidence
supporting this interpretation was provided by the finding that MAb
14-16A recognized a form of gN within virus-infected cells which
appeared to be identical to the gN present in extracellular virions.
Together with the findings that the epitope defined by MAb 14-16A was
expressed in the envelope of infectious virions, these results indicate that maturation of the gM-gN complex occurred in the distal
compartments of the secretory system. In agreement with this
interpretation is the recent finding that MAb 14-16A was reactive with
gN (previously designated gp65) localized to a cytoplasmic compartment
which is believed to be a site of virion assembly in HCMV-infected
cells (42). Thus, the demonstration that a mature form of gN
complexed with gM was localized exclusively to this compartment in
HCMV-infected cells was consistent with the hypothesis that this
cytoplasmic compartment was indeed a site of virion assembly and did
not merely represent a cytoplasmic accumulation of virion structural
proteins in various states of maturation.
Thus far, gB and gH have been identified as major targets for the
neutralizing humoral immune response in human sera. When recombinant gB
and gH were used in preadsorption experiments, between 0 and 98% (gB)
and 0 and 58% (gH) of the total neutralizing capacity could be removed
from human sera (7, 35, 36, 45). Thus, additional antigens
must contribute to the induction of neutralizing antibodies. In the
present study, more than 60% of human convalescent-phase sera
contained antibodies reactive with the gM-gN complex. The contribution
of antibodies directed against the individual glycoproteins
to this response is unknown. The seropositivity rate of approximately
30% for gM is probably accurate, since the isolated expression of gM
as a recombinant protein results in a polypeptide which carries
terminal modifications and likely adopts a near-native structure.
Therefore, this protein could be detected by gM-specific antibodies
produced following natural infection. The antigen recognized by
the additional 30% of sera when assayed against the gM-gN complex is
unclear. The likeliest possibility is that the processing and transport
of gN when complexed to gM expose antibody binding sites on gN which
are not expressed in the absence of gM. Since gN lacks significant
posttranslational modifications and likely native conformation when
expressed by itself, the seroreactivity rate of 6% in this serum panel
also likely reflects the requirements of terminal
carbohydrate modification and native folding for recognition of
gN. Antibodies specific for epitopes unique to the complex could also
contribute to the increased rate of seroreactivity for the gM-gN
complex. In any case, the gM-gN complex was identified in this study as
an additional major, antigen for the humoral immune response against
HCMV. The potential importance of this response has been suggested by
previous findings, which indicated that the majority of infected
newborns lack detectable antibodies against the gCII (gM-gN) complex,
whereas most adult convalescent-phase sera contain gCII-specific
antibodies (22).
In summary, we have identified the UL73 gene product of HCMV as gN. We
were able to demonstrate that the protein product of the UL73 gene is
processed and transported authentically only in the presence of the gM
protein and that it forms a disulfide-linked complex with gM. This
complex represents a major constituent of HCMV virions and is highly
immunogenic during natural infection. Future experiments will be
directed towards defining the functional and immunological properties
of the gM-gN complex.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the Deutsche
Forschungsgemeinschaft (MA 929/4-2), the Wilhelm Sander-Stiftung, and the National Institute of Allergy and Infectious Diseases, National Institutes of Health (AI35602).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Klinische und Molekulare Virologie, Universität
Erlangen-Nürnberg, Schlossgarten 4, 91054 Erlangen, Germany.
Phone: 49 9131 8522107. Fax: 49 9131 8522101. E-mail:
mlmach{at}viro.med.uni-erlangen.de.
 |
REFERENCES |
| 1.
|
Alford, C. A., and W. J. Britt.
1990.
Cytomegalovirus, p. 1981-2010.
In
B. N. Fields, and D. M. Knipe (ed.), Virology. Raven Press, Ltd., New York, N.Y.
|
| 2.
|
Baines, J. D., and B. Roizman.
1991.
The open reading frames UL3, UL4, UL10, and UL16 are dispensable for the replication of herpes simplex virus 1 in cell culture.
J. Virol.
65:938-944[Abstract/Free Full Text].
|
| 3.
|
Baines, J. D., and B. Roizman.
1993.
The UL10 gene of herpes simplex virus 1 encodes a novel viral glycoprotein, gM, which is present in the virion and in the plasma membrane of infected cells.
J. Virol.
67:1441-1452[Abstract/Free Full Text].
|
| 4.
|
Britt, W. J.
1984.
Neutralizing antibodies detect a disulfide-linked glycoprotein complex within the envelope of human cytomegalovirus.
Virology
135:369-378[CrossRef][Medline].
|
| 5.
|
Britt, W. J., and D. Auger.
1985.
Identification of a 65 000 dalton virion envelope protein of human cytomegalovirus.
Virus Res.
4:31-36[CrossRef][Medline].
|
| 6.
|
Britt, W. J., and D. Auger.
1986.
Synthesis and processing of the envelope gp55-116 complex of human cytomegalovirus.
J. Virol.
58:185-191[Abstract/Free Full Text].
|
| 7.
|
Britt, W. J.,
L. Vugler,
E. J. Butfiloski, and E. B. Stephens.
1990.
Cell surface expression of human cytomegalovirus (HCMV) gp55-116 (gB): use of HCMV-recombinant vaccinia virus-infected cells in analysis of the human neutralizing antibody response.
J. Virol.
64:1079-1085[Abstract/Free Full Text].
|
| 8.
|
Britt, W. J., and L. G. Vugler.
1992.
Oligomerization of the human cytomegalovirus major envelope glycoprotein complex gB (gp55-116).
J. Virol.
66:6747-6754[Abstract/Free Full Text].
|
| 9.
|
Cha, T. A.,
E. Tom,
G. W. Kemble,
G. M. Duke,
E. S. Mocarski, and R. R. Spaete.
1996.
Human cytomegalovirus clinical isolates carry at least 19 genes not found in laboratory strains.
J. Virol.
70:78-83[Abstract].
|
| 10.
|
Chee, M. S.,
A. T. Bankier,
S. Beck,
R. Bohni,
C. M. Brown,
R. Cerny,
T. Horsnell,
C. A. Hutchison,
T. Kouzarides,
J. A. Martignetti, et al.
1990.
Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169.
Curr. Top. Microbiol. Immunol.
154:125-169[Medline].
|
| 11.
|
Dijkstra, J. M.,
V. Gerdts,
B. G. Klupp, and T. C. Mettenleiter.
1997.
Deletion of glycoprotein gM of pseudorabies virus results in attenuation for the natural host.
J. Gen. Virol.
78:2147-2151[Abstract].
|
| 12.
|
Dijkstra, J. M.,
N. Visser,
T. C. Mettenleiter, and B. G. Klupp.
1996.
Identification and characterization of pseudorabies virus glycoprotein gM as a nonessential virion component.
J. Virol.
70:5684-5688[Abstract/Free Full Text].
|
| 13.
|
Ellinger, S.,
M. Mach,
K. Korn, and G. Jahn.
1991.
Cleavage and purification of prokaryotically expressed HIV gag and env fusion proteins for detection of HIV antibodies in the ELISA.
Virology
180:811-813[CrossRef][Medline].
|
| 14.
|
Gretch, D. R.,
B. Kari,
L. Rasmussen,
R. C. Gehrz, and M. F. Stinski.
1988.
Identification and characterization of three distinct families of glycoprotein complexes in the envelopes of human cytomegalovirus.
J. Virol.
62:875-881[Abstract/Free Full Text].
|
| 15.
|
Hobom, U.,
W. Brune,
M. Messerle,
G. Hahn, and U. Koszinowski.
2000.
Fast screening procedures for random transposon libraries of cloned herpesvirus genomes: mutational analysis of human cytomegalovirus envelope glycoprotein genes.
J. Virol.
74:7720-7729[Abstract/Free Full Text].
|
| 16.
|
Huber, M. T., and T. Compton.
1997.
Characterization of a novel third member of the human cytomegalovirus glycoprotein H-glycoprotein L complex.
J. Virol.
71:5391-5398[Abstract].
|
| 17.
|
Huber, M. T., and T. Compton.
1998.
The human cytomegalovirus UL74 gene encodes the third component of the glycoprotein H-glycoprotein L-containing envelope complex.
J. Virol.
72:8191-8197[Abstract/Free Full Text].
|
| 18.
|
Huber, M. T., and T. Compton.
1999.
Intracellular formation and processing of the heterotrimeric gH-gL-gO (gCIII) glycoprotein envelope complex of human cytomegalovirus.
J. Virol.
73:3886-3892[Abstract/Free Full Text].
|
| 19.
|
Jons, A.,
J. M. Dijkstra, and T. C. Mettenleiter.
1998.
Glycoproteins M and N of pseudorabies virus form a disulfide-linked complex.
J. Virol.
72:550-557[Abstract/Free Full Text].
|
| 20.
|
Jons, A.,
H. Granzow,
R. Kuchling, and T. C. Mettenleiter.
1996.
The UL49.5 gene of pseudorabies virus codes for an O-glycosylated structural protein of the viral envelope.
J. Virol.
70:1237-1241[Abstract].
|
| 21.
|
Kari, B., and R. Gehrz.
1988.
Isolation and characterization of a human cytomegalovirus glycoprotein containing a high content of O-linked oligosaccharides.
Arch. Virol.
98:171-188[CrossRef][Medline].
|
| 22.
|
Kari, B., and R. Gehrz.
1990.
Analysis of human antibody responses to human cytomegalovirus envelope glycoproteins found in two families of disulfide linked glycoprotein complexes designated gC-I and gC-II.
Arch. Virol.
114:213-228[CrossRef][Medline].
|
| 23.
|
Kari, B., and R. Gehrz.
1992.
A human cytomegalovirus glycoprotein complex designated gC-II is a major heparin-binding component of the envelope.
J. Virol.
66:1761-1764[Abstract/Free Full Text].
|
| 24.
|
Kari, B., and R. Gehrz.
1993.
Structure, composition and heparin binding properties of a human cytomegalovirus glycoprotein complex designated gC-II.
J. Gen. Virol.
74:255-264[Abstract/Free Full Text].
|
| 25.
|
Kari, B.,
R. Goertz, and R. Gehrz.
1990.
Characterization of cytomegalovirus glycoproteins in a family of complexes designated gC-II with murine monoclonal antibodies.
Arch. Virol.
112:55-65[CrossRef][Medline].
|
| 26.
|
Kari, B.,
W. Li,
J. Cooper,
R. Goertz, and B. Radeke.
1994.
The human cytomegalovirus UL100 gene encodes the gC-II glycoproteins recognized by group 2 monoclonal antibodies.
J. Gen. Virol.
75:3081-3086[Abstract/Free Full Text].
|
| 27.
|
Kari, B.,
R. Radeke, and R. Gehrz.
1992.
Processing of human cytomegalovirus envelope glycoproteins in and egress of cytomegalovirus from human astrocytoma cells.
J. Gen. Virol.
73:253-260[Abstract/Free Full Text].
|
| 28.
|
Klupp, B. G.,
R. Nixdorf, and T. C. Mettenleiter.
2000.
Pseudorabies virus glycoprotein M inhibits membrane fusion.
J. Virol.
74:6760-6768[Abstract/Free Full Text].
|
| 29.
|
Lake, C. M.,
S. J. Molesworth, and L. M. Hutt-Fletcher.
1998.
The Epstein-Barr virus (EBV) gN homolog BLRF1 encodes a 15-kilodalton glycoprotein that cannot be authentically processed unless it is coexpressed with the EBV gM homolog BBRF3.
J. Virol.
72:5559-5564[Abstract/Free Full Text].
|
| 30.
|
Lehner, R.,
H. Meyer, and M. Mach.
1989.
Identification and characterization of a human cytomegalovirus gene coding for a membrane protein that is conserved among human herpesviruses.
J. Virol.
63:3792-3800[Abstract/Free Full Text].
|
| 31.
|
Li, L.,
J. A. Nelson, and W. J. Britt.
1997.
Glycoprotein H-related complexes of human cytomegalovirus: identification of a third protein in the gCIII complex.
J. Virol.
71:3090-3097[Abstract].
|
| 32.
|
Liang, X.,
B. Chow,
C. Raggo, and L. A. Babiuk.
1996.
Bovine herpesvirus 1 UL49.5 homolog gene encodes a novel viral envelope protein that forms a disulfide-linked complex with a second virion structural protein.
J. Virol.
70:1448-1454[Abstract].
|
| 33.
|
Liang, X.,
M. Tang,
B. Manns,
L. A. Babiuk, and T. J. Zamb.
1993.
Identification and deletion mutagenesis of the bovine herpesvirus 1 dUTPase gene and a gene homologous to herpes simplex virus UL49.5.
Virology
195:42-50[CrossRef][Medline].
|
| 34.
|
MacLean, C. A.,
L. M. Robertson, and F. E. Jamieson.
1993.
Characterization of the UL10 gene product of herpes simplex virus type 1 and investigation of its role in vivo.
J. Gen. Virol.
74:975-983[Abstract/Free Full Text].
|
| 35.
|
Marshall, G. S.,
G. P. Rabalais,
G. G. Stout, and S. L. Waldeyer.
1992.
Antibodies to recombinant-derived glycoprotein B after natural human cytomegalovirus infection correlate with neutralizing activity.
J. Infect. Dis.
165:381-384[Medline].
|
| 36.
|
Marshall, G. S.,
G. G. Stout,
M. E. Knights,
G. P. Rabalais,
R. Ashley,
H. Miller, and E. Rossier.
1994.
Ontogeny of glycoprotein gB-specific antibody and neutralizing activity during natural cytomegalovirus infection.
J. Med. Virol.
43:77-83[Medline].
|
| 37.
|
Masse, M. J.,
A. Jons,
J. M. Dijkstra,
T. C. Mettenleiter, and A. Flamand.
1999.
Glycoproteins gM and gN of pseudorabies virus are dispensable for viral penetration and propagation in the nervous systems of adult mice.
J. Virol.
73:10503-10507[Abstract/Free Full Text].
|
| 38.
|
Osterrieder, N.,
A. Neubauer,
C. Brandmuller,
B. Braun,
O. R. Kaaden, and J. D. Baines.
1996.
The equine herpesvirus 1 glycoprotein gp21/22a, the herpes simplex virus type 1 gM homolog, is involved in virus penetration and cell-to-cell spread of virions.
J. Virol.
70:4110-4115[Abstract].
|
| 39.
|
Osterrieder, N.,
A. Neubauer,
B. Fakler,
C. Brandmuller,
C. Seyboldt,
O. R. Kaaden, and J. D. Baines.
1997.
Synthesis and processing of the equine herpesvirus 1 glycoprotein M.
Virology
232:230-239[CrossRef][Medline].
|
| 40.
|
Pilling, A.,
A. J. Davison,
E. A. Telford, and D. M. Meredith.
1994.
The equine herpesvirus type 1 glycoprotein homologous to herpes simplex virus type 1 glycoprotein M is a major constituent of the virus particle.
J. Gen. Virol.
75:439-442[Abstract/Free Full Text].
|
| 41.
|
Ross, J.,
M. Williams, and J. I. Cohen.
1997.
Disruption of the varicella-zoster virus dUTPase and the adjacent ORF9A gene results in impaired growth and reduced syncytia formation in vitro.
Virology
234:186-195[CrossRef][Medline].
|
| 42.
|
Sanchez, V.,
K. D. Greis,
E. Sztul, and W. J. Britt.
2000.
Accumulation of virion tegument and envelope proteins in a stable cytoplasmic compartment during human cytomegalovirus replication: characterization of a potential site of virus assembly.
J. Virol.
74:975-986[Abstract/Free Full Text].
|
| 43.
|
Schoppel, K.,
E. Hassfurther,
W. J. Britt,
M. Ohlin,
C. A. Borrebaeck, and M. Mach.
1996.
Antibodies specific for the antigenic domain 1 (AD-1) of glycoprotein B (gpUL55) of human cytomegalovirus bind to different substructures.
Virology
216:133-145[CrossRef][Medline].
|
| 44.
|
Talbot, P., and J. D. Almeida.
1977.
Human cytomegalovirus: purification of enveloped virions and dense bodies.
J. Gen. Virol.
36:345-349[Abstract/Free Full Text].
|
| 45.
|
Urban, M.,
M. Klein,
W. J. Britt,
E. Hassfurther, and M. Mach.
1996.
Glycoprotein H of human cytomegalovirus is a major antigen for the neutralizing humoral immune response.
J. Gen. Virol.
77:1537-1547[Abstract/Free Full Text].
|
| 46.
|
Wu, S. X.,
X. P. Zhu, and G. J. Letchworth.
1998.
Bovine herpesvirus 1 glycoprotein M forms a disulfide-linked heterodimer with the UL49.5 protein.
J. Virol.
72:3029-3036[Abstract/Free Full Text].
|
Journal of Virology, December 2000, p. 11881-11892, Vol. 74, No. 24
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Burkhardt, C., Himmelein, S., Britt, W., Winkler, T., Mach, M.
(2009). Glycoprotein N subtypes of human cytomegalovirus induce a strain-specific antibody response during natural infection. J. Gen. Virol.
90: 1951-1961
[Abstract]
[Full Text]
-
Leege, T., Fuchs, W., Granzow, H., Kopp, M., Klupp, B. G., Mettenleiter, T. C.
(2009). Effects of Simultaneous Deletion of pUL11 and Glycoprotein M on Virion Maturation of Herpes Simplex Virus Type 1. J. Virol.
83: 896-907
[Abstract]
[Full Text]
-
Yamagishi, Y., Sadaoka, T., Yoshii, H., Somboonthum, P., Imazawa, T., Nagaike, K., Ozono, K., Yamanishi, K., Mori, Y.
(2008). Varicella-Zoster Virus Glycoprotein M Homolog Is Glycosylated, Is Expressed on the Viral Envelope, and Functions in Virus Cell-to-Cell Spread. J. Virol.
82: 795-804
[Abstract]
[Full Text]
-
Patrone, M., Secchi, M., Bonaparte, E., Milanesi, G., Gallina, A.
(2007). Cytomegalovirus UL131-128 Products Promote gB Conformational Transition and gB-gH Interaction during Entry into Endothelial Cells. J. Virol.
81: 11479-11488
[Abstract]
[Full Text]
-
Krzyzaniak, M., Mach, M., Britt, W. J.
(2007). The Cytoplasmic Tail of Glycoprotein M (gpUL100) Expresses Trafficking Signals Required for Human Cytomegalovirus Assembly and Replication. J. Virol.
81: 10316-10328
[Abstract]
[Full Text]
-
Mach, M., Osinski, K., Kropff, B., Schloetzer-Schrehardt, U., Krzyzaniak, M., Britt, W.
(2007). The Carboxy-Terminal Domain of Glycoprotein N of Human Cytomegalovirus Is Required for Virion Morphogenesis. J. Virol.
81: 5212-5224
[Abstract]
[Full Text]
-
Baines, J. D., Wills, E., Jacob, R. J., Pennington, J., Roizman, B.
(2007). Glycoprotein M of Herpes Simplex Virus 1 Is Incorporated into Virions during Budding at the Inner Nuclear Membrane. J. Virol.
81: 800-812
[Abstract]
[Full Text]
-
Lipinska, A. D., Koppers-Lalic, D., Rychlowski, M., Admiraal, P., Rijsewijk, F. A. M., Bienkowska-Szewczyk, K., Wiertz, E. J. H. J.
(2006). Bovine Herpesvirus 1 UL49.5 Protein Inhibits the Transporter Associated with Antigen Processing despite Complex Formation with Glycoprotein M.. J. Virol.
80: 5822-5832
[Abstract]
[Full Text]
-
Shimamura, M., Mach, M., Britt, W. J.
(2006). Human Cytomegalovirus Infection Elicits a Glycoprotein M (gM)/gN-Specific Virus-Neutralizing Antibody Response. J. Virol.
80: 4591-4600
[Abstract]
[Full Text]
-
Wang, D., Shenk, T.
(2005). Human cytomegalovirus virion protein complex required for epithelial and endothelial cell tropism. Proc. Natl. Acad. Sci. USA
102: 18153-18158
[Abstract]
[Full Text]
-
Spaderna, S., Kropff, B., Kodel, Y., Shen, S., Coley, S., Lu, S., Britt, W., Mach, M.
(2005). Deletion of gpUL132, a Structural Component of Human Cytomegalovirus, Results in Impaired Virus Replication in Fibroblasts. J. Virol.
79: 11837-11847
[Abstract]
[Full Text]
-
Pomeranz, L. E., Reynolds, A. E., Hengartner, C. J.
(2005). Molecular Biology of Pseudorabies Virus: Impact on Neurovirology and Veterinary Medicine. Microbiol. Mol. Biol. Rev.
69: 462-500
[Abstract]
[Full Text]
-
May, J. S., Colaco, S., Stevenson, P. G.
(2005). Glycoprotein M Is an Essential Lytic Replication Protein of the Murine Gammaherpesvirus 68. J. Virol.
79: 3459-3467
[Abstract]
[Full Text]
-
Mach, M., Kropff, B., Kryzaniak, M., Britt, W.
(2005). Complex Formation by Glycoproteins M and N of Human Cytomegalovirus: Structural and Functional Aspects. J. Virol.
79: 2160-2170
[Abstract]
[Full Text]
-
Ziegler, C., Just, F. T., Lischewski, A., Elbers, K., Neubauer, A.
(2005). A glycoprotein M-deleted equid herpesvirus 4 is severely impaired in virus egress and cell-to-cell spread. J. Gen. Virol.
86: 11-21
[Abstract]
[Full Text]
-
Crump, C. M., Bruun, B., Bell, S., Pomeranz, L. E., Minson, T., Browne, H. M.
(2004). Alphaherpesvirus glycoprotein M causes the relocalization of plasma membrane proteins. J. Gen. Virol.
85: 3517-3527
[Abstract]
[Full Text]
-
Varnum, S. M., Streblow, D. N., Monroe, M. E., Smith, P., Auberry, K. J., Pasa-Tolic, L., Wang, D., Camp, D. G. II, Rodland, K., Wiley, S., Britt, W., Shenk, T., Smith, R. D., Nelson, J. A.
(2004). Identification of Proteins in Human Cytomegalovirus (HCMV) Particles: the HCMV Proteome. J. Virol.
78: 10960-10966
[Abstract]
[Full Text]
-
Browne, H., Bell, S., Minson, T.
(2004). Analysis of the Requirement for Glycoprotein M in Herpes Simplex Virus Type 1 Morphogenesis. J. Virol.
78: 1039-1041
[Abstract]
[Full Text]
-
Koyano, S., Mar, E.-C., Stamey, F. R., Inoue, N.
(2003). Glycoproteins M and N of human herpesvirus 8 form a complex and inhibit cell fusion. J. Gen. Virol.
84: 1485-1491
[Abstract]
[Full Text]
-
Pignatelli, S., Dal Monte, P., Rossini, G., Chou, S., Gojobori, T., Hanada, K., Guo, J. J., Rawlinson, W., Britt, W., Mach, M., Landini, M. P.
(2003). Human cytomegalovirus glycoprotein N (gpUL73-gN) genomic variants: identification of a novel subgroup, geographical distribution and evidence of positive selective pressure. J. Gen. Virol.
84: 647-655
[Abstract]
[Full Text]
-
Liu, Y., Biegalke, B. J.
(2002). The Human Cytomegalovirus UL35 Gene Encodes Two Proteins with Different Functions. J. Virol.
76: 2460-2468
[Abstract]
[Full Text]
-
Theiler, R. N., Compton, T.
(2002). Distinct Glycoprotein O Complexes Arise in a Post-Golgi Compartment of Cytomegalovirus-Infected Cells. J. Virol.
76: 2890-2898
[Abstract]
[Full Text]
-
Rudolph, J., Seyboldt, C., Granzow, H., Osterrieder, N.
(2002). The Gene 10 (UL49.5) Product of Equine Herpesvirus 1 Is Necessary and Sufficient for Functional Processing of Glycoprotein M. J. Virol.
76: 2952-2963
[Abstract]
[Full Text]
-
Spaderna, S., Blessing, H., Bogner, E., Britt, W., Mach, M.
(2002). Identification of Glycoprotein gpTRL10 as a Structural Component of Human Cytomegalovirus. J. Virol.
76: 1450-1460
[Abstract]
[Full Text]
-
Pignatelli, S., Dal Monte, P., Landini, M. P.
(2001). gpUL73 (gN) genomic variants of human cytomegalovirus isolates are clustered into four distinct genotypes. J. Gen. Virol.
82: 2777-2784
[Abstract]
[Full Text]