INTRODUCTION

Top Abstract Introduction Materials and Methods Results and Discussion References

Drosophila S2 cells have been proven to be a useful experimental system for a high level of protein expression (23). In particular, previous studies have shown that protein processing, such as glycosylation (2, 25, 36, 41) and amidation (27), in S2 cells is basically similar to that in mammalian cells. Thus, S2 cells provide an attractive alternative for mammalian recombinant protein expression. S2 cells have also been used to express and study recombinant proteins, including cell adhesion molecules (3), oncogenes (14, 21), antibodies (22), receptors (13, 20, 29, 41), transcription factors (10, 38), and viral antigens (6, 7). In most cases, the test proteins were reliably processed and biologically active. Up until now, there has been a major restraint in using S2 cells for protein expression, i.e., the low transfection efficiency attained by various standard DNA transfection methods (17, 18). Therefore, it is gratifying to introduce a far more efficient and expeditious method that delivers target genes into S2 cells.

Baculovirus is one of the most powerful vehicles for foreign gene expression at extremely high levels. In nature, baculovirus only replicates in insect (lepidopteran) host cells and was considered to be nonpermissive in other insect cells (such as Drosophila cell lines) (35). Nevertheless, Miller and colleagues demonstrated that baculovirus could in deed be used to transduce Drosophila DL-1 and DM cells under well-specified laboratory conditions (8, 30, 35, 37). It was also found that foreign gene expression in other nonpermissive cells (including insect and mammalian cells) is promoter dependent and that the polyhedrin (PH) promoter of baculovirus has little or no activity in these cell lines (4, 8, 19, 30, 31). Of special note was the application of recombinant baculovirus with mammalian expression cassettes in the delivery and expression of foreign genes in such mammalian cell lines as HeLa, CHO, BHK, and COS-7 (4, 9, 19, 39, 42). Accordingly, we explored the possibility of utilizing recombinant baculovirus as a gene delivery vehicle for target gene expression in the widely employed Drosophila S2 cells, whose genetic background is well understood.

Here we describe a baculovirus-mediated gene expression system in Drosophila S2 cells which we call the "baculovirus-S2 system". This system provides several advantages over the classical baculovirus system in lepidopteran host cells. First, the baculovirus-S2 system does not cause cell lysis after S2 cells are infected with virus, and the protein expression level in S2 cells is comparable with that in Sf9, Sf21, and High Five cells. Thus, the baculovirus-S2 system provides a valuable alternative for large-scale protein production. Second, baculovirus can be successively used to deliver multiple exogenous genes into S2 cells. Third, this system can be incorporated into the method (12) used in viral plaque screening and viral titer determination using enhanced green fluorescent protein (EGFP) as a visible marker. Our findings significantly expand the applications of Drosophila S2 cells for protein expression and genetic studies.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results and Discussion References

Construction and production of recombinant baculoviruses. All viruses utilized were constructed by using shuttle vectors derived from pBacPAK8 (Clontech). pBacEGFP (Fig. 1A) was constructed by cloning an EGFP PCR product into pBacPAK8 using BamHI and PacI sites. The EGFP fragment was PCR amplified from pEGFP-1 (Clontech) with primers 5'-CAGGATCCGCCACCATGGTGAGCAAGGGCG-3' and 5'-AGCAATTAATTAATGAACATGTCGAGCAGGTAC-3'. The constructs of pBacEGFP/hsp70, pBacEGFP/actin 5C, and pBacEGFP/MT were derived from pBacEGFP through cloning PCR fragments of Drosophila heat shock protein 70 (hsp70), actin 5C, and metallotheionein (MT) promoters in combination with simian virus 40 polyadenylation sequences from pUAST (5), pAc5.1/V5/HisA, and pMT/V5/HisA (Invitrogen) into the EcoRV site. These promoters were located next to the baculovirus PH promoter, but in the opposite direction. For the convenience of assay, the second EGFP was cloned into pBacEGFP/hsp70, pBacEGFP/actin 5C, and pBacEGFP/MT at EcoRI and NotI sites as the foreign target gene. The resulting constructs were named pBacEGFP/hsp70 EGFP, pBacEGFP/actin 5C EGFP, and pBacEGFP/MT EGFP, respectively (Fig. 1B, C, and D). EGFP under the control of the PH promoter was used as a selection marker for plaque selection and virus titer assay. The vector pBacEGFP/hsp70 ena, which contains ena (encoding an Abl kinase substrate) as the target gene was cut from pPAC ena (21) and inserted into the NotI site of pBac EGFP/hsp70. Another target gene, HA-dok (another kinase substrate of Abl), was also constructed into NotI site of pBacEGFP/hsp70. The pBacEGFP/hsp70 His-EGFP was constructed by cloning His-EGFP PCR product into pBacEGFP/hsp70 using EcoRI and NotI sites. The His-EGFP fragment was PCR amplified from pEGFP-1 with primers 5'-CAGGAAT TCCCACCATGCATCATCACCATCACCATGTGAGCAAGGGCG - 3' and 5'-AGCGCGGCCGCAATGAACATGTCGAGCAGGTAC-3'. The vector pBacEGFP/hsp70 HA-dcdc2 was constructed by cutting dcdc2 (Drosophila cdc2) from pPAC HA-dcdc2 and inserted into the XbaI site of pBacEGFP/MT. The vector pBacEGFP/hsp70 DsRed was engineered to carry a red fluorescent target gene DsRed from pDsRed-N1 (Clontech). Recombinant viruses were generated by using standard protocols of the BacPAK system (Clontech).

View larger version (23K): [in this window] [in a new window]   FIG. 1.   Maps of the transfer vectors for constructing recombinant baculoviruses (detailed construct information described in text). (A) pBacEGFP. (B) pBacEGFP/hsp70 EGFP. (C) pBacEGFP/actin 5C EGFP. (D) pBacEGFP/MT EGFP. The PH promoter-driven EGFP selection marker was used to isolate a single virus plaque for amplification and to determine the virus titer.

Cell culture. S2 cells were maintained at 23.5°C in a modified M3 medium supplemented with 10% fetal bovine serum (Life Technologies). Spodoptera frugiperda (fall armyworm) Sf21 and Sf9 cells were maintained at 27°C in Grace's medium (Life Technologies) with 10% fetal bovine serum (Life Technologies). High Five cells were maintained at 27°C in High Five cell culture medium (Invitrogen).

Infection of S2 cells by recombinant baculovirus. S2 cells were seeded in 24-well culture dishes at 10⁶ cells per well. Culture medium was removed and replaced with virus inoculum at the indicated multiplicities of infection (MOIs), and S2 cells were incubated with 40 rpm shaking for 1 h at room temperature. After removal of the virus, fresh medium was added, and S2 cells were incubated at 23.5°C. For Western blot analysis, cell pellets were added with sample buffer, boiled, and analyzed by polyacrylamide gels under denaturing and reducing conditions. Proteins were transferred to Immobilon-P transfer membranes (Millipore) by Semidrier (Bio-Rad) and immunoblotted by standard protocols. EGFP was detected by the Living Colors Peptide Antibody (Clontech). Hemagglutinin (HA) epitope was detected by HA monoclonal antibody (BAbCO). His tag was detected by His tag monoclonal antibody (Clontech). Ena was detected by Ena monoclonal antibody (21).

Flow cytometry. Infected S2 cells were collected, washed, and resuspended in phosphate-buffered saline (PBS). Data collection was performed on a Becton Dickinson FACSCalibur flow cytometer. EGFP was used as a reporter gene to assess transfection efficiencies and relative protein expression levels. To quantitate the relative EGFP expressions of infected S2 cells, the LinearFlow Green Flow Cytometry Intensity Calibration Kit (Molecular Probes, Ltd.) was used to calibrate the EGFP intensity. The fluorescence intensity standard was generated by six precisely determined intensity level of fluorescent microspheres. Six suspensions of fluorescent polystyrene microspheres were mixed in PBS and excited in a flow cytometer with a 488-nm excitation. These microspheres were used for calibrating the FL1 channel of a flow cytometer and as reference standards. Relative EGFP expression values were estimated by intrapolation from the linear fluorescence intensity standard.

Confocal microscopy. S2 cells were infected with BacEGFP/hsp70 EGFP at MOIs of 1, 10, 100, and 200. At 36 h postinfection, cells were harvested and plated on polylysin-coated glass slides for 30 min. Cells were washed twice with PBS, covered with cover slips, and sealed by using mounting medium. EGFP expressions were detected by a Leica TCS NT confocal microscope.

Relative protein quantification assay. Cells were seeded at different densities in six-well dishes with 1 × 10⁶ S2 cells and 2 × 10⁵ cells of Sf9, Sf21, and High Five to make up for the cell size difference (S2 cells were about one-fifth of the volume of Sf or High Five cells) for the optimal virus infection and culturing conditions. S2 cells were infected by BacEGFP/hsp70 EGFP with an MOI of 100 PFU per cell and incubated for 36 h until assay. The same titer of BacEGFP was used to infect Sf9, Sf21, and High Five cells and then incubated for 72 h. At the indicated postinfection times, cells were harvested, washed twice with PBS, and lysed on ice for 30 min in 1 ml of cold lysis buffer. Protease inhibitors (100 µM N-acetyl-L-leucinyl-L-leucinyl-methioninal, 100 µM N-acetyl-L-leucinyl-L-leucinyl-norleucinal, 100 µM ALLN, 1 mM pefabloc, and 1 µg of pepstatin, 1 µg of aprotinin, and 1 µg of leupeptin per ml) were added into the lysis buffer. Total proteins of individual cell types were quantified by DC Protein Assay (Bio-Rad). Cell lysates of equal amount of total protein from different cell lines were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis. Proteins were transferred to nitrocellulose membranes and immunoblotted by using Living Colors Peptide Antibody against EGFP. Relative EGFP protein of each cell extract was quantified by using a FLA-2000 phosphorimager (Fujifilm). The experimental means were obtained by averaging data from three independent experiments.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials and Methods Results and Discussion References

Baculovirus-mediated gene expression in S2 cells. Autographa californica nuclear polyhedrosis virus (AcNPV) is currently the most commonly used baculovirus for foreign gene expression. To examine if AcNPV is able to deliver an effective gene expression cassette into S2 cells, we constructed recombinant baculoviruses coding for EGFP under the control of four different promoters. One (pBacEGFP) was derived from the baculovirus PH promoter and three (pBacEGFP/hsp70, pBacEGFP/actin 5C, and pBacEGFP/MT) were obtained from the Drosophila hsp70, actin 5C, and MT promoters, respectively (Fig. 1). Gene expression levels by the four recombinant baculoviruses were examined at 36 h postinfection. Western blots of cell extracts were probed with antibody directed against EGFP. When S2 cells were mock infected or infected with BacEGFP, no EGFP expression could be detected (Fig. 2A, lanes 1 and 2). Expression of EGFP could only be observed in S2 cells infected with baculovirus containing Drosophila promoters (hsp70, actin 5C, and MT) (Fig. 2A, lanes 3, 4, and 5). These results support previous studies that the virus PH promoter is functionally restrained in nonpermissive cells (8, 37). Thus, baculovirus-mediated gene expression in S2 cells is also promoter dependent. Our data suggest that modified recombinant baculovirus containing a Drosophila expression cassette can transduce gene expression in S2 cells.

View larger version (22K): [in this window] [in a new window]   FIG. 2.   Susceptibility of Drosophila S2 cells to baculovirus-mediated foreign gene transduction. (A) Western blot analysis of EGFP expression in S2 cells at 36 h postinfection. Lane 1, uninfected cells; lane 2, cells infected with BacEGFP (with PH promoter), showing no EGFP expression; lanes 3 and lane 4, cells infected with BacEGFP/hsp70 EGFP and BacEGFP/actin 5C EGFP, respectively: lane 5, S2 cells infected with recombinant virus BacEGFP/MT EGFP, and EGFP expression was induced by 1 mM CuSO4 at 24 h postinfection. (B) Efficacy of EGFP expression by these promoters as analyzed by flow cytometry (the EGFP quantification method is described in detail in the text). Results are the averages of three independent infections.

Plaque selection by a fluorescent marker. GFP has been used as a tool for screening recombinant baculoviruses in Sf9 cells (12, 33). Taking advantage of the promoter-dependent phenomenon that virus PH promoter is active in Sf21 cells but not in S2 cells, we constructed EGFP under the control of the PH promoter as a visible selection marker for virus plaque assay in Sf21 cells. To investigate the use of EGFP for recombinant virus selection, a gene called ena that encodes a kinase substrate that is phosphorylated by the Abl proto-oncogene found in mammalian and Drosophila cells (14, 21) was cloned under the hsp70 promoter into a vector with EGFP under the PH promoter. After cotransfection of Sf21 cells, fluorescent plaques were selected and characterized to identify those expressing Ena. The resulting recombinant baculovirus was then used to infect S2 cells for exogenous gene expression. While the autofluorescent signal of the EGFP marker was below the detection level in S2 cells (Fig. 3Ab), the exogenous gene expression of Ena was detected by antibody directed against Ena (Fig. 3Ac). The finding that the selection marker was only expressed in Sf9 and Sf21 cells but not in S2 cells eliminates the possible competition and interference with the target gene expression in S2 cells. This design also excludes the possibility of target gene mutation from the traditional chemical plaque selection procedure by neutral red in Sf21 cells (26).

View larger version (68K): [in this window] [in a new window]   FIG. 3.   Confocal microscopic analysis of the gene expression and the infection efficiency. (A) Confocal microscopic analysis of EGFP selection marker and target gene (ena) expression in the baculovirus-S2 system. Mid-exponentially grown S2 cells (106 cells/well) were seeded into a 24-well petri dish and exposed to an MOI for BacEGFP/hsp70 ena of 100. At 36 h postinfection, cells were harvested, attached to poly-L-lysine coated slides, stained with anti-Ena polyclonal antibody, and then analyzed by confocal microscopy (Leica TCS NT). (Aa) Phase image of BacEGFP/hsp70 ena-infected S2 cells. (Ab). No detectable EGFP signal in S2 cells. (Ac) Ena protein detected in S2 cells by immunocytochemistry with polyclonal antibody directed against Ena. (B) Confocal microscopy analysis of the dose-response infection efficiency. S2 cells transduced with BacEGFP/hsp70 EGFP at the indicated MOIs were examined by confocal microscopy to determine infection efficiencies.

High infection efficiency and gene expression levels. The results described above show the capability of baculovirus as a vehicle for gene delivery and expression in Drosophila S2 cells. Previous researchers observed that the MOI is critical in achieving baculovirus-mediated protein expression in mammalian cells (9). The optimal virus MOI for the highest infection efficiency in S2 cells was examined. S2 cells were transduced with an increasing titer of BacEGFP/hsp70 EGFP viruses. At 36 h postinfection, the infection efficiency was examined by confocal microscopy (Fig. 3B). For accurate calculation, infection efficiency was determined by flow cytometry studies. At an MOI of 1 PFU per cell, approximately 17% of the cells showed EGFP expression. The "infection efficiency" increased steadily with higher MOIs (39, 51, 73, and 85% for MOIs of 5, 10, 25, and 50, respectively) and reached close to 100% at an MOI of 100. Therefore, the infection efficiency of S2 cell is virus dose dependent at from 1 to 100 MOI. However, at an MOI of from 100 to 800, the infection efficiency remained optimal.

Nonlytic system for S2 cells. In the classical baculovirus system, lepidopteran cells such as Sf9, Sf21, and High Five cells undergo a lytic cycle after virus infection. Such a lethal viral infection in cells might trigger the cellular protein processing machinery to deteriorate several days postinfection. This event might lead to improper posttranscriptional and/or posttranslational modifications of gene products. To investigate whether S2 cells are destined for the same lytic pathway, S2 cells were exposed to the BacEGFP/hsp70 EGFP virus at various MOIs, and viabilities were determined by trypan blue exclusion assay. The percent viabilities of S2 cells transduced with BacEGFP/hsp70 EGFP baculovirus at various MOIs were as follows (MOI, percent viability [mean ± standard deviation]): 1, 99.2 ± 0.4; 5, 98.6 ± 0.2; 10, 96.2 ± 0.5; 25, 95.2 ± 0.7; 50, 95.5 ± 0.3; 100, 93.1 ± 0.7; 200, 94.6 ± 0.5; 400, 93.2 ± 0.6; and 800, 95.8 ± 0.4. The viability of the infected S2 cells was determined by staining the cells with 0.4% trypan blue solution (Sigma) at 72 h postinfection. These results are the averages of three independent experiments. The result indicates that there are no apparent cytopathic effects on S2 cells by 72-h postinfection, even at an MOI of 800. Thus, this expression system does not include the lytic cycle of baculovirus.

Comparable protein expression levels in S2 versus that in lepidopteran cells. Baculovirus has been proven to be a powerful tool for evoking a high level of heterologous protein production in eukaryotic cells. To compare the relative potency of protein expressions by different baculovirus systems, EGFP protein expression from S2, Sf9, Sf21, and High Five cells were examined by Western blot analysis. EGFP proteins were quantified by phosphorimager analysis, and the relative yields of EGFP protein from the same amount of total protein in different cell lines were calculated. The relative EGFP protein (3.32 U) expressed from S2 cells is substantially higher than that from Sf9 (1 U) and Sf21 (1.85 U) cells and is comparable with that in High Five cells (4.17 U) (Fig. 4). The baculovirus expression system is known to express exogenous proteins at levels ranging from 1 to 500 mg/liter (34). To determine the absolute level of the EGFP expression by the baculovirus-S2 system, 100 ml of mid-exponentially grown S2 cells were cultured in a spin flask with 8 × 10⁶ cells/ml and infected with MOI 100 BacEGFP/hsp70 EGFP for 1 h. At 36 h postinfection, cells were lysed for Western blot analysis. The absolute EGFP level was quantified with recombinant EGFP standard (Clontech) by using a phosphorimager. The predicted absolute level of EGFP expressed by S2 cells is approximately 3.2 mg/liter. Our data suggest that the baculovirus-mediated gene expressions in S2 cells might be an alternative for large-scale protein expressions.

View larger version (13K): [in this window] [in a new window]   FIG. 4.   Comparison of the baculovirus-mediated EGFP expression levels in S2 cells and in other host cells. S2 cells were transduced with BacEGFP/hsp70 EGFP at an MOI of 100 PFU/cell, and cells were harvested at 36 h postinfection for Western blot analysis. The same titer of BacEGFP (EGFP under the control of the PH promoter) was transduced into Sf9, Sf21, and High Five cells, and cells were harvested at 72 h postinfection for Western blot analysis. Total proteins in the cell lysate were measured by using the DC Protein Assay (Bio-Rad). The relative yields of EGFP expression from equal amounts of total protein were determined by using a phosphorimager. Results are the averages of three independent infections.

Superinfection in S2 cells. Superinfection is defined as an infected cell that is capable of being infected by another virus at subsequent time points. For the classical baculovirus expression system, multiple recombinant baculoviruses are capable of coinfecting into the same cell concurrently. However, the same host cell becomes nonpermissive to another baculovirus infection once it is first infected by a homologous (the same species) recombinant baculovirus (16, 24) at an earlier time point. Others have shown that it is possible for an infected Sf cell to be infected with another heterologous virus (24). However, there is no report describing the prospect of homologous baculovirus superinfection in any applied cell lines. To explore the feasibility of utilizing baculovirus to express two or more genes in one cell at different infection times, S2 cells were either concurrently coinfected with 100-MOI virus doses of BacEGFP/hsp70 HA-dcdc2, BacEGFP/hsp70 ena, and BacEGFP/hsp70 His6-EGFP in combination or were individually infected with these three viruses sequentially at intervals of 4 h. At 36 h postinfection, the three Western blots of cell extract were probed, respectively, with antibodies directed against HA-tagged dCdc2, Ena, and His-tagged EGFP and subsequently detected with alkaline phosphatase-conjugated goat anti-mouse secondary antibody. As shown in Fig. 5A, three proteins, which were either transduced concurrently or sequentially, were expressed equally well in the S2 cells. The same superinfection studies were also done with High Five cells. Three different recombinant baculoviruses (BacEGFP/hsp70 HA-dok, BacEGFP/hsp70 ena, and BacEGFP/hsp70 His6-EGFP) were used for this experiment. In contrast to the S2 cells being repeatedly transduced with multiple recombinant baculovirus, lepidopteran High Five cells can only be infected once by baculovirus (Fig. 5B). To confirm that the coexpression of multiple target genes by superinfection is not due to different populations of infected cells each infected with a different virus, confocal microscopic analysis of the coexpression of two fluorescent target genes in S2 cells was conducted. BacEGFP/hsp70 DsRed (a red fluorescent protein from sea anemone) (28) and BacEGFP/hsp70 EGFP were either coinfected or sequentially infected at 4-h intervals. Figure 5C shows that more than 96% of the cells coexpressed both fluorescent proteins either by coinfection or by superinfection of recombinant viruses. It is evident that the initial entry of the recombinant baculovirus did not prohibit the transduction of another homologous virus into the same S2 cells over time. We have also noted that the expression levels of two heterologous genes in the same cell were not always equivalent. The expression level of the second transduced target gene is not necessarily lower than that of the first target gene. Together, these data strongly suggest that the baculovirus-S2 system may be an alternative approach to coinfect two or more recombinant baculoviruses concurrently or sequentially over time for the production of biologically active proteins.

View larger version (183K): [in this window] [in a new window]   FIG. 5.   Superinfection of multiple homologous baculovirus in S2 and High Five cells. (A) Western blot of S2 cell lysates. Lane 1, uninfected S2 cells; lane 2, S2 cells coinfected with BacEGFP/hsp70 dcdc2 (HA tagged), BacEGFP/hsp70 ena, and BacEGFP/hsp70 EGFP (His tagged) at MOIs of 100; lane 3, S2 cells were sequentially infected by the aforementioned three viruses at 4-h intervals. Western blot analysis of HA-tagged dcdc2, Ena, and His-tagged EGFP expressions were detected with antibodies against HA tag, Ena, and His tag. The results are the averages of three independent infections. (B) Western blot analysis of High Five cell lysates. Lane 1, uninfected Sf21 cells; lane 2, High Five cells coinfected with BacEGFP/hsp70 dok (HA tagged), BacEGFP/hsp70 ena, and BacEGFP/hsp70 EGFP (His tagged) at an MOI of 100; lane 3, Sf21 cells sequentially infected by the aforementioned three viruses with 4-h intervals. Western blot analysis of HA-tagged Dok, Ena, and His-tagged EGFP expressions were detected with antibodies against HA tag, Ena, and His tag, respectively. (C) Confocal microscopy of fluorescent target gene coexpressions in S2 cells. BacEGFP/hsp70 DsRed and BacEGFP/hsp70 EGFP were either coinfected (upper panels) or sequentially infected (lower panels) at 4-h intervals. More than 96% of the cells demonstrated coexpression of two proteins either by coinfection or by superinfection of recombinant viruses. Nonetheless, expression levels of two target genes were not always comparable.