Previous Article | Next Article ![]()
Journal of Virology, November 2000, p. 10699-10706, Vol. 74, No. 22
Departments of
Microbiology1 and Mathematics and
Statistics,3 University of Otago, Dunedin, New
Zealand, and Ludwig Institute for Cancer Research, Royal
Melbourne Hospital, Victoria 3050, Australia2
Received 12 June 2000/Accepted 11 August 2000
Infection by the parapoxvirus orf virus causes proliferative skin
lesions in which extensive capillary proliferation and dilation are
prominent histological features. This infective phenotype may be linked
to a unique virus-encoded factor, a distinctive new member of the
vascular endothelial growth factor (VEGF) family of molecules. We
constructed a recombinant orf virus in which the VEGF-like gene was
disrupted and show that inactivation of this gene resulted in the loss
of three VEGF activities expressed by the parent virus: mitogenesis of
vascular endothelial cells, induction of vascular permeability, and
activation of VEGF receptor 2. We used the recombinant orf virus to
assess the contribution of the viral VEGF to the vascular response seen
during orf virus infection of skin. Our results demonstrate that the
viral VEGF, while recognizing a unique profile of the known VEGF
receptors (receptor 2 and neuropilin 1), is able to stimulate a
striking proliferation of blood vessels in the dermis underlying the
site of infection. Furthermore, the data demonstrate that the viral VEGF participates in promoting a distinctive pattern of epidermal proliferation. Loss of a functional viral VEGF resulted in lesions with
markedly reduced clinical indications of infection. However, viral
replication in the early stages of infection was not impaired, and only
at later times did it appear that replication of the recombinant virus
might be reduced.
Vascular endothelial growth factor
(VEGF) is a specific mitogen for vascular endothelial cells and a
potent inducer of vascular permeability, and it plays a critical role
in the formation of new blood vessels during both vasculogenesis and
angiogenesis (reviewed in reference 13). The latter
includes angiogenesis associated with tumor formation and a number of
other pathological conditions (reviewed in reference
1). Several proteins related in sequence and
structure to VEGF (also called VPF, for vascular permeability factor)
have been reported. The VEGF family now includes placental growth
factor (PlGF), VEGF-B, VEGF-C, and VEGF-D, each of which shows between
30 and 45% amino acid sequence identity with VEGF. The family members
are all structurally similar and share a central VEGF homology domain,
which contains eight cysteine residues that form part of a cysteine
knot motif. The VEGF family members are ligands for a set of mammalian
tyrosine kinase receptors (37). VEGF binds and activates
both VEGF receptor 1 (VEGFR-1) (Flt-1) and VEGFR-2 (Flk-1 or KDR),
while PlGF and VEGF-B bind only VEGFR-1. VEGF-C and VEGF-D bind VEGFR-2
and VEGFR-3 (Flt-4). VEGF and PlGF-2 also appear to interact with a
recently discovered neuronal cell guidance receptor, neuropilin 1. Although the functional significance of each of these ligand-receptor
interactions remains to be precisely defined, gene targeting studies
have demonstrated the requirement of VEGFR-1 and VEGFR-2 for embryonic
development. In general terms, it appears that VEGFR-1 plays a role in
vascular endothelial differentiation and migration, VEGFR-2 is involved in vascular endothelial mitogenesis, and VEGFR-3 is involved in the
regulation of angiogenesis of the lymphatic vasculature.
We reported previously that the NZ2 strain of the
parapoxvirus orf virus encodes an apparent homolog of VEGF
(VEGF-ORFVNZ2) (26) and recently showed, along
with others, that the viral factor shares some of the functional
features of mammalian VEGF (31, 43). These include the
ability of purified VEGF-ORFVNZ2 to stimulate the
proliferation of vascular endothelial cells, to promote vascular
permeability, and to bind VEGFR-2 and neuropilin 1. However, the viral
VEGF does not recognize VEGFR-1 or VEGFR-3 and, as such, forms a new
member of the VEGF family of molecules with a unique profile of
receptor recognition. The in vivo activities of this new growth factor
have not yet been examined.
Orf virus is the type species of the genus
Parapoxvirus and shares numerous features with other members
of the poxvirus family (19, 32). However, the distinctive
morphology of parapoxvirus virions and the high G+C content of their
genomes (44) suggest that a significant genetic divergence
from other genera of this family has occurred. This suggestion has been
confirmed by sequence analyses of the 140-kb orf virus genome (14,
30). Orf virus produces pustular dermatitis in humans, sheep, and
goats (reviewed in reference 19). Infection is
initiated in damaged skin, and lesions progress through stages of
erythema, papule, vesicle, pustule, and scab, with infection confined
to the epidermis. The pathological features of human and ovine orf
virus lesions are the same, and in both hosts infection is confined to
the epidermis, with no evidence of systemic spread. The lesions are
remarkable for extensive vascular proliferation and dilation as well as
marked proliferation of the epidermis, with finger-like projections of the epidermis deep into the dermis (18). The expression of
an orf virus-encoded member of the VEGF family of molecules may provide an explanation for some of these observations. No other virus has been
reported to encode a VEGF.
In this study, we constructed a recombinant orf virus in which the
VEGF-like gene was disrupted and used this construct to examine the
activities of VEGF-ORFVNZ2 during orf virus infection of
its natural host. In vivo expression of the viral VEGF promoted a
strong angiogenic response including erythema, capillary proliferation, and dilation. In addition, these experiments demonstrated an unexpected role for the viral VEGF in epidermal proliferation.
Cells and virus.
Orf virus strain NZ2 (33) and
vaccinia virus strain Lister (34) were propagated in primary
bovine testis (BT) or ovine testis (LT) cells using Eagle's minimal
essential medium containing 10% fetal bovine serum and 5% lactalbumen hydrolysate.
Construction of recombinant orf virus.
The gene encoding
VEGF-ORFVNZ2 is located within a 1.45-kb
SphI-SmaI subfragment of the KpnI E
fragment of orf virus (26). The 1.45-kb subfragment was
isolated and cloned into pSP70 to generate pVU486. Digestion of pVU486
with AvrII and BsmI removed a 123-nucleotide
sequence from the VEGF-ORFVNZ2 gene and was followed by
incorporation of a linker (CTAGGATCCTTTTTATGAATTCCG) which introduced BamHI and EcoRI restriction sites and
a poxvirus early transcription termination signal. The orf virus
sequences flanking the linker were a left arm of 981 bp, consisting of
869 bp upstream of the VEGF coding region followed by the first 112 bp
of the VEGF gene, and a right arm of 345 bp, consisting of the terminal 167 bp of the VEGF gene and 178 bp downstream of it. This plasmid was
designated pVU487. pVU488 contained the Escherichia coli
guanosine phosphoribosyltransferase (gpt) gene under the
control of the orf virus early promoter, PE1 (15), and the
E. coli lacZ gene under the control of the orf virus late
promoter, PF1 (14). The promoter-reporter elements were
kindly provided by D. Lyttle and will be described in detail elsewhere.
An 812-bp PE1-gpt fragment was derived from pVU488 by PCR
and ligated into the BamHI site of pVU487. The
PF1-lacZ element was removed from pVU488 using EcoRI and ligated into the EcoRI site of pVU487.
The final plasmid construct was called pVEGF-
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Viral Vascular Endothelial Growth Factor Plays a
Critical Role in Orf Virus Infection
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
.
3 h later, and lysates were recovered 5 days postinfection (p.i.). BT cells
were infected with dilutions of the lysates calculated to give rise to
between 1,250 and 5,000 plaques per 35-mm-diameter culture dish.
Putative recombinant plaques were identified 5 days p.i. by their blue
phenotype in the presence of
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal).
Putative recombinant clones arose at a frequency of 10
4.
Candidate clones were enriched by successive rounds of plaque purification. An apparently pure recombinant clone obtained after three
cycles of plaquing was subjected to three further cycles before a stock
was prepared. This clone was called ovVEGF-
.
Molecular characterization of recombinant orf virus. Viral cores were recovered from lysates of infected BT cells by centrifugation through a sucrose-dextran cushion, and DNA was purified by standard methods (12, 29). Restriction enzyme analyses, Southern blot hybridizations, PCRs, and DNA sequence determinations were performed according to standard methods (16, 29). The primers used in PCRs were as follows: gf1, AGCGCCCGGGATCCATGAAGTTGCTCGTCG; gf2, ACTCGAGGTACCTAGCGGCGTCTTCTGGG; gpt, CCTGTTCAAACCCCGCTTTA; lac, GACAAACTCGGGCAGCGTT; and out, TCACCGAGGCGGAGCCGTT.
Experimental infection of sheep with orf virus. Orf virus-naive merino-cross lambs were inoculated on the wool-free region of the inner surface of the hind legs. An approximately 2-cm-long scratch was made in the skin using a bifurcated needle, and 106 PFU of virus in 20 µl of phosphate-buffered saline (PBS) was applied to the scratch. Cell-free suspensions were prepared from 3-mm punch biopsies of infected skin (22), and the viral titer was determined by a plaque assay on BT cells.
Immunohistochemical staining and quantitation of vascular endothelial cells. Punch biopsies (5 mm) were fixed in 10% neutral buffered formalin and processed onto paraffin wax. Two 4-µm serial sections were taken from three points, 100 µm apart, in the fixed block. The first of the serial sections was stained with hematoxylin and eosin, and the second was used for immunohistochemical analysis of vascularization. Vascular endothelial cells were identified with a polyclonal rabbit anti-human von Willebrand factor antiserum (Dako). The extent of vascularization was quantified from each of three semiserial sections per lesion by counting the stained cells which fell on any of the 400 intersecting points within a grid (0.5 by 0.5 mm), each side of which was divided by 20 equidistant lines. The areal fraction of dermis vascularized was expressed as the fraction of the intersecting points on which a stained cell fell (42).
Preparation of viral conditioned medium (CM). BT cells were infected at a multiplicity of infection of 0.1 PFU per cell and incubated until all cells were clearly infected. LT cells were infected at a multiplicity of infection of 3 PFU per cell and incubated for 24 h. Cells were sedimented at low speed, and the supernatants were filtered twice (0.1-µm-pore-size filters) to remove infectious orf virus.
VEGF bioassays. Mitogenic assays were conducted with viral CM and human microvascular endothelial cells (HMVEC) (43). HMVEC were seeded at 104 cells per well and allowed to adhere. Samples of CM diluted to 10% in medium with reduced serum and without growth supplements were added. Proliferation was measured by direct counting of cells 72 h later. The Ba/F3-derived cell line Ba/F3-VEGFR-2-EpoR, expressing a chimeric receptor consisting of the extracellular domain of mouse VEGFR-2 and the transmembrane and cytoplasmic domains of the mouse erythropoietin receptor, was used to determine if CM was capable of binding and activating VEGFR-2 (37). Cells were washed free of interleukin 3 and then resuspended in dilutions of CM from virus-infected cells or from COS-7 cells transiently expressing the mouse VEGF isoform consisting of 164 amino acids, VEGF164 (37). Cells were incubated for 48 h, and DNA synthesis was quantified by measuring [3H]thymidine incorporation with a beta counter. The induction of vascular permeability by CM was determined by measuring the extravasation of Evans blue dye in guinea pig skin (Miles assay) (43). Anesthetized guinea pigs were injected intracardially with 500 µl of 0.5% Evans blue dye. CM was diluted 1/5 in PBS (pH 7.2), and 100 µl was injected intradermally to shaved areas on the back of the animal. Five nanograms of purified mouse VEGF164 was used as a positive control. The animals were sacrificed after 20 min, the skin was excised, dye was eluted in formamide, and the absorbance at 620 nm was recorded.
| |
RESULTS |
|---|
|
|
|---|
Disruption of the orf virus VEGF gene.
A recombinant orf virus
in which the VEGF-ORFVNZ2 gene had been inactivated was
constructed by removing 116 bp of the gene, including a region encoding
five cysteines critical for maintaining the tertiary structure of VEGF,
and replacing this segment with a reporter cassette (see Materials and
Methods). A schematic representation of the VEGF region of this
recombinant virus, ovVEGF-
, is shown in Fig.
1, along with DNA analyses which
confirmed its identity.
|
DNA with BamHI revealed
a new fragment of 5.4 kb which hybridized with a
lacZ-specific probe (Fig. 1B). The bands corresponding to
the 0.8- and 0.1-kb BamHI fragments were too faint to be
seen on the gel, and the predicted 2.2-kb reduction in the size of the
54.3-kb BamHI A fragment (26, 29) was not
adequately resolved under standard electrophoresis conditions. The
additional DNA incorporated in ovVEGF-
did not contain a HindIII site and was predicted to result in a net
increase of 4.2 kb in the size of the HindIII B fragment
(26, 29). Figure 1C reveals the predicted increase in the
size of HindIII-B and also shows that the new fragment
hybridized with a probe containing the VEGF gene.
PCR analysis with a variety of primer pairs confirmed the purity of
ovVEGF-
. A PCR product indicative of an intact VEGF gene (427 bp,
primers gf1 and gf2) was produced only when wild-type orf virus (WT)
DNA was included in the reaction (Fig. 1D, lane 2). PCRs in which one
of the pair of primers was derived from gpt or
lacZ gave rise to the predicted products only when
ovVEGF-
DNA was used as a template (Fig. 1D, lanes 4 to 9). The
identity of each PCR product was confirmed by direct DNA sequencing.
These analyses confirmed the integrity of the inserted genetic elements and revealed no evidence of any substantial alteration to other regions
of the genome of ovVEGF-
.
No differences in plaque morphology were observed between WT and
ovVEGF-
when they were grown in BT cells. Nor were differences apparent in the kinetics of the appearance of infectious virus in
one-step or multicycle growth curves (data not shown).
VEGF-like activity is not produced by ovVEGF-
.
CM prepared
from cells infected with WT, ovVEGF-
, or the Lister strain of
vaccinia virus or mock infected with PBS was subjected to three assays
of VEGF-like activity: endothelial cell mitogenesis, vascular
permeability, and activation of VEGFR-2. CM from WT-infected LT
cells was able to promote a threefold increase in the number of HMVEC
(Fig. 2A). No such increase was promoted
by CM from cells infected with ovVEGF-
or vaccinia virus or mock
infected.
|
was not. CM from
COS-7 cells transiently expressing mouse VEGF164 was also
able to stimulate thymidine incorporation by the Ba/F3-derived cells.
CM from infected LT cells was assayed for the ability to induce
vascular permeability in guinea pig skin. CM from WT-infected cells
induced permeability, whereas CM from ovVEGF-
-, vaccinia virus-, and
mock-infected cells did not (Fig. 2C). Mouse VEGF164 (5 ng)
served as a positive control in this assay. These data demonstrate that
orf virus-infected cells express a product that stimulates VEGFR-2 and
promotes both endothelial cell mitogenesis and vascular permeability
but that this product is not produced by ovVEGF-
.
Gross pathology of WT and ovVEGF-
lesions.
In order to
assess the role of VEGF-ORFVNZ2 in disease, we infected
sheep by applying 106 PFU of virus to scarified skin. Each
of three animals was given four replicate inoculations with WT,
ovVEGF-
, or PBS. The development of WT lesions followed the general
pattern reported previously (24). This pattern was
characterized by the progressive development of erythema, pustules, and
a scab until the experiment was terminated 14 days p.i. Representative
lesions observed on one animal are shown in Fig.
3A. Erythema was
visible along the scratch lines 2 days p.i. This reaction was marked by
4 days, at which time pustules first became apparent (data not shown).
By 6 days p.i., the intense erythematous margin seen after 4 days was
still evident and the pustules had developed further. Pustule formation
was at a maximum 10 days p.i., by which time the erythema was reduced. At the last time point, 14 days p.i., erythema was minimal, the pustules had contracted, and a scab was beginning to form.
|
followed a course similar to that
observed with infection by WT but were substantially less florid. Some
reddening along the lines of ovVEGF-
infection was apparent 6 and 10 days p.i., but the marked erythematous reaction seen with WT was not
evident. Pustule formation was minimal and was visible only 10 days
p.i. A fine line of scab formed over mock-infected scratches, but there
was no evidence of erythema or pustule formation. For all inoculations,
there was good uniformity in the responses seen in the replicate
lesions on individual animals and across all three animals.
Histological analysis of WT and ovVEGF-
lesions.
The
reduced pathology seen in superficial examinations of ovVEGF-
lesions compared with WT lesions was also apparent in histological examinations of these lesions (Fig. 3B). Histological differences were
seen as early as 2 days p.i., when in the WT lesions there was an
accumulation of fluid in the dermis that was not seen in the ovVEGF-
lesions or PBS controls. After 6 days, there was an intense influx of
inflammatory cells in the dermis of WT lesions. Cellular ballooning and
degeneration of the upper layers of the epidermis were also evident in
WT lesions, and the epidermis had become markedly hyperplastic. In
contrast, the influx of inflammatory cells into the dermis of
ovVEGF-
lesions was less intense, and there was little evidence of
the cytopathic effects observed in the epidermis of WT lesions.
lesions at this stage had a relatively
intense inflammatory cell infiltrate, the upper layers of the epidermis
showed signs of degeneration, and the epidermis had become mildly
hyperplastic. All ovVEGF-
lesions had developed a small pustule that
had lifted away from the epidermis.
At 14 days p.i., the dermis of WT lesions remained heavily infiltrated
with inflammatory cells, the epidermis was extremely hyperplastic, and
the overlying pustule had become much larger and in some cases had
detached. In contrast, ovVEGF-
lesions had a mild inflammatory cell
infiltrate, any pustule that had been present had detached, and the
epidermis remained mildly thickened and hyperplastic. In summary, both
histological examinations and the observed gross pathology suggested
that the inactivation of viral VEGF resulted in an infection that was
substantially less intense and resolved more quickly.
Epidermal hyperplasia in orf virus lesions.
Epidermal
hyperplasia is a feature of the response to orf virus infection. At 14 days p.i., the epidermis of WT lesions was more than sevenfold thicker
than that of mock-infected lesions and approximately twofold thicker
than that of ovVEGF-
lesions (data not shown). A major component of
the enlarged epidermis seen in WT lesions was the number of epidermal
downgrowths, known as rete ridges. These were apparent 6 days p.i.,
when WT lesions had developed 9.3-fold more rete ridges than had
ovVEGF-
lesions (Table 1). The rete
ridges seen in WT lesions extended further into the dermis and were, on
average, 1.7-fold longer than those few seen in ovVEGF-
lesions.
This pattern was also apparent 14 days p.i., at which time the rete
ridges had increased in length by two- to threefold over those seen at
6 days p.i. (Table 1). Rete ridges were not seen in mock-infected
lesions.
|
WT lesions are more vascularized than ovVEGF-
lesions.
Vascularization at the sites of infection was assessed using anti-human
von Willebrand factor antibody. Representative sections from WT-,
ovVEGF-
-, and mock-infected lesions sampled 10 days p.i. are shown
in Fig. 3B. The extent of dermal vascularization associated with sites
of infection was analyzed by determining the areal fraction of dermis
reacting with anti-von Willebrand factor antibody. This quantitative
analysis of vascularization showed a time-dependent increase in the
dermal vascularization of WT lesions that greatly exceeded any such
response in ovVEGF-
lesions (Fig. 4).
At 2 days p.i., there appeared to be no difference in the
vascularization of WT-, ovVEGF-
-, or mock-infected lesions. By 6 days p.i., however, the dermis of WT lesions was intensely vascularized
and the lumen of blood vessels appeared to be enlarged. WT lesions were
from 1.8-fold (sheep 102) to 3.8-fold (sheep 103) more vascularized
than corresponding mock-infected lesions (Fig. 4). Markedly enhanced
dermal vascularization and dilation of blood vessels were also apparent
in WT lesions sampled 10 (Fig. 3) and 14 days p.i., with the area
vascularized exceeding that seen in mock-infected lesions by an average
of 5-fold and by as much as 9.8-fold in one case (sheep 101; day 14).
It was clear that orf virus infection of sheep skin induced a
substantial proliferation of the vasculature of the underlying dermis.
This dramatic response was not seen in ovVEGF-
lesions. In all
samples taken at days 6, 10, and 14 p.i., ovVEGF-
lesions were
found to be less vascularized than WT lesions taken at the same time
from the same animal (Fig. 4). At these times p.i., the extent of
dermal vascularization of the WT lesions exceeded that seen in the
corresponding ovVEGF-
lesions by 1.9- to 6.2-fold. Analysis of these
data using paired t tests for each day confirmed that the
vascularization seen in WT lesions was significantly greater than that
seen in ovVEGF-
lesions at 6, 10, and 14 days p.i. (P
values of 0.048, 0.021, and 0.039, respectively) but was not
significantly different at 2 days p.i. (P value of 0.485).
Figure 4 shows that in all samples taken 6, 10, and 14 days p.i., the
extent of dermal vascularization recorded for ovVEGF-
lesions
exceeded that recorded for mock-infected lesions. This stimulation of
vascularization was markedly lower than that seen for WT lesions and,
on average, the values for ovVEGF-
infection exceeded those for mock
infection by 1.7-fold. Only vascularization at 6 days p.i. was
significantly different (P value of 0.039). These results
demonstrate that the viral VEGF is expressed during natural infection
and plays a key role in the development of the vascularized nature of
orf virus lesions.
|
Effect of inactivation of VEGF-ORFVNZ2 on viral yield
in vivo.
In order to provide an estimate of the production of
infectious virus during the course of infection in sheep skin, 3-mm
punch biopsies were taken and, after processing, the titers of PFU were determined (Fig. 5). At 2 days p.i.,
virus was detected in only two of the six samples, but by 6 days p.i.,
all viral lesions contained significant amounts of virus, with similar
titers of virus being detected in WT and ovVEGF-
lesions. This
result can be seen in the average ratio of WT to ovVEGF-
titers,
which at day 6 was 0.9.
|
was somewhat unexpected in light of the
reduced pathology of the lesions. The results indicate that in the
absence of a functional VEGF-like gene and the consequent absence of
extensive dermal vascularization, ovVEGF-
can establish an infection
that, in terms of viral yield during the early stages, is similar to
that established by WT. Viral titers in WT lesions sampled 10 or 14 days p.i. were generally higher than the day-6 titers, with an average
20.2-fold increase between day-6 titers and maximum titers. In contrast
to the uniform increase in the titers in WT lesions, the titers in
ovVEGF-
lesions on two sheep were reduced in samples taken later
than 6 days p.i. Furthermore, in no case did the titers in samples
taken from ovVEGF-
lesions 10 and 14 days p.i. exceed the titers in
samples taken from WT lesions on the same sheep at the same time. This
result suggested that at later stages of the infection, the growth of
ovVEGF-
was impaired relative to that of WT. However, analysis by
paired t tests revealed that only the difference seen 10 days p.i. was statistically significant (P value of 0.039).
X-Gal staining of plaques derived from the biopsies of
ovVEGF-
lesions revealed that the lacZ gene had
been retained in the progeny virus. PCR analysis of WT and ovVEGF-
biopsy specimens using the primer pairs gf1-gf2 and lacZ-gf2
(Fig. 1), followed by sequencing of products, confirmed the absence of
the VEGF-like gene in virus recovered from ovVEGF-
lesions.
| |
DISCUSSION |
|---|
|
|
|---|
Descriptions of orf virus lesions frequently refer to prominent vascular changes, and as early as 1890, Walley referred to lesions that "readily bleed" and observed "distension of the blood vessels" (41). More recently, Groves described "massive capillary proliferation and dilation [that] gave the impression of an angiomatous lesion" (18). Construction of a recombinant orf virus in which the viral VEGF was inactivated allowed us to examine for the first time the role played by the viral VEGF in the vascular response seen in orf virus lesions.
We demonstrate here that VEGF-like activities expressed by WT-infected
cells were not seen in cells infected with the recombinant virus, in
which the VEGF-like gene was disrupted. Disruption of the viral VEGF
gene and the loss of VEGF activity had no detectable effect on the
growth of orf virus in cultured cells; however, infection of its
natural host was significantly affected. Analysis of vascularization
associated with the viral lesions allowed us to confirm previous
reports that the dermis underlying an orf virus lesion is intensely
vascularized (18). As early as 6 days p.i., the density of
endothelial cells was, on average, fivefold greater than that seen in
the dermis of a mock-infected lesion. Furthermore, at this time and up
to at least 14 days p.i., there was significantly greater
vascularization of WT lesions than of lesions induced by
ovVEGF-
. These observations demonstrate that the viral VEGF is
able to promote angiogenesis during infection of skin.
Although our measure of the vascular response was based on the density
of endothelial cells rather than on vascular profiles, we did observe a
progressive development of recognizable microvessels with clearly
visible lumina (Fig. 3). Confirmation that the vast majority of the
vascular response is directed by the viral VEGF rather than by host
factors induced by orf virus infection is provided by the virus yield
data, which show that at 6 days p.i., the virus yields are similar for
both WT and ovVEGF-
. If dermal vascularization were a host response
to viral infection, it would be expected that the response would be
proportional to the extent of viral growth. This is clearly not so. Orf
virus replication is known to be confined to the epidermis (23,
24), but our data suggest that the viral VEGF affects endothelial
cells of the dermis. This notion is consistent with the results of
studies of transgenic mice, in which overexpression of VEGF in
keratinocytes stimulated an increase in the density of blood vessels in
the dermis (10). Enhanced expression of VEGF has also been
reported for a range of malignant and benign tumors of the skin and has been shown for advanced melanoma lesions to directly correlate with a
2.5-fold increase in the vascular density of the associated dermis
(11). Studies with purified VEGF-ORFVNZ2 have
shown that it recognizes VEGFR-2 but not VEGFR-1 or VEGFR-3 (31,
43). Our demonstration that in situ expression of this factor
promotes angiogenesis is consistent with the view that VEGFR-2 is
predominantly responsible for signaling vascular endothelial cell mitogenesis.
Our data show a correlation between the presence of an intact viral VEGF gene and the induction of not only dermal vascularization but also epidermal hyperplasia. Cutaneous angiogenesis in conjunction with epidermal hyperplasia has also been reported for cutaneous infantile hemangiomas and UV-irradiated skin and was connected in both studies to altered levels of angiogenic factors, including VEGF (3, 4). The pathway by which the viral VEGF might induce epidermal proliferation is unclear, but the induction of growth factors, such as fibroblast growth factor 2 (FGF-2), keratinocyte growth factor (KGF), or heparin-binding epidermal growth factor (HB-EGF), is possible. For example, VEGF has been shown to induce HB-EGF in vascular endothelial cells, and HB-EGF is a known mitogen of keratinocytes (2).
In addition to a general thickening of the epidermis, WT lesions showed
extensive rete ridge formation that was not apparent in ovVEGF-
lesions. These extensions of the epidermis into the dermis are also
seen in other pathologies. For example, psoriatic skin shows both
enhanced angiogenesis and an increase in rete ridge length
(9). A link between rete ridge formation and KGF was
suggested by a study of wound healing (38). A role for the orf virus-encoded VEGF in promoting the expression of KGF could be
postulated to occur via increased vascular permeability, leading to
alterations in the dermal extracellular matrix, including the release
of sequestered FGF-2. Such FGF-2 could then signal dermal fibroblasts
to produce KGF and might thereby induce epidermal proliferation, with
the formation of rete ridges.
The considerable epidermal proliferation seen in ovVEGF-
lesions indicates that factors other than
VEGF-ORFVNZ2 also play a role in stimulating this cellular
response to orf virus infection. Lesions of other poxviruses typically
demonstrate localized cellular proliferation but do not show the
vascularization seen in orf virus lesions. A probable explanation for
this effect has been provided by the demonstration that several
poxviruses each encode a growth factor related to epidermal growth
factor (EGF) (5, 8, 40). We have not been able to detect any
evidence of an EGF homolog encoded by orf virus. Nor is there any
evidence of VEGF-like activity encoded by any virus other than
parapoxviruses. However, virus-encoded EGF and VEGF are both examples
of a growing family of factors which are expressed by poxviruses and
other large DNA viruses, which are often nonessential for viral
replication, but which play important roles in modulating the host
environment during infection (25, 28, 36).
The epidermal and vascular responses seen in lesions of orf virus are reminiscent of a sustained wound healing response. Orf virus applied to wounded skin establishes replication in the regenerating epidermal layer (23, 24), and extravagantly proliferative and persistent orf virus lesions have been reported for immunocompromised individuals (21, 35, 39). The expression of a viral VEGF might assist in maintaining this regenerative response and thereby might support extended viral growth. Our data are suggestive of extended replication of WT relative to orf virus with a deletion of VEGF, but more detailed examinations will be required to clarify this possibility. Atypically severe orf virus lesions have been reported for thermally injured skin (20), and erythema multiforme reactions are a relatively common complication of orf virus infection. Intriguingly, both of these pathologies, in the absence of orf virus, have been linked to elevated levels of VEGF (6, 17).
Another possible role for the viral VEGF, again with a link to wound healing, is the extensive scab formation seen on healing orf virus lesions. The scab shed from orf virus lesions contains substantial amounts of infectious virus. The envelopment of the virus in the scab provides it with protection from environmental inactivation. In this way, the virus remains available to infect naive animals as much as 1 year after being shed (19). Vascular hyperpermeability, with associated leakage of plasma proteins, is a feature of wound healing and has been linked to the overexpression of VEGF (7). The viral VEGF is able to induce vascular permeability and would seem to contribute to scab formation, since lesions induced by orf virus with a deletion of VEGF have essentially no scab. Our data conclusively demonstrate an in vivo role for the virus-encoded VEGF and provide a natural disease model to study the activities of a new member of the VEGF family that activates VEGFR-2 but not VEGFR-1 or VEGFR-3.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported in part by the Health Research Council of New Zealand.
We thank D. Lyttle for supplying genetic elements used in the
construction of pVEGF-
; C. Macintosh for assistance with the sheep
studies; R. Napper, K. Turner, and H.-S. Yoon for assistance with
histological analyses; N. Ferrara for preliminary analysis of orf
virus-encoded VEGF activity; L. Wise for useful discussions; and E. Whelan, C. Caesar, and A. Vitali for skilled technical assistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, University of Otago, P.O. Box 56, Dunedin, New Zealand. Phone: (64) (3) 4797730. Fax: (64) (3) 4797744. E-mail: andy.mercer{at}stonebow.otago.ac.nz.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Achen, M. G., and S. A. Stacker. 1998. The vascular endothelial growth factor family; proteins which guide the development of the vasculature. Int. J. Exp. Pathol. 79:255-265[CrossRef][Medline]. |
| 2. |
Arkonac, B. M.,
L. C. Foster,
N. E. Sibinga,
C. Patterson,
K. Lai,
J. C. Tsai,
M. E. Lee,
M. A. Perrella, and E. Haber.
1998.
Vascular endothelial growth factor induces heparin-binding epidermal growth factor-like growth factor in vascular endothelial cells.
J. Biol. Chem.
273:4400-4405 |
| 3. | Bielenberg, D. R., C. D. Bucana, R. Sanchez, C. K. Donawho, M. L. Kripke, and I. J. Fidler. 1998. Molecular regulation of UVB-induced cutaneous angiogenesis. J. Investig. Dermatol. 111:864-872[CrossRef][Medline]. |
| 4. | Bielenberg, D. R., C. D. Bucana, R. Sanchez, J. B. Mulliken, J. Folkman, and I. J. Fidler. 1999. Progressive growth of infantile cutaneous hemangiomas is directly correlated with hyperplasia and angiogenesis of adjacent epidermis and inversely correlated with expression of the endogenous angiogenesis inhibitor, IFN-beta. Int. J. Oncol. 14:401-408[Medline]. |
| 5. |
Blomquist, M. C.,
L. T. Hunt, and W. C. Barker.
1984.
Vaccinia virus 19-kilodalton protein: relationship to several mammalian proteins, including two growth factors.
Proc. Natl. Acad. Sci. USA
81:7363-7367 |
| 6. | Brown, L. F., T. J. Harrist, K. T. Yeo, M. Stahle-Backdahl, R. W. Jackman, B. Berse, K. Tognazzi, H. F. Dvorak, and M. Detmar. 1995. Increased expression of vascular permeability factor (vascular endothelial growth factor) in bullous pemphigoid, dermatitis herpetiformis, and erythema multiforme. J. Investig. Dermatol. 104:744-749[CrossRef][Medline]. |
| 7. |
Brown, L. F.,
K. T. Yeo,
B. Berse,
T. K. Yeo,
D. R. Senger,
H. F. Dvorak, and L. van de Water.
1992.
Expression of vascular permeability factor (vascular endothelial growth factor) by epidermal keratinocytes during wound healing.
J. Exp. Med.
176:1375-1379 |
| 8. |
Chang, W.,
C. Upton,
S. L. Hu,
A. F. Purchio, and G. McFadden.
1987.
The genome of Shope fibroma virus, a tumorigenic poxvirus, contains a growth factor gene with sequence similarity to those encoding epidermal growth factor and transforming growth factor alpha.
Mol. Cell. Biol.
7:535-540 |
| 9. |
Dam, T. N.,
S. Kang,
B. J. Nickoloff, and J. J. Voorhees.
1999.
1 ,25-Dihydroxycholecalciferol and cyclosporine suppress induction and promote resolution of psoriasis in human skin grafts transplanted on to SCID mice.
J. Investig. Dermatol.
113:1082-1089[CrossRef][Medline].
|
| 10. | Detmar, M., L. F. Brown, M. P. Schon, B. M. Elicker, P. Velasco, L. Richard, D. Fukumura, W. Monsky, K. P. Claffey, and R. K. Jain. 1998. Increased microvascular density and enhanced leukocyte rolling and adhesion in the skin of VEGF transgenic mice. J. Investig. Dermatol. 111:1-6[CrossRef][Medline]. |
| 11. | Erhard, H., F. J. Rietveld, M. C. van Altena, E. B. Brocker, D. J. Ruiter, and R. M. de Waal. 1997. Transition of horizontal to vertical growth phase melanoma is accompanied by induction of vascular endothelial growth factor expression and angiogenesis. Melanoma Res. 7(Suppl. 2):S19-S26. |
| 12. | Esposito, J., R. Condit, and J. Obijeski. 1981. The preparation of orthopoxvirus DNA. J. Virol. Methods 2:175-179[CrossRef][Medline]. |
| 13. | Ferrara, N., and T. Davis-Smyth. 1997. The biology of vascular endothelial growth factor. Endocrine Rev. 16:4-25. |
| 14. | Fleming, S. B., J. Blok, K. M. Fraser, A. A. Mercer, and A. J. Robinson. 1993. Conservation of gene structure and arrangement between vaccinia virus and orf virus. Virology 195:175-184[CrossRef][Medline]. |
| 15. | Fleming, S. B., K. M. Fraser, A. A. Mercer, and A. J. Robinson. 1991. Vaccinia virus-like early transcriptional control sequences flank an early gene in orf virus. Gene 97:207-212[CrossRef][Medline]. |
| 16. | Fleming, S. B., C. A. McCaughan, A. E. Andrews, A. D. Nash, and A. A. Mercer. 1997. A homolog of interleukin-10 is encoded by the poxvirus orf virus. J. Virol. 71:4857-4861[Abstract]. |
| 17. | Grad, S., W. Ertel, M. Keel, M. Infanger, D. J. Vonderschmitt, and F. E. Maly. 1998. Strongly enhanced serum levels of vascular endothelial growth factor (VEGF) after polytrauma and burn. Clin. Chem. Lab. Med. 36:379-383[CrossRef][Medline]. |
| 18. | Groves, R. W. 1991. Human orf and milkers' nodule: a clinicopathological study. J. Am. Acad. Dermatol. 25:706-711[Medline]. |
| 19. | Haig, D. M., and A. A. Mercer. 1998. Orf. Vet. Res. 29:311-326[Medline]. |
| 20. | Hooser, S. B., G. Scherba, D. E. Morin, and H. E. Whiteley. 1989. Atypical contagious ecthyma in a sheep after extensive cutaneous thermal injury. J. Am. Vet. Med. Assoc. 195:1255-1256[Medline]. |
| 21. | Hunskaar, S. 1986. Giant orf in a patient with lymphocytic leukaemia. Br. J. Dermatol. 114:631-634[CrossRef][Medline]. |
| 22. | Hussain, K. A., and D. Buger. 1989. In vivo and in vitro characteristics of contagious ecthyma virus isolates: host response mechanism. Vet. Microbiol. 19:23-26[CrossRef][Medline]. |
| 23. | Jenkinson, D. M., P. E. McEwan, V. A. Moss, H. Y. Elder, and H. W. Reid. 1990. Location and spread of orf virus antigen in infected ovine skin. Vet. Dermatol. 1:189-195. |
| 24. | Jenkinson, D. M., P. E. McEwan, S. K. Onwuka, V. A. Moss, H. Y. Elder, G. Hutchinson, and H. W. Reid. 1990. The pathological changes and polymorphonuclear and mast cell responses in the skin of specific pathogen free lambs following primary and secondary challenge with orf virus. Vet. Dermatol. 1:139-150. |
| 25. | Kalvakolanu, D. V. 1999. Virus interception of cytokine-regulated pathways. Trends Microbiol. 7:166-171[CrossRef][Medline]. |
| 26. |
Lyttle, D. J.,
K. M. Fraser,
S. B. Fleming,
A. A. Mercer, and A. J. Robinson.
1994.
Homologs of vascular endothelial growth factor are encoded by the poxvirus orf virus.
J. Virol.
68:84-92 |
| 27. |
Mackett, M.,
G. L. Smith, and B. Moss.
1984.
A general method for the production and selection of infectious vaccinia virus recombinants expressing foreign genes.
J. Virol.
49:857-864 |
| 28. | McFadden, G., K. Graham, K. Ellison, M. Barry, J. Macen, M. Schreiber, K. Mossman, P. Nash, A. Lalani, and H. Everett. 1995. Interruption of cytokine networks by poxviruses: lessons from myxoma virus. J. Leukoc. Biol. 57:731-738[Abstract]. |
| 29. | Mercer, A. A., K. F. Fraser, G. Barns, and A. J. Robinson. 1987. The structure and cloning of orf virus DNA. Virology 157:1-12[CrossRef][Medline]. |
| 30. | Mercer, A. A., D. J. Lyttle, E. M. Whelan, S. B. Fleming, and J. T. Sullivan. 1995. The establishment of a gene map of orf virus reveals a pattern of genomic organisation that is highly conserved among divergent poxviruses. Virology 212:698-704[CrossRef][Medline]. |
| 31. | Meyer, M., M. Clauss, A. Lepple-Wienhues, J. Waltenberger, H. G. Augustin, M. Ziche, C. Lanz, M. Büttner, H.-J. Rziha, and C. Dehio. 1999. A novel vascular endothelial growth factor encoded by orf virus, VEGF-E, mediates angiogenesis via signalling through VEGFR-2 (KDR) but not VEGFR-1 (Flt-1) receptor tyrosine kinase. EMBO J. 18:363-374[CrossRef][Medline]. |
| 32. | Moss, B. 1996. Poxviridae and their replication, p. 2637-2671. In B. N. Fields, D. M. Knipe, and P. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa. |
| 33. | Robinson, A. J., G. Ellis, and T. Balassu. 1982. The genome of orf virus: restriction endonuclease analysis of viral DNA isolated from lesions of orf virus in sheep. Arch. Virol. 71:43-55[CrossRef][Medline]. |
| 34. | Robinson, A. J., and A. A. Mercer. 1988. Orf virus and vaccinia virus do not cross protect in sheep. Arch. Virol. 101:255-259[CrossRef][Medline]. |
| 35. | Savage, J., and M. M. Black. 1972. "Giant orf" of finger in a patient with a lymphoma. Proc. R. Soc. Med. 64:766-768. |
| 36. | Smith, G. L., J. A. Symons, A. Khanna, A. Vanderplasschen, and A. Alcami. 1997. Vaccinia virus immune evasion. Immunol. Rev. 159:137-154[CrossRef][Medline]. |
| 37. |
Stacker, S. A.,
A. Vitali,
C. Caesar,
T. Domagala,
L. C. Groenen,
E. Nice,
M. G. Achen, and A. F. Wilks.
1999.
A mutant form of vascular endothelial growth factor (VEGF) that lacks VEGF receptor-2 activation retains the ability to induce vascular permeability.
J. Biol. Chem.
274:34884-34892 |
| 38. |
Staiano-Coico, L.,
J. G. Krueger,
J. S. Rubin,
S. D'Limi,
V. P. Vallat,
L. Valentino,
T. D. Fahey,
A. Hawes,
G. Kingston,
M. R. Madden,
M. Mathwich,
A. B. Gottlieb, and S. A. Aaronson.
1993.
Human keratinocyte growth factor effects in a porcine model of epidermal wound healing.
J. Exp. Med.
178:865-878 |
| 39. | Tan, S. T., G. B. Blake, and S. Chambers. 1991. Recurrent orf in an immunocompromised host. Br. J. Plastic Surg. 44:465-467[CrossRef][Medline]. |
| 40. |
Upton, C.,
J. L. Macen, and G. McFadden.
1987.
Mapping and sequencing of a gene from myxoma virus that is related to those encoding epidermal growth factor and transforming growth factor alpha.
J. Virol.
61:1271-1275 |
| 41. | Walley, T. 1890. Contagious dermatitis: "orf" in sheep. J. Comp. Pathol. Ther. 3:357-360. |
| 42. |
Weidner, N.,
J. P. Semple,
W. R. Welch, and J. Folkman.
1991.
Tumor angiogenesis and metastasis correlation in invasive breast carcinoma.
N. Engl. J. Med.
324:1-8[Abstract].
|
| 43. |
Wise, L.,
T. Veikkola,
A. Mercer,
L. Savory,
S. Fleming,
C. Caesar,
A. Vitali,
T. Makinen,
K. Alitalo, and S. Stacker.
1999.
Vascular endothelial growth factor (VEGF)-like protein from orf virus NZ2 binds to VEGFR-2 and neuropilin-1.
Proc. Natl. Acad. Sci. USA
96:3071-3076 |
| 44. |
Wittek, R.,
C. C. Kuenzle, and R. Wyler.
1979.
High G+C content in parapoxvirus DNA.
J. Gen. Virol.
43:231-234 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»