Previous Article | Next Article 
Journal of Virology, November 2000, p. 10600-10611, Vol. 74, No. 22
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Strategy for Systematic Assembly of Large RNA and
DNA Genomes: Transmissible Gastroenteritis Virus Model
Boyd
Yount,1
Kristopher M.
Curtis,2 and
Ralph S.
Baric1,2,*
Department of Epidemiology, Program of
Infectious Diseases, School of Public Health,1
and Department of Microbiology and Immunology, School of
Medicine,2 University of North Carolina at
Chapel Hill, Chapel Hill, North Carolina 27599
Received 18 May 2000/Accepted 15 August 2000
 |
ABSTRACT |
A systematic method was developed to assemble functional
full-length genomes of large RNA and DNA viruses. Coronaviruses contain the largest single-stranded positive-polarity RNA genome in nature. The
~30-kb genome, coupled with regions of genomic instability, has
hindered the development of a full-length infectious cDNA construct. We have assembled a full-length infectious construct of
transmissible gastroenteritis virus (TGEV), an important pathogen in
swine. Using a novel approach, six adjoining cDNA subclones that
span the entire TGEV genome were isolated. Each clone was engineered
with unique flanking interconnecting junctions which determine a
precise systematic assembly with only the adjacent cDNA subclones,
resulting in an intact TGEV cDNA construct of ~28.5 kb in length.
Transcripts derived from the full-length TGEV construct were
infectious, and progeny virions were serially passaged in permissive
host cells. Viral antigen production and subgenomic mRNA
synthesis were evident during infection and throughout passage. Plaque-purified virus derived from the infectious construct
replicated efficiently and displayed similar plaque morphology in
permissive host cells. Host range phenotypes of the molecularly cloned
and wild-type viruses were similar in cells of swine and feline origin. The recombinant viruses were sequenced across the unique
interconnecting junctions, conclusively demonstrating the marker
mutations and restriction sites that were engineered into the component
clones. Full-length infectious constructs of TGEV will permit the
precise genetic modification of the coronavirus genome. The method that we have designed to generate an infectious cDNA construct of TGEV could theoretically be used to precisely reconstruct microbial or
eukaryotic genomes approaching several million base pairs in length.
 |
INTRODUCTION |
Molecular genetic analysis of the
structure and function of RNA virus genomes has been profoundly
advanced by the availability of full-length cDNA clones, the source
of infectious RNA transcripts that replicate efficiently when
introduced into permissive cell lines (2, 9). Recombinant
DNA technology has allowed the isolation of infectious cDNA clones
from a number of positive-stranded RNA viruses, including
picornaviruses, caliciviruses, alphaviruses, flaviviruses, and arteriviruses, whose RNA genomes range in size from
~7 to 15 kb in length (1, 13, 32, 34, 35, 47, 48, 54). The
availability of these clones has enhanced our understanding of the
molecular mechanisms of viral replication and pathogenesis and resulted
in new approaches for heterologous gene expression and vaccine development.
The order Nidovirales includes mammalian positive-polarity
single-stranded RNA viruses in the arterivirus and coronavirus families
(10, 16). The Coronaviridae family includes the
Coronavirus and Torovirus genera (10,
46). Despite significant size differences (~13 to 32 kb), the
polycistronic genome organization and regulation of gene expression
from a nested set of subgenomic mRNAs are similar for all
members of the order (16, 46). The family
Coronaviridae contains the largest RNA viral genomes in
nature (26, 44). Transmissible gastroenteritis virus
(TGEV), a group I coronavirus, contains a ~28.5-kb
genomic RNA that is packaged into a helical nucleocapsid
structure and surrounded by an envelope that contains three
virus-specific glycoprotein spikes, including the S glycoprotein, membrane glycoprotein (M), and a small envelope glycoprotein (E) (17, 18, 33, 36). The TGEV genome is polycistronic and encodes eight large open reading frames (ORFs), which are expressed from full-length or subgenome-length mRNAs during infection
(17, 42, 43). The 5'-most ~20 kb encode the RNA replicase
genes, which are encoded in two large ORFs, designated 1a and 1b, the latter of which is expressed by ribosomal frameshifting (3, 17). ORF1a encodes at least two viral proteases and several other nonstructural proteins, while ORF1b contains polymerase, helicase, and metal-binding motifs typical of an RNA polymerase (3, 17, 19). In the 3'-most ~9 kb of the TGEV genome, each of the downstream ORFs is preceded by a highly conserved intergenic sequence element, which directs the synthesis of each of the six or
seven subgenomic RNAs (11, 17, 18, 52). These
subgenomic mRNAs are arranged in a nested set structure
from the 3' end of the genome, and each contains a leader RNA sequence
derived from the 5' end of the genome (26, 29, 42, 43).
Subgenomic mRNAs are generated by a discontinuous
transcription mechanism, the details of which are somewhat
controversial (4, 40, 42, 43). In addition to the viral
mRNAs, full-length and subgenome-length negative-strand RNAs are
implicated in mRNA synthesis (4, 26, 40, 42, 43).
Another unique feature of coronavirus replication is the high RNA
recombination frequencies associated with infection (6, 25,
26).
The large size of the coronavirus genome, coupled with the inability to
clone portions of the polymerase gene in microbial vectors, has
hampered the ability to perform precise manipulations and reverse
genetics in members of the Coronaviridae (17, 18, 26,
44). Recently these problems were overcome when a full-length cDNA of TGEV was stably cloned in bacterial artificial chromosome (BAC) vectors (3). In this report, we describe a simple and rapid approach for systematically assembling a full-length, infectious cDNA construct of TGEV using a series of smaller subclones and a
novel strategy which theoretically may allow the assembly of large
microbial or eukaryotic chromosomes approaching several million base
pairs in length.
 |
MATERIALS AND METHODS |
Virus and cells.
The Purdue strain (ATCC VR-763) of TGEV was
obtained from the American Type Culture Collection (ATCC) and passaged
once in the swine testicular (ST) cell line. ST cells were obtained
from the ATCC (ATCC 1746-CRL) and maintained in minimal essential
medium (MEM) containing 10% fetal clone II (HyClone) and supplemented with 0.5% lactalbumin hydrolysate, 1× nonessential amino acids, 1 mM
sodium pyruvate, kanamycin (0.25 µg/ml), and gentamicin (0.05 µg/ml). Baby hamster kidney cells (BHK) were maintained in alpha-MEM containing 10% fetal calf serum supplemented with 10% tryptose phosphate broth, kanamycin (0.25 µg/ml), and gentamicin (0.05 µg/ml). Feline kidney cells (CRFK) were maintained in Eagle's MEM
with nonessential amino acids, Earle's balanced salt solution, and
10% fetal bovine serum at 37°C. Wild-type TGEV or viruses (icTGEV)
derived from the full-length construct were plaque purified twice, and
stocks were grown in ST cells as described (42, 43). To
measure the growth rate of different viruses, cultures of ST cells
(5 × 105) were infected with wild-type TGEV or
various molecularly cloned isolates at a multiplicity of infection
(MOI) of 5 for 1 h. The cells were washed twice with
phosphate-buffered saline (PBS) to remove residual virus and incubated
at 37°C in complete medium. At different times postinfection, progeny
virions were harvested and assayed by plaque assay in ST cells. To
study the host range phenotype, cultures of ST or CRFK cells
(105) were infected with wild-type or molecularly cloned
icTGEV at an MOI of 5 for 1 h and fixed at 12 h postinfection
for fluorescent analysis (FA).
Mutagenesis, cloning, and sequencing of the TGEV genome.
The
cloning strategy for a full-length TGEV construct is illustrated in
Fig. 1 and is based on the observation
that the BglI restriction endonuclease cleaves at a specific
sequence palindrome (GCCNNNN
NGGC) but leaves
highly variable 3-nucleotide ends that do not randomly self-assemble.
Rather, these DNAs will only anneal with fragments containing the
complementary 3-nucleotide overhang generated at identical
BglI sites. The TGEV genome was cloned from infected ST cell
intracellular RNA by reverse transcription-PCR (RT-PCR) using primer
pairs directed against the Purdue strain of TGEV or a Taiwanese isolate
(11, 17, 33) (Table 1). To
create unique junction sites for assembly of a full-length TGEV
cDNA construct, primer-mediated PCR mutagenesis was used to insert
unique BglI restriction sites at the 5' and 3' ends of each
subclone (Table 1, Fig. 1). These primer pairs do not alter the coding
sequence and result in RT-PCR amplicons ranging in size from ~5.0 to
6.9 kb in length. Total intracellular RNA was isolated from
TGEV-infected cells using RNA STAT-60 reagents according to the
manufacturer's directions (Tel-TEST B, Inc.). To isolate the TGEV
subclones, reverse transcription was performed using Superscript II and
oligodeoxynucleotide primers according to the manufacturer's
recommendations (Gibco-BRL). Following cDNA synthesis at 50°C
for 1 h, the cDNA was denatured for 2 min at 94°C and
amplified by PCR with Expand Long Taq polymerase (Boehringer Mannheim Biochemicals) for 25 cycles at 94°C for 30 s, 58°C
for 25 to 30 s, and 68°C for 1 to 7 min depending on the size of
the amplicon. The PCR amplicons were isolated from agarose gels and cloned into Topo II TA (Invitrogen) or pGem-TA cloning vectors (Promega) according to the manufacturer's directions.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Strategy for directionally assembling a TGEV infectious
construct. (A) The TGEV genome is a linear positive-polarity RNA of
about 28,500 nucleotides. Using RT-PCR and unique oligonucleotide
primer mutagenesis, five clones spanning the entire TGEV genome were
isolated using standard recombinant DNA techniques. Unique
BglI sites were inserted at the junctions between each
clone, a unique T7 start site was inserted at the 5' end of clone A,
and a 25-nucleotide T tail and downstream NotI site were
inserted at the 3' end of clone F. The approximate location of each
site is shown. (B) Cloning the TGEV B amplicon. Because of chromosomal
instability in E. coli, it was noted that two B clones (TGEV
B1 and B3) contained large insertions at nucleotide 9973 in the TGEV
genome (17). Other TGEV B clones had deletions across these
sequences. Assuming that these insertions and deletions were
"detoxifying" poison TGEV sequences in E. coli, we
bisected the B fragment by inserting a BstXI site at
position 9949 and cloning two separate clones designated TGEV B1-1,2
and TGEV B2-1,2. Quasispecies variation in the sequence of each
independent plasmid clones is shown, with conserved changes denoted
with asterisks. These conserved changes differed from the published
sequence reported by Eleouet et al. (17) but were identical
to the sequence reported by Almazan et al. (3). To
reconstruct a wild-type B1 fragment, an SfiI-PflI
fragment from B1-1 was isolated and inserted into the TGEV B1-2
backbone to produce a consensus B1 clone.
|
|
Three to seven independent clones of each TGEV amplicon were isolated
and sequenced using a panel of primers located about
0.5 kb from each
other on the TGEV insert and an ABI model automated
sequencer. A
consensus sequence for each of the cloned fragments
was determined, and
when necessary (i.e., pTGEV A, pTGEV B1, pTGEV
C, and
pTGEV F), a consensus clone was assembled using restriction
enzymes
and standard recombinant DNA techniques to remove unwanted
amino acid
changes associated with reverse transcription or naturally
occurring
quasispecies
variation.
Assembly of a full-length TGEV infectious construct.
Each of
the plasmids was grown to high concentration, isolated, and digested or
double-digested with BglI, BstXI, or
NotI according to the manufacturer's direction (NEB) (Fig.
1A). The TGEV A clone was digested with ApaI, treated with
calf intestine alkaline phosphatase, and subsequently digested with
BglI, resulting in a ~6.3-kb fragment. The TGEV F clone
was NotI digested, treated with calf alkaline phosphatase,
and then BglI digested. All other vectors were digested with
BglI or BstXI. The appropriately sized cDNA
inserts were isolated from 0.8 to 1.2% agarose gels in TAE buffer
(Tris, acetate EDTA) containing 5 mM cytidine (Fluka) and extracted
using Qiaex II gel extraction kits according to the manufacturer's
directions (Qiagen Inc., Valencia, Calif.). Cytidine was incorporated
to reduce DNA damage associated with cumulative UV exposure during
visualization in agarose gels (21). Appropriate cDNA
subsets (A+B1, B2+C, and DE-1+F) were pooled into 100- to 300-µl
aliquots, and equivalent amounts of each DNA were ligated with T4 DNA
ligase (15 U/100 µl) at 16°C overnight in 30 mM Tris-HCl (pH
7.8)-10 mM MgCl2-10 mM dithiothreitol-1 mM ATP.
Appropriately sized products (A/B1, B2/C, and DE-1/F) were separated in
0.7% agarose gels containing 5 mM cytidine as described, isolated, and
religated as described above. The final products were purified by
phenol-chloroform-isoamyl alcohol (1:1:24) and chloroform extraction and precipitated under ethanol prior to in vitro transcription reactions. The full-length TGEV construct is designated TGEV 1000.
The nucleocapsid protein may function as part of the transcriptional
complex (
7,
15,
26). To provide N protein in
trans,
the TGEV
N gene was amplified from the
TGEV F clone using primer
pairs flanking the
N gene ORF. The
upstream primer contained an
SP6 site
(5'-TCGGCCTCGATTTAGGTGACACTATAGATGGCCAACCAGGGACAACG-3'),
while the downstream primer introduced a 14-nucleotide oligo(T)
stretch, providing a poly(A) tail following in vitro
transcription
(5'-TTTTTTTTTTTTTTAGTTCGTTACCTCGTCAATC-3'). The
TGEV leader RNA
sequence, 3'-most ORF, and noncoding sequences were not
present
in this construct. The PCR product was purified from gels and
used directly for in vitro
transcription.
RNA transfection.
Full-length transcripts of the TGEV
cDNA, TGEV 1000, were generated in vitro as described by the
manufacturer (mMessage mMachine; Ambion, Austin, Tex.) with certain
modifications. For 2 h at 37°C, several 30-µl reactions were
performed that were supplemented with 4.5 µl of a 30 mM GTP stock,
resulting in a 1:1 ratio of GTP to cap analog. Similar reactions were
performed using 1 µg of PCR amplicons encoding the TGEV N
gene sequence or Sindbis virus noncytopathic replicons encoding green
fluorescent protein (pSin-GFP; kindly provided by Charlie Rice,
Washington University) and a 2:1 ratio of cap analog to GTP
(1). The transcripts were treated with DNase I, denatured,
and separated in 0.5% agarose gels in TAE buffer containing 0.1%
sodium dodecyl sulfate. Alternatively, the transcripts were either
treated with 50 ng of RNase A for 15 min at room temperature, DNase I
treated, or directly electroporated into BHK cells.
BHK or ST cells were grown to subconfluence, trypsinized, washed twice
with PBS, and resuspended in PBS at a concentration
of 10
7
cells/ml. RNA transcripts were added to 800 µl of the cell suspension
in an electroporation cuvette, and three electrical pulses of
850 V at
25 µF were given with a Bio-Rad Gene Pulser II electroporator.
The
BHK cells were seeded with 10
6 uninfected ST cells in a
75-cm
2 flask and incubated at 37°C for 3 to 4 days. Virus
progeny were
then passaged in ST cells in 75-cm
2 flasks at
2-day intervals and purified twice by plaque
assay.
Immunofluorescence assays.
Cells were grown on LabTek
chamber slides (four or eight wells) and infected with wild-type TGEV
or molecularly cloned viruses (icTGEV-1, icTGEV-2, and icTGEV-3)
generated from the infectious construct. At 12 h postinfection,
cells were fixed in acetone-methanol (1:1) and stored at 4°C. Fixed
cells were rehydrated in PBS (pH 7.2) and incubated with a 1:100
dilution of mouse anti-TGEV polyclonal antiserum for 30 min at room
temperature. After three washes in PBS, the cells were incubated with a
1:100 dilution of goat anti-mouse immunoglobulin G-fluorescein
isothiocyanate conjugate (Sigma) for 30 min at room temperature. After
three additional washes with PBS, the cells were visualized and
photographed under a Zeiss LSM110 confocal fluorescence microscope.
Images were digitized and assembled in Photoshop 5.5 (Adobe Systems
Inc.).
RT-PCR to detect marker mutations and sequence analysis.
Cultures of ST cells were infected for 1 h at room temperature
with wild-type TGEV or plaque-purified icTGEV-1 and icTGEV-3 viruses
that were derived from the infectious construct. Intracellular RNA was
isolated at 12 h postinfection and used as the template for
RT-PCRs using four different primer pair sets that asymmetrically flank
each of the interconnecting BglI or BstXI
junctions that were used in the assembly of TGEV 1000. RT reactions
were performed using Superscript II reverse transcriptase for 1 h
at 50°C as described by the manufacturer (Gibco-BRL) prior to PCR
amplification with the reverse primer that flanked a particular
interconnecting junction. To amplify across the B1-B2 junction, forward
(5'-GCATCGTAAGACTCAACAAGG-3') and reverse
(5'-GTCACAGCAAGTGAGAACCATG-3') primers were located at
nucleotides 9738 to 9759 and 10248 to 10270, respectively, and resulted
in a 532-bp amplicon (17). In virus derived from the
infectious construct, BstXI digestion should result in 321- and 211-bp fragments. To amplify across the B2-C junction, forward (5'-TTGAGCGCGAAGCATCAGTGC-3') and reverse
(5'-TTCCACTGCCGAAAGCTTCACC-3') primers were located at
nucleotides 11231 to 11151 and 11634 to 11655, respectively, and
resulted in an amplicon of 424 bp (17). In molecularly
cloned virus, BglI digestion should result in products of
300 and 124 bp. To amplify across the C-DE-1 junction, forward (GAATGTGCACACTAGGACCTG) and reverse
(AGCAGGTGGTATGTATTGTTCG) primers were located at nucleotides
16380 to 16400 and 16936 to 16957, respectively (17). If a
BglI site is present in this 577-bp amplicon, digestion
should result in products of 370 and 207 bp. To amplify across the
DE-1-F junction, forward (CGTTGTACAGGTGGTTATGAC) and
reverse (CTCCGCTTGTCTGGTTAGAGTC) primers were located at
nucleotides 23304 to 23324 and 23852 to 23873 in the S gene,
respectively (3, 33). Following BglI digestion of
this 569-bp amplicon, 386- and 183-bp fragments should be visualized in
icTGEV virus derived from the infectious construct. Following 28 cycles
of amplification with Taq polymerase (Expand Long Kit; Roche
Biochemical), the PCR products were separated and isolated from agarose
gels. PCR amplicons were either subcloned directly into pGemT cloning vectors for sequencing or digested with BglI or
BstXI restriction endonuclease according to the
manufacturer's directions (NEB). The digested DNAs were then separated
in 1.5% agarose gels in TAE buffer and visualized under UV light. All
sequence comparisons were performed using the Vector Suite II (Informax
Inc.) Align X program.
 |
RESULTS |
Theoretical framework.
Conventional restriction enzymes, such
as PstI and EcoRI, leave sticky ends that
assemble with similarly cut DNA fragments in the presence of DNA ligase
(39) (Table 2). Assuming a
random sequence, the rare cutters (NotI, etc.) recognize an
8-nucleotide palindrome sequence and cleave DNA on average every 65,000 bp (39). This class of restriction enzymes leave compatible
ends that randomly concatamerize or reassemble with other DNA molecules having a similar compatible end. In contrast, a subclass of restriction enzymes (BglI, BstXI, and SfiI) also
recognize palindrome sequences but leave random sticky ends of 1 to 4 nucleotides in length that are not complementary to most other sticky
ends generated with the same enzyme at other sites in the DNA. The
BglI restriction endonuclease recognizes the palindrome
sequence GCCNNNN
NGGC and is
predicted to cleave the DNA every ~4,096 bp in a random DNA sequence
(39). Because a 3-nucleotide variable overhang is
generated following cleavage, 64 (43) different
variable ends can be generated, which efficiently assemble only
with the appropriate 3-nucleotide complementary overhang generated at
an identical BglI site (Table 2). Consequently, identical
BglI sites are repeated every ~262,144 bp in a random sequence of DNA.
As DNA and RNA sequences are not random, the actual distribution of
these restriction sites will vary considerably and be
heavily
influenced by the sequence of the genome, percent base
pair
composition, and the presence of duplications, inversions,
and
repetitive sequences. To address these questions, we determined
the
frequency of
BglI,
SapI,
BstXI,
SfiI, and
EcoRI sites in the
genome of a variety
of microbial and viral pathogens, including
Marburg virus, TGEV,
various herpesviruses, fowlpox virus, and
Campylobacter
jejuni and
Mycoplasma genitalium (Table
2). These
data
clearly demonstrate that the expected repeat distance of
identical
BglI sites in a given genome may be far less than or
greater
than once every 262,144 bp (Table
2). For example, the
large genomes of
C. jejuni and
M. genitalium are devoid of
SfiI
sites, yet the genome of Epstein-Barr virus contains 68
SfiI sites
because of its high GC content and the presence
of duplications
in the sequence. Potential problems of identical-end
duplicity,
however, can be circumvented if the DNA pieces are cleverly
sorted
using recursive techniques, allowing the assembly of
approximately
2
64 fragments of various sizes that contain
different
BglI ends.
Importantly, these data suggest that
the genomes of many microbial
organisms can be engineered and then
assembled by in vitro ligation
from a series of smaller subclones. As
the TGEV genome contains
a single
BglI site (Table
2), we
hypothesized that a sequential
series of smaller DNA subclones, each
flanked by unique
BglI junctions,
could be systematically
and precisely assembled into an intact
full-length TGEV cDNA
construct from which in vitro transcription
will result in an
infectious RNA (Fig.
1). To test this hypothesis,
we assembled a
full-length infectious construct of a coronavirus,
thereby
demonstrating the method's potential application for assembling
other
large genomes or chromosomes in
vitro.
Assembly of a full-length TGEV construct.
Initially, we
isolated five cDNA subclones spanning the entire TGEV genome
(designated TGEV A, B, C, DE, and F). Each cDNA subclone was
flanked by unique BglI sites and will only anneal with the
appropriate adjacent subclone, resulting in a full-length TGEV cDNA
construct (Fig. 1A). To RT-PCR clone the 6.2-kb TGEV A fragment located
at the 5' end of the TGEV genome, the forward primer included a T7
start site and the 5'-most TGEV leader RNA sequences, while the reverse
primer was located at nucleotide 6180, just downstream from a naturally
occurring BglI site (GCCTGTT
TGGC) in the TGEV genome (3, 17) (Table 1). The 5.2-kb B
fragment was amplified using a forward primer upstream of the
BglI site at position 6159 and a reverse primer which
introduced a unique BglI site
(GCCGCAT
CGGC) at position 11355 (Fig. 1). The 5.2-kb C fragment was amplified using a forward primer which introduced the same BglI site at nucleotide 11355 and a reverse primer
which introduced another unique BglI site
(GCCTTCT
TGGC) at position 16595. While our
original cloning strategy called for separate D and E fragments, it
became evident that a single 6.9-kb fragment was stable in microbial
vectors. Therefore, a single DE-1 fragment was amplified using a
forward primer that introduced the same BglI site at
position 16595 and a reverse primer which introduced a new
BglI site (GCCGTGC
AGGC) in the
S glycoprotein gene at nucleotide 23487. The F fragment was
cloned with a forward primer that introduced the same BglI
site at position 23487 and a reverse primer that contained the 3'-most
nucleotides of the TGEV genome, including an additional 25 T's prior
to terminating at a NotI site. A list of the primers used to
mutagenize the TGEV genome and to isolate each of the TGEV subclones is
shown in Table 1. These primer pairs did not alter the
amino acid coding sequence of the virus. The sequence of each
unique interconnecting junction is shown in Fig. 1.
The pTGEV A, C, DE, and F clones were stable in plasmid DNAs in
Escherichia coli. The B fragment, however, was unstable, and
only a few slow-growing isolates were obtained, all of which
contained
deletions or insertions in the wild-type sequence. During two
different cloning attempts, a 200- to 300-nucleotide fragment
from the
E. coli chromosome was inserted at position 9973, which
is in a region of instability in the TGEV genome noted by other
investigators (Fig.
1B) (
3,
17). In addition, some clones
contained a ~500-bp deletion across this region. We reasoned that
breaks in the TGEV B sequence at or around nucleotide 9973 might
ablate
fragment instability and allow the cloning of these sequences
into
E. coli. Since the TGEV B fragment does not contain a
BstXI
site, we used primer-mediated mutagenesis (C-A change
at position
9944) to bisect the B fragment into TGEV B1 and TGEV B2
amplicons
with an adjoining
BstXI
(CCAT
TCAC
TTGG) site located at
position 9949 in the TGEV genome (Fig.
1, Table
1). The 4-nucleotide
overhang
generated by
BstXI would also provide additional
specificity
and sensitivity in systematically assembling the TGEV
subclones.
After these modifications, pTGEV B1 and B2 plasmid
subclones which
were stable and grew efficiently in
E. coli were rapidly identified.
The location of each of the
subclones used in the assembly of
the TGEV full-length construct
is shown in relationship to important
motifs or
cis-acting
sequences in the viral genome (Fig.
2).
Data
from our lab and others suggest that sequences in and around the
TGEV poliovirus 3C-like protease (3-Clpro) motif are either
bactericidal
or unstable in microbial vectors (
3,
17).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 2.
Sequence and chromosomal location of the TGEV subclones.
The consensus amino acid changes that differ from the published
sequence are shown in each of the final clones used to assemble a
full-length TGEV construct (17). Each of these changes in
the TGEV sequence has also been noted by Almazan et al. (3)
at all indicated positions except those denoted by an asterisk. The
relative locations of the different TGEV motifs were taken from Eleouet
et al. (17). Abbreviations: PL, papain-like protease; GFL,
growth factor-like domain; Pol, polymerase motif; MIB, metal-binding
motif; Hel, helicase motif; VD, variable domain; CD, conserved domain;
, intergenic starts.
|
|
Inserts from three to six independent subclones from each fragment were
sequenced, and a consensus TGEV subclone was assembled
using standard
recombinant DNA techniques. The consensus sequence
of our Perdue TGEV
full-length construct contained 15 amino acid
changes and numerous
silent changes compared with the published
sequence (Fig.
2)
(
17). These changes were also noted by Almazan
et al.
(
3). T7 termination sites might also prevent efficient
in vitro transcription of infectious full-length TGEV transcripts
from
the construct. Two types of sites are known to cause pausing
and/or
termination by bacteriophage T7 RNA polymerase (
28,
37).
A
type I termination site consists of a stable stem-loop structure
that
terminates transcription in adjacent stretches of T residues,
while a
type II pause site consists of a specific 7-bp sequence
(ATCTGTT)
(
28,
37). Transcription termination will occur when
a
stretch of T's is located 6 to 8 nucleotides downstream of this
sequence (
28,
37). Type I stops had prevented transcription
of vesicular stomatitis virus full-length negative-strand RNAs
in vitro
with T7 polymerase (
58). To preempt potential problems
in
the generation of full-length TGEV transcripts, putative type
I T7 RNA
polymerase termination sites (long runs of six T's) were
identified in
the TGEV consensus sequence that starts at nucleotide
3632 in the
pTGEV A subclone and 13615 in the pTGEV C subclone
(
3,
17). Mutations were introduced by primer-mediated overlapping
PCR
mutagenesis without altering the coding sequence. Putative
type II
pause sites were also identified at nucleotides 17551,
19957, and 23103 in the TGEV genome (
3), but did not contain
the prerequisite
downstream T-rich stretch necessary for efficient
T7
termination.
To assemble a full-length cDNA construct of TGEV, plasmids were
digested with
BglI,
BstXI, or
NotI,
and the appropriate sized
inserts were isolated from agarose gels (Fig.
3A). The TGEV A
and B1, B2, and C, and
DE-1 and F fragments were ligated overnight
in the presence of T7 DNA
ligase. Systematically assembled products
were isolated from agarose
gels (Fig.
3B to D), and the TGEV A-B1,
B2-C3, and DE-1-F fragments
were religated overnight. The final
products were purified by
phenol-chloroform-isoamyl alcohol and
chloroform extraction,
precipitated under ethanol, and then separated
in agarose gels (Fig.
4A
and B). Clearly, an appropriately sized
full-length TGEV cDNA of about 29 kb in length (TGEV 1000) was
generated as well as some assembly intermediates. Capped T7 transcripts
were synthesized, treated with DNase, and analyzed in 0.5% agarose
gels in parallel with the TGEV 1000 assembled product. These data
demonstrate that low levels of high-molecular-weight
transcripts
were evident following T7 transcription in vitro (Fig.
4C).
Using
transcripts driven from various pSin replicons (encoding GFP or
T7 polymerase) as a control, we predict that these TGEV transcripts
were likely full length (data not shown). DNase treatment
removed
the TGEV full-length cDNA as well as the incomplete
assembly intermediates
(Fig.
4C).

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 3.
Assembly of the TGEV full-length construct. (A) The
various TGEV plasmid DNAs were digested with BglI,
BstXI, or NotI, and the appropriate-sized
products were isolated from agarose gels as described in the text. The
TGEV A and B1 fragments, TGEV B2 and C3 fragments, or TGEV DE-1 and F
fragments were ligated at 16°C overnight in separate reactions.
Appropriate-sized products were isolated from agarose gels. (B) A+B1.
(C) B2+C. (D) DE-1+F. Following purification from agarose gels,
the purified products are shown in panel A as well.
|
|

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
In vitro transcription from full-length TGEV constructs.
The A-B1, B2-C, and DE-1-F contigs were ligated in vitro as described
in the text. (A and B) DNA positions after 8 and 30 h of
electrophoresis, respectively. Lane 1, purified A-B1 product; lane 2, purified B2-C product; lane 3, purified DE-1-F product; lane 4, 1-kb
ladder; lane 5, in vitro-ligated products; lane 6, high-molecular-weight markers. (C) The in vitro-ligated products were
transcribed in vitro, and the products were digested with DNase for 15 min at room temperature and separated in agarose gels. Lane 1, high-molecular-weight DNA markers; lane 2, 1-kb DNA ladder; lane 3, in
vitro-ligated TGEV products; lane 4, DNase-treated in vitro
transcripts. Arrow indicates high-molecular-weight transcripts.
|
|
Transfection and recovery of infectious virus.
Synthesis of
full-length TGEV transcripts was difficult but resulted in
high-molecular-weight RNA product (Fig. 4C). To enhance transfection efficiencies, we tested several different strategies to maximize infectivity of the putative full-length transcripts in vitro. Under identical conditions of treatment, about 10 to 20% of ST cells are efficiently transfected with Sindbis replicons encoding GFP (1), compared with about 60 to 80% of the BHK cells (data not shown). As coronavirus host range specificity occurs
primarily at entry and the genomic RNA is infectious in a
variety of permissive and nonpermissive cells (5, 14, 41, 44,
51), we reasoned that BHK cells might be more sensitive primary
hosts because of the intrinsically higher transfection efficiency. In
addition, several reports have suggested that the coronavirus N
nucleocapsid protein may function as part of the transcription complex
and may influence the translation efficiency of viral mRNAs
(7, 15, 49). Because these data suggested that N might
enhance the infectivity of full-length transcripts, four
different transfection strategies were tested in BHK cells. We
transfected BHK cells with TGEV transcripts alone, TGEV plus TGEV
N gene transcripts, or just TGEV N transcripts.
In a parallel experiment, TGEV and TGEV N gene transcripts
were treated with RNase A prior to transfection. Following
electroporation, the BHK cells were seeded with 106 ST
cells to serve as appropriate permissive hosts for progeny virus amplification.
Three days posttransfection, supernatants were passaged into ST cells,
and cytopathic effect was observed within 36 h postinfection
only
with supernatants derived from the TGEV-
N
gene-transfected
cultures. Supernatants were harvested at 48 h
postinfection and
passaged twice more at 48-h intervals in fresh ST
cell cultures.
Cytopathic effect typical of TGEV infection was evident
at each
passage (data not shown). Fluorescent antibody staining with
mouse
anti-TGEV serum demonstrated that viral antigen was clearly
present
in each passage (data not shown). Using RT-PCR with primer
pairs
located within the leader RNA sequence and at the 3' end of
the
TGEV genome, leader-containing subgenomic mRNA
transcripts (mRNAs
6 and 7) encoding the N and hydrophobic membrane
proteins were
also evident in passage 1 ST cells (data not
shown). Furthermore,
virus derived from the TGEV 1000 transcripts
was diluted and inoculated
into ST cells, where plaques developed after
48 h (Fig.
5). No
significant
differences in plaque morphology were noted between
the molecularly
cloned recombinant viruses and wild type, suggesting
that the cDNA
construct did not contain debilitating mutations.
Transcripts of TGEV
plus
N gene treated with RNase A prior to
electroporation
did not result in the production of infectious
virus.

View larger version (107K):
[in this window]
[in a new window]
|
FIG. 5.
Plaque morphology of icTGEV viruses. Cultures of ST
cells were infected with wild-type (WT) TGEV, icTGEV-1, and icTGEV-3.
Cells were stained with neutral red at 48 h postinfection, and
images were digitized and prepared using PhotoShop 5.5.
|
|
Plaque-purified stocks prepared from passages 1 through 3 of icTGEV
(icTGEV-1, icTGEV-2, and icTGEV-3, respectively) were
used in growth
curves and compared to the parental TGEV strain
in ST cells. Cultures
were infected with virus at an MOI of 5
for 1 h, and samples were
harvested at selected times over the
next 44 h. No significant
differences in the replication of wild-type
TGEV- or TGEV 1000-derived
viruses icTGEV-1, icTGEV-2, and icTGEV-3
were noted in ST cells, and
all viruses replicated to titers that
approached 10
8 PFU/ml
within 28 h (Fig.
6). These data
indicate that viruses
derived from the infectious cDNA construct
had phenotypes indistinguishable
from those of wild-type TGEV in swine
cells. TGEV efficiently
utilizes the feline and porcine
aminopeptidase N receptors for
docking and entry and can replicate
efficiently in feline CRFK
cells (
14,
51) (data not
shown). To determine the host range
phenotype of these viruses,
cultures of ST and CRFK cells were
infected with the molecularly cloned
icTGEV-1 or icTGEV-3 virus
at an MOI of 5 and fixed at 12 h
postinfection. Viral antigen
expression was measured by FA (Fig.
7). Efficient virus docking
and entry
were evidenced by significant levels of antigen expression
in swine and
feline cells infected with the molecularly cloned
viruses. These data
demonstrate that the molecularly cloned viruses
had a host range
phenotype similar to that of the wild type.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
Growth curves of plaque-purified molecularly cloned
viruses. Plaque-purified wild-type TGEV and recombinant TGEV viruses
(icTGEV-1, icTGEV-2, and icTGEV-3) derived from the infectious
construct were inoculated into ST cells at an MOI of 5 for 1 h at
room temperature. The virus was removed, and the cultures were
incubated in complete medium at 37°C. Samples were harvested at the
indicated times and assayed by plaque assay in ST cells.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 7.
Host range phenotype of molecularly cloned icTGEV.
Cultures of ST or CRFK cells (105) were inoculated with
molecularly cloned viruses icTGEV-1 and icTGEV-3 at an MOI of 5 for
1 h at room temperature. The inocula were removed, and the cells
were incubated in complete medium at 37°C for 12 h. Medium was
removed, and the cells were fixed in a 50% methanol-acetone mix,
washed, and stained by FA as described in the text. (A) Mock-infected
ST. (B) icTGEV-1-infected ST cells. (C) icTGEV-3-infected ST cells. (D)
Mock-infected CRFK cells. (E) icTGEV-1-infected CRFK cells. (F)
icTGEV-3-infected CRFK cells.
|
|
Identification of marker mutations.
Infectious virus derived
from transfected cultures should contain the four unique
interconnecting junction sequences used in the construction of the
infectious TGEV 1000 construct (Fig. 1 and 2). If these noncoding
mutations produce a neutral phenotype on virus replication, they should
also be stable during passage. Consequently, wild-type TGEV, icTGEV-1,
and icTGEV-3 were inoculated into ST cells, and intracellular RNA was
isolated at 12 h postinfection. Using RT-PCR and primer pairs that
asymmetrically flank each of the B1-B2, B2-C, C-DE-1, and DE-1-F
junctions, we amplified products of ~400 to 600 bp (Fig.
8). Results using restriction fragment length polymorphism analysis demonstrated that none of the marker mutations were present in the wild-type TGEV genome (Fig.
8A). However, the icTGEV-1 and icTGEV-3 viruses both
contained the unique marker mutation profiles used to create the unique
BglI and BstXI restriction sites within the TGEV
1000 construct (Fig. 8B and C). The PCR products were subcloned, and
the reverse complement of the sequence is shown, demonstrating that the
appropriate mutations were present in the viruses isolated from the
infectious construct (Fig. 9). Clearly,
TGEV 1000 transcripts were infectious and produced virus which
contained the appropriate marker mutations. These data illustrate that
infectious constructs of coronaviruses can be systematically and
precisely assembled from a series of smaller subclones in vitro.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 8.
Marker mutations are present in virus derived from the
infectious construct. Cultures of ST cells were infected with wild-type
(WT) TGEV or plaque-purified icTGEV isolates derived from the
infectious construct. Intracellular RNA was isolated, and RT-PCR
was performed using primer pairs that asymmetrically flank each
of the unique BglI-BstXI junctions inserted into
the infectious construct. (A) Wild-type TGEV. (B) icTGEV-1 (passage 1).
(C) icTGEV-3 (passage 3). In panel C, a larger ~1.6-kb wild-type
TGEV amplicon spanning the B1-B2 junction was also treated with
BstXI as a control (the amplicon was derived from primer
pairs located between nucleotides 9730 and 9750 and 11342 and 11362 in
the TGEV sequence [3]). Arrows indicate cleaved DNA
intermediates.
|
|

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 9.
Sequence analysis of icTGEV-3. The uncut RT-PCR
amplicons shown in Fig. 8 were isolated from gels and subcloned into
Topo II TA cloning vectors. Inserts were sequenced using universal
primers and an automated sequencer. (A) icTGEV-3 B2-C junction.
(B) icTGEV-3 C-DE junction. (C) icTGEV-3 DE-F junction. Note:
sequences are the reverse complement of the genomic TGEV
sequence. The wild-type virus sequence is also noted in each panel.
|
|
 |
DISCUSSION |
The complete ~30-kb nucleotide sequence for a number of
coronaviruses has been available for about 10 years (8, 17, 22, 27), yet until recently, a full-length infectious clone has not
been assembled because of size constraints and regions of coronavirus
genomic instability in bacterial vectors, the requirement for a
vector system which allows simple reverse genetic applications, and the
inability to synthesize full-length transcripts in vitro. Each of these
inherent restrictions must be circumvented to assemble infectious
coronavirus constructs and at the same time allow easy reverse genetic
applications. In a landmark achievement, a full-length TGEV infectious
clone was recently engineered into BAC vectors using standard DNA
techniques (3). Following DNA transfection into ST cells,
full-length transcripts were initially transcribed from a
cytomegalovirus (CMV) promoter and then amplified by virus replication
in the cytoplasm of the cell. In this paper, we describe a rapid
approach to systematically assembling a full-length infectious TGEV
cDNA from a panel of six smaller subclones using in vitro ligation.
These methods will provide a powerful complementary approach to
systematically assemble new large cDNAs from a variety of microbial
pathogens into BAC or other vectors that stably maintain large DNA
inserts (30). Importantly, RNA or DNA genomes which are too
large, circular, or unstable in these cloning vectors can still be
assembled using this in vitro ligation technique. As coronaviruses
contain the largest RNA genome, these approaches should permit reverse
genetic studies for all RNA viruses.
Evidence from several experiments demonstrated that transcripts of the
TGEV 1000 genomic construct were infectious. Transcripts treated with RNase were not infectious, indicating that infection was
likely initiated from the RNA transcripts synthesized in vitro. Medium
from transfected cultures could be used to propagate infection, with
corresponding cytopathology and viral antigen expression in fresh
cultures of cells. Progeny virions formed plaques in monolayers
of permissive cells, and plaque-purified molecularly cloned virus grew
efficiently to levels equivalent to those of wild-type virus in
permissive host cells. The host range phenotypes of molecularly
cloned viruses and wild-type virus were similar in vitro,
although additional experiments are needed to determine if these
viruses utilize the feline aminopeptidase receptor for docking and
entry into feline cells (51). Most importantly, plaque-purified virus contained the expected BglI and
BstXI marker mutations, providing definitive evidence that
transcripts driven from the TGEV 1000 construct were infectious in
vitro. The presence of these neutral mutations did not restrict the
ability of icTGEV to replicate efficiently in ST cells.
It is remarkable that two entirely different approaches can be
exploited to engineer infectious constructs of large RNA and DNA
viruses. Our assembly strategy for coronavirus infectious constructs is
simple and straightforward and does not depend on the availability of
an existing viral defective interfering cDNA clone as a foundation
for building the infectious construct (3). In contrast to
infectious clones of other positive-strand RNA viruses (1, 2, 3,
13, 32, 35, 54), the TGEV 1000 construct must be assembled de
novo and does not exist intact in bacterial vectors, circumventing
problems in sequence instability. This did not restrict its
applicability for reverse genetic applications, but rather allowed
genetic manipulation of independent subclones, which will minimize the
introduction of spurious mutations elsewhere in the genome during
recombinant DNA manipulation. Another advantage of our approach is that
different combinations of restriction sites can be used that generate
highly variable 5' or 3' overhangs of 1 to 4 nucleotides in
length, further increasing the specificity and sensitivity of the
assembly cascade (Table 2). Because of insert toxicity in E. coli, infectious clones of yellow fever virus and Japanese
encephalitis virus were assembled by in vitro ligation from two
subclones but used conventional restriction enzymes like
BamHI, ApaI, and AatI (34,
48). Our strategy, however, prevents spurious self-assembly of
subclones and will provide a strong complementary approach to
engineering large RNA or DNA genomes into BAC vectors or other vectors
that stably maintain large DNA inserts (3).
It is interesting that in both TGEV infectious constructs assembled to
date, sequences in or around the TGEV 3-Clpro motif were unstable in
E. coli. Our studies, coupled with the findings by Almazan
et al. (3), suggest that the unstable sequences can be
disabled by bisecting the sequence between nucleotides 9758 and 9949 in
the TGEV genome. This information may permit the isolation of larger
TGEV A-B1, B2-C, and DE-F subclones and allow the assembly of
infectious cDNAs following a single DNA isolation-ligation step. It
is not clear whether similar unstable sequences are located at this
position in other group 1 and group 2 coronaviruses.
Synthesizing ~29-kb transcripts in vitro is problematic and the
greatest impediment to generating infectious RNA from the assembled
TGEV 1000 construct. Using a DNA launch platform and transcription of
TGEV RNAs from a CMV promoter, transfection resulted in ~36
infectious units/10 µg of DNA (3). Using an RNA launch platform, similar results were obtained in our laboratory. Compared with Sindbis virus replicons encoding GFP, we synthesized ~100-fold less full-length TGEV transcripts in vitro, probably due to the extreme
size of the viral genome (data not shown). Using transcripts driven
from the ~28.5-kb TGEV full-length construct alone, viral structural
gene expression was not noted in 105 cells. In BHK cultures
cotransfected with TGEV and N gene transcripts, ~100 to
500 cells per 105 cells expressed viral structural proteins
under identical conditions (data not shown). At 16 h
posttransfection, little if any structural protein expression was noted
in BHK cells electroporated with N gene transcripts alone or
transcripts treated with RNase A. This compares with transfection
efficiencies of greater than 60% using the 11- to 12-kb Sindbis virus
noncytopathic replicons encoding GFP. Although less dramatic, similar
problems were reported with the ~13-kb infectious arterivirus
cDNA clone (54). These problems may be circumvented
somewhat by constructing BHK cell lines that simultaneously express the
swine aminopeptidase N receptor and T7 RNA polymerase, allowing DNA
transfection and transcription in vivo, and direct selection of progeny
virus amplification in susceptible BHK cell lines (1, 14,
51). Alternatively, CMV promoters can be inserted at the 5' end
of the TGEV A clone, allowing DNA launch of infectious RNA
(3).
In our studies, we could not generate infectious full-length
transcripts until the putative T7 polymerase stop signals were removed
from the TGEV genome, cytidine was included in agarose gels to reduce
UV damage to DNA fragments, and BHK cells were used as recipient hosts
(21). At this time, we have no direct evidence that the T
stretches in the TGEV A and C fragments might act as T7 termination
sites, as the RNA structure in these regions has not been characterized
biochemically. Inclusion of capped N gene transcripts during
the transfection process also enhanced the infectivity of the TGEV
full-length construct in three separate trials. It is not completely
clear whether these results were simply serendipitous or whether N
transcripts were simply protecting the full-length transcripts from
degradation by competitively interfering with RNase activity in cells
or culture medium. The N protein may also protect the genome-length RNA
in a ribonucleoprotein structure in the cell, enhance infectivity
directly by stabilizing or functioning as part of an intact replication
complex (7, 15, 26), or enhance the expression of viral
mRNAs (49). Interestingly, TGEV engineered into BAC
vectors did not require the presence of nucleocapsid protein to enhance
transcript infectivity, suggesting an ancillary role for N transcripts
in our system (3).
Prior to these and earlier studies (3), targeted RNA
recombination using defective interfering donor RNAs was the best method for introducing precise alterations into the structural genes of
the group II coronavirus mouse hepatitis virus, but this approach has
been essentially limited to the 3'-most 9 kb of the mouse hepatitis
virus genome (24, 25, 53). The availability of TGEV
infectious constructs will obviously benefit studies of all aspects of
TGEV biology and pathogenesis, including analysis of the coronavirus
replicase and the somewhat controversial transcription processes which
govern expression of the subgenome-length mRNAs (17, 40, 42,
43). The future development of TGEV vaccines and expression
vectors is a particularly intriguing application, as the polycistronic
genome organization and synthesis of subgenome-length mRNAs may
allow the simultaneous expression of multiple foreign genes
(18). It will also be relatively easy to target TGEV to other species by simple replacements of the S glycoprotein
gene (14, 25, 51). In contrast to arterivirus expression
vectors, the coronavirus intergenic sequences rarely overlap upstream
ORFs, simplifying the design and expression of foreign genes from
downstream intergenic promoters (11, 17, 52). Several TGEV
downstream ORFs also appear to encode luxury functions that can be
deleted from the viral genome without affecting infectivity in vitro
(18, 29, 56, 57). Finally, the helical TGEV nucleocapsid
structure may minimize packaging constraints and allow the expression
of multiple large genes from a single construct (18, 26,
36).
The theoretical limits of our technique may approach several million
base pairs of DNA and provide a rapid approach for inserting large
cDNAs into BAC vectors (20, 30, 45). The systematic assembly method should be appropriate for constructing full-length infectious constructs of other large RNA viruses, including
coronaviruses (27 to 32 kb), toroviruses (24 to 27 kb), and filoviruses
like the Ebola and Marburg viruses (19 kb) (10, 26, 31).
Viral genomes which are unstable in prokaryotic vectors might also
be successfully cloned using these methods (9, 34, 48).
Moreover, full-length infectious double-stranded DNA genomes of
adenoviruses and herpesviruses promise to be a powerful tool in
vaccination, gene transfer, and gene therapy (30, 45, 50,
55). Historically, full-length infectious constructs of these DNA
viruses have been generated by ligation of DNA fragments, by homologous
recombination (the more widely used method), or as full-length clones
in BAC vectors (30, 38, 45, 50, 55). Direct ligation of DNA fragments has been restricted by the low efficiency of large-fragment ligations and the scarcity of unique restriction sites that make the
approach technically challenging. Systematic and precise assembly using
rare cutters (SfiI and SapI) that leave variable
ends and can be purposely engineered into a sequence should simplify
assembly of large double-stranded DNA viruses (Table 2). This will
alleviate the difficulties associated with typical restriction enzymes
or recombination approaches, which often result in second-site
alterations (38, 45, 50, 55). This method may also
circumvent other restrictions inherent in recombination-based methods
which are limited to specific regions in the viral genome and which
often result in recombinant viruses which are not wild type while
allowing the introduction or removal of only a few genes in the virus vectors.
Our systematic assembly approach is not limited to manipulating the
chromosomes of large RNA and DNA viruses. Over the past decade, the
genome sequence of a large number of prokaryotic and eukaryotic
chromosomes has provided significant insight into gene organization,
structure, and function and likely identified the minimal set of genes
required for prokaryotic life (12, 23; TIGR home
page http://www.tigr.org). Reconstruction of a minimal genome from the
bottom up is technically challenging and requires systematically
assembling large DNA fragments and then inserting the reconstructed
genome into an environment that allows metabolic activity and
replication (12). Using a recursive approach, the systematic
assembly of large chromosomes or minichromosomes from the bottom up is
theoretically feasible (Table 2). Technical challenges will likely
include the isolation of large DNA fragments and accompanying assembly
intermediates from gels and the introduction of large DNA genomes into
environments that permit replication. Our approach, however, may
provide a means to address the function of large blocks of DNA, like
pathogenesis islands, or to directly engineer chromosomes that contain
large gene cassettes of interest (12). Additional studies
will be needed to test the application of these methods in other viral,
prokaryotic, and eukaryotic genomes.
 |
ACKNOWLEDGMENTS |
We thank Robert E. Johnston, Nancy Davis, Patrick Harrington,
Mary Schaad, Mark Denison, and Lawrence Park for helpful discussion and
encouragement during the course of these studies.
This work was supported by a research grant from the National
Institutes of Health (AI 23946).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Epidemiology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-7400. Phone: (919) 966-3895. Fax: (919) 966-2089. E-mail: rbaric{at}sph.unc.edu.
 |
REFERENCES |
| 1.
|
Agapov, E. V.,
I. Frolov,
B. D. Lindenbach,
B. M. Pragai,
S. Schlesinger, and C. M. Rice.
1998.
Noncytopathic sindbis virus RNA vectors for heterologous gene expression.
Proc. Natl. Acad. Sci. USA
95:12989-12994[Abstract/Free Full Text].
|
| 2.
|
Ahlquist, P.,
R. French,
M. Janda, and L. S. Loesch-Fries.
1984.
Multicomponent RNA plant virus infection derived from cloned viral cDNA.
Proc. Natl. Acad. Sci. USA
81:7066-7070[Abstract/Free Full Text].
|
| 3.
|
Almazan, F.,
J. M. Gonzalez,
Z. Penzes,
A. Izeta,
E. Calvo,
J. Plana-Duran, and L. Enjuanes.
2000.
Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome.
Proc. Natl. Acad. Sci. USA
97:5516-5521[Abstract/Free Full Text].
|
| 4.
|
Baric, R. S., and B. Yount.
2000.
Subgenomic negative-strand function during mouse hepatitis virus infection.
J. Virol.
74:4039-4046[Abstract/Free Full Text].
|
| 5.
|
Baric, R. S.,
E. Sullivan,
L. Hensley,
B. Yount, and W. Chen.
1999.
Persistent infection promotes cross-species transmissibility of mouse hepatitis virus.
J. Virol.
71:638-649.
|
| 6.
|
Baric, R. S.,
M. C. Schaad, and S. Stohlman.
1990.
Establishing a genetic recombination map for the murine coronavirus strain A59 complementation groups.
Virology
177:646-656[CrossRef][Medline].
|
| 7.
|
Baric, R. S.,
G. W. Nelson,
J. O. Fleming,
M. M. C. Lai, and S. A. Stohlman.
1988.
Interactions between coronavirus nucleocapsid protein and viral RNAs: implications for viral transcription.
J. Virol.
62:4280-4287[Abstract/Free Full Text].
|
| 8.
|
Boursnell, M. E.,
T. D. Brown,
I. J. Foulds,
P. F. Green,
F. M. Tomley, and M. M. Binns.
1987.
Completion of the sequence of the genome of the coronavirus avian infectious bronchitis virus.
J. Gen. Virol.
68:57-77[Abstract/Free Full Text].
|
| 9.
|
Boyer, J. C., and A. L. Haenni.
1994.
Infectious transcripts and cDNA clones of RNA viruses.
Virology
198:415-426[CrossRef][Medline].
|
| 10.
|
Cavanagh, D., and M. C. Horzinek.
1993.
Genus Torovirus assigned to the Coronaviridae.
Arch. Virol.
128:395-396[CrossRef][Medline].
|
| 11.
|
Chen, C. M.,
D. Cavanagh, and P. Britton.
1997.
Cloning and sequencing of a 8.4 kb region from the 3' end of a Taiwanese virulent isolate of the coronavirus transmissible gastroenteritis virus.
Virus Res.
38:83-89.
|
| 12.
|
Cho, M. K.,
D. Magnus,
A. L. Caplan,
McGee, and the Ethics of Genomics Group.
1999.
Ethical considerations in synthesizing a minimal genome.
Science
286:2087-2090[Free Full Text].
|
| 13.
|
Davis, N. L.,
L. V. Willis,
J. F. Smith, and R. E. Johnston.
1989.
In vitro synthesis of infectious Venezuelan equine encephalitis virus RNA from a cDNA clone: analysis of a viable deletion mutant.
Virology
171:189-204[CrossRef][Medline].
|
| 14.
|
Delmas, B.,
J. Gelfi,
R. L'Haridon,
L. K. Vogel,
H. Sjostrom,
O. Noren, and H. Laude.
1992.
Aminopeptidase N is a major receptor for the enteropathogenic coronavirus TGEV.
Nature
357:417-420[CrossRef][Medline].
|
| 15.
|
Denison, M. R.,
w. J. Spaan,
Y. van der Meer,
C. A. Gibson,
A. C. Sims,
B. Prentice, and X. T. Lu.
1999.
The putative helicase of the coronavirus mouse hepatitis virus is processed from the replicase gene polyprotein and localizes in complexes that are active in viral RNA synthesis.
J. Virol.
73:6862-6871[Abstract/Free Full Text].
|
| 16.
|
De Vries, A. A. F.,
M. C. Horzinek,
P. J. M. Rottier, and R. I. de Groot.
1997.
The genome organization of the Nidovirales: similarities and differences between arteriviruses, toroviruses and coronaviruses.
Semin. Virol.
8:33-47[CrossRef].
|
| 17.
|
Eleouet, J. F.,
D. Rasschaert,
P. Lambert,
L. Levy,
P. Vende, and H. Laude.
1995.
The complete sequence (20kb) of the polyprotein-encoding gene 1 of transmissible gastroenteritis virus.
Virology
206:817-822[CrossRef][Medline].
|
| 18.
|
Enjuanes, L., and B. A. M. Van der Zeijst.
1995.
Molecular basis of transmissible gastroenteritis coronavirus (TGEV) epidemiology, p. 337-376.
In
S. G. Siddell (ed.), The Coronaviridae. Plenum Press, New York, N.Y.
|
| 19.
|
Gorbalenya, A. E.,
E. V. Koonin,
A. P. Donchenko, and V. M. Blinov.
1989.
Coronavirus genome: prediction of putative functional domains in the nonstructural polyprotein by comparative amino acid sequence analysis.
Nucleic Acids Res.
17:4847-4861[Abstract/Free Full Text].
|
| 20.
|
Grimes, B., and H. Cooke.
1998.
Engineering mammalian chromosomes.
Hum. Mol. Genet.
7:1635-1640[Abstract/Free Full Text].
|
| 21.
|
Grundemann, D., and E. Schomig.
1996.
Protection of DNA during preparative agarose gel electrophoresis against damage induced by ultraviolet light.
Biotechniques
21:898-903[Medline].
|
| 22.
|
Herold, J.,
T. Raabe,
B. Schelle-Prinz, and S. G. Siddell.
1993.
Nucleotide sequence of the human coronavirus 229E RNA polymerase locus.
Virology
195:680-691[CrossRef][Medline].
|
| 23.
|
Hutchison, C. A.,
S. N. Peterson,
S. R. Gill,
R. T. Cline,
O. White,
C. M. Fraser,
H. O. Smith, and J. C. Venter.
1999.
Global transposon mutagenesis and a minimal Mycoplasma genome.
Science
286:2165-2169[Abstract/Free Full Text].
|
| 24.
|
Koetzner, C. A.,
M. M. Parker,
C. S. Ricard,
L. S. Sturman, and P. S. Masters.
1992.
Repair and mutagenesis of the genome of a deletion mutant of the coronavirus mouse hepatitis virus by targeted RNA recombination.
J. Virol.
66:1841-1848[Abstract/Free Full Text].
|
| 25.
|
Kuo, L.,
G.-J. Godeke,
J. B. M. Raamsman,
P. S. Masters, and P. J. M. Rottier.
2000.
Retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier.
J. Virol.
74:1393-1406[Abstract/Free Full Text].
|
| 26.
|
Lai, M. M. C., and D. Cavanagh.
1997.
The molecular biology of coronaviruses.
Adv. Virus Res.
48:1-100.
|
| 27.
|
Lee, H. J.,
C. K. Shieh,
A. E. Gorbalenya, et al.
1991.
The complete nucleotide sequence of murine coronavirus gene 1 encoding the putative proteases and RNA polymerase.
Virology
180:567-582[CrossRef][Medline].
|
| 28.
|
Lyakhov, D. L.,
B. He,
X. Zhang,
F. W. Studier,
J. J. Dunn, and W. T. McAllister.
1998.
Pausing and termination by bacteriophage T7.
J. Mol. Biol.
280:201-213[CrossRef][Medline].
|
| 29.
|
McGoldrick, A.,
J. P. Lowing, and D. J. Paton.
1999.
Characterization of a recent virulent TGEV from Britain with a deleted ORF3a.
Arch. Virol.
4:763-770.
|
| 30.
|
Messerle, M.,
I. Crnkovic,
W. Hammerschmidt,
H. Ziegler, and U. H. Koszinowski.
1997.
Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome.
Proc. Natl. Acad. Sci. USA
94:14759-14763[Abstract/Free Full Text].
|
| 31.
|
Peters, C. J.,
A. Sanchez,
P. E. Rollin,
T. G. Ksiazek, and F. A. Murphy.
1996.
Filoviridae: Marburg and Ebola viruses, p. 1161-1176.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology. Lippincott Williams and Wilkens, Philadelphia, Pa.
|
| 32.
|
Racaniello, V. R., and D. Baltimore.
1981.
Cloned poliovirus complementary DNA is infectious in mammalian cells.
Science
214:916-919[Abstract/Free Full Text].
|
| 33.
|
Rasschaert, D., and H. Laude.
1987.
The predicted primary structure of the peplomer protein E2 of the porcine coronavirus transmissible gastroenteritis virus.
J. Gen. Virol.
68:1883-1890[Abstract/Free Full Text].
|
| 34.
|
Rice, C. M.,
A. Grakovig,
R. Galler, and T. J. Chambers.
1989.
Transcription of yellow fever RNA from full length cDNA templates produced by in vitro ligation.
New Biol.
1:285-296[Medline].
|
| 35.
|
Rice, C. M.,
R. Levis,
J. H. Strauss, and H. V. Huang.
1987.
Production of infectious RNA transcripts from Sindbis virus cDNA clones: mapping of lethal mutations, rescue of a temperature-sensitive marker, and in vitro mutagenesis to generate defined mutants.
J. Virol.
61:3809-3819[Abstract/Free Full Text].
|
| 36.
|
Risco, C.,
I. M. Anton,
L. Enjuanes, and J. L. Carrascosa.
1996.
The transmissible gastroenteritis coronavirus contains a spherical core shell consisting of M and N proteins.
J. Virol.
70:4773-4777[Abstract].
|
| 37.
|
Rosenberg, A. H.,
B. N. Lade,
D-s Chui,
S.-W. Lin,
J. J. Dunn, and F. W. Studier.
1987.
Vectors for selective expression of cloned DNAs by T7 RNA polymerase.
Gene
56:125-135[CrossRef][Medline].
|
| 38.
|
Rosenfeld, M. A.,
W. Siegfried,
K. Yoshimura,
K. Yoneyama,
M. Fukayama,
L. F. Stier,
P. K. Paako,
P. Gilardi,
L. D. Stratford-Perricaudet,
M. Perricaudet,
S. Jallat,
A. Pavirani,
J. P. Lecocq, and R. G. Crystal.
1991.
Adenovirus-mediated transfer of a recombinant 1 antitrypsin gene to the lung epithelium in vitro.
Science
252:431-434[Abstract/Free Full Text].
|
| 39.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed., p. 5.1-5.31.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 40.
|
Schaad, M. C., and R. S. Baric.
1994.
Genetics of mouse hepatitis virus transcription: evidence that subgenomic negative strands are functional templates.
J. Virol.
68:8169-8179[Abstract/Free Full Text].
|
| 41.
|
Schochetman, G.,
R. H. Stevens, and R. W. Simpson.
1977.
Presence of infectious polyadenylated RNA in the coronavirus avian infectious bronchitis virus.
Virology
77:772-782[CrossRef][Medline].
|
| 42.
|
Sethna, P. B.,
M. A. Hofmann, and D. A. Brian.
1991.
Minus-strand copies of replicating coronavirus mRNAs contain antileaders.
J. Virol.
65:320-325[Abstract/Free Full Text].
|
| 43.
|
Sethna, P. B.,
S. L. Hung, and D. A. Brian.
1989.
Coronavirus subgenomic minus-strand RNAs and the potential for mRNA replicons.
Proc. Natl. Acad. Sci. USA
86:5626-5630[Abstract/Free Full Text].
|
| 44.
|
Siddell, S. G. (ed.).
1995.
The Coronaviridae, p. 1-10.
Plenum Press, New York, N.Y.
|
| 45.
|
Smith, G. A., and L. W. Enquist.
2000.
A self-recombining bacterial artificial chromosome and its application for analysis of herpesvirus pathogenesis.
Proc. Natl. Acad. Sci. USA
97:4873-4979[Abstract/Free Full Text].
|
| 46.
|
Snijder, E. J., and M. C. Horzinek.
1993.
Toroviruses: replication, evolution and comparison with other members of the coronavirus-like superfamily.
J. Gen. Virol.
74:2305-2316[Abstract/Free Full Text].
|
| 47.
|
Sosnovtsev, S., and K. Y. Green.
1995.
RNA transcripts derived from a cloned full length copy of the feline calicivirus genome do not require VpG for infectivity.
Virology
210:383-390[CrossRef][Medline].
|
| 48.
|
Sumyoshi, H.,
C. M. Hoeke, and D. W. Trent.
1992.
Infectious Japanese encephalitis virus RNA can be synthesized from in vitro-ligated cDNA templates.
J. Virol.
66:5425-5431[Abstract/Free Full Text].
|
| 49.
|
Tahara, S. M.,
T. A. Dietlin,
C. C. Bergmann,
G. W. Nelson,
S. Kyuwa,
R. P. Anthony, and S. A. Stohlman.
1994.
Coronavirus translational regulation: leader effects mRNA efficiency.
Virology
202:621-630[CrossRef][Medline].
|
| 50.
|
Tong-Chuan, H.,
S. Zhou,
L. T. Da Costa,
J. yu,
K. W. Kinzler, and B. Vogelstein.
1998.
A simplified system for generating recombinant adenoviruses.
Proc. Natl. Acad. Sci. USA
95:2509-2514[Abstract/Free Full Text].
|
| 51.
|
Tresnan, D. B.,
R. Levis, and K. V. Holmes.
1996.
Feline aminopeptidase N serves as a receptor for feline, porcine, and human coronaviruses in serogroup 1.
J. Virol.
70:8669-8674[Abstract].
|
| 52.
|
Tung, F. Y. T.,
S. Abraham,
M. Sethna,
S.-L. Hung,
P. B. Sethna,
B. G. Hogue, and D. A. Brian.
1992.
The 9.1 kilodalton hydrophobic protein encoded at the 3' end of the porcine transmissible gastroenteritis coronavirus genome is membrane associated.
Virology
186:676-683[CrossRef][Medline].
|
| 53.
|
Van der Most, R. G.,
L. Heijnen,
W. J. Spaan, and R. J. de Groot.
1992.
Homologous recombination allows efficient introduction of site-specific mutations into the genome of coronavirus MHV-A59 via synthetic co-replicating RNAs.
Nucleic Acids Res.
20:3375-3381[Abstract/Free Full Text].
|
| 54.
|
Van Dinten, L. C.,
J. A. den Boon,
A. L. M. Wassenaar,
W. J. M. Spaan, and E. J. Snijder.
1997.
An infectious retrovirus cDNA clone: identification of a replicase point mutation that abolishes discontinuous mRNA transcription.
Proc. Natl. Acad. Sci. USA
94:991-996[Abstract/Free Full Text].
|
| 55.
|
Van Zijl, M.,
W. Quint,
J. Briaire,
T. de Rover,
A. Gielkens, and A. Berns.
1988.
Regeneration of herpesviruses from molecularly cloned subgenomic fragments.
J. Virol.
62:2191-2195[Abstract/Free Full Text].
|
| 56.
|
Vaughn, E. M.,
P. G. Halbur, and P. S. Paul.
1995.
Sequence comparisons of porcine respiratory coronavirus isolates reveals heterogeneity in the S, 3, and 3-1 genes.
J. Virol.
69:3176-3184[Abstract].
|
| 57.
|
Wesley, R. D.,
R. D. Woods, and A. K. Cheung.
1991.
Genetic analysis of porcine respiratory coronavirus, an attenuated variant of transmissible gastroenteritis virus.
J. Virol.
65:3369-3373[Abstract/Free Full Text].
|
| 58.
|
Whelan, S.,
A. Ball,
J. Barr, and G. Wertz.
1995.
Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones.
Proc. Natl. Acad. Sci. USA
92:8388-8392[Abstract/Free Full Text].
|
Journal of Virology, November 2000, p. 10600-10611, Vol. 74, No. 22
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lippow, S. M., Aha, P. M., Parker, M. H., Blake, W. J., Baynes, B. M., Lipovsek, D.
(2009). Creation of a type IIS restriction endonuclease with a long recognition sequence. Nucleic Acids Res
37: 3061-3073
[Abstract]
[Full Text]
-
Miknis, Z. J., Donaldson, E. F., Umland, T. C., Rimmer, R. A., Baric, R. S., Schultz, L. W.
(2009). Severe Acute Respiratory Syndrome Coronavirus nsp9 Dimerization Is Essential for Efficient Viral Growth. J. Virol.
83: 3007-3018
[Abstract]
[Full Text]
-
Oostra, M., Hagemeijer, M. C., van Gent, M., Bekker, C. P. J., te Lintelo, E. G., Rottier, P. J. M., de Haan, C. A. M.
(2008). Topology and Membrane Anchoring of the Coronavirus Replication Complex: Not All Hydrophobic Domains of nsp3 and nsp6 Are Membrane Spanning. J. Virol.
82: 12392-12405
[Abstract]
[Full Text]
-
Frieman, M., Baric, R.
(2008). Mechanisms of Severe Acute Respiratory Syndrome Pathogenesis and Innate Immunomodulation. Microbiol. Mol. Biol. Rev.
72: 672-685
[Abstract]
[Full Text]
-
Donaldson, E. F., Yount, B., Sims, A. C., Burkett, S., Pickles, R. J., Baric, R. S.
(2008). Systematic Assembly of a Full-Length Infectious Clone of Human Coronavirus NL63. J. Virol.
82: 11948-11957
[Abstract]
[Full Text]
-
Moreno, J. L., Zuniga, S., Enjuanes, L., Sola, I.
(2008). Identification of a Coronavirus Transcription Enhancer. J. Virol.
82: 3882-3893
[Abstract]
[Full Text]
-
van den Born, E., Posthuma, C. C., Knoops, K., Snijder, E. J.
(2007). An infectious recombinant equine arteritis virus expressing green fluorescent protein from its replicase gene. J. Gen. Virol.
88: 1196-1205
[Abstract]
[Full Text]
-
Ye, Y., Hauns, K., Langland, J. O., Jacobs, B. L., Hogue, B. G.
(2007). Mouse Hepatitis Coronavirus A59 Nucleocapsid Protein Is a Type I Interferon Antagonist. J. Virol.
81: 2554-2563
[Abstract]
[Full Text]
-
Sawicki, S. G., Sawicki, D. L., Siddell, S. G.
(2007). A Contemporary View of Coronavirus Transcription. J. Virol.
81: 20-29
[Full Text]
-
Almazan, F., DeDiego, M. L., Galan, C., Escors, D., Alvarez, E., Ortego, J., Sola, I., Zuniga, S., Alonso, S., Moreno, J. L., Nogales, A., Capiscol, C., Enjuanes, L.
(2006). Construction of a Severe Acute Respiratory Syndrome Coronavirus Infectious cDNA Clone and a Replicon To Study Coronavirus RNA Synthesis. J. Virol.
80: 10900-10906
[Abstract]
[Full Text]
-
Tan, Y. W., Fang, S., Fan, H., Lescar, J., Liu, D.X.
(2006). Amino acid residues critical for RNA-binding in the N-terminal domain of the nucleocapsid protein are essential determinants for the infectivity of coronavirus in cultured cells. Nucleic Acids Res
34: 4816-4825
[Abstract]
[Full Text]
-
Yount, B., Roberts, R. S., Lindesmith, L., Baric, R. S.
(2006). Rewiring the severe acute respiratory syndrome coronavirus (SARS-CoV) transcription circuit: Engineering a recombination-resistant genome. Proc. Natl. Acad. Sci. USA
103: 12546-12551
[Abstract]
[Full Text]
-
Verma, S., Bednar, V., Blount, A., Hogue, B. G.
(2006). Identification of Functionally Important Negatively Charged Residues in the Carboxy End of Mouse Hepatitis Coronavirus A59 Nucleocapsid Protein. J. Virol.
80: 4344-4355
[Abstract]
[Full Text]
-
St-Jean, J. R., Desforges, M., Almazan, F., Jacomy, H., Enjuanes, L., Talbot, P. J.
(2006). Recovery of a Neurovirulent Human Coronavirus OC43 from an Infectious cDNA Clone.. J. Virol.
80: 3670-3674
[Abstract]
[Full Text]
-
Wu, H.-Y., Ozdarendeli, A., Brian, D. A.
(2006). Bovine Coronavirus 5'-Proximal Genomic Acceptor Hotspot for Discontinuous Transcription Is 65 Nucleotides Wide. J. Virol.
80: 2183-2193
[Abstract]
[Full Text]
-
Weiss, S. R., Navas-Martin, S.
(2005). Coronavirus Pathogenesis and the Emerging Pathogen Severe Acute Respiratory Syndrome Coronavirus. Microbiol. Mol. Biol. Rev.
69: 635-664
[Abstract]
[Full Text]
-
Yount, B., Roberts, R. S., Sims, A. C., Deming, D., Frieman, M. B., Sparks, J., Denison, M. R., Davis, N., Baric, R. S.
(2005). Severe Acute Respiratory Syndrome Coronavirus Group-Specific Open Reading Frames Encode Nonessential Functions for Replication in Cell Cultures and Mice. J. Virol.
79: 14909-14922
[Abstract]
[Full Text]
-
Calvo, E., Escors, D., Lopez, J. A., Gonzalez, J. M., Alvarez, A., Arza, E., Enjuanes, L.
(2005). Phosphorylation and subcellular localization of transmissible gastroenteritis virus nucleocapsid protein in infected cells. J. Gen. Virol.
86: 2255-2267
[Abstract]
[Full Text]
-
Casais, R., Davies, M., Cavanagh, D., Britton, P.
(2005). Gene 5 of the Avian Coronavirus Infectious Bronchitis Virus Is Not Essential for Replication. J. Virol.
79: 8065-8078
[Abstract]
[Full Text]
-
Lassnig, C., Sanchez, C. M., Egerbacher, M., Walter, I., Majer, S., Kolbe, T., Pallares, P., Enjuanes, L., Muller, M.
(2005). From The Cover: Development of a transgenic mouse model susceptible to human coronavirus 229E. Proc. Natl. Acad. Sci. USA
102: 8275-8280
[Abstract]
[Full Text]
-
Schelle, B., Karl, N., Ludewig, B., Siddell, S. G., Thiel, V.
(2005). Selective Replication of Coronavirus Genomes That Express Nucleocapsid Protein. J. Virol.
79: 6620-6630
[Abstract]
[Full Text]
-
Sola, I., Moreno, J. L., Zuniga, S., Alonso, S., Enjuanes, L.
(2005). Role of Nucleotides Immediately Flanking the Transcription-Regulating Sequence Core in Coronavirus Subgenomic mRNA Synthesis. J. Virol.
79: 2506-2516
[Abstract]
[Full Text]
-
Chen, H., Gill, A., Dove, B. K., Emmett, S. R., Kemp, C. F., Ritchie, M. A., Dee, M., Hiscox, J. A.
(2005). Mass Spectroscopic Characterization of the Coronavirus Infectious Bronchitis Virus Nucleoprotein and Elucidation of the Role of Phosphorylation in RNA Binding by Using Surface Plasmon Resonance. J. Virol.
79: 1164-1179
[Abstract]
[Full Text]
-
Almazan, F., Galan, C., Enjuanes, L.
(2004). The Nucleoprotein Is Required for Efficient Coronavirus Genome Replication. J. Virol.
78: 12683-12688
[Abstract]
[Full Text]
-
Prentice, E., McAuliffe, J., Lu, X., Subbarao, K., Denison, M. R.
(2004). Identification and Characterization of Severe Acute Respiratory Syndrome Coronavirus Replicase Proteins. J. Virol.
78: 9977-9986
[Abstract]
[Full Text]
-
St-Jean, J. R., Jacomy, H., Desforges, M., Vabret, A., Freymuth, F., Talbot, P. J.
(2004). Human Respiratory Coronavirus OC43: Genetic Stability and Neuroinvasion. J. Virol.
78: 8824-8834
[Abstract]
[Full Text]
-
Hertzig, T., Scandella, E., Schelle, B., Ziebuhr, J., Siddell, S. G., Ludewig, B., Thiel, V.
(2004). Rapid identification of coronavirus replicase inhibitors using a selectable replicon RNA. J. Gen. Virol.
85: 1717-1725
[Abstract]
[Full Text]
-
Ivanov, K. A., Thiel, V., Dobbe, J. C., van der Meer, Y., Snijder, E. J., Ziebuhr, J.
(2004). Multiple Enzymatic Activities Associated with Severe Acute Respiratory Syndrome Coronavirus Helicase. J. Virol.
78: 5619-5632
[Abstract]
[Full Text]
-
Curtis, K. M., Yount, B., Sims, A. C., Baric, R. S.
(2004). Reverse Genetic Analysis of the Transcription Regulatory Sequence of the Coronavirus Transmissible Gastroenteritis Virus. J. Virol.
78: 6061-6066
[Abstract]
[Full Text]
-
de Haan, C. A. M., van Genne, L., Stoop, J. N., Volders, H., Rottier, P. J. M.
(2003). Coronaviruses as Vectors: Position Dependence of Foreign Gene Expression. J. Virol.
77: 11312-11323
[Abstract]
[Full Text]
-
Yount, B., Curtis, K. M., Fritz, E. A., Hensley, L. E., Jahrling, P. B., Prentice, E., Denison, M. R., Geisbert, T. W., Baric, R. S.
(2003). Reverse genetics with a full-length infectious cDNA of severe acute respiratory syndrome coronavirus. Proc. Natl. Acad. Sci. USA
100: 12995-13000
[Abstract]
[Full Text]
-
Ontiveros, E., Kim, T. S., Gallagher, T. M., Perlman, S.
(2003). Enhanced Virulence Mediated by the Murine Coronavirus, Mouse Hepatitis Virus Strain JHM, Is Associated with a Glycine at Residue 310 of the Spike Glycoprotein. J. Virol.
77: 10260-10269
[Abstract]
[Full Text]
-
Thiel, V., Karl, N., Schelle, B., Disterer, P., Klagge, I., Siddell, S. G.
(2003). Multigene RNA Vector Based on Coronavirus Transcription. J. Virol.
77: 9790-9798
[Abstract]
[Full Text]
-
Escors, D., Izeta, A., Capiscol, C., Enjuanes, L.
(2003). Transmissible Gastroenteritis Coronavirus Packaging Signal Is Located at the 5' End of the Virus Genome. J. Virol.
77: 7890-7902
[Abstract]
[Full Text]
-
Kanjanahaluethai, A., Jukneliene, D., Baker, S. C.
(2003). Identification of the Murine Coronavirus MP1 Cleavage Site Recognized by Papain-Like Proteinase 2. J. Virol.
77: 7376-7382
[Abstract]
[Full Text]
-
Haijema, B. J., Volders, H., Rottier, P. J. M.
(2003). Switching Species Tropism: an Effective Way To Manipulate the Feline Coronavirus Genome. J. Virol.
77: 4528-4538
[Abstract]
[Full Text]
-
Sola, I., Alonso, S., Zuniga, S., Balasch, M., Plana-Duran, J., Enjuanes, L.
(2003). Engineering the Transmissible Gastroenteritis Virus Genome as an Expression Vector Inducing Lactogenic Immunity. J. Virol.
77: 4357-4369
[Abstract]
[Full Text]
-
Benjeddou, M., Leat, N., Allsopp, M., Davison, S.
(2002). Development of infectious transcripts and genome manipulation of Black queen-cell virus of honey bees. J. Gen. Virol.
83: 3139-3146
[Abstract]
[Full Text]
-
Yount, B., Denison, M. R., Weiss, S. R., Baric, R. S.
(2002). Systematic Assembly of a Full-Length Infectious cDNA of Mouse Hepatitis Virus Strain A59. J. Virol.
76: 11065-11078
[Abstract]
[Full Text]
-
Kuo, L., Masters, P. S.
(2002). Genetic Evidence for a Structural Interaction between the Carboxy Termini of the Membrane and Nucleocapsid Proteins of Mouse Hepatitis Virus. J. Virol.
76: 4987-4999
[Abstract]
[Full Text]
-
Gonzalez, J. M., Penzes, Z., Almazan, F., Calvo, E., Enjuanes, L.
(2002). Stabilization of a Full-Length Infectious cDNA Clone of Transmissible Gastroenteritis Coronavirus by Insertion of an Intron. J. Virol.
76: 4655-4661
[Abstract]
[Full Text]
-
Alonso, S., Sola, I., Teifke, J. P., Reimann, I., Izeta, A., Balasch, M., Plana-Duran, J., Moormann, R. J. M., Enjuanes, L.
(2002). In vitro and in vivo expression of foreign genes by transmissible gastroenteritis coronavirus-derived minigenomes. J. Gen. Virol.
83: 567-579
[Abstract]
[Full Text]
-
Hegyi, A., Friebe, A., Gorbalenya, A. E., Ziebuhr, J.
(2002). Mutational analysis of the active centre of coronavirus 3C-like proteases. J. Gen. Virol.
83: 581-593
[Abstract]
[Full Text]
-
Curtis, K. M., Yount, B., Baric, R. S.
(2002). Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles. J. Virol.
76: 1422-1434
[Abstract]
[Full Text]
-
Casais, R., Thiel, V., Siddell, S. G., Cavanagh, D., Britton, P.
(2001). Reverse Genetics System for the Avian Coronavirus Infectious Bronchitis Virus. J. Virol.
75: 12359-12369
[Abstract]
[Full Text]
-
Thiel, V., Herold, J., Schelle, B., Siddell, S. G.
(2001). Viral Replicase Gene Products Suffice for Coronavirus Discontinuous Transcription. J. Virol.
75: 6676-6681
[Abstract]
[Full Text]
-
Thiel, V., Herold, J., Schelle, B., Siddell, S. G.
(2001). Infectious RNA transcribed in vitro from a cDNA copy of the human coronavirus genome cloned in vaccinia virus. J. Gen. Virol.
82: 1273-1281
[Abstract]
[Full Text]
-
Ziebuhr, J., Thiel, V., Gorbalenya, A. E.
(2001). The Autocatalytic Release of a Putative RNA Virus Transcription Factor from Its Polyprotein Precursor Involves Two Paralogous Papain-like Proteases That Cleave the Same Peptide Bond. J. Biol. Chem.
276: 33220-33232
[Abstract]
[Full Text]