INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Adenovirus vectors (AdV) have a recognized potential for gene delivery, founded on their broad host range, robust growth in culture, and capacity to infect mitotically quiescent cells (13, 45). AdV can be propagated in a helper cell line, 293, a human embryonic kidney cell line transformed by adenovirus type 5 (14). 293 cells express the viral E1 gene products (E1a and E1b) that are the master regulatory proteins for subsequent viral gene expression. E1-deleted viruses can propagate in 293 cells but not in other cells. Although it would be expected that E1-deleted viruses lack the machinery to express viral genes, several studies have demonstrated that cellular E1-like components can stimulate viral gene expression (24, 39, 43). The expression of these viral genes results in the relatively rapid elimination of transduced cells in vivo as a result of a cytotoxic T-cell responses (46-48). Thus, attention has focused on eliminating the remaining vestiges of viral expression. Viral genes that have been deleted for this purpose include the gene for E4 proteins (4, 29, 51), DNA-binding protein (9, 12), DNA polymerase (3), and the preterminal protein (42). The most aggressive approach has been the creation of helper virus-dependent vectors that lack all viral genes (18, 28, 32, 34, 40). These vectors have high capacity, evoke reduced cellular immune responses, and show prolonged expression in vivo (37). However to deploy these viruses on the scale required for human clinical application presents major challenges because a CsCl gradient is needed to remove the helper virus.

We have developed a different approach to the problem of creating a gene expression unit devoid of vector-derived open reading frames. In this strategy, the vector is propagated as a linear, helper-independent virus in the conventional way on 293 cells. Upon introduction into the host cell, the viral chromosome undergoes a site-specific rearrangement to form a circular episome expressing the gene of interest. The viral enhancer is excised as a result of the rearrangement, leaving a deleted linear DNA without enhancer function.

The adenoviral enhancer and packaging signals are found as a mosaic structure at the left end of the viral genome and are essential for viral gene expression and encapsidation of the viral genome (19, 20). In principle, viral gene expression in target cells should be decreased by disconnecting this sole enhancer element from the genome. This approach should also allow more sophisticated rearrangements to be incorporated, in which the linear remnant is subjected to additional genoclastic remodeling. Like the vector systems recently described by Berk, Perricaudet, and coworkers, the rearrangement is carried out by Cre recombinase acting on loxP sites (31, 44). However the present system does not rely on a helper virus expressing Cre and, perhaps because of this, is not subject to the unexplained toxicity seen in the two-virus system (44).

We also introduce here a convenient and effective strategy for producing recombinant adenoviruses that is based on the use of intron endonucleases and bacteriophage lambda in vitro packaging. Due to its simplicity and reliability, this approach has substantial advantages over traditional methods, which rely on homologous recombination between plasmids cotransfected into 293 cells, and over various recently described strategies (7, 18, 27, 35, 36, 38) that aim to circumvent the rate-limiting in vivo recombination step. In this report we present a two-cosmid system for generating AdV, based on  phage packaging and the use of highly specific intron-encoded endonucleases, I-CeuI and PI-PspI. Inclusion of intron endonuclease cleavage sites at the ends of the viral DNA allows the viral genome to be liberated from its cosmid context, resulting in improved (10- to 100-fold) generation of recombinant viruses compared to a related cosmid approach (10).

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Adenovirus type 2 (Ad2) DNA was purchased from Sigma. Restriction enzymes, intron endonucleases I-CeuI and PI-PspI, and Moloney murine leukemia virus reverse transcriptase (RT) were purchased from New England Biolabs, Stratagene, or Promega. DNA fragments amplified by PCR were confirmed by DNA sequencing. Nucleotide (nt) positions refer to the wild-type Ad2 sequence in GenBank (J019017).

Two-cosmid system. The EcoRI-BsaI fragment that spans the ampicillin resistance gene in pBR322 was deleted and replaced by a synthetic adapter, and the bacteriophage  cos site was inserted between the unique StyI and BsmI sites. A PCR-amplified Ad2 fragment containing the left-end inverted terminal repeat (ITR) enhancer elements, and the encapsidation signal (nt 1 to 376) was created and inserted into the adapter (Fig. 1) to yield the tetracycline-resistant left-end plasmid pLEP. The right end of Ad2 from the AflII site to the right end (nt 3527 to 35937) was assembled into an ampicillin-resistant cosmid vector, pACKrr3, by multiple steps of PCR amplification and fragment interchange. The resultant cosmid was termed pREP7. To expand vector capacity, two deletions were incorporated into the pREP7 cosmid, an E3 gene deletion (nt 27901 to 30841, 2,840 bp; cosmid pREP8) and a 1.3-kb deletion (nt 34121 to 35469) in the E4 region of the Ad2 region (pREP12). Complete vector sequences are available from the authors.

View larger version (22K): [in this window] [in a new window]   FIG. 1.   Schematic structure of the AdV system. (A) Diagram of the pLEP cosmid polylinker region and its position relative to the adenoviral left ITR. The adenovirus enhancer (Enh)/packaging sequence () is boxed. (B) Generation of a single cosmid encoding the AdV genome by the direct ligation of two smaller plasmids. A gene expression unit (CMV-GFP) was inserted into the pLEP cosmid at the polylinker region. pLEP and pREP cosmids were digested with an intron endonuclease (PI-PspI), ligated, and packaged in vitro to generate pAd2CMVGFP. This DNA was then digested with another intron endonuclease (I-CeuI) to expose the ITRs at both ends of the viral genome (L., left; R., right). Finally, cosmid digestion mixtures were transfected into 293 cells. Plaques generated by recombinant viruses are detected in 7 to 10 days. MCS, multiple cloning site; WT, wild type; TP, terminal protein.

Preparation of recombinant AdV. One microgram of PI-PspI-digested pLEP plasmid was dephosphorylated and ligated to 1 µg of a PI-PspI-cleaved pREP plasmid in a 20-µl reaction for 2 h at room temperature, and 4 µl of the ligated DNA was packaged in a  phage extract (MaxPlax lambda packaging extracts; Epicentre Technologies). One-tenth of the packaged material was used to transduce Escherichia coli DH5 or DK1 cells. Transductants containing pLEP fused to pREP were selected on agar containing ampicillin (25 µg/ml) and tetracycline (12.5 µg/ml) (Amp/Tet). Colonies were selected and DNA was isolated (Qiagen). DNA was used either for restriction analysis or for transfection of 293 cells as described below.

Cultured cells and primary human hepatocytes. 293 (human embryonic kidney) cells were obtained from Microbix Biosystems (Ontario, Canada). HepG2 (human hepatocellular carcinoma), HeLa (human cervical epitheloid carcinoma), A-431 (human epidermoid carcinoma), and HT29 (human colon adenocarcinoma) cells were all obtained from the American Type Culture Collection. All cells were cultured in complete Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, and penicillin-streptomycin (Gibco-BRL) and maintained at 37°C and 5% CO₂ atmosphere in an incubator. Primary human hepatocytes, generously provided by Albert Edge (Diacrin, Inc., Charlestown, Mass.), were isolated and cultured as described (15).

Generation of AdV by transfecting linearized cosmid DNA. 293 cells were cultured in 10-cm dishes in DMEM-FBS. Cells were grown to ~50% confluence on the day of transfection. Ten micrograms of cosmid DNA was digested with I-CeuI in a volume of 50 µl. The reaction mixture was transfected into 293 cells by calcium phosphate precipitation (13) without purification. After transfection, cells were cultured and examined daily for the appearance of cytopathic effects. Virus propagation and purification, plaque assay, and viral DNA isolation were performed by established protocols (13).

Liver-specific promoter. Human hepatic control regions 1 and 2 (HCR1 and -2) of the ApoE/C gene locus (2, 8) were amplified by PCR using 293 cell genomic DNA as the template. The following primers were used to amplify both HCR1 and HCR2 fragments: HCRtop (5'GCGGAATTCGGCTTGGTGACTTAGAGAACAGAG3') and HCRbot (5'GCGGGATCCTTGAACCCGGACCCTCTCACACTA3'). The amplified PCR fragments (~0.39 kb) were cloned into pUC19. The HCR1 and HCR2 sequences were confirmed by dideoxy DNA sequencing. The two fragments were assembled in a head-to-tail orientation, fused with a synthetic basal TATA element (B. Seed, unpublished), and cloned in a parental pLEP vector containing a GFP reporter gene. The resultant plasmid was named pLEPHCR12GFP.

Self-resolving AdV. The self-resolving AdV was generated using the two-cosmid system. A plasmid, pAd2237 (Eunchung Park, personal communication), containing loxP sites, a GFP reporter gene (16), EBNA-1/OriP, and sequences encoding Cre recombinase was used to incorporate these elements into the pLEP plasmid to yield pLEP1BHCRGFP. To generate the self-resolving AdV, 1 µg of pLEP1BHCRGFP DNA and 1 µg of pREP8 (E1E3) were digested with PI-PspI, ligated, packaged, and assembled into one cosmid named pAdVEBV as described above.

Assessment of GFP expression and titering. GFP expression was assessed by fluorescence microscopy (Olympus IX70) or microtiter plate reader (PerSeptive Biosystem CytoFluor II). For the latter, 5 × 10⁴ 293 cells were seeded into each well of a 96-well plate. The cells were infected with serially diluted virus stock and cultured for 48 h, and GFP intensity was measured. Titers were estimated by interpolation into the linear region of a standard curve prepared from virus of known (plaque-derived) titer. All titers were determined in triplicate.

Virus infection, DNA, RNA isolation, and blot analysis. HepG2 and HeLa cells were seeded in 35-mm dishes and cultured to approximately 80% confluence in DMEM-FBS. Cells were infected with the desired multiplicity of virus in a volume of 1 ml at 37°C for 2 h. At the end of the incubation, cells were washed with phosphate-buffered saline (PBS) twice and cultured in 2 ml of medium. Cells were collected in parallel at desired points for low-molecular-weight DNA and RNA extraction. Low-molecular-weight DNA was extracted from the infected cells as described (22), and total RNA was prepared using RNAzol solution (Tel-Test, Inc.).

RT-PCR, PCR, and quantitative PCR. Four micrograms of total RNA was reverse transcribed into cDNA using Moloney murine leukemia virus RT by a standard protocol (Promega). The cDNA from each sample (1 µl) was used in subsequent PCRs. PCR primers were designed to amplify the tripartite leader sequence of the adenovirus late genes: TPL1 (5' ACT CTC TTC CGC ATC GCT GT 3') and TPL2 (5' CTT GCG ACT GTG ACT GGT TAG 3'). For detection of the AdV genome in the Hirt DNA samples, 1 µg of DNA was employed in the PCR amplification using the following primers, which are specific for the adenovirus DNA in the fiber gene: Fiber1 (5' CCG CAC CCA CTA TCT TCA TA 3') and Fiber2 (5' GGT GTC CAA AGG TTC GGA GA 3'). PCRs were performed as 95°C for 30 s, 54°C for 30 s, and 72°C for 30 s for 30 cycles. All amplified products were analyzed on a 2% agarose gel.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Development of a two-cosmid system for efficient construction of recombinant AdV. To simplify and facilitate the generation of recombinant AdV, we established a system to assemble the desired AdV genome in a single plasmid by ligation (Fig. 1). The system consists of two component vectors, a left-end plasmid, pLEP, and a right-end plasmid, pREP. The left-end adenovirus sequences (nt 1 to 376) in pLEP include the viral inverted terminal repeat, the cis-acting packaging sequences, and the viral enhancer. The adenovirus sequences are followed by the gene expression unit intended for delivery and an intron endonuclease (PI-PspI) cleavage site. The right-end plasmid contains a PI-PspI site followed by the Ad2 genome from the end of the E1 locus rightward (nt 3527 to 35937).

View larger version (36K): [in this window] [in a new window]   FIG. 2.   Confirmation of the structure of recombinant adenoviruses. (A) Restriction analysis of cosmids carrying the full-length AdV DNA, showing uniform generation of the desired vector DNA. DNA samples (2 µg) from four pAd2-7CMVGFP colonies were digested with BglII, resolved on a 1% agarose gel, and stained with ethidium bromide. The predicted sizes of the DNA fragments are 13,261, 7,684, 5,228, 5,088, 2,284, 1,757, 1,549, 1,270, 351, and 275 bp. The 5,228- and 5,088-bp fragments appear as a doublet, and the 351- and 275-bp fragments are too small to be seen on the gel. (B) Release of the recombinant DNA from cosmids by I-CeuI digestion. pAd2-7CMV DNA (2 µg) from two clones was digested with I-CeuI. Arrows indicated the position of the released recombinant AdV DNA and the vector fragments of approximately 35 and 5 kb.

View larger version (17K): [in this window] [in a new window]   FIG. 3.   Exposure of ITRs enhances the efficiency of AdV generation. (A) The appearance of plaques in 293 cells transfected with 10 µg of pIAdGFPB with no ITR exposed (undigested), one ITR exposed (BsaBI or I-CeuI), or both ITRs exposed (BsaBI plus I-CeuI) was determined. Values represent the mean plaque counts per dish (CPEs) and the time required for plaque development in 293 cells from three separate experiments. I, I-CeuI; B, BsaBI. (B) Plaques were allowed to grow over 10 days after transfection. Viruses were harvested, and the titer of each virus stock was determined by a GFP-based semiquantitative titration procedure described in the text. Values represent the mean ± standard error for three independent determinations.

Construction of an AdV capable of self-rearrangement. One approach to attenuating adenoviral gene expression and improving transgene persistence is the creation of viruses capable of undergoing internal, self-directed rearrangement upon delivery to the target tissue. In principle, this objective can be achieved through the regulated expression of site-specific recombinases in vectors that contain the cis-acting target of recombinase action. To allow such vectors to be created, the recombinase activity must be suppressed during propagation in the packaging cell line. We have explored a number of strategies to achieve this end; one of the more effective to date has been the use of a lineage-specific promoter to control recombinase expression.

View larger version (35K): [in this window] [in a new window]   FIG. 4.   Linear AdV that resolves into a circular episome. The elements involved in the self-directed rearrangement of the vector are shown schematically in pLEP1BHCRGFP/EBV and in the corresponding AdV. Starting from the left ITR (L.ITR), the elements are shown in the following sequence: L.ITR, 147 bp; first 34-bp loxP site; 185-bp enhancer/packaging signal; 64-bp splicing acceptor (SA) from EF1 gene first intron; 720-bp GFP cDNA; 230-bp simian virus 40 (SV40) poly(A) site; 1.7-kb TK-EBNA-1/OriP; 970-bp HCR12 promoter; 1-kb EF1 gene first intron containing splicing donor (SD) and acceptor (SA) sites with the second loxP site inserted at 64 bp upstream of the 3' end; 1.2-kb Cre gene tagged with AU1 and a nuclear localization signal; ~120-bp poly(A) signal and PI-PspI site. After infection of liver cells, the HCR12 promoter drives the expression of Cre, which results in cleavage of the two loxP sites. This results in circularization of the fragment containing the EBV replicon. The excision severs the connection between the enhancer/packaging signals and the remainder of the AdV genome. The Cre gene becomes promoterless and is left on the AdV genome fragment. After excision, the HCR12 promoter drives the expression of the GFP reporter gene. The EBV replicon maintains the excised circle as an episome in host cells.

Rearrangement in target and nontarget cells. To test excision efficiency, HepG2 (hepatocellular carcinoma) and HeLa (cervical carcinoma) cells were infected with virus at a multiplicity of infection (MOI) of 1,000 nominal particles/cell. This titer corresponds to approximately 10 PFU per cell. Cells were examined for GFP expression before extraction of DNA for analysis of chromosomal rearrangement. Hirt DNA (5 µg) was digested with BglII and analyzed by DNA blot techniques (Fig. 5). The BglII fragment from the noncircularized AdV is 3,162 bp, generated from the 5' end of the AdV to the first BglII site in the AdV. The circularized fragment, created from the two loxP sites, has a size of 4,915 bp (Fig. 5A). Densitometry revealed that at 72 h postinfection, 95% or more of the input genomes had undergone circularization in HepG2 cells. In contrast, low but detectable levels of circularized fragment could be visualized in HeLa cells infected at the same time and at the same MOI used for the HepG2 cells (Fig. 5B).

View larger version (46K): [in this window] [in a new window]   FIG. 5.   Blot analyses of the self-resolving AdV genome, documenting DNA self-rearrangement in HepG2 and HeLa cells. Cells were infected with Ad2HCRGFP/EBV viruses for 2 h at 37°C. Hirt DNA samples were extracted from the cells, and ~5 µg of Hirt DNA samples were digested with BglII and analyzed by Southern blot techniques using a 32P-labeled EBNA-1 fragment as the hybridization probe. (A) Schematic representation of the loxP sites and EBNA-1 locations in the AdV genome. The relevant BglII site is also shown. (B) Time course from 0 to 72 h of rearrangement in HepG2 and HeLa cells at an equal MOI of 1,000 particles per cell. (C) DNA blot results obtained from HeLa cells infected at an MOI of 10,000 and HepG2 cells at an MOI of 1,000. The upper bands (4,915 bp) represent the circularized DNA fragments, whereas the lower bands (3,162 bp) represent the noncircularized AdV.

View larger version (28K): [in this window] [in a new window]   FIG. 6.   GFP expression in liver and nonliver cells infected with the Ad2HCRGFP/EBV viruses. Cells were cultured in 35-mm dishes and infected with the Ad2HCRGFP/EBV virus at the desired MOI. (A) HepG2 cells were infected with 1,000 particles per cell, whereas HeLa cells were infected with 10,000. GFP expression was examined at the indicated time points after infection. Fluorescent cells were photographed using an Olympus SC 35-mm camera mounted on an Olympus IX70 fluorescent microscope, at ×200 magnification, using a filter with peak excitation and emission wavelengths of 450 and 510 nm, respectively. HepG2, HeLa, A431, and HT29 cells (B) and human primary hepatocytes (C) were seeded in 35-mm dishes and infected with the Ad2HCRGFP/EBV virus at an MOI of 10,000 particles per cell. GFP expression was examined at 72 h after infection. The human primary hepatocytes were photographed under bright-field (left) and fluorescent (right) conditions.

Diminished viral gene expression in rearranged AdV. After excision, the adenovirus major enhancer/packaging signal segregates with the episomal DNA, yielding a linear fragment containing the remainder of the AdV genome without this important cis element (Fig. 4). To assess the impact of enhancer deletion, quantitative RT-PCR measurement of late viral gene expression was performed. As most late adenoviral gene transcripts have a common ~200-bp tripartite leader (TPL) sequence (1), the TPL sequence was chosen as a marker of viral gene expression. HepG2 cells were infected with the first-generation vectors Ad2CMVGFP and Ad2HCRGFP or the self-resolving vector Ad2HCRGFP/EBV using increasing MOIs. Total cellular RNA and low-molecular-weight DNA were isolated in parallel. RT-PCR was performed to quantitate the amount of RNA encoding the TPL in the cDNA samples. PCR amplification of a 201-bp fiber gene fragment from the AdV genome was used to detect the amount of viral genome in the DNA samples. A representative result of three experiments is shown in Fig. 7A. TPL sequences were detected, 72 h postinfection, with either 100 or 1,000 viruses infected per cell using both the first-generation adenoviruses (upper panel). In contrast, no TPL signal was detected in the self-resolving Ad2HCRGFP/EBV-infected cells, even at an MOI of 100,000/cell. PCR amplification of the AdV fiber gene revealed comparable levels of AdV genomic DNA in cells infected at comparable MOIs (Fig. 7A, lower panel). The cDNA samples in which the TPL signals were detected were further analyzed by real-time fluorescence PCR. The corresponding genomic DNA samples were also analyzed to determine the number of AdV genomes present in each sample. The results are summarized in Fig. 7B. Approximately 10⁴ TPL per 10⁶ AdV genomes were detected in the Ad2HCRGFP-infected cells, but no detectable TPL was found in the self-resolving Ad2HCRGFP/EBV-infected cells. These results suggest that adenoviral gene expression is dramatically reduced by the separation of the viral enhancer sequences occasioned by the rearrangement of the self-resolving vector.

View larger version (36K): [in this window] [in a new window]   FIG. 7.   PCR analyses of adenovirus late gene expression in cells infected with the first-generation AdVs or the self-resolving Ad2HCRGFP/EBV. HepG2 cells were cultured in 35-mm dishes and infected with increasing MOIs (0, 10, 100, 1000, 10,000, and 100,000) of AdV. RNA and DNA were isolated in parallel from the cells at 72 h after infection. (A) RT-PCR was performed to detect the TPL sequence (upper panel) for virus late gene expression; and PCR was performed in the DNA samples for detection of the AdV genomes. The specific target sequences are described in detail in Materials and Methods. (B) Summary of quantitative RT-PCR and PCR results. Each determination is the average of three experiments.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Viral gene delivery vehicles are attractive vectors for human gene therapy. They transduce foreign genes efficiently and deliver large amounts of genetic material without incurring the high mutation rate that naked DNA undergoes upon transfection (5, 6, 30, 41). Large-scale production of recombinant viruses appears feasible, and clinically acceptable formulations could be deployed therapeutically without investment in a substantial infrastructure for local production and use.

Evading the genetically honed ability of the immune system to recognize and destroy viruses and virus-infected cells poses a substantial challenge. Both the humoral and cellular arms of the immune system participate in viral rejection, the humoral arm through antibody recognition and neutralization of the viral particle (11, 48), and the cellular arm through recognition of intracellular peptides either synthesized de novo by viral genes or borne into the cell during infection (25, 48). This paper reports the development of a vector designed to enhance the persistence of virally delivered genes and evade the cellular immune response by severing the connection between the sole adenoviral enhancer and the sequences encoding potentially antigenic viral proteins. Our data indicate that segregation of the enhancer from the multiple adenoviral genes that utilize the common TPL sequence results in a dramatic reduction in viral gene expression.

Previous studies have demonstrated that excision of the enhancer element could affect late gene transcription either directly (21), by diminishing the expression of other early gene products (19, 20, 33), or through a combination of these factors. Conversely, early viral genes can be upregulated by insertion of the adenovirus enhancer element, even in the absence of E1 function (23). Although the relative potency of the different possible contributions to diminished expression is not known, the magnitude of the observed effect is substantial and supports the utility of regulated rearrangement as a strategy for the creation of scaleable AdV for clinical uses. Because of the intermingling of the adenovirus enhancer and packaging sequences, it has been difficult to assess enhancer function by generating an enhancerless virus without compromising viral growth or viability (20). The self-resolving AdV system provides a tool to analyze the roles of the enhancer in viral gene regulation and virus growth.

The circularization of the vector via the action of Cre recombinase has the additional benefit of placing the therapeutic gene on a self-replicating episome. Vector circularization occurs in a tissue-targeted manner, in this case as a result of the activation of a synthetic liver-specific promoter upstream of Cre. Once circularized, the EBV replicon in the episome confers improved persistence on the therapeutic gene, as detected by reporter gene expression and direct assay for the presence of vector DNA sequences (26, 31, 49, 50).

The self-resolving adenovirus/EBV vector used in the present study differs from two previously reported adenovirus/EBV hybrid vectors (31, 44), both by removal of the enhancer and by the method by which Cre recombinase is delivered to the host cell to induce vector rearrangement. In these Cre helper virus-dependent systems, coinfection with an AdV expressing Cre recombinase is required to initiate the cyclization process. The present system places the Cre recombinase and loxP recombination sites on a single vector. Because manipulation of plasmids containing both Cre and loxP sites in this study was occasionally frustrated by the expression of low levels of Cre in E. coli, we introduced an intron into the Cre cDNA. Constructs bearing the intron were easily manipulated in E. coli and gave robust expression in mammalian cells. The use of hepatic locus control elements from the apoE/C gene region allows adequate suppression of expression in 293 cells while permitting recombination and subsequent gene expression in the target tissue. This approach eliminates the requirement for a helper virus, thus avoiding two potential limitations of that system. First, the continuous expression of Cre recombinase may lead to toxicity in host cells, either as a direct consequence of the protein's activity or via its immunogenicity. Second, the Cre helper virus may itself produce antigenic viral proteins that contribute to the immunologic elimination of infected host cells. In contrast, the self-resolving adenovirus/EBV vector system provides no alternative source of viral proteins, and Cre expression is terminated upon rearrangement.

The synthetic liver-specific promoter used in this work provided a means to control Cre recombinase expression during propagation of the vector in 293 cells and allowed us to test the consequences of abstracting the enhancer from the linear vector DNA upon delivery of the DNA to the target cells. However, promoter activity was not completely extinguished in some nonhepatic cells, as revealed by cyclization of the input DNA in HeLa cells. Despite this, expression of the transduced gene was minimal in HeLa cells compared to that seen in HepG2 cells or primary hepatocytes. Future efforts will be directed at creating more efficient molecular switches to improve control of circularization and gene expression.

We have also reported here a convenient general system for creating recombinant adenoviruses, which may increase their attractiveness as gene transduction tools for basic research. The system employs two conventional plasmid vectors and a  phage packaging step. The entire recombinant AdV genome is assembled into a single cosmid that is easily amplified in E. coli. A similar approach using a three-plasmid ligation system (10) appears to be less effective, probably due to the inefficiency of initiating viral replication from DNA embedded within a larger plasmid structure. The use of intron endonuclease recognition sequences flanking the ITRs enhances virus production while simplifying insertion of therapeutic gene sequences into the pLEP shuttle plasmid. The convenience of this vector system has facilitated the construction of over 200 recombinant viruses to date.