Previous Article | Next Article 
Journal of Virology, December 2000, p. 11654-11662, Vol. 74, No. 24
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Vaccinia Virus F12L Protein Is Required for Actin
Tail Formation, Normal Plaque Size, and Virulence
Wei-Hong
Zhang,
Diane
Wilcock,
and
Geoffrey L.
Smith*
Sir William Dunn School of Pathology,
University of Oxford, Oxford OX1 3RE, United Kingdom
Received 15 June 2000/Accepted 20 September 2000
 |
ABSTRACT |
Vaccinia virus gene F12L is shown to encode a 65-kDa protein that
is synthesized early and late during infection and that is not modified
by glycosylation. Computational sequence comparison revealed that
related proteins are encoded by all sequenced chordopoxviruses. A virus
deletion mutant lacking the F12L gene (v
F12L) and a revertant virus
with the F12L gene reinserted into the deletion mutant (vF12L-rev) were
constructed and analyzed. A version of the F12L gene with a C-terminal
amino acid tag derived from the influenza virus hemagglutinin and that
is recognized by a monoclonal antibody was also inserted into the F12L
locus of v
F12L. Loss of the F12L protein reduced the formation of
IMV 2-fold, but there was a dramatic (99.5%) reduction in actin tail
formation, and the levels of cell-associated enveloped virus and
extracellular enveloped virus were reduced 8- to 11-fold and 7-fold,
respectively. Consistent with the lack of actin tail formation,
v
F12L produced a very small plaque. The v
F12L virus was severely
attenuated in vivo, such that a dose of v
F12L 10,000-fold greater
than the dose of wild-type virus that induced severe disease was unable
to induce disease in mice infected intranasally.
 |
INTRODUCTION |
Vaccinia virus (VV) is a large DNA
virus that replicates in the cytoplasm of infected cells
(34). Like all poxviruses, the VV particle is large and
complex, and more than 100 polypeptides have been identified in the
purified virion (15). The virus genome encodes approximately
200 genes and has been sequenced for VV strains Copenhagen
(18), modified virus Ankara (2), and most of the
Western Reserve (WR) strain (see reference 46 for
additional references).
VV produces two infectious forms of virus called intracellular mature
virus (IMV) and extracellular enveloped virus (EEV). EEV was shown to
be antigenically distinct from IMV (3), and an immune
response against the EEV-specific antigens is necessary for protection
against orthopoxvirus challenge (6, 51). Virus morphogenesis
begins in cytoplasmic factories that are largely devoid of cellular
organelles (11, 28). The first visible structures within
these factories are virus crescents that are composed of lipid and
virus protein, but the origin and composition of these crescents is
disputed. Early studies proposed that crescents contain a single lipid
membrane that was synthesized de novo (11). Later these
structures were proposed to contain a double lipid bilayer that was
derived from and was continuous with intermediate compartment membranes
between the endoplasmic reticulum and the Golgi complex
(47). More recently, additional electron microscopic evidence reported that there was only a single lipid bilayer without continuity with cellular membranes (22). After their
formation, lipid crescents extend into ovals called immature virus that
lack infectivity. These mature into electron-dense IMV particles by condensation of the core and proteolytic processing of several core proteins.
IMV particles represent the majority of infectious progeny and most
remain within the infected cell until cell lysis. However, some IMV
particles are transported away from the virus factory in a process that
is dependent upon the A27L protein and microtubules (41) to
sites where they become wrapped by two additional cellular membranes
(25). These wrapping membranes are derived from the tubular
endosomes (50) or trans-Golgi network (20, 42)
that have been modified by the inclusion of virus-encoded proteins that
ultimately become part of the EEV outer envelope. This wrapping process
produces an intracellular enveloped virus (IEV). IEV particles move to
the cell surface where the outer membrane fuses with the plasma
membrane, exposing a virion the cell surface. If this virion is
retained on the cell surface or is released and then reattaches, it is
called cell associated enveloped virus (CEV) (4), but if it
is released it is called EEV. VV infection induces the polymerization of actin tails that protrude from the cell surface with an enveloped virion at their tip (9). Virus mutants that are unable to
induce the polymerization of actin form a small plaque due to
inefficient cell-to-cell spread (see below).
Six VV genes were reported to encode EEV-specific proteins. These are
F13L (p37) (21), A33R (gp22-28) (37), A34R
(gp22-24) (12), A36R (p45-50) (36), A56R (gp86,
the virus hemagglutinin [HA]) (45), and B5R (gp42)
(13, 27). Recently, however, the A36R protein was found not
to be present in the CEV or EEV particle, despite copurifying with EEV
in density gradients (52). The roles of these proteins have
been investigated by the analysis of virus mutants in which the
individual genes are mutated, repressed, or deleted. These studies have
shown that none of the EEV proteins have a major effect on the
production or infectivity of IMV, but they have different effects on
the subsequent stages of morphogenesis. F13L (4), B5R
(14, 56), and A34R (12, 32, 57) are needed for
the wrapping of IMV particles since the formation of IEV is reduced or
abolished in their absence. Consequently, the formation of actin tails
is also greatly inhibited or abolished with these mutants (9, 19,
31, 39, 40, 57, 58). A56R is not required for either IEV or actin
tail formation (40), and the plaque formed by the deletion
mutant is of wild-type size but syncytial. In the absence of A33R, some
IEV particles are made but an increased proportion of these have
incomplete wrapping and actin tails are not formed (38).
Lastly, A36R is not required for IEV formation but is required for
production of actin tails (17, 36, 39, 40, 58). A36R has a
type Ib membrane topology with the N terminus and the majority of the
protein in the cytosol (39, 52). It has an unusual
distribution and is present on the outer IEV membrane and the plasma
membrane beneath CEV particles (52).
The production of EEV by these mutants is variable. Without F13L
(4) and B5R (14, 56), EEV formation is reduced by 10- to 100-fold, and without A36R EEV it is reduced 3- to 5-fold (36). In contrast, loss of the HA did not affect EEV
formation or infectivity (G. L. Smith, unpublished data) and loss
of A33R (38) and A34R (32) increased EEV
formation 2- to 4-fold and 25-fold, respectively. However, the EEV
formed in the absence of A34R had a fivefold-reduced specific
infectivity (32).
In this report we have characterized the F12L gene product and studied
the properties of a virus lacking this gene. This deletion mutant
formed normal amounts of IMV but was defective in actin tail formation,
plaque size, CEV and EEV production, and virulence.
 |
MATERIALS AND METHODS |
Cells and viruses.
Monkey kidney BS-C-1 and CV-1 cells,
rabbit kidney (RK)13 cells, human osteosarcoma
TK
143B cells and HeLa D980R cells were grown in
Dulbecco's modified Eagle's medium (DMEM) supplemented with 10%
fetal bovine serum (FBS; Gibco). VV strain WR was used throughout.
Plasmids.
A plasmid that could be used to construct a VV
F12L deletion mutant (v
F12L) was constructed as follows. The 5' (353 bp) and 3' (349 bp) ends of the F12L gene were amplified by PCR using VV WR DNA as a template. Oligonucleotides
5'-CCCGGATCCATGTTAAACAGGGTACAA (forward) and 5'-CCCGGATCCGTGCTATATCTCCCTGTT
(reverse) were used for the 5' fragment and included terminal
BamHI sites (underlined). Oligonucleotides
5'-CCCGTCGACCTGCTATCAGAGCAGGAT (forward) and 5'-CCCGTCGACTTATAATTTTACCATCTG
(reverse) were used for the 3' fragment and included terminal
SalI sites (underlined). The initiation codon and
termination codon (complement of) are shown in boldface type. The PCR
fragment representing the 5' end of the gene was digested with
BamHI and cloned into pSJH7 (24) that had been
digested with BamHI. pSJH7 contains the Escherichia coli guanine xanthine phosphoribosyl transferase (Ecogpt) gene linked to the VV 7.5K early-late promoter (7). The resultant plasmid was then digested with SalI and ligated with the PCR
fragment representing the 3' end of the open reading frame (ORF) that
has also been digested with SalI. The resulting plasmid,
p
F12L, contained the F12L gene with a 1,207-bp internal deletion.
To express the F12L ORF in an inducible manner in VV-infected cells,
the entire F12L ORF flanked by 5' NdeI and 3'
SalI sites (underlined) was amplified by PCR using VV DNA as
template and oligonucleotides
5'-GGGAATTCCATATGTTAAACAGGGTACAAATCTTG (forward) and
5'-CCCGTCGACTTATAATTTTACCATCTG
(reverse) as primers. Emboldened nucleotides indicate the
translation initiation codon and termination codon (complement of). The
PCR product was digested with NdeI and SalI and
inserted into plasmid pVOTE.2 (54), forming pVOTE.2-F12L.
To attach the influenza virus HA epitope YPYDVPDYA at the C terminus of
F12L, two PCR fragments were generated using virus
DNA as a template.
One fragment contained the entire F12L ORF,
together with a 5'
HindIII site and the C-terminal HA tag (primers
5'-GCG
AAGCTTATGTTAAACAGGGTACAAATCTTGATG
[forward] and
5'-agcgtaatcaggcacgtcgtaaaggtaTAATTTTACCATCTGACTCATG
[reverse]). The second fragment contained 501 bp downstream
from
the F12L termination codon, together with the 5' HA tag and the
3'
XhoI restriction site (primers
5'-tacgacgtgcctgattacgct
TAAAAAGTGAAAAACAATATTATTTTT
[forward] and
5'-GCG
CTCGAGCTCATTTTTTAAGCAGATTGTTGC
[reverse]).
Boldface, underlined, or lowercase nucleotides
represent the translation
initiation and termination codons,
restriction sites or HA tag,
respectively. These PCR fragments were
then assembled into a single
DNA fragment by splicing by overlap
extension (
23). The assembled
DNA fragment was digested with
HindIII and
XhoI and inserted into
pBAC-1
(Clontech) that had been digested with the same enzymes.
All DNA
fragments that were generated by PCR and cloned into plasmid
vectors
were sequenced and shown to be
correct.
Construction of recombinant VVs.
A recombinant VV lacking
1,207 bp (63%) of the F12L ORF was constructed by transient dominant
selection (16). Briefly, plasmid p
F12L was transfected
with Lipofectin (Gibco-BRL) into CV-1 cells that had been infected with
VV WR. A mycophenolic acid (MPA)-resistant virus was selected from the
resultant progeny virus by plaque assay on BS-C-1 cells. This
intermediate virus was then resolved by plaque assay on HeLa D980R
cells (29) in the presence of 6-thioguanine (26)
to produce the deletion mutant (v
F12L) and a plaque purified
wild-type virus (vF12L) derived from the same intermediate. A revertant
virus was constructed by rescue of the small-plaque phenotype. CV-1
cells were infected with v
F12L and transfected with a plasmid
containing the entire HindIII F fragment cloned into
pUC13. A virus forming a large plaque was selected from the progeny by
plaque assay on BS-C-1 cells, plaque purified three times, and
designated vF12L-rev. The recombinant virus expressing the HA-tagged
version of the F12L protein was selected in a similar way after
transfection of pBAC-1-F12LHA into v
F12L-infected CV-1 cells. This
virus was called vF12LHA. Lastly, a virus with an IPTG
(isopropyl-
-D-thiogalactopyranoside)-inducible version
of the F12L gene was constructed by infecting CV-1 cells with vT7LacOI (54), transfecting these cells with pVOTE.2-F12L, and
selecting an MPA-resistant recombinant virus by plaque assay on BS-C-1
cells. After three cycles of plaque purification, this virus was
amplified and designated vindF12L.
Antiserum to the F12L protein.
A rabbit polyclonal antibody
was raised against synthetic peptide SYKDINESMSQMVK (F12L amino acids
621 to 634) coupled to keyhole limpet hemocyanin by intramuscular
injection with the peptide emulsified in complete Freund adjuvant.
Rabbits were boosted with the same antigen emulsified in incomplete
Freund adjuvant.
Immunocytochemistry.
BS-C-1 cells were grown on glass
coverslips and were infected with 0.1 PFU/cell. At 15 h
postinfection (p.i.) the infected cells were washed with cold
phosphate-buffered saline (PBS) and fixed in ice-cold acetone for 1 min
at room temperature (RT). After incubation in blocking buffer (5%
FBS-1% bovine serum albumin in PBS) for 1 h at RT, the cells
were incubated at RT for 1 h with mouse monoclonal antibody (MAb)
AB1.1 directed against the VV D8L protein (36). After
extensive washing, the bound antibody was detected with fluorescein
isothiocyanate-conjugated donkey anti-mouse (Stratech Scientific,
Luton, United Kingdom) (diluted 1:100 in blocking buffer) for 45 min at
RT. F-actin was stained with tetramethyl rhodamine isothiocyanate
(TRITC)-phalloidin (Sigma, Poole, United Kingdom) for 1 h at RT.
Samples were mounted in mowiol (87.5% glycerol, 10% PBS, 2.5%
diazabicydo) and analyzed by a Bio-Rad MRC 1024 confocal microscope,
and images were processed with Adobe Photoshop software.
Virulence assay.
Groups of five BALB/c mice were inoculated
intranasally under general anaesthetic with doses of vF12L, v
F12L,
or vF12L-rev of between 104 and 108 PFU in 25 µl of PBS. Mice were weighed daily before and after infection, and
the mean weights for each group of animals were calculated and compared
with the mean weights of the same group of animals on day 0. Animals
that had lost 30% of their body weight were sacrificed by cervical dislocation.
 |
RESULTS |
The VV F12L gene was selected for study because there is a
conserved counterpart of this ORF in fowlpox virus (24% amino acid identity) and insertional mutagenesis of this fowlpox virus gene resulted in a small-plaque phenotype and sixfold-reduced production of
extracellular virus (35). The phenotype of the fowlpox virus mutant is similar to some VV mutants that have lost genes encoding EEV-specific proteins (Introduction). In addition, there are related genes in all other sequenced chordopoxviruses, including variola virus
(44), molluscum contagiosum virus (43), Shope
fibroma virus (55), and myxoma virus (8),
implying an important and conserved function. The F12L-like proteins
encoded by all these viruses have similar lengths. The VV protein
shares 95% amino acid identity with the comparable protein in variola
virus strain Bangladesh, 34% identity and 55% similarity with Shope
fibroma virus, 27% identity and 49% similarity with molluscum
contagiosum virus, and 27% identity and 45% similarity with fowlpox
virus. The F12L ORF in VV strain Copenhagen was predicted to encode a protein of 73.2 kDa (635 amino acid residues) (18). The
sequence of the F12L ORF in VV WR was determined by J. Sisler and
kindly provided by B. Moss (National Institutes of Health, Bethesda, Md.) and showed 16 nucleotide changes from the Copenhagen sequence out
of 1,908 nucleotides (99.2% identity). Four of these resulted in amino
acid substitutions H38R, S98P, I239M, and N545H (Copenhagen residue
shown first), but the proteins were the same lengths. An alignment of
the proteins from different chordopoxviruses is shown in Fig.
1A, and the hydropathy
profile is shown in Fig. 1B. A computational search showed that VV F12L
had six potential sites for attachment of N-linked carbohydrate, but no
signal sequence was identified. Several regions of hydrophobic nature
are present within F12L (Fig. 1B), but it is unclear if these would
cause association of the protein with membranes of the infected cell or
virus particles.


View larger version (124K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Amino acid alignment of the VV F12L protein and
related proteins from other chordopoxviruses. VAC, VV strain WR; VAR,
variola virus strain Bangladesh-1975 (30); SFV, Shope
fibroma virus (55); MCV, molluscum contagiosum virus
(43); FPV, fowlpox virus (35). Positions showing
conserved amino acid residues in five, four, or three sequences are
highlighted in black, dark gray, or light gray, respectively. (B)
Hydrophobicity profile of the VV F12L protein.
|
|
Characterization of the F12L protein.
To identify the F12L
protein, a recombinant virus was constructed that contained the F12L
ORF fused to a nine-amino-acid tag at the C terminus that is recognized
by MAb HA.11 (Covalence, Luton, United Kingdom). This tagged version of
the F12L gene was inserted into the VV mutant from which the majority
of the F12L gene had been deleted (v
F12L) (see Materials and
Methods), taking advantage of the small plaque phenotype of v
F12L
(see below). By transfecting the plasmid with the HA-tagged F12L allele
into cells infected with v
F12L, a large plaque recombinant virus
(vF12LHA) was selected. Southern blotting and PCR analysis of the
genome of vF12LHA confirmed that it had the predicted genomic structure (data not shown). The plaque size and growth properties of this virus
in cell culture were indistinguishable from the wild-type virus,
indicating that the addition of the short C-terminal tag to the F12L
protein was not deleterious.
Cells were mock infected or were infected with WR or vF12LHA viruses,
and extracts of these cells were analyzed by immunoblotting
using MAb
HA.11 (Fig.
2A). This antibody detected a
protein of
approximately 65 kDa in vF12LHA-infected cells that was
absent
from cells infected with WR and from mock-infected cells. In the
presence of cytosine arabinoside (a drug that inhibits virus DNA
replication and hence the expression of intermediate and late
virus
proteins), the amount of F12L protein detected by immunoblot
was
reduced greatly but was still detectable. This indicated that
the
protein is expressed early and late during infection, despite
the lack
of a TAAAT late transcriptional start motif near the
5' end of the ORF.
To determine if the F12L protein was modified
by the addition of
carbohydrate, parallel cultures were infected
or mock infected in the
presence of tunicamycin or monensin, drugs
that inhibit the addition of
N- or O-linked carbohydrate, respectively
(Fig.
2B and C). Neither of
these drugs affected the size of the
F12L protein as far as could be
determined from sodium dodecyl
sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE), suggesting
that the F12L protein was either
not glycosylated or contained
very little carbohydrate, despite
containing six potential sites
for addition of N-linked glycans.
However, both drugs reduced
the amount of F12L protein detected at late
times in infection.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
Immunoblot showing the identification of the F12L
protein. BS-C-1 cells were infected with the indicated viruses at 10 PFU/cell. At 15 h p.i. the infected cells were harvested, and
extracts of the infected cells were analyzed by SDS-PAGE and
immunoblotting. Cells were infected in the presence or absence of 40 µg of cytosine arabinoside (AraC) (A), 10 µg of tunicamycin (B), or
10 µg of monensin (C) per ml, as indicated. Blots were incubated with
MAb HA.11 (diluted 1:400 in blocking buffer), and bound antibody was
detected by incubation with horseradish peroxidase-conjugated goat
anti-mouse immunoglobulin G, followed by chemiluminescent reagents as
directed by the manufacturer (Amersham). The positions of molecular
weight markers are shown in kilodaltons.
|
|
The F12L protein copurifies with EEV.
To determine if F12LHA
is incorporated into virions, cells were infected with either vF12LHA
or WR viruses, and IMV and EEV particles were purified from the
cytoplasm of infected cells or from the cell culture supernatant by
sucrose density gradient centrifugation. Equal amounts of IMV and EEV
proteins were then analyzed by SDS-PAGE and immunoblotting using MAbs
HA.11, 15B6 that is directed against the p37 EEV protein encoded by
gene F13L (20), and AB1.1 that is directed against the
32-kDa protein of IMV encoded by gene D8L (36) (Fig.
3A). MAb AB1.1 detected protein in IMV
and EEV from each virus, while MAb 15B6 detected the p37 protein only
in EEV from each virus, as expected. However, MAb HA.11 detected
protein only in EEV from vF12LHA. This indicated that the F12L protein
copurified with EEV particles.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Immunoblots showing F12L associated with EEV. (A) IMV
and EEV were purified from cells or culture supernatants of cells
infected with WR or vF12LHA as described in Materials and Methods.
Equivalent amounts (3 µg) of purified EEV or IMV were then analyzed
by SDS-PAGE and immunoblotting with the MAbs HA.11 (anti-HA tag,
diluted 1:400), 15B6 (anti-F13L, diluted 1:2,000), and AB1.1 (anti-D8L,
diluted 1:2,000) overnight at 4°C for MAb HA.11 or at RT for 1 h
for other antibodies. (B) WR IMV and EEV as in panel A or extracts from
BS-C-1 cells infected with vF12L or vindF12L in the presence
of 10 mM IPTG were analyzed as in panel A. A rabbit antiserum raised
against the F12L protein and MAbs AB1.1 (anti-D8L) and 19C2 directed
against the B5R protein (tissue culture supernatant diluted 1:8)
(42) were used. Molecular weight markers are shown in
kilodaltons.
|
|
To obtain independent evidence that the F12L protein was associated
with EEV and that this was not due to the attachment of
the HA tag at
the C terminus of F12L, WR IMV and EEV were purified
and immunoblotted
with an antibody raised against the F12L protein
(see Materials and
Methods) (Fig.
3B). This detected a protein
or approximately 65-kDa in
EEV and not IMV, although the signal
was weak. To determine if the
protein detected in EEV was the
same size as the F12L protein in
infected cells, extracts of cells
infected with a plaque-purified
wild-type virus (vF12L) (see Materials
and Methods) or a virus that
expressed the F12L gene upon addition
of IPTG (v
indF12L)
(see Materials and Methods) were analyzed in
parallel (Fig.
3B). A
protein of the same size was seen in cells
infected with each virus. As
controls, MAb AB1.1 detected the
D8L protein in extracts from infected
cells and each type of virion,
and MAb 19C2, directed against the B5R
gene product (
42), detected
the B5R protein in infected
cells and EEV but not in
IMV.
Phenotype of a mutant virus lacking F12L.
The role of the F12L
protein in the virus life cycle was examined by the construction of a
virus mutant lacking 63% of the F12L ORF (Materials and Methods). Five
days after infection under semisolid overlay, the plaque size of this
mutant was very small compared to a plaque purified wild-type virus
(vF12L) isolated from the same intermediate (Fig.
4). A revertant virus in which the F12L
gene was reinserted into the v
F12L genome (vF12L-rev) was analyzed
in parallel and showed a similar-sized plaque to that of the wild type.
Incubation of infected cells under liquid overlay showed that the
formation of secondary plaques was reduced, suggesting reduced release
of EEV (data not shown). The genome structures of these viruses were
analyzed by PCR and Southern blotting and shown to be as expected (data
not shown).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 4.
Plaque size formed by viruses. BS-C-1 cells were
infected with the indicated viruses and incubated under semisolid
overlay (DMEM containing 2.5% FBS and 1.5% carboxymethylcellulose)
for 5 days. The monolayers were stained with 0.1% (wt/vol) crystal
violet in 15% ethanol.
|
|
The small plaque size of v

F12L was consistent with the phenotype of
the fowlpox virus lacking this gene (
35) and also with
VV
mutants that lacked the F13L, A33R, A34R, A36R, and B5R proteins
(see
the introduction). These other VV mutants had greatly
reduced
or abolished actin tail formation. Consequently, the
ability of
the v

F12L mutant to induce actin tails was examined
(Fig.
5).
Infected cells were stained
with MAb AB1.1 to detect all virus
particles and costained with
TRITC-phalloidin to detect F-actin.
In cells infected with vF12L (Fig.
5) or vF12L-rev (data not shown),
there were numerous actin tails with
a virus particle at their
tip. In contrast, in v

F12L-infected cells
the number of actin
tails was reduced by 99.5% and the rare actin
tails that were
detected appeared thicker than those in vF12L-infected
cells (data
not shown).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
Graph showing the number of virus-tipped actin tails in
infected cells at different times p.i. BS-C-1 cells were infected with
vF12L, v F12L, or vF12L-rev at 0.1 PFU/cell and at the indicated
times p.i. were stained with MAb AB1.1 to reveal all VV particles and
with TRITC-phalloidin to detect F-actin. Samples were analyzed by
confocal microscopy and reconstructed z-series of images of different
sections through the cell were examined. The number of virus-tipped
actin tails was counted for each of 10 infected cells (as shown by
reactivity with AB1.1), and the average number is shown. The number of
virus-tipped actin tails in cells infected with vF12L and vF12L-rev
were indistinguishable, and data are shown for only vF12L compared with
v F12L.
|
|
Growth properties of v
F12L.
The growth properties of the
virus deletion mutant were examined in cell culture (Fig.
6). After low-multiplicity infection (0.01 PFU/cell), the production of both IMV and EEV was reduced greatly. For IMV, this reduction was probably attributable partly to
the reduced rate of spread of virus from the first infected cells
(consistent with the small-plaque phenotype), but even after infection
at 10 PFU/cell there was a twofold reduction in infectious IMV (data
not shown). Notably, the difference between the titer of infectious IMV
made by v
F12L and vF12L or vF12L-rev decreased at later times after
infection, presumably as the infection spread slowly to surrounding
uninfected cells. For EEV, the difference in infectious titer between
the deletion mutant and the controls after infection at 0.01 PFU/cell
was approximately 100-fold by 48 and 72 h p.i., and a large
difference remained even at 96 h p.i. To determine the proportion
of this extracellular virus that was EEV, rather than IMV that had been
released from cells at these late times p.i., virus in the supernatant
was incubated with mouse MAb 5B4/2F2 directed against the IMV surface
protein encoded by the A27L gene and that neutralizes IMV infectivity (10). Under these conditions the remaining infectivity of
v
F12L, representing EEV, was still approximately 100-fold lower than that of wild-type or revertant viruses. This indicated a specific defect in the production of EEV from cells infected with a virus lacking the F12L protein.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
Growth of v F12L in tissue culture. BS-C-1 cells were
infected with the indicated viruses at 0.01 PFU/cell. After incubation
for 1 h at 37°C, nonabsorbed virus was washed away, and cells
were incubated in minimal essential medium containing 1% FBS. (A) At
the indicated times, culture supernatants were removed and, after
centrifugation at 1,000 × g for 10 min to remove
detached cells and cell debris, the virus infectivity was determined by
plaque assay on fresh monolayers of BS-C-1 cells. Where indicated
(+Ab), the infectivity of the diluted virus samples was determined
after incubation with MAb 5B4/2F2 that neutralizes IMV (10),
as described previously (53). (B) The infectivity associated
with the infected cells was determined by scraping the cells into PBS,
recovering the cells by centrifugation as described above, and
combining the pellets with the pellets derived from centrifugation of
the culture supernatant. The infectivity present was determined by
plaque assay on fresh monolayers of BS-C-1 cells.
|
|
To examine further the formation of IMV and EEV, cells were infected
with vF12L, v

F12L, or vF12L-rev and labeled with
[
3H]thymidine from 1.75 to 24 h p.i. IMV within
infected cells and
EEV present in the culture supernatant were then
purified by CsCl
density gradient centrifugation (
36). The
radioactivity in the
gradient fractions, determined by scintillation
counting, showed
similar-sized peaks for each virus that corresponded
to the density
of IMV (Fig.
7). However,
when the titer of infectious virus present
in these peaks was
determined by plaque assay, there was a reduction
in IMV titer for the
deletion mutant of between 2.1- and 2.4-fold
compared with revertant
and wild-type viruses, respectively.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 7.
CsCl density gradient analysis of IMV and enveloped
viruses produced by vF12L, v F12L and vF12L-rev. RK13
cells were infected with the indicated viruses at 10 PFU per cell and
labeled with 100 µCi of [3H]thymidine (Amersham) from
1.75 h p.i. At 24 h p.i., the virus in the infected cells (A)
or culture supernatant (B) was purified by CsCl density gradient
centrifugation as described previously (36). The density of
the fractions was determined by refractometry. The infectious virus
present in peak fractions corresponding to IMV or EEV was titrated by
plaque assay on BS-C-1 cells, and the amount of radioactivity in these
fractions was determined by scintillation counting. These values are
displayed underneath the graphs, and the relative differences between
the deletion mutant and control viruses are displayed.
|
|
For EEV there was a more dramatic difference. The amount of radioactive
EEV made by v

F12L was reduced 4.5- to 4.8-fold compared
to controls.
The difference in the infectious virus present in
these peaks was
slightly greater, 6.7- to 7.2-fold, compared to
vF12L and vF12L-rev,
respectively. Thus, the loss of the F12L
protein had a relatively minor
effect on IMV production but reduced
the production of EEV physical
particles approximately fivefold
and of EEV infectious particles
approximately
sevenfold.
The formation of CEV particles by the v

F12L was also analyzed. To do
this, BS-C-1 cells were infected with vF12L, v

F12L,
or vF12L-rev at
5 PFU/cell for 24 h p.i., the medium was removed,
and the cells
were incubated in PBS containing 1 µg of trypsin
per ml for 1 h at
37°C. Infectious virus released from the cells
during this time
(predominately CEV) (
5) was then measured
by plaque assay in
duplicate. The virus titers were as follows:
vF12L, 5.2 × 10
5 PFU/ml; v

F12L, 4.6 × 10
4 PFU/ml;
and vF12L-rev, 3.6 × 10
5 PFU/ml. These results show
that the level of infectious virus
released from v

F12L-infected
cells by this treatment was approximately
8- to 11-fold lower than from
cells infected with vF12L or vF12L-rev.
This suggests that low levels
of CEV particles are produced by
v

F12L and, taken together with the
low levels of EEV made by
this virus (Fig.
7), indicates that the F12L
protein plays an
important role in the formation of cell surface or
released enveloped
virus.
The v
F12L virus is attenuated in vivo.
In several other
cases, mutant viruses that have a decreased plaque size are attenuated
in in vivo models. To determine if the loss of the F12L protein
affected virus virulence, groups of 5 BALB/c mice were infected with
vF12L, v
F12L, or vF12L-rev, and their body weights were recorded
(Fig. 8). After infection with
104 PFU of vF12L or vF12L-rev, all animals suffered rapid
weight loss and were sacrificed by 8 days p.i. In contrast, animals
infected with 104 PFU of v
F12L showed no weight loss and
continued to increase in weight similar to uninfected controls.
Moreover, even at a 10,000-fold-greater dose of virus (108
PFU), the animals infected with the v
F12L remained healthy and had
only a very small (5% maximum), transient weight loss. The loss of the
F12L gene thus reduces VV virulence profoundly.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 8.
Virulence assay. Groups of five BALB/c female mice were
infected intranasally with the indicated doses of vF12L, v F12L, or
vF12L-rev on day 0 (arrow). The mean weight of each group of animals
compared to the weight of the same group on day zero are shown ± the standard error of the mean (n = 5).
|
|
 |
DISCUSSION |
This report shows that the VV F12L gene encodes a 65-kDa protein
that is made early and late during infection and that copurifies with
EEV but not IMV. Although, this might suggest that F12L is another
EEV-specific protein, this is not certain, and additional data using
immunoelectron microscopy and confocal microscopy are needed to examine
this more carefully. These studies are in progress. Previously, the
A36R protein was found to copurify with EEV on density gradients
(36), but subsequent microscopic analysis found that the
protein was not on CEV particles but copurified with membrane fragments
attached to the WR EEV particles (52).
The roles of the F12L protein in virus replication, dissemination, and
virulence were analyzed by using plaque-purified wild-type, deletion
mutant, and revertant viruses that did or did not express the F12L
gene. These analyses showed that F12L protein had only a minor
(twofold) effect on the formation of IMV particles, but the formation
of actin tails and CEV particles was greatly reduced, and the deletion
mutant formed a small plaque. v
F12L produced sevenfold-reduced
levels of infectious EEV, and the virus was dramatically attenuated in vivo.
It remains to be determined where F12L is located in the infected cell
and whether it is associated with cellular or virus membranes. For
these purposes, the virus containing the F12L protein tagged at its C
terminus with an epitope recognized by an MAb will be useful. Although
the F12L protein has several regions of hydrophobic amino acids
residues and several potential sites for attachment of carbohydrate,
these seem not to be used since the protein was unaltered in
electrophoretic mobility in the presence of inhibitors of N- or
O-linked carbohydrate. This suggests that if the protein is associated
with membranes, it has a topology that places the majority of the mass
in the cytosol, so that it is not accessible to enzymes within vesicles
that attach carbohydrate. In this regard, F12L might be similar to the
F13L and A36R proteins that are predominantly in the cytosol rather
than within the lumen of the wrapping membranes (21, 39,
52).
The loss of the F12L protein greatly reduced the formation of actin
tails. Like other viruses that make fewer actin tails, the F12L mutant
has a reduced plaque size, emphasizing the importance of actin tails
for efficient cell-to-cell spread. The production of EEV by viruses
that do not form actin tails is quite variable. In some cases where the
formation of IEV particles is reduced greatly
(v
F13L and v
B5R), the production of EEV is reduced 10- to
100-fold. However, with v
A34R and v
A33R, where IEV
formation is also reduced or incomplete, the production of EEV is
increased 25-fold and 2- to 4-fold, respectively. The v
A36R mutant
makes normal IEV particles but no actin tails and forms three- to
fivefold-reduced EEV. In comparison with these phenotypes the v
F12L
mutant described here makes approximately sevenfold-less
infectious EEV.
Lastly, the virulence of the v
F12L virus was reduced dramatically.
Doses of 104 PFU of wild-type and revertant virus caused
severe illness in mice infected by the intranasal route, whereas this
dose of v
F12L had no noticeable effect. Moreover, even at
10,000-fold-higher doses of v
F12L, the animals suffered little
ill effect. Other mutants that are defective in EEV formation or
cell-to-cell spread also showed dramatic attenuation. In comparison,
mutant viruses that have lost specific immunomodulators, such as
the biosynthetic steroid enzyme 3-
hydroxysteroid
dehydrogenase (33), the type I interferon-binding
protein (49), or the soluble interleukin-1 receptor
(48), exhibited only modest attenuation or even enhanced virulence (1) in this model. Evidently, the ability of VV to spread efficiently from cell-to-cell and more widely by the release of
EEV is far more important for virus virulence than the possession of
these immunomodulators. The latter however, may have profound affects
on the immune response to infection and the immunogenicity of
recombinant viruses.
 |
ACKNOWLEDGMENTS |
This work was supported by a Program Grant from the United
Kingdom Medical Research Council and an equipment grant from The Wellcome Trust.
We thank Henriette van Eijl for critical reading of the manuscript and
Caroline Gubser and Han-Joo Lee for computational analysis.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Wright-Fleming
Institute, Imperial College School of Medicine, St. Mary's Campus,
Norfolk Place, London W2 1PG, United Kingdom. Phone: 44-207-594-3972. Fax: 44-207-594-3973. E-mail: glsmith{at}ic.ac.uk.
Present address: Laboratory of Immunobiology, Dana-Farber Cancer
Institute and Department of Medicine, Harvard Medical School, Boston,
MA 02115.
Present address: Cambridge Antibody Technology Ltd., The
Science Park, Melbourn, Royston, Cambridgeshire SG8 6JJ, United Kingdom.
 |
REFERENCES |
| 1.
|
Alcamí, A., and G. L. Smith.
1992.
A soluble receptor for interleukin-1 beta encoded by vaccinia virus: a novel mechanism of virus modulation of the host response to infection.
Cell
71:153-167[CrossRef][Medline].
|
| 2.
|
Antoine, G.,
F. Scheiflinger,
F. Dorner, and F. G. Falkner.
1998.
The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses.
Virology
244:365-396[CrossRef][Medline].
|
| 3.
|
Appleyard, G.,
A. J. Hapel, and E. A. Boulter.
1971.
An antigenic difference between intracellular and extracellular rabbitpox virus.
J. Gen. Virol.
13:9-17[Abstract/Free Full Text].
|
| 4.
|
Blasco, R., and B. Moss.
1991.
Extracellular vaccinia virus formation and cell-to-cell virus transmission are prevented by deletion of the gene encoding the 37,000-dalton outer envelope protein.
J. Virol.
65:5910-5920[Abstract/Free Full Text].
|
| 5.
|
Blasco, R., and B. Moss.
1992.
Role of cell-associated enveloped vaccinia virus in cell-to-cell spread.
J. Virol.
66:4170-4179[Abstract/Free Full Text].
|
| 6.
|
Boulter, E. A.,
H. T. Zwartouw,
D. H. I. Titmuss, and H. B. Maber.
1971.
The nature of the immune state produced by inactivated vaccinia virus in rabbits.
Am. J. Epidemiol.
94:612-620[Abstract/Free Full Text].
|
| 7.
|
Boyle, D. B., and B. E. H. Coupar.
1988.
A dominant selectable marker for the construction of recombinant poxviruses.
Gene
65:123-128[CrossRef][Medline].
|
| 8.
|
Cameron, C.,
S. Hota-Mitchell,
L. Chen,
J. Barrett,
J. X. Cao,
C. Macaulay,
D. Willer,
D. Evans, and G. McFadden.
1999.
The complete DNA sequence of myxoma virus.
Virology
264:298-318[CrossRef][Medline].
|
| 9.
|
Cudmore, S.,
P. Cossart,
G. Griffiths, and M. Way.
1995.
Actin-based motility of vaccinia virus.
Nature
378:636-638[CrossRef][Medline].
|
| 10.
|
Czerny, C. P., and H. Mahnel.
1990.
Structural and functional analysis of orthopoxvirus epitopes with neutralizing monoclonal antibodies.
J. Gen. Virol.
71:2341-2352[Abstract/Free Full Text].
|
| 11.
|
Dales, S., and E. H. Mosbach.
1968.
Vaccinia as a model for membrane biogenesis.
Virology
35:564-583[CrossRef][Medline].
|
| 12.
|
Duncan, S. A., and G. L. Smith.
1992.
Identification and characterization of an extracellular envelope glycoprotein affecting vaccinia virus egress.
J. Virol.
66:1610-1621[Abstract/Free Full Text].
|
| 13.
|
Engelstad, M.,
S. T. Howard, and G. L. Smith.
1992.
A constitutively expressed vaccinia gene encodes a 42-kDa glycoprotein related to complement control factors that forms part of the extracellular virus envelope.
Virology
188:801-810[CrossRef][Medline].
|
| 14.
|
Engelstad, M., and G. L. Smith.
1993.
The vaccinia virus 42-kDa envelope protein is required for the envelopment and egress of extracellular virus and for virus virulence.
Virology
194:627-637[CrossRef][Medline].
|
| 15.
|
Essani, K., and S. Dales.
1979.
Biogenesis of vaccinia: evidence for more than 100 polypeptides in the virion.
Virology
95:385-394[CrossRef][Medline].
|
| 16.
|
Falkner, F. G., and B. Moss.
1990.
Transient dominant selection of recombinant vaccinia viruses.
J. Virol.
64:3108-3111[Abstract/Free Full Text].
|
| 17.
|
Frischknecht, F.,
V. Moreau,
S. Röttger,
S. Gonfloni,
I. Rechmann,
G. Superti-Furga, and M. Way.
1999.
Actin-based motility of vaccinia virus mimics receptor tyrosine kinase signalling.
Nature
401:926-929[CrossRef][Medline].
|
| 18.
|
Goebel, S. J.,
G. P. Johnson,
M. E. Perkus,
S. W. Davis,
J. P. Winslow, and E. Paoletti.
1990.
The complete DNA sequence of vaccinia virus.
Virology
179:247-266[CrossRef][Medline].
|
| 19.
|
Herrera, E.,
M. del Mar Lorenzo,
R. Blasco, and S. N. Isaacs.
1998.
Functional analysis of vaccinia virus B5R protein: essential role in virus envelopment is independent of a large portion of the extracellular domain.
J. Virol.
72:294-302[Abstract/Free Full Text].
|
| 20.
|
Hiller, G., and K. Weber.
1985.
Golgi-derived membranes that contain an acylated viral polypeptide are used for vaccinia virus envelopment.
J. Virol.
55:651-659[Abstract/Free Full Text].
|
| 21.
|
Hirt, P.,
G. Hiller, and R. Wittek.
1986.
Localization and fine structure of a vaccinia virus gene encoding an envelope antigen.
J. Virol.
58:757-764[Abstract/Free Full Text].
|
| 22.
|
Hollinshead, M.,
A. Vanderplasschen,
G. L. Smith, and D. J. Vaux.
1999.
Vaccinia virus intracellular mature virions contain only one lipid membrane.
J. Virol.
73:1503-1517[Abstract/Free Full Text].
|
| 23.
|
Horton, R. M.,
Z. L. Cai,
S. N. Ho, and L. R. Pease.
1989.
Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.
BioTechniques
8:528-535.
|
| 24.
|
Hughes, S. J.,
L. H. Johnston,
A. de Carlos, and G. L. Smith.
1991.
Vaccinia virus encodes an active thymidylate kinase that complements a cdc8 mutant of Saccharomyces cerevisiae.
J. Biol. Chem.
266:20103-20109[Abstract/Free Full Text].
|
| 25.
|
Ichihashi, Y.,
S. Matsumoto, and S. Dales.
1971.
Biogenesis of poxviruses: role of A-type inclusions and host cell membranes in virus dissemination.
Virology
46:507-532[CrossRef][Medline].
|
| 26.
|
Isaacs, S. N.,
G. J. Kotwal, and B. Moss.
1990.
Reverse guanine phosphoribosyltransferase selection of recombinant vaccinia viruses.
Virology
178:626-630[CrossRef][Medline].
|
| 27.
|
Isaacs, S. N.,
E. J. Wolffe,
L. G. Payne, and B. Moss.
1992.
Characterization of a vaccinia virus-encoded 42-kilodalton class I membrane glycoprotein component of the extracellular virus envelope.
J. Virol.
66:7217-7224[Abstract/Free Full Text].
|
| 28.
|
Joklik, W. K.
1964.
The intracellular uncoating of poxvirus DNA. II. The molecular basis of the uncoating process.
J. Mol. Biol.
8:277-288[Medline].
|
| 29.
|
Kerr, S. M.,
L. H. Johnston,
M. Odell,
S. A. Duncan,
K. M. Law, and G. L. Smith.
1991.
Vaccinia DNA ligase complements Saccharomyces cerevisiae cdc9, localizes in cytoplasmic factories and affects virulence and virus sensitivity to DNA damaging agents.
EMBO J.
10:4343-4350[Medline].
|
| 30.
|
Massung, R. F.,
L. I. Liu,
J. Qi,
J. C. Knight,
T. E. Yuran,
A. R. Kerlavage,
J. M. Parsons,
J. C. Venter, and J. J. Esposito.
1994.
Analysis of the complete genome of smallpox variola major virus strain Bangladesh-1975.
Virology
201:215-240[CrossRef][Medline].
|
| 31.
|
Mathew, E.,
C. M. Sanderson,
M. Hollinshead, and G. L. Smith.
1998.
The extracellular domain of vaccinia virus protein B5R affects plaque phenotype, extracellular enveloped virus release, and intracellular actin tail formation.
J. Virol.
72:2429-2438[Abstract/Free Full Text].
|
| 32.
|
McIntosh, A. A., and G. L. Smith.
1996.
Vaccinia virus glycoprotein A34R is required for infectivity of extracellular enveloped virus.
J. Virol.
70:272-281[Abstract].
|
| 33.
|
Moore, J. B., and G. L. Smith.
1992.
Steroid hormone synthesis by a vaccinia enzyme: a new type of virus virulence factor.
EMBO J.
11:1973-1980[Medline]. (Erratum, 11:3490.)
|
| 34.
|
Moss, B.
1996.
Poxviridae: the viruses and their replication, p. 2637-2671.
In
B. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J. Melnick, T. P. Monath, B. Roizman, and S. E. Straus (ed.), Virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 35.
|
Ogawa, R.,
J. G. Calvert,
N. Yanagida, and K. Nazerian.
1993.
Insertional inactivation of a fowlpox virus homologue of the vaccinia virus F12L gene inhibits the release of enveloped virions.
J. Gen. Virol.
74:55-64[Abstract/Free Full Text].
|
| 36.
|
Parkinson, J. E., and G. L. Smith.
1994.
Vaccinia virus gene A36R encodes a Mr 43-50 K protein on the surface of extracellular enveloped virus.
Virology
204:376-390[CrossRef][Medline].
|
| 37.
|
Roper, R. L.,
L. G. Payne, and B. Moss.
1996.
Extracellular vaccinia virus envelope glycoprotein encoded by the A33R gene.
J. Virol.
70:3753-3762[Abstract].
|
| 38.
|
Roper, R. L.,
E. J. Wolffe,
A. Weisberg, and B. Moss.
1998.
The envelope protein encoded by the A33R gene is required for formation of actin-containing microvilli and efficient cell-to-cell spread of vaccinia virus.
J. Virol.
72:4192-4204[Abstract/Free Full Text].
|
| 39.
|
Röttger, S.,
F. Frischknecht,
I. Reckmann,
G. L. Smith, and M. Way.
1999.
Interactions between vaccinia virus IEV membrane proteins and their roles in IEV assembly and actin tail formation.
J. Virol.
73:2863-2875[Abstract/Free Full Text].
|
| 40.
|
Sanderson, C. M.,
F. Frischknecht,
M. Way,
M. Hollinshead, and G. L. Smith.
1998.
Roles of vaccinia virus EEV-specific proteins in intracellular actin tail formation and low pH-induced cell-cell fusion.
J. Gen. Virol.
79:1415-1425[Abstract].
|
| 41.
|
Sanderson, C. M.,
M. Hollinshead, and G. L. Smith.
2000.
The vaccinia virus A27L gene is needed for the microtubule-dependent transport of intracellular mature virus particles.
J. Gen. Virol.
81:47-58[Abstract/Free Full Text].
|
| 42.
|
Schmelz, M.,
B. Sodeik,
M. Ericsson,
E. Wolffe,
H. Shida,
G. Hiller, and G. Griffiths.
1994.
Assembly of vaccinia virus: the second wrapping cisterna is derived from the trans Golgi network.
J. Virol.
68:130-147[Abstract/Free Full Text].
|
| 43.
|
Senkevich, T. G.,
J. J. Bugert,
J. R. Sisler,
E. V. Koonin,
G. Darai, and B. Moss.
1996.
Genome sequence of a human tumorigenic poxvirus: prediction of specific host response-evasion genes.
Science
273:813-816[Abstract].
|
| 44.
|
Shchelkunov, S. N.,
R. F. Massung, and J. J. Esposito.
1995.
Comparison of the genome DNA sequences of Bangladesh-1975 and India-1967 variola viruses.
Virus Res.
36:107-118[CrossRef][Medline].
|
| 45.
|
Shida, H.
1986.
Nucleotide sequence of the vaccinia virus hemagglutinin gene.
Virology
150:451-462[CrossRef][Medline].
|
| 46.
|
Smith, G. L.,
Y. S. Chan, and S. T. Howard.
1991.
Nucleotide sequence of the 42 kbp of vaccinia virus strain WR from near the right inverted terminal repeat.
J. Gen. Virol.
72:1349-1376[Abstract/Free Full Text].
|
| 47.
|
Sodeik, B.,
R. W. Doms,
M. Ericsson,
G. Hiller,
C. E. Machamer,
W. van't Hof,
G. van Meer,
B. Moss, and G. Griffiths.
1993.
Assembly of vaccinia virus: role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks.
J. Cell Biol.
121:521-541[Abstract/Free Full Text].
|
| 48.
|
Spriggs, M.,
D. E. Hruby,
C. R. Maliszewski,
D. J. Pickup,
J. E. Sims,
R. M. L. Buller, and J. Vanslyke.
1992.
Vaccinia and cowpox viruses encode a novel secreted interleukin-1 binding protein.
Cell
71:145-152[CrossRef][Medline].
|
| 49.
|
Symons, J. A.,
A. Alcamí, and G. L. Smith.
1995.
Vaccinia virus encodes a soluble type I interferon receptor of novel structure and broad species specificity.
Cell
81:551-560[CrossRef][Medline].
|
| 50.
|
Tooze, J.,
M. Hollinshead,
B. Reis,
K. Radsak, and H. Kern.
1993.
Progeny vaccinia and human cytomegalovirus particles utilize early endosomal cisternae for their envelopes.
Eur. J. Cell Biol.
60:163-178[Medline].
|
| 51.
|
Turner, G. S., and E. J. Squires.
1971.
Inactivated smallpox vaccine: immunogenicity of inactivated intracellular and extracellular vaccinia virus.
J. Gen. Virol.
13:19-25[Abstract/Free Full Text].
|
| 52.
|
van Eijl, H.,
M. Hollinshead, and G. L. Smith.
2000.
The vaccinia virus A36R protein is a type Ib membrane protein present on intracellular but not extracellular enveloped particles.
Virology
271:26-36[CrossRef][Medline].
|
| 53.
|
Vanderplasschen, A., and G. L. Smith.
1997.
A novel virus binding assay using confocal microscopy: demonstration that the intracellular and extracellular vaccinia virions bind to different cellular receptors.
J. Virol.
71:4032-4041[Abstract].
|
| 54.
|
Ward, G. A.,
C. K. Stover,
B. Moss, and T. R. Fuerst.
1995.
Stringent chemical and thermal regulation of recombinant gene expression by vaccinia virus vectors in mammalian cells.
Proc. Natl. Acad. Sci. USA
92:6773-6777[Abstract/Free Full Text].
|
| 55.
|
Willer, D. O.,
G. McFadden, and D. H. Evans.
1999.
The complete genome sequence of shope (rabbit) fibroma virus.
Virology
264:319-343[CrossRef][Medline].
|
| 56.
|
Wolffe, E. J.,
S. N. Isaacs, and B. Moss.
1993.
Deletion of the vaccinia virus B5R gene encoding a 42-kilodalton membrane glycoprotein inhibits extracellular virus envelope formation and dissemination.
J. Virol.
67:4732-4741[Abstract/Free Full Text].
|
| 57.
|
Wolffe, E. J.,
E. Katz,
A. Weisberg, and B. Moss.
1997.
The A34R glycoprotein gene is required for induction of specialized actin-containing microvilli and efficient cell-to-cell transmission of vaccinia virus.
J. Virol.
71:3904-3915[Abstract].
|
| 58.
|
Wolffe, E. J.,
A. S. Weisberg, and B. Moss.
1998.
Role for the vaccinia virus A36R outer envelope protein in the formation of virus-tipped actin-containing microvilli and cell-to-cell virus spread.
Virology
244:20-26[CrossRef][Medline].
|
Journal of Virology, December 2000, p. 11654-11662, Vol. 74, No. 24
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Olson, V. A., Karem, K. L., Smith, S. K., Hughes, C. M., Damon, I. K.
(2009). Smallpox virus plaque phenotypes: genetic, geographical and case fatality relationships. J. Gen. Virol.
90: 792-798
[Abstract]
[Full Text]
-
Johnston, S. C., Ward, B. M.
(2009). Vaccinia Virus Protein F12 Associates with Intracellular Enveloped Virions through an Interaction with A36. J. Virol.
83: 1708-1717
[Abstract]
[Full Text]
-
Meyer, V. S., Kastenmuller, W., Gasteiger, G., Franz-Wachtel, M., Lamkemeyer, T., Rammensee, H.-G., Stevanovic, S., Sigurdardottir, D., Drexler, I.
(2008). Long-Term Immunity against Actual Poxviral HLA Ligands as Identified by Differential Stable Isotope Labeling. J. Immunol.
181: 6371-6383
[Abstract]
[Full Text]
-
Izmailyan, R., Chang, W.
(2008). Vaccinia Virus WR53.5/F14.5 Protein Is a New Component of Intracellular Mature Virus and Is Important for Calcium-Independent Cell Adhesion and Vaccinia Virus Virulence in Mice. J. Virol.
82: 10079-10087
[Abstract]
[Full Text]
-
Domi, A., Weisberg, A. S., Moss, B.
(2008). Vaccinia Virus E2L Null Mutants Exhibit a Major Reduction in Extracellular Virion Formation and Virus Spread. J. Virol.
82: 4215-4226
[Abstract]
[Full Text]
-
Earley, A. K., Chan, W. M., Ward, B. M.
(2008). The Vaccinia Virus B5 Protein Requires A34 for Efficient Intracellular Trafficking from the Endoplasmic Reticulum to the Site of Wrapping and Incorporation into Progeny Virions. J. Virol.
82: 2161-2169
[Abstract]
[Full Text]
-
Perdiguero, B., Lorenzo, M. M., Blasco, R.
(2008). Vaccinia Virus A34 Glycoprotein Determines the Protein Composition of the Extracellular Virus Envelope. J. Virol.
82: 2150-2160
[Abstract]
[Full Text]
-
Perdiguero, B., Blasco, R.
(2006). Interaction between Vaccinia Virus Extracellular Virus Envelope A33 and B5 Glycoproteins.. J. Virol.
80: 8763-8777
[Abstract]
[Full Text]
-
Roper, R. L.
(2006). Characterization of the Vaccinia Virus A35R Protein and Its Role in Virulence. J. Virol.
80: 306-313
[Abstract]
[Full Text]
-
Herrero-Martinez, E., Roberts, K. L., Hollinshead, M., Smith, G. L.
(2005). Vaccinia virus intracellular enveloped virions move to the cell periphery on microtubules in the absence of the A36R protein. J. Gen. Virol.
86: 2961-2968
[Abstract]
[Full Text]
-
Yang, G., Pevear, D. C., Davies, M. H., Collett, M. S., Bailey, T., Rippen, S., Barone, L., Burns, C., Rhodes, G., Tohan, S., Huggins, J. W., Baker, R. O., Buller, R. L. M., Touchette, E., Waller, K., Schriewer, J., Neyts, J., DeClercq, E., Jones, K., Hruby, D., Jordan, R.
(2005). An Orally Bioavailable Antipoxvirus Compound (ST-246) Inhibits Extracellular Virus Formation and Protects Mice from Lethal Orthopoxvirus Challenge. J. Virol.
79: 13139-13149
[Abstract]
[Full Text]
-
Davies, D. H., McCausland, M. M., Valdez, C., Huynh, D., Hernandez, J. E., Mu, Y., Hirst, S., Villarreal, L., Felgner, P. L., Crotty, S.
(2005). Vaccinia Virus H3L Envelope Protein Is a Major Target of Neutralizing Antibodies in Humans and Elicits Protection against Lethal Challenge in Mice. J. Virol.
79: 11724-11733
[Abstract]
[Full Text]
-
Law, M., Hollinshead, M., Lee, H.-J., Smith, G. L.
(2004). Yaba-like disease virus protein Y144R, a member of the complement control protein family, is present on enveloped virions that are associated with virus-induced actin tails. J. Gen. Virol.
85: 1279-1290
[Abstract]
[Full Text]
-
Ward, B. M., Moss, B.
(2004). Vaccinia Virus A36R Membrane Protein Provides a Direct Link between Intracellular Enveloped Virions and the Microtubule Motor Kinesin. J. Virol.
78: 2486-2493
[Abstract]
[Full Text]
-
Ward, B. M., Weisberg, A. S., Moss, B.
(2003). Mapping and Functional Analysis of Interaction Sites within the Cytoplasmic Domains of the Vaccinia Virus A33R and A36R Envelope Proteins. J. Virol.
77: 4113-4126
[Abstract]
[Full Text]
-
Smith, G. L., Vanderplasschen, A., Law, M.
(2002). The formation and function of extracellular enveloped vaccinia virus. J. Gen. Virol.
83: 2915-2931
[Abstract]
[Full Text]
-
Krauss, O., Hollinshead, R., Hollinshead, M., Smith, G. L.
(2002). An investigation of incorporation of cellular antigens into vaccinia virus particles. J. Gen. Virol.
83: 2347-2359
[Abstract]
[Full Text]
-
Johnson, D. C., Huber, M. T.
(2002). Directed Egress of Animal Viruses Promotes Cell-to-Cell Spread. J. Virol.
76: 1-8
[Full Text]
-
van Eijl, H., Hollinshead, M., Rodger, G., Zhang, W.-H., Smith, G. L.
(2002). The vaccinia virus F12L protein is associated with intracellular enveloped virus particles and is required for their egress to the cell surface. J. Gen. Virol.
83: 195-207
[Abstract]
[Full Text]
-
Law, M., Hollinshead, R., Smith, G. L.
(2002). Antibody-sensitive and antibody-resistant cell-to-cell spread by vaccinia virus: role of the A33R protein in antibody-resistant spread. J. Gen. Virol.
83: 209-222
[Abstract]
[Full Text]
-
Goldberg, M. B.
(2001). Actin-Based Motility of Intracellular Microbial Pathogens. Microbiol. Mol. Biol. Rev.
65: 595-626
[Abstract]
[Full Text]
-
Husain, M., Moss, B.
(2001). Vaccinia Virus F13L Protein with a Conserved Phospholipase Catalytic Motif Induces Colocalization of the B5R Envelope Glycoprotein in Post-Golgi Vesicles. J. Virol.
75: 7528-7542
[Abstract]
[Full Text]
-
Mathew, E. C., Sanderson, C. M., Hollinshead, R., Smith, G. L.
(2001). A mutational analysis of the vaccinia virus B5R protein. J. Gen. Virol.
82: 1199-1213
[Abstract]
[Full Text]