Previous Article | Next Article 
Journal of Virology, December 2000, p. 11764-11772, Vol. 74, No. 24
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Development of a Primary Tamarin Hepatocyte Culture
System for GB Virus-B: a Surrogate Model for Hepatitis C
Virus
Burton
Beames,1
Deborah
Chavez,1
Bernadette
Guerra,1
Lena
Notvall,1
Kathleen M.
Brasky,2 and
Robert E.
Lanford1,*
Department of Virology and
Immunology1 and Department of Laboratory
Animal Medicine,2 Southwest Regional Primate
Research Center, Southwest Foundation for Biomedical Research, San
Antonio, Texas 78227
Received 2 May 2000/Accepted 14 September 2000
 |
ABSTRACT |
GB virus-B (GBV-B) causes an acute hepatitis in tamarins
characterized by increased alanine transaminase levels that quickly return to normal as the virus is cleared. Phylogenetically, GBV-B is
the closest relative to hepatitis C virus (HCV), and thus GBV-B infection of tamarins represents a powerful surrogate model system for
the study of HCV. In this study, the course of infection of GBV-B in
tamarins was followed using a real-time 5' exonuclease (TaqMan) reverse
transcription-PCR assay to determine the level of GBV-B in the serum.
Peak viremia levels exceeded 109 genome equivalents/ml,
followed by viral clearance within 14 to 16 weeks. Rechallenge of
animals that had cleared infection resulted in viremia that was limited
to 1 week, suggestive of a strong protective immune response. A robust
tissue culture system for GBV-B was developed using primary cultures of
tamarin hepatocytes. Hepatocytes obtained from a GBV-B-infected animal
maintained high levels of cell-associated viral RNA and virion
secretion for 42 days of culture. In vitro infection of normal
hepatocytes resulted in rapid amplification of cell-associated viral
RNA and secretion of up to 107 genome equivalents/ml of
culture supernatant. In addition, infection could be monitored by
immunofluorescence staining for GBV-B nonstructural NS3 protein. This
model system overcomes many of the current obstacles to HCV research,
including low levels of viral replication, lack of a small primate
animal model, and lack of a reproducible tissue culture system.
 |
INTRODUCTION |
Hepatitis C virus (HCV) is a major
worldwide health problem, with an estimated 2% of the population
chronically infected with this virus. Chronic HCV infection can cause
significant liver disease and cirrhosis of the liver and, in some
patients, lead eventually to liver cancer. The current animal model for
the study of HCV is the chimpanzee. However, this model system suffers
from the limited availability of chimpanzees and the high cost
associated with conducting studies on large nonhuman primates. A
smaller, less expensive model system would be desirable.
One alternative model is the hepatitis GB virus-B (GBV-B) in
Saguinus species (tamarins). The GB agents, GBV-A, -B,
and -C, are members of Flaviviridae (21); GBV-B
is the virus most closely related to HCV (22). GBV-A and
GBV-B were isolated from tamarins inoculated with a blood sample from a
surgeon (GB) suffering from acute hepatitis (10). Although
GBV-A and GBV-B were isolated from a tamarin inoculated with human
serum believed to contain a human hepatitis virus, GBV-A and GBV-B
are considered tamarin viruses. While GBV-A has been isolated from
a number of tamarins (5), GBV-B has been isolated only once,
and its origins are unclear. A third GB agent, GBV-C (27),
also known as hepatitis G virus (19), was isolated from
human serum samples in attempts to isolate new hepatitis viruses;
however its association with hepatitis is tenuous (1).
GBV-A causes no recognized disease in tamarins, while GBV-B causes an
acute, self-limited hepatitis, as evidenced by a reproducible rise in
the serum level of alanine transaminase (ALT), an indication of liver
damage. HCV infection in humans frequently results in persistent
infection with associated disease sequelae, while GBV-B-infected tamarins appear to clear the viral infection with no long-lasting ill
effects. However, relatively few animals have been followed long term
by reverse transcription-PCR (RT-PCR) since the virus was identified in
1995 (28), and so the potential for a low percentage
of chronic infections exists. The acute nature of GBV-B infections in tamarins distinguishes this hepatitis from HCV
infections in humans, although the viruses share many
characteristics. GBV-B is the virus most closely related to HCV
genetically (22). The polyproteins possess
approximately 25 to 30% homology at the amino acid level
(21), while the 5' and 3' untranslated regions are more
distinct (6, 21, 24). The functional similarities between
the viruses were demonstrated by the correct processing of the HCV
polyprotein by the GBV-B NS3 protease and the creation of
functional chimeric NS3 proteins between HCV and GBV-B (7, 25). The studies support the premise that antiviral compounds with activity against GBV-B might show similar activities against HCV.
In this report, we describe the development of a tissue culture system
for GBV-B that utilizes primary cultures of tamarin hepatocytes. Our
studies were initiated by the development of a quantitative,
real-time 5' exonuclease PCR (TaqMan) assay for GBV-B and the
characterization of the infection profile of GBV-B in the absence
of GBV-A in two tamarins. GBV-B replication in culture was documented
for 42 days using hepatocytes from an infected tamarin. Replication
could also be demonstrated by detection of the NS3 protein in infected
cells by immunofluorescence. In vitro infection of normal hepatocytes
was highly efficient and was accompanied by high levels of replication
and secretion of infectious virions. This system should provide a
much-needed surrogate tissue culture system for HCV.
 |
MATERIALS AND METHODS |
Animals.
Tamarins were housed at the Southwest Regional
Primate Research Center at the Southwest Foundation for Biomedical
Research. Animals were cared for by members of the Department of
Laboratory Animal Medicine in accordance with Guide for the Care
and Use of Laboratory Animals (9), and all protocols
were approved by the Institutional Animal Care and Use Committee. Two
species of tamarins were used in this study. Characterization of GBV-B replication in vivo was performed with two cottontop tamarins (Saguinus oedipus); in vitro tissue culture studies used
hepatocytes obtained from two moustached tamarins (S. mystax). Tamarins 12024 and 12026 were inoculated with GBV-B,
followed through the course of the infection, and subsequently
rechallenged with a GBV-B inoculum. Infected and uninfected primary
tamarin hepatocytes were obtained from tamarins 12036 and 12035, respectively.
Hepatitis GB inoculum.
Hepatitis GB inoculum was obtained
from the American Type Culture Collection (ATCC) (VR-806). A 100-µl
aliquot was used as inoculum to infect tamarin 12024 by intravenous
injection. Following inoculation, the animal was bled biweekly and
serum was collected to assay for GBV-B and GBV-A RNA and for antibodies
to GBV-B. Two additional tamarins, 12026 and 12036, were injected with
100 µl of a 1:100 dilution of the 16-day postinjection plasma from tamarin 12024 (referred to as the challenge inoculum). A portion of
this 16-day postinjection plasma has been deposited with the ATCC.
Cloning of GBV-A and GBV-B genomic fragments.
Fragments of
the GBV-A and GBV-B genomes were amplified using RNA templates isolated
from 25 µl of the original ATCC GB serum using a High Pure RNA
isolation kit (Boehringer Mannheim). DNA fragments of 337 and 217 bp,
representing GBV-A and GBV-B sequences, respectively, were amplified
using a single-tube Access RT-PCR kit (Promega). A 45-min cDNA reaction
at 48°C preceded 55 rounds of amplification using denaturation for
30 s at 94°C, annealing for 30 s at 50°C, and extension
for 30 s at 60°C. The primer sets used were those cited by
Schlauder et al. (26): GBV-A primers 3011F
(5'GAAAGCTTGGTTGGTTGTGG) and 3348R
(5'CAATAGCACAATCTTCCTTGG), and GBV-B primers 5539F
(5'CAAAATGTTCCTGTCATTATTTG) and 5756R (5'GATCCATAGTGAGCCACTCAC). Both fragments were cloned into
the T-tailed vector pGEM-T (Promega) for the production of
hybridization probes and synthetic RNA copy number standards.
Cloned GBV-B DNA (a gift from Stanley Lemon) was used to amplify a
924-bp fragment of the putative NS3 protein, using primers 4064F
(5'CCGGATCCTTTACAGCACATATGGCATGTACC) and 4987R
(5'GGGAATTCGGGTCATTGGGAGCAGCATAGCC). The NS3 fragment was
released from pGEM-T by restriction at the 5' BamHI and 3'
EcoRI sites within the primers. The fragment was cloned into
pGEX-3X (Amersham Pharmacia) for expression as glutathione S-transferase (GST) fusion proteins in Escherichia
coli. The identity of the cloned fragment was confirmed by sequencing.
Expression of the GST-NS3 fusion protein and generation of
polyclonal antisera.
The GST-NS3 fusion protein, representing a
portion of NS3 identified as being immunogenic in infected animals
(23), was expressed in E. coli to serve as
antigen to generate polyclonal rabbit antisera. Initial attempts to
express the GST-NS3 protein resulted in an insoluble pellet of GST-NS3
protein upon lysis of the bacteria by sonication, precluding affinity
purification on glutathione beads. The protein pellet was solubilized
in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer, and the GST-NS3 polypeptide was purified by SDS-PAGE. The GST-NS3 protein, visualized by staining with Coomassie blue in
water, was excised and eluted from macerated acrylamide by shaking in
water. A single rabbit was immunized with the gel-purified material to
generate the anti-GST-NS3 antiserum used for immunofluorescence.
Anti-NS3 ELISA.
Antibodies to GST-NS3 in GBV-B-infected
animals were monitored by enzyme-linked immunosorbent assay (ELISA)
using soluble GST-NS3 protein isolated from E. coli by
sonication in the presence of 4% Tween 20. The soluble GST-NS3 protein
was purified on glutathione beads using established methods. Purified
GST-NS3 protein (10 ng per well) was bound to Immulon 2 96-well plates
(Dynatech Laboratories, Chantilly, Va.) in borate-buffered saline (145 mM NaCl, 6 mM NaOH, 48 mM H3BO3, 50 mM KCl [pH
8.2]). All ELISA incubations were for 1 h at 37°C except for
the final substrate incubation; between incubation steps, wells were
washed four times with phosphate-buffered saline (PBS)-0.05% Tween
20. Unoccupied protein binding sites were blocked with 5% nonfat dry
milk in PBS. Serial tamarin serum samples were diluted 1:40 in antibody
diluent, 0.5% nonfat dry milk-PBS-0.05% Tween 20, before
incubation. Bound antibody was detected with goat anti-human
immunoglobulin G (IgG)-horseradish peroxidase conjugate diluted 1:1,000
in antibody diluent. The substrate [100 µl of
2,2'-azinobis(3-ethylbenzthiazolinesulfonic acid) (ABTS; 1 mg/ml;
Sigma] was incubated at room temperature until color development was
stopped by the addition of 50 µl of 1% SDS. Plates were read at 405 nm.
TaqMan quantification of GBV-B RNA.
GBV-B RNA was isolated
from serum, cells, or medium either by using a High Pure RNA isolation
kit or by extraction with RNAzol (Biotecx Laboratories). GBV-B RNA was
quantified by a real-time, 5' exonuclease PCR (TaqMan) assay using a
primer-probe combination that recognized a portion of the GBV-B capsid
gene. The primers (558F [5'AACGAGCAAAGCGCAAAGTC] and 626R
[5'CATCATGGATACCAGCAATTTTGT]) and probe (579P
[5'6FAM-AGCGCGATGCTCGGCCTCGTA-TAMRA]) (6FAM = 6-carboxyfluorescein; TAMRA = N,N,N',N'-tetramethyl-6-carboxyrhodamine) were selected using the Primer Express software designed for this purpose (PE Biosystems, Foster City, Calif.) and were obtained from PE
Biosystems. The primers were used at 15 pmol/50-µl reaction, and the
probe was used at 10 pmol/50-µl reaction. The reactions were
performed using a TaqMan Gold RT-PCR kit (PE Biosystems) and included a
30-min 48°C reverse transcription step, followed by 10 min at 95°C
and then 45 cycles of amplification using the universal TaqMan
standardized conditions, a 15-s 95°C denaturation step followed by a
1-min 60°C annealing/extension step. Standards to establish genome
equivalents were synthetic RNAs transcribed from the cloned capsid
gene. Synthetic RNA was prepared using a SP6 Megascript kit (Ambion)
and was purified by DNase treatment, RNAzol extraction, and ethanol
precipitation. RNA was quantified by optical density, and 10-fold
serial dilutions were prepared from 10 to 1 million copies, using tRNA
as a carrier. These standards were run in duplicate in all TaqMan
assays in order to calculate genome equivalents in the experimental
samples. The calibration curves from one preparation of synthetic RNA
to the next are essentially identical. Although no international
standard for GBV-B RNA is available, similar assays developed for HCV
yield values comparable to those for commercially available assays.
Hepatocyte cultures.
Tamarin 12036 was inoculated with 100 µl of a 1:100 dilution of 16-day postinjection plasma from tamarin
12024. Hepatocytes were isolated 31 days postinjection using
collagenase perfusion as described elsewhere (17).
Uninfected hepatocytes were isolated from naive tamarin 12035 and used
for in vitro infections. Hepatocytes were seeded into 12- or 6-well
collagen-coated tissue culture dishes or into 60-mm-diameter dishes
containing glass coverslips for immunofluorescence. Hepatocytes were
maintained in serum-free medium containing hormones and growth factor
supplements as previously described (17). Culture medium was
changed three times per week, and samples were harvested periodically
by addition of 500 µl of Trizol (Life Technologies) to the wells.
Coverslips were harvested at 4 days postseeding and used for
immunofluorescence studies as previously described (15).
Coverslips were stained with rabbit antiserum directed against E. coli-expressed GST-NS3 protein at 1:1,000 and then detected using
a goat anti-rabbit IgG-fluorescein conjugate at 1:20. Aliquots of
primary hepatocytes were frozen by established methods (17),
and most studies were performed with frozen cells that had been thawed
and plated.
 |
RESULTS |
Detection of GBV-A and GBV-B viruses.
The original description
of the molecular cloning of the GB agents reported that the GB inoculum
contained both GBV-B and GBV-A (28). To analyze the GB
inoculum and serum from infected animals, RT-PCR assays were developed
to detect GBV-B and GBV-A. Analysis of the GB agent present in the
original deposit at the ATCC revealed that it contained both GBV-B and
GBV-A. In contrast, analysis of serial bleeds from tamarin 12024 inoculated with the ATCC GB material (see below) failed to detect GBV-A
(data not shown), while GBV-B could be readily detected. The failure to induce a GBV-A infection could have been due to a number of factors, including the age of the inoculum or preexisting immunity from previous
GBV-A exposure. Nonetheless, the animals described in this study were
infected with GBV-B alone, and the serum from these animals represents
a source of GBV-B inoculum not contaminated with GBV-A.
The initial RT-PCR assay for GBV-B was a gel-based assay combined with
Southern hybridization. To obtain a quantitative measure
of GBV-B RNA
for our studies, we developed a real-time, 5' exonuclease
RT-PCR
(TaqMan) assay. The capsid region was chosen as the target
site for the
TaqMan primers and probe. The assay readily detected
synthetic GBV-B
RNA down to 10 copies and was linear over a 6-log
range from 10 to 1 million copies, based on genome equivalents
calculated using synthetic
RNA transcribed from the GBV-B capsid
clone (see Materials and
Methods).
Course of GBV-B infection in tamarins.
Tamarin 12024 was
injected with 100 µl of the ATCC GB inoculum. The animal was bled
every 2 weeks, and the serum was tested for ALT as an indication of
liver damage, for viral RNA by TaqMan RT-PCR, and for antibodies to NS3
by ELISA (Fig. 1A, top). A robust infection was initiated with the ATCC GB inoculum in tamarin 12024. By
week 2 postinoculation (p.i.), the first postinoculation bleed, the
serum viral RNA titer was 4.8 × 108 genome
equivalents (ge)/ml and remained elevated through week 12 p.i. The
serum viral RNA levels rapidly declined to 3.4 × 102
ge/ml at week 14 p.i. Viral RNA was no longer detectable by week 16 p.i. The ALT levels also increased rapidly and closely
paralleled the pattern for serum viral RNA. The ALT level was elevated
to 84 by week 2 p.i., peaked at 328 by week 10 p.i., and had
dropped to normal levels by week 14 p.i. The tamarin seroconverted
for anti-NS3 antibody on week 8 p.i., and peak ELISA values were
observed on week 14 p.i.; however, the ELISA values rapidly
declined in the absence of viral replication and were near background
levels by week 20 p.i.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
Infection profiles of GBV-B infected tamarins. (A)
Progress of initial GBV-B infection in tamarins 12024 (top) and 12026 (bottom). GBV-B levels are shown in comparison to the liver damage, as
measured by ALT, and rise in serum antibody titers to the GBV-B NS3
protein over the 24- to 26-week course of the experiment. (B) GBV-B
levels and serum antibody titers to the NS3 protein during the course
of rechallenge infection of 12024 (top) and 12026 (bottom) with a
standard inoculum of GBV-B-containing 12024 tamarin serum. GBV-B TaqMan
data, measured in genome equivalents per milliliter of serum, are shown
as bar graphs, with line graphs representing ALT and NS3 ELISA
absorbance superimposed.
|
|
A second tamarin was infected with the serum derived from 12024. The
day 16 plasma (7.4 × 10
7 ge/ml) was chosen to be a
standardized inoculum for future experiments.
The use of 100 µl of a
1:100 dilution of the serum provided a
dose of 7.4 × 10
4 ge. Tamarin 12026 was challenged with this inoculum.
The course
of infection closely resembled the infection pattern
observed
in 12024 (Fig.
1A, bottom). Serum viral RNA levels peaked at
3.1
× 10
9 ge/ml at 2 weeks p.i. The virus titer
declined to 9.1 × 10
3 by 12 weeks p.i. and was below
the level of detection by week
14 p.i. The higher initial virus
titer in tamarin 12026 than in
12024 probably represents interanimal
variation rather than the
difference in the inoculum. ALT levels were
elevated by 2 weeks
p.i. but fluctuated considerably, reaching a peak
value of 160
on week 12 p.i. The animal seroconverted for antibody
to NS3 by
week 10 p.i. These data indicate that a standardized
GBV-B inoculum
lacking GBV-A has been produced for future in vivo and
in vitro
studies.
GBV-B rechallenge of previously infected tamarins.
To
determine whether animals that had previously cleared GBV-B infection
would be protected from a rechallenge with homologous inoculum,
tamarins 12024 and 12026 were injected with 100 µl of a 1:100
dilution of 12024, the challenge inoculum. Very little evidence of
reinfection was observed by TaqMan analysis of serial serum samples.
Both animals were PCR positive 1 week p.i., with titers of 1.2 × 105 and 5.3 × 105 for tamarins 12024 and
12026, respectively (Fig. 1B). All subsequent bleeds taken at 1-week
intervals were negative. The viral RNA detected at week 1 p.i.
could not represent carry-forward of the inoculum, since the viral RNA
levels per milliliter of serum were equivalent to the entire inoculum.
Thus, the rapid decrease in viral RNA values seen at week 1 p.i.
represents an enhanced clearance of an attenuated infection. Serum from
each animal was tested by ELISA to determine whether an increase in
antibody titer followed the second exposure to the virus. Tamarin 12024 showed a marked increase in serum antibody titers to the NS3 protein by
week 4 postrechallenge (Fig. 1B, top); in contrast, tamarin 12026 showed an essentially flat response to the GBV-B rechallenge (Fig. 1B, bottom).
GBV-B replication in in vivo-infected hepatocytes.
One of our
major priorities with the GBV-B system was the creation of a tissue
culture system that would permit studies that have been difficult or
impossible to conduct with HCV. The high level of replication of GBV-B
observed in tamarins suggested that many of the types of studies
impossible with HCV might be feasible with this system. To initiate the
culture studies, we first determined whether tamarin hepatocytes were
permissive for maintaining GBV-B replication in culture when the
hepatocytes were obtained from a GBV-B-infected animal. Hepatocytes
were isolated from liver tissue by collagenase perfusion from tamarin
12036 at 31 days p.i. with the standardized inoculum. Hepatocytes were
maintained using the serum-free medium and culture conditions that we
had established for HCV replication in chimpanzee hepatocytes
(17). Cultures were maintained for up to 6 weeks, and
individual wells were harvested at intervals for analysis of viral RNA
by TaqMan assay. Analysis of an aliquot of the cells prior to plating
(day 0) determined that the cells contained 8 × 107
ge/µg of total cell RNA (Fig. 2). On
day 2 postplating, the cells contained 2.6 × 107
ge/µg of RNA, indicating that the culture system was maintaining viral RNA levels similar to that observed in vivo. Some decline in
viral RNA levels was observed over time, with a decrease of approximately 2 logs in titer by day 42 postisolation (Fig. 2). Medium
collected at day 42 postplating contained 9.2 × 105
ge/ml after 18 medium changes, indicating that the cells continued to
secrete virus for prolonged periods postplating (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Persistence of GBV-B replication in primary tamarin
hepatocytes. GBV-B levels were monitored for 42 days in primary
hepatocytes isolated from GBV-B-infected tamarin 12036. Day 0 represents RNA isolated from hepatocytes harvested on the day of
isolation from the liver.
|
|
Susceptibility of normal tamarin hepatocytes for in vitro GBV-B
infection.
To determine the level of susceptibility of tamarin
hepatocytes to in vitro infection with GBV-B, normal hepatocytes were isolated from an uninfected animal (tamarin 12035). The hepatocytes were plated in collagen-coated dishes and exposed to GBV-B-containing tamarin serum under various conditions. A number of parameters were
examined to determine whether GBV-B could efficiently infect hepatocytes in vitro. A crucial step in the analysis was to determine whether the level of GBV-B increases over time following inoculation of
primary tamarin hepatocytes. An in vitro growth curve was conducted by
inoculation of hepatocytes on day 3 postplating with 10 µl of
undiluted serum from 12024 day 16 plasma (7.4 × 105
ge; multiplicity of infection of 0.75 ge/cell). Following a 6-h exposure to inoculum, the cells were washed extensively, and wells were
harvested for RNA on the days indicated (Fig.
3). Cells harvested following the 6-h
exposure period (day 0) contained 6.3 × 104 ge/µg
of RNA, representing virus that was bound to or had been internalized
by the cells. By day 1, the level of cell-associated GBV-B RNA
increased 41-fold, to 2.6 × 106 ge/µg of RNA. The
level of cell-associated GBV-B RNA remained approximately the same
through the 14 day experiment. Although peak cell-associated RNA levels
were attained by day 1, secreted virus did not peak until day 3. The
level of viral RNA in the medium on day 1, 3.1 × 104
ge/ml, increased 193-fold, to 6.0 × 106 ge/ml, on day
3. Viral RNA levels declined by approximately 1 log by day 7 and
remained constant to day 14 p.i. (Fig. 3).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 3.
Growth curve of GBV-B in primary tamarin hepatocytes.
Tamarin hepatocytes were inoculated with GBV-B-containing plasma, using
an adsorption period of 6 h. Cultures were washed extensively to
remove unadsorbed virus and then harvested in duplicate at various
times over a 14-day period. Time zero (immediately after washing away
the inoculum) represents the level of virus attached or internalized by
the cells. Cell-associated (squares) or secreted (circles) GBV-B RNA
was quantified by TaqMan RT-PCR and expressed as genome equivalents per
microgram of cellular RNA or milliliter of culture medium,
respectively.
|
|
TaqMan values in these assays were expressed in genome equivalents per
microgram of cell RNA as a means of normalizing independent
cultures
irrespective of variation in cell number between cultures
and
efficiency in recovery of cell RNA. The values can be extrapolated
to a
per-cell basis by assuming that 1 µg of cell RNA is derived
from
5 × 10
4 cells. In addition, the percentage of cells
infected as determined
by immunofluorescence (20% [see below]) can
be used to refine
the estimation of virions produced per infected cell.
Given these
assumptions, these values indicate that each infected cell
contained
260 genomes and that 60 virions per infected cell were
secreted
every 2 days (medium was changed every other day). This ratio
suggests that a significant fraction of the newly synthesized
virions
remain cell
associated.
Estimation of doubling time for GBV-B.
Since the level of
cell-associated GBV-B RNA had reached a maximum level within 24 h
p.i., the first time point examined, a compressed growth curve study
was performed using duplicate cultures. To examine earlier time points,
the inoculum was adsorbed to the cells for only 1 h. Following the
adsorption period, cells were extensively washed, and cultures were
harvested to determine the level of viral RNA adsorbed to the cells at
the 0-h time point. Cultures were then harvested at multiple times
during the first 24 h p.i. and at 48 h p.i. (Fig.
4). At time zero, 18.7 × 103 ge was adsorbed to the cultures; this decreased to
4.8 × 103 and 4.0 × 103 ge at the
4- and 8-h time points, respectively. The first increase in viral RNA
levels was observed at 12 h p.i. with 11.5 × 103
ge. The RNA levels increased threefold at each 4-h time interval between 8, 12, and 16 h, from 4.0 × 103 to
11.5 × 103 to 32.5 × 103 ge,
respectively. The increase in viral RNA levels from 8 to 12 h and
12 to 16 h provides an estimated doubling time of 2.6 h. The
level of viral RNA increased a further 3- and 2.8-fold at 24 and
48 h p.i., to 96.5 × 103 and 270 × 103 ge/µg of cell RNA, respectively. The maximum level of
cell-associated viral RNA was lower in this experiment than in the
previous growth curve, presumably due to the reduced exposure time to
the inoculum, since results of subsequent studies were nearly identical
to results of the initial growth curve (see below and compare Fig. 3 to
Table 1).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 4.
Estimation of doubling time for GBV-B in primary tamarin
hepatocytes. Tamarin hepatocytes were inoculated with GBV-B-containing
plasma using a shortened adsorption period (1 h). Cultures were washed
extensively to remove unadsorbed virus and harvested in duplicate at
various times over a 48-h period. Time (immediately after washing away
the inoculum) represents the level of virus attached or internalized by
the cells. Cell-associated GBV-B RNA was quantified by TaqMan RT-PCR.
|
|
Time of maximum susceptibility for in vitro infection.
Since
cultured hepatocytes are known to lose differentiated status to various
degrees depending on the culture conditions, it was necessary to
determine the optimum time postplating for in vitro infection or the
window of maximum susceptibility. Hepatocytes from tamarin 12035 were
inoculated for 6 h in duplicate on days 1, 3, 7, and 14 postisolation. Each well was harvested 7 days postinfection, and total
cell RNA was analyzed by TaqMan RT-PCR. The duplicate wells showed
nearly identical levels of GBV-B RNA, with less than twofold variation
(Table 1). Considering that the culture system uses primary primate
hepatocytes and measurements are based on RT-PCR, this level of
reproducibility is remarkable. Cultures infected on days 1 and 3 postplating yielded comparable values of 2 × 106 to
3 × 106 ge/µg of RNA (Table 1), which were in turn
nearly identical to the values obtained in the in vitro growth curve
where the cultures were inoculated under similar conditions (6-h
adsorption on day 3 postplating) and were harvested 7 days p.i. (Fig.
3). However, the levels of GBV-B RNA were decreased significantly in
wells inoculated on days 7 and 14 postplating. Although the results
from the latter time points could still be considered an efficient
culture system for GBV-B, it is clear that some required function was
diminished at latter times.
Titration of inoculum.
For the initial in vitro infection
experiments, 10 µl of undiluted 16-day postinfection plasma from
tamarin 12024 was arbitrarily selected. Higher levels of plasma can
often form fibrin clots on primary hepatocytes and occasionally induce
toxicity. TaqMan analysis of this plasma indicated that it contains
7.4 × 107 ge/ml. This would provide a multiplicity of
infection of approximately 0.74 ge per cell at 10 µl per well
(106 cells). To determine the minimum inoculum that
provides efficient infection, a titration of the inoculum was performed
(Table 2). Primary hepatocytes were
inoculated 3 days postplating with dilutions of GBV-B plasma containing
from 5 × 102 to 1 × 106 ge, and
cultures were harvested 1 and 3 days p.i. Early harvests were used such
that the initial level of infection could be determined prior to
cell-to-cell spread of the infection. In this experiment, TaqMan values
were extrapolated to genome equivalents per culture by multiplying the
total cellular RNA harvested from each culture by the genome
equivalents per microgram of cell RNA determined in TaqMan assays.
Although expression of values in genome equivalents-per-microgram yields normalized values for all cultures, it does not present an
accurate representation of the total yield per culture. The results
demonstrate a 100-fold amplification of the input RNA by 24 h p.i.
for the lowest inoculum used. This value further increased to 240-fold
above the input RNA by day 3. Increasing the inoculum resulted in
dramatic increases in the yield of viral RNA, with the highest dose
having genome equivalent-per-culture values 480-fold above the lowest
dose. However, the increase was not linear. This probably reflects the
inefficiency of adsorption of high doses of inoculum. At all doses of
inoculum considerable, amplification of the input RNA level occurred by
24 h, and further increase was observed at 3 days for doses below
5 × 104 ge. The relative increases in cell-associated
RNA levels in comparison to the total input RNA values represent an
underestimation of replication, since the data from the 0-h time point
in Fig. 3 can be used to estimate that less than 10% of the inoculum
adsorbs to the cells, and it is unlikely that all adsorbed virions
enter a productive replication cycle.
Infectivity of tissue culture derived GBV-B.
To determine
whether GBV-B from 12036 in vivo-infected hepatocytes was infectious
upon passage to new cultures, uninfected hepatocytes from tamarin 12035 were inoculated with the medium derived from day 42 cultures of the in
vivo-infected cultures of 12036 (Fig. 2). Cultures were inoculated 3 days postplating with 0.5 ml of medium (4.6 × 105 ge)
or 0.5 ml of a 10-fold concentrate of the medium, and cultures were
harvested 7 days p.i. Analysis of the cells for cell-associated viral
RNA or the medium for secreted virus indicated that both inocula
induced infection, with approximately a 10-fold increase in the average
level of cell-associated viral RNA in cultures inoculated with the
10-fold-concentrated medium (Table 3).
Although the TaqMan values were lower for the cell-associated viral RNA in comparison to cultures inoculated with tamarin serum, the level of
secreted virus was comparable to that obtained for the day 7 harvest in
the in vitro growth curve (Fig. 3). The data demonstrate that GBV-B
released into the medium from infected primary tamarin hepatocytes is
infectious in vitro. Subsequent studies have confirmed the infectivity
of secreted virions, as well as demonstrated multiple log reductions in
specific infectivity for particles produced in the presence of
nucleoside analogs (unpublished data).
Immunofluorescence of in vitro-infected hepatocytes.
To
determine the percentage of cells being infected in these experiments,
in vitro-infected hepatocyte cultures were examined by
immunofluorescence staining for NS3 using a rabbit anti-GST-NS3 antiserum (Materials and Methods). Hepatocyte cultures from tamarin 12035 grown on glass coverslips were infected with the 12024 day 16 inoculum on day 3 postplating and were harvested 4 days after infection. Staining of infected cultures with the anti-GST-NS3 antiserum revealed a bright green cytoplasmic staining (Fig.
5A). Uninfected cultures stained with the
rabbit anti-GST-NS3 (Fig. 5B) did not exhibit specific staining, nor
did infected cultures stained with the prebleed serum from the same
rabbit prior to immunization with GST-NS3 (Fig. 5C).

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 5.
Immunofluorescence staining for NS3 protein. Hepatocytes
grown on glass coverslips were inoculated with GBV-B 3 days postplating
and harvested 3 days postinfection unless noted otherwise. GBV-B NS3
protein was detected by immunofluorescence using a rabbit anti-GST-NS3
antiserum and goat anti-rabbit IgG-fluorescein. (A) Infected
hepatocytes stained with anti-NS3 (magnification, ×100); (B)
uninfected hepatocytes stained with anti-NS3 (×100); (C) infected
hepatocytes stained with normal rabbit (prebleed; ×100); (D) lower
magnification of infected hepatocytes stained with anti-NS3 (×50); (E)
hepatocytes infected with a low multiplicity and harvested 21 days p.i.
(×100); (F) higher magnification of infected hepatocytes stained with
anti-NS3 (×200).
|
|
To further demonstrate the specificity of the staining reaction, we
performed blocking experiments in which the antiserum
was adsorbed with
either GST or NS3 lacking GST prior to being
used in staining.
Unadsorbed antiserum again yielded a bright
cytoplasmic staining (Fig.
6A) which was not reduced by prior
adsorption of the antiserum with purified GST (Fig.
6B). In contrast,
adsorption of the antiserum with purified NS3 completely eliminated
the
specific fluorescent staining (Fig.
6C).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
Specificity of rabbit anti-GST-NS3 antiserum in
immunofluorescence staining for NS3 protein. Hepatocytes were
inoculated with GBV-B and harvested 3 days p.i. Cells were stained for
NS3 protein using rabbit anti-GST-NS3 antiserum (A). To demonstrate
specificity, the antiserum was adsorbed for 16 h at 4°C with 5 µg of purified GST (B) or NS3 (C) protein prior to being used for
immunofluorescence staining. Adsorption with GST had no effect on
staining, while adsorption with NS3 eliminated staining.
|
|
Lower-magnification photographs of the cultures revealed that a high
percentage of cells were infected in some fields (Fig.
5D). Observation
of multiple fields from different experiments
indicated that
approximately 20 to 30% of the cells was positive
3 days p.i. This
represents efficient infection, since as described
above, the
standardized inoculum used in these experiments represented
a
multiplicity of infection of 0.75 ge per cell. To evaluate the
spread
of infection over time, cultures were inoculated with a
10-fold-lower
multiplicity of infection and were harvested at
various times over a
3-week period. In cultures harvested on day
3, approximately 1 to 2%
of the cells were positive (data not
shown), while in cultures
harvested on day 21 almost all cells
were positive (Fig.
5E). Despite
the extensive spread of infection
over a 3-week period, some cells
appeared to be resistant to infection.
These cells may have lost
hepatocyte differentiated functions
required for infection, or they may
have been protected by the
induction of interferon in infected cells.
Examination of cultures
at higher magnification revealed a
cytoplasmic/perinuclear staining
suggestive of endoplasmic reticulum
localization (Fig.
6F).
 |
DISCUSSION |
The past decade has witnessed rapid advances in our understanding
of HCV epidemiology, pathogenesis, and molecular biology of
replication. The advances in molecular biology of replication have
depended on the use of model systems to examine internal ribosome entry
site function, polyprotein processing, the functions of
individual proteins, and their interactions with the host cell. The
primary limiting factor in advances at this time is the lack of an
adequate culture system. The development of infectious cDNA clones of
HCV have provided a new means to develop tissue culture systems for
genetic analysis of replication (3, 11, 13, 29-31);
however, this potential has not yet been realized. A single system for
the selection of cells that maintain high levels of replication of an
HCV replicon expressing the nonstructural proteins has been described
(20), but widespread application of this technology has not
been achieved. A number of viruses can serve as potential surrogates
for HCV, including bovine viral diarrhea virus, a member of the
pestivirus family. The use of GBV-B as a surrogate system for HCV is
particularly attractive, since it is the virus most closely related to
HCV and induces hepatitis in a small-primate model. This study
significantly advances the GBV-B model through the development of a
tissue culture system with high levels of replication and efficient in
vitro infection.
Our previous studies with HCV replication in primary chimpanzee
hepatocytes provided some of the most convincing evidence for in vitro
replication of HCV; however, this system was limited in many aspects
(16, 18). Most importantly, the level of replication of HCV
both in vivo and in vitro necessitated the use of highly strand
specific RT-PCR assays for negative-strand RNA to document replication
(16, 18). The level of replication rarely exceeded the
quantity of virus present in inoculum, and the virus remained primarily
cell associated. The GBV-B system described in this study was not
dependent on strand-specific assays, since cell-associated viral RNA
increased as much as 100-fold in comparison to the input inoculum (Fig.
3 and 4 and Table 2), and viral RNA in the medium increased 193-fold
between days 1 and 3 p.i. (Fig. 3). In addition, the expression of
NS3 could readily be detected by immunofluorescence.
Although viral replication and secretion could be detected for 42 days,
the latest time point examined, and cells could be efficiently infected
in vitro for 14 days postplating, it is apparent that some cellular
requirement for infection and/or replication diminishes with time. The
high levels of GBV-B replication coupled with quantitative, real-time
TaqMan RT-PCR provide an opportunity to optimize this system to
maintain the high levels of replication observed in the first 2 weeks
and potentially to define the limiting factors required for
replication. Use of the serum-free medium will permit studies on the
impact of alterations in the levels of growth factors and hormones on
replication as well as the effects of various cytokines.
The recent development of infectious cDNA clones of GBV-B
(6; Stanley Lemon, personal communication) also
suggests that this system will be useful for genetic analysis of
replication. Unlike HCV, it can be anticipated that transfection of
primary tamarin hepatocytes with synthetic RNA from an infectious clone will lead to high levels of replication. The availability of infectious clones of both HCV and GBV-B provides an opportunity to make chimeric clones. Chimeric viruses would certainly improve the utility of the
system for the screening of HCV antiviral drugs, if such clones are
infectious. The failure to develop chimeric clones between different
genotypes of HCV (30) suggests that replacement of limited
domains containing catalytic motifs would more likely be infectious
than those containing global replacements. In contrast, the ability of
the dengue virus NS5 protein to provide function in trans to
Kunjin virus replicons lacking a portion of the NS5 domain
(12) suggests that such replacements are feasible. In addition, the high level of homology of GBV-B with HCV within certain
motifs suggests that hybrid clones may not be required for the testing
of some antiviral compounds in this system. This approach is supported
by data demonstrating that the NS3 protease domain of GBV-B can cleave
the NS4A/4B, NS4B/NS5A, and NS5A/NS5B domains of HCV (7,
25). In addition, preliminary data indicate that both interferon
and ribavirin are capable of suppressing GBV-B replication in this
culture system (unpublished data).
The GBV-B tamarin model will also provide a valuable animal model in
which to examine pathogenesis, antiviral therapy, and immune clearance
of the virus. The development of a quantitative, real-time TaqMan
RT-PCR assay is a significant advancement for the use of this system.
Characterization of the infection profile of two animals revealed serum
viral RNA titers of 109 ge/ml. Viral clearance occurred in
both animals within 12 to 14 weeks. The level of serum viral RNA
closely paralleled the rise and fall of the ALT levels. The ALT levels
were significantly elevated within 2 weeks p.i. Whether the high levels
of GBV-B replication are to some degree cytopathic or whether the early rise in ALT was due to an innate or specific immune response to infected cells was not determined in these studies. No overt cytopathic effect was observed in vitro in infected hepatocytes. This does not
exclude a low level of cytopathic effect or a slow but accelerated death of infected cells, since primary cultures of hepatocytes always
contain some dying cells. The spread of the infection over 21 days to
yield cultures that are uniformly positive for NS3 by
immunofluorescence argues against a significant cytopathic effect, but
detailed studies on the induction of apoptotic markers should be
conducted before it is concluded that no cytopathic consequences of
viral infection exist.
Seroconversion for anti-NS3 antibodies did not occur until 8 weeks
p.i., and antibody titer rapidly declined to baseline levels in the
absence of viral replication. Similar infection profiles for GBV-B have
been reported previously (26). This rapid viral clearance,
rapid loss of antibody profile is very similar to those that we have
recently described for chimpanzees inoculated with HCV (2).
Rapid viral clearance was observed in 66% of the infected animals, and
rapid loss of antibody occurred in 50% of the animals with viral
clearance (2). Whether similar profiles occur in HCV-infected humans is difficult to determine, since the time of
infection is rarely known in humans, and all viral markers are lost
within months of infection. However, a number of studies support a
higher level of viral clearance in humans than previously suspected
(4, 8, 14).
At this time, chronic infections with GBV-B have not been reported. The
high levels of replication could contribute to a more intense immune
response that favors viral clearance. Typically, HCV levels in
chimpanzee and human sera are on the order of 106 ge/ml,
while serum levels of GBV-B RNA approach 109 ge/ml.
Alternatively, there may be other intrinsic differences between the
viruses and their hosts that lead to viral clearance. If GBV-B is
transmitted in nature in tamarins primarily through a parenteral route
with low levels of sexual and maternal transmission, as is observed
with HCV in humans, it is difficult to imagine maintenance of the virus
in a population without some chronic infections, unless other animals
serve as a reservoir for the virus. This of course assumes that
tamarins are indeed the natural host for GBV-B. At this time too few
animals have been followed long term with sensitive RT-PCR assays to
exclude the possibility for a low percentage of chronic infections. The
potential exists for the induction of chronic infections through the
use of transient immunosuppression with cyclosporin or FK506.
Chronically infected animals would certainly be useful in a number of
studies including the evaluation of antiviral drugs.
Perhaps one of the most promising potential applications of the tamarin
model and the tissue culture system described in this report is
development of an in vitro neutralization assay and an animal model for
evaluating HCV vaccine approaches. We observed protective immunity in
animals that had cleared the infection and were rechallenged, although
a very transient low-level viremia was observed. Whether this
protection is due to a humoral or cellular immune response remains to
be determined. Even if protection was provided by cellular immunity in
these animals, the in vitro culture system provides an opportunity to
rapidly evaluate the neutralizing potential of serum from small animals
immunized with various envelope protein configurations.
 |
ACKNOWLEDGMENTS |
This work was supported by grant P51 RR13986 to the Southwest
Regional Primate Research Center, by grant RO1 AI49574 from the
National Institutes of Health, and by a grant from Schering-Plough Research Institute.
We thank Zhi Hong and Johnson Lau (Schering-Plough) for the purified
NS3 protein and many helpful discussions on this project.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Virology and Immunology, Southwest Regional Primate Research
Center, Southwest Foundation for Biomedical Research,
7620 N.W. Loop 410, San Antonio, TX 78227. Phone: (210) 258-9445. Fax: (210) 670-3329. E-mail: rlanford{at}sfbr.org.
 |
REFERENCES |
| 1.
|
Alter, H.,
Y. Nakatsuji,
J. Melpolder,
J. Wages, Jr.,
R. Wesley,
J. W. K. Shih, and J. P. Kim.
1997.
The incidence of transfusion-associated hepatitis G virus infection and its relation to liver disease.
N. Engl. J. Med.
336:747-754[Abstract/Free Full Text].
|
| 2.
|
Bassett, S. E.,
K. M. Brasky, and R. E. Lanford.
1998.
Analysis of hepatitis C virus-inoculated chimpanzees reveals unexpected clinical profiles.
J. Virol.
72:2589-2599[Abstract/Free Full Text].
|
| 3.
|
Beard, M. R.,
G. Abell,
M. Honda,
A. Carroll,
M. Gartland,
B. Clarke,
K. Suzuki,
R. Lanford,
D. V. Sangar, and S. M. Lemon.
1999.
An infectious molecular clone of a Japanese genotype 1b hepatitis C virus.
Hepatology
30:316-324[CrossRef][Medline].
|
| 4.
|
Bronowicki, J. P.,
D. Vetter,
G. Uhl,
H. Hudziak,
A. Uhrlacher,
J. M. Vetter, and M. Doffoel.
1997.
Lymphocyte reactivity to hepatitis C virus (HCV) antigens shows evidence for exposure to HCV in HCV-seronegative spouses of HCV-infected patients.
J. Infect. Dis.
176:518-522[Medline].
|
| 5.
|
Bukh, J., and C. L. Apgar.
1997.
Five new or recently discovered (GBV-A) virus species are indigenous to New World monkeys and may constitute a separate genus of the Flaviviridae.
Virology
229:429-436[CrossRef][Medline].
|
| 6.
|
Bukh, J.,
C. L. Apgar, and M. Yanagi.
1999.
Toward a surrogate model for hepatitis C virus: an infectious molecular clone of the GB virus-B hepatitis agent.
Virology
262:470-478[CrossRef][Medline].
|
| 7.
|
Butkiewicz, N.,
N. Yao,
W. Zhong,
J. Wright-Minogue,
P. Ingravallo,
R. Zhang,
J. Durkin,
D. N. Strandring,
B. M. Baroudy,
D. V. Sangar,
S. M. Lemon,
J. Y. N. Lau, and Z. Hong.
2000.
Virus-specific cofactor requirement and chimeric hepatitis C virus/GB virus B nonstructural protein 3.
J. Virol.
74:4291-4301[Abstract/Free Full Text].
|
| 8.
|
Cerny, A.,
J. G. McHutchison,
C. Pasquinelli,
M. E. Brown,
M. A. Brothers,
B. Grabscheid,
P. Fowler,
M. Houghton, and F. V. Chisari.
1995.
Cytotoxic T lymphocyte response to hepatitis C virus-derived peptides containing the HLA A2.1 binding motif.
J. Clin. Investig.
95:521-530.
|
| 9.
|
Committee on Care and Use of Laboratory Animals.
1996.
Guide for the care and use of laboratory animals.
Institute of Laboratory Animal Resources, National Research Council, Washington, D.C.
|
| 10.
|
Deinhardt, F.,
A. W. Holmes,
R. B. Capps, and H. Popper.
1967.
Studies on the transmission of human viral hepatitis to marmoset monkeys.
J. Exp. Med.
125:673-688[Abstract].
|
| 11.
|
Hong, Z.,
M. Beaudet-Miller,
R. E. Lanford,
B. Guerra,
J. Wright-Minogue,
A. Skelton,
B. M. Baroudy,
G. R. Reyes, and J. Y. Lau.
1999.
Generation of transmissible hepatitis C virions from a molecular clone in chimpanzees.
Virology
256:36-44[CrossRef][Medline].
|
| 12.
|
Khromykh, A. A.,
P. L. Sedlak, and E. G. Westaway.
1999.
trans-complementation analysis of the flavivirus Kunjin ns5 gene reveals an essential role for translation of its N-terminal half in RNA replication.
J. Virol.
73:9247-9255[Abstract/Free Full Text].
|
| 13.
|
Kolykhalov, A. A.,
E. V. Agapov,
K. J. Blight,
K. Mihalik,
S. M. Feinstone, and C. M. Rice.
1997.
Transmission of hepatitis C by intrahepatic inoculation with transcribed RNA.
Science
277:570-574[Abstract/Free Full Text].
|
| 14.
|
Koziel, M. J.,
D. K. H. Wong,
D. Dudley,
M. Houghton, and B. D. Walker.
1997.
Hepatitis C virus-specific cytolytic T lymphocyte and T helper cell responses in seronegative persons.
J. Infect. Dis.
176:859-866[Medline].
|
| 15.
|
Lanford, R. E., and J. S. Butel.
1979.
Antigenic relationship of SV40 early proteins to purified large T polypeptide.
Virology
97:295-306[CrossRef][Medline].
|
| 16.
|
Lanford, R. E., and D. Chavez.
1998.
Strand specific rTth RT/PCR for the analysis of HCV replication, p. 471-481.
In
J. Y. N. Lau (ed.), Methods in molecular medicine: hepatitis C. Humana Press, Inc., Totowa, N.J.
|
| 17.
|
Lanford, R. E., and L. E. Estlack.
1998.
A cultivation method for highly differentiated primary chimpanzee hepatocytes permissive for hepatitis C virus replication, p. 501-515.
In
J. Y. N. Lau (ed.), Methods in molecular medicine: hepatitis C. Humana Press, Inc., Totowa, N.J.
|
| 18.
|
Lanford, R. E.,
C. Sureau,
J. R. Jacob,
R. White, and T. R. Fuerst.
1994.
Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR.
Virology
202:606-614[CrossRef][Medline].
|
| 19.
|
Linnen, J.,
J. Wages, Jr.,
Z.-Y. Zhang-Keck,
K. E. Fry,
K. Z. Krawczynski,
H. Alter,
E. Koonin,
M. Gallagher,
M. Alter,
S. Hadziyannis,
P. Karayiannis,
K. Fung,
Y. Nakatsuji,
J. W. K. Shih,
L. Young,
M. Piatak, Jr.,
C. Hoover,
J. Fernandez,
S. Chen,
J.-C. Zou,
T. Morris,
K. C. Hyams,
S. Ismay,
J. D. Lifson,
G. Hess,
S. K. H. Foung,
H. Thomas,
D. Bradley,
H. Margolis, and J. P. Kim.
1996.
Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent.
Science
271:505-508[Abstract].
|
| 20.
|
Lohmann, V.,
F. Körner,
J. O. Koch,
U. Herian,
L. Theilmann, and R. Bartenschlager.
1999.
Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line.
Science
285:110-113[Abstract/Free Full Text].
|
| 21.
|
Muerhoff, A. S.,
T. P. Leary,
J. N. Simons,
T. J. Pilot-Matias,
G. J. Dawson,
J. C. Erker,
M. L. Chalmers,
G. G. Schlauder,
S. M. Desai, and I. K. Mushahwar.
1995.
Genomic organization of GB viruses A and B: two new members of the Flaviviridae associated with GB agent hepatitis.
J. Virol.
69:5621-5630[Abstract].
|
| 22.
|
Ohba, K.,
M. Mizokami,
J. Y. N. Lau,
E. Orito,
K. Ikeo, and T. Gojobori.
1996.
Evolutionary relationship of hepatitis C, pesti-, flavi-, plantviruses, and newly discovered GB hepatitis agents.
FEBS Lett.
378:232-234[CrossRef][Medline].
|
| 23.
|
Pilot-Matias, T. J.,
A. S. Muerhoff,
J. N. Simons,
T. P. Leary,
S. L. Buijk,
M. L. Chalmers,
J. C. Erker,
G. J. Dawson,
S. M. Desai, and I. K. Mushahwar.
1996.
Identification of antigenic regions in the GB hepatitis viruses GBV-A, GBV-B, and GBV-C.
J. Med. Virol.
48:329-338[CrossRef][Medline].
|
| 24.
|
Rijnbrand, R.,
G. Abell, and S. M. Lemon.
2000.
Mutational analysis of the GB virus B internal ribosome entry site.
J. Virol.
74:773-783[Abstract/Free Full Text].
|
| 25.
|
Scarselli, E.,
A. Urbani,
A. Sbardellati,
L. Tomei,
R. De Francesco, and C. Traboni.
1997.
GB virus B and hepatitis C virus NS3 serine proteases share substrate specificity.
J. Virol.
71:4985-4989[Abstract].
|
| 26.
|
Schlauder, G. G.,
G. J. Dawson,
J. N. Simons,
T. J. Pilot-Matias,
R. A. Gutierrez,
C. A. Heynan,
M. F. Kniggo,
G. S. Kurpiewski,
S. L. Buijk,
T. P. Leary,
A. S. Muerhoff,
S. M. Desai, and I. K. Mushahwar.
1995.
Molecular and serologic analysis in the transmission of the GB hepatitis agents.
J. Med. Virol.
46:81-90[Medline].
|
| 27.
|
Simons, J. N.,
T. P. Leary,
G. J. Dawson,
T. J. Pilot-Matias,
A. S. Muerhoff,
G. G. Schlauder,
S. M. Desai, and I. K. Mushahwar.
1995.
Isolation of novel virus like sequences associated with human hepatitis.
Nat. Med.
1:564-569[CrossRef][Medline].
|
| 28.
|
Simons, J. N.,
T. J. Pilot-Matias,
T. P. Leary,
G. J. Dawson,
S. M. Desai,
G. G. Schlauder,
A. S. Muerhoff,
J. C. Erker,
S. L. Buijk,
M. L. Chalmers,
C. L. Van Sant, and I. K. Mushahwar.
1995.
Identification of two flavivirus-like genomes in the GB hepatitis agent.
Proc. Natl. Acad. Sci. USA
92:3401-3405[Abstract/Free Full Text].
|
| 29.
|
Yanagi, M.,
R. H. Purcell,
S. U. Emerson, and J. Bukh.
1997.
Transcripts from a single full-length cDNA clone of hepatitis C virus are infectious when directly transfected into the liver of a chimpanzee.
Proc. Natl. Acad. Sci. USA
94:8738-8743[Abstract/Free Full Text].
|
| 30.
|
Yanagi, M.,
R. H. Purcell,
S. U. Emerson, and J. Bukh.
1999.
Hepatitis C virus: an infectious molecular clone of a second major genotype (2a) and lack of viability of intertypic 1a and 2a chimeras.
Virology
262:250-263[CrossRef][Medline].
|
| 31.
|
Yanagi, M.,
M. St. Claire,
M. Shapiro,
S. U. Emerson,
R. H. Purcell, and J. Bukh.
1998.
Transcripts of a chimeric cDNA clone of hepatitis C virus genotype 1b are infectious in vivo.
Virology
244:161-172[CrossRef][Medline].
|
Journal of Virology, December 2000, p. 11764-11772, Vol. 74, No. 24
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Weatherford, T., Chavez, D., Brasky, K. M., Lemon, S. M., Martin, A., Lanford, R. E.
(2009). Lack of Adaptation of Chimeric GB Virus B/Hepatitis C Virus in the Marmoset Model: Possible Effects of Bottleneck. J. Virol.
83: 8062-8075
[Abstract]
[Full Text]
-
Weatherford, T., Chavez, D., Brasky, K. M., Lanford, R. E.
(2009). The Marmoset Model of GB Virus B Infections: Adaptation to Host Phenotypic Variation. J. Virol.
83: 5806-5814
[Abstract]
[Full Text]
-
Woollard, D. J., Haqshenas, G., Dong, X., Pratt, B. F., Kent, S. J., Gowans, E. J.
(2008). Virus-Specific T-Cell Immunity Correlates with Control of GB Virus B Infection in Marmosets. J. Virol.
82: 3054-3060
[Abstract]
[Full Text]
-
Haqshenas, G., Dong, X., Netter, H., Torresi, J., Gowans, E. J.
(2007). A chimeric GB virus B encoding the hepatitis C virus hypervariable region 1 is infectious in vivo. J. Gen. Virol.
88: 895-902
[Abstract]
[Full Text]
-
Targett-Adams, P., Schaller, T., Hope, G., Lanford, R. E., Lemon, S. M., Martin, A., McLauchlan, J.
(2006). Signal Peptide Peptidase Cleavage of GB Virus B Core Protein Is Required for Productive Infection in Vivo. J. Biol. Chem.
281: 29221-29227
[Abstract]
[Full Text]
-
Aurisicchio, L., De Tomassi, A., La Monica, N., Ciliberto, G., Traboni, C., Palombo, F.
(2005). Regulated and Liver-Specific Tamarin Alpha Interferon Gene Delivery by a Helper-Dependent Adenoviral Vector. J. Virol.
79: 6772-6780
[Abstract]
[Full Text]
-
Jacob, J. R., Lin, K.-C., Tennant, B. C., Mansfield, K. G.
(2004). GB virus B infection of the common marmoset (Callithrix jacchus) and associated liver pathology. J. Gen. Virol.
85: 2525-2533
[Abstract]
[Full Text]
-
Nam, J.-H., Faulk, K., Engle, R. E., Govindarajan, S., St. Claire, M., Bukh, J.
(2004). In Vivo Analysis of the 3' Untranslated Region of GB Virus B after In Vitro Mutagenesis of an Infectious cDNA Clone: Persistent Infection in a Transfected Tamarin. J. Virol.
78: 9389-9399
[Abstract]
[Full Text]
-
Bright, H., Carroll, A. R., Watts, P. A., Fenton, R. J.
(2004). Development of a GB Virus B Marmoset Model and Its Validation with a Novel Series of Hepatitis C Virus NS3 Protease Inhibitors. J. Virol.
78: 2062-2071
[Abstract]
[Full Text]
-
Martin, A., Bodola, F., Sangar, D. V., Goettge, K., Popov, V., Rijnbrand, R., Lanford, R. E., Lemon, S. M.
(2003). Chronic hepatitis associated with GB virus B persistence in a tamarin after intrahepatic inoculation of synthetic viral RNA. Proc. Natl. Acad. Sci. USA
100: 9962-9967
[Abstract]
[Full Text]
-
Pizzuti, M., De Tomassi, A., Traboni, C.
(2003). Replication and IRES-Dependent Translation Are Both Affected by Core Coding Sequences in Subgenomic GB Virus B Replicons. J. Virol.
77: 7502-7509
[Abstract]
[Full Text]
-
De Tomassi, A., Pizzuti, M., Graziani, R., Sbardellati, A., Altamura, S., Paonessa, G., Traboni, C.
(2002). Cell Clones Selected from the Huh7 Human Hepatoma Cell Line Support Efficient Replication of a Subgenomic GB Virus B Replicon. J. Virol.
76: 7736-7746
[Abstract]
[Full Text]
-
Mackay, I. M., Arden, K. E., Nitsche, A.
(2002). Real-time PCR in virology. Nucleic Acids Res
30: 1292-1305
[Abstract]
[Full Text]
-
Hope, R. G., Murphy, D. J., McLauchlan, J.
(2002). The Domains Required to Direct Core Proteins of Hepatitis C Virus and GB Virus-B to Lipid Droplets Share Common Features with Plant Oleosin Proteins. J. Biol. Chem.
277: 4261-4270
[Abstract]
[Full Text]
-
Lanford, R. E., Chavez, D., Guerra, B., Lau, J. Y. N., Hong, Z., Brasky, K. M., Beames, B.
(2001). Ribavirin Induces Error-Prone Replication of GB Virus B in Primary Tamarin Hepatocytes. J. Virol.
75: 8074-8081
[Abstract]
[Full Text]