Previous Article | Next Article 
Journal of Virology, November 2000, p. 10407-10416, Vol. 74, No. 22
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Human Monoclonal Antibodies That Inhibit Binding of Hepatitis C
Virus E2 Protein to CD81 and Recognize Conserved Conformational
Epitopes
Kenneth G.
Hadlock,1
Robert E.
Lanford,2
Susan
Perkins,1
Judy
Rowe,1
Qing
Yang,1
Shoshana
Levy,3
Piero
Pileri,4
Sergio
Abrignani,4 and
Steven
K. H.
Foung1,*
Departments of
Pathology1 and
Medicine,3 Stanford University,
Stanford, California; Department of Virology and
Immunology, Southwest Regional Primate Research Center, Southwestern
Foundation for Biomedical Research, San Antonio,
Texas2; and IRIS-Chiron, Siena,
Italy4
Received 22 December 1999/Accepted 9 August 2000
 |
ABSTRACT |
The intrinsic variability of hepatitis C virus (HCV) envelope
proteins E1 and E2 complicates the identification of protective antibodies. In an attempt to identify antibodies to E2 proteins from
divergent HCV isolates, we produced HCV E2 recombinant proteins from
individuals infected with HCV genotypes 1a, 1b, 2a, and 2b. These
proteins were then used to characterize 10 human monoclonal antibodies
(HMAbs) produced from peripheral B cells isolated from an individual
infected with HCV genotype 1b. Nine of the antibodies recognize
conformational epitopes within HCV E2. Six HMAbs identify epitopes
shared among HCV genotypes 1a, 1b, 2a, and 2b. Six, including five
broadly reactive HMAbs, could inhibit binding of HCV E2 of genotypes
1a, 1b, 2a, and 2b to human CD81 when E2 and the antibody were
simultaneously exposed to CD81. Surprisingly, all of the antibodies
that inhibited the binding of E2 to CD81 retained the ability to
recognize preformed CD81-E2 complexes generated with some of the same
recombinant E2 proteins. Two antibodies that did not recognize
preformed complexes of HCV 1a E2 and CD81 also inhibited binding of HCV
1a virions to CD81. Thus, HCV-infected individuals can produce
antibodies that recognize conserved conformational epitopes and inhibit
the binding of HCV to CD81. The inhibition is mediated via antibody
binding to epitopes outside of the CD81 binding site in E2, possibly by
preventing conformational changes in E2 that are required for CD81 binding.
 |
INTRODUCTION |
Hepatitis C virus (HCV),
a member of the family Flaviviridae, expresses its proteins
from a 9.5-kb positive-sense RNA genome (18). The virus is
highly variable, with more than nine distinct genotypes (1,
18). Most patients progress from acute to chronic disease in
spite of a robust immune response. Nonetheless, evidence for a humoral
immune response providing at least partial protection in clinical and
animal model studies is accumulating (6, 9-11, 29, 37) and
suggests that neutralizing antibodies have a role in the containment of
HCV infection. For a protective immune response, the important viral
gene products are the envelope proteins, designated E1 and E2. Both
sequence analyses of different isolates and sequential studies of virus
isolates in infected patients suggest that the HCV E2 protein is under
immune selection leading to selection of variants in the amino-terminal
domain of HCV E2, designated hypervariable region 1 (HVR-1) (1, 9,
16-18, 20, 37, 39, 40). Antibodies to HVR-1 appear to mediate
virus neutralization in cell culture and chimpanzee protection studies
(10, 37). Unfortunately, antibodies to HVR-1 tend to be
isolate specific and over time drive the selection of new viral
variants that the existing immune response does not recognize (9,
20, 37, 40). Although there has been progress at inducing a
broader immune response to HVR-1-related sequences (31), the
high mutability of HVR-1 sequences in vivo may allow for the selection
of immune escape mutants even against antibodies that recognize the
majority of HVR-1 isolates.
Studies using HCV E1 and E2 proteins expressed in mammalian cells
showed that infected individuals have an antibody response to HCV E2
composed in part to epitopes that are conformational in nature
(15, 23). Studies involving the isolation of human monoclonal or recombinant antibodies to HCV E2 protein showed that a
substantial fraction of these antibodies recognize conformational epitopes (2, 3, 13). As to biological function of these domains, investigators have used surrogate assays to provide insights into virus neutralization since the virus cannot be grown in vitro (18). One surrogate assay, referred to as the neutralization of binding (NOB) assay, evaluates the ability of a given antibody or
serum to prevent the binding of HCV E2 protein with a human T-cell line
(35). The finding that serum antibodies obtained from
chimpanzees protected by vaccination were strongly positive in the NOB
assay provides support for the relevance of the assay as a measure of
virus neutralization activity (35).
The human tetraspanin cell surface protein CD81 (TAPA-1) (for a
review, see reference 24) is the target protein
bound by HCV E2 in the NOB assay (30). Furthermore, human
CD81 binds to free virions and consequently is a possible receptor for
HCV (30). At present, however, direct evidence that CD81 is
necessary and sufficient for HCV infection has not been obtained
(34). Nevertheless, several human monoclonal antibodies
(HMAbs) to HCV E2 protein have been reported to inhibit the interaction
of HCV 1a E2 with human cells (2, 13). However, it is not
known if the epitopes recognized by antibodies that inhibit the
interaction of HCV E2 with CD81 are conserved in HCV E2 proteins of
different genotypes, nor have the mechanisms underlying the observed
inhibition of E2 binding to CD81 been explored. Both breadth of
reactivity to multiple HCV genotypes and the ability to interfere with
the binding of HCV virions to susceptible cells would be key attributes of a neutralizing antibody if CD81 was a receptor or coreceptor for HCV.
To address these questions, we produced and characterized a panel of
HMAbs from peripheral B cells of an individual with asymptomatic HCV
infection and having a high serum neutralization of binding titer.
These 10 HMAbs to HCV E2 were tested for the ability to bind to HCV E2
proteins of genotypes 1a, 1b, 2a, and 2b and inhibit the interaction of
these E2 proteins with human CD81. Additionally, the HMAbs were
evaluated for the ability to bind to preformed CD81-E2 complexes. We
present evidence indicating that the epitopes recognized by antibodies
capable of inhibiting E2 binding to CD81 are conformational and
conserved in HCV E2 proteins of multiple genotypes. Also, antibodies
that efficiently inhibited the formation of the E2-CD81 complexes
retained the ability to recognize preformed E2-CD81 complexes generated
by some of the same E2 proteins. Two of the antibodies that inhibited
binding of HCV E2 protein to CD81 and did not recognize preformed 1a
E2-CD81 complexes also prevented binding of HCV 1a virions to CD81.
These antibodies will be useful for testing the hypothesis that
antibodies that inhibit the interaction of HCV with CD81 mediate virus neutralization.
 |
MATERIALS AND METHODS |
Cell lines and antibodies.
Insect cell line Sf9 was cultured
and grown as described elsewhere (22). Mammalian cell lines
BSC-1 and HeLa were grown in minimal essential medium (Life
Technologies, Bethesda, Md.) supplemented with 10% fetal calf serum
and 2 mM glutamine. H. Greenberg (Stanford University) generously
provided a mouse monoclonal antibody (E2G) to HCV E2 (8). T. Fuerst (Avant Immunotherapeutics, Needham, Mass.) generously provided
the BSC-1 cells, vaccinia virus strains, and pVOTE vector
(38).
Generation and identification of HMAbs.
Peripheral B cells
were isolated from a single HCV-infected individual. The electrofusion
of Epstein-Barr virus (EBV)-activated B cells to heteromyeloma cells
produced human hybridomas, using methods as described elsewhere
(28). An immunofluorescence assay (IFA) with fixed Sf9 cells
expressing recombinant E1 or E2 protein detected HCV-specific
antibodies. Sf9 cells infected with recombinant baculovirus Elt
(22), Sf9 cells infected with recombinant baculovirus E2t
(22), and uninfected cells were combined at a ratio of 1:1:1 and fixed onto HTC Super Cured 24-spot slides (Cel-Line Associates, Newfield, N.J.) with 100% acetone for 10 min at room temperature (RT).
Antibody binding to fixed cells was detected by fluorescence microscopy
as described previously (14). EBV-activated B cells were
selected for electrofusion based on IFA reactivity. Hybridomas of
interest from successful electrofusions were cloned by limiting dilution. Antibody purification and biotinylation of HMAb CBH-4G were
performed as described elsewhere (14). The heavy- and
light-chain subtypes of the antibodies were identified using a
commercially available kit (The Binding Site Ltd., Birmingham, United Kingdom).
Expression of HCV E2 proteins.
Aliquots of plasma positive
for HCV RNA were genotyped by the InnoLipa HCV assay (Innogenetics,
Leuven, Belgium). RNA used for cloning was prepared with a commercial
kit (Purescript RNA kit; Gentra Systems, Minneapolis Minn.) from 125 µl of plasma infected with HCV genotype 1a, 1b, 2a, or 2b.
Amplification of RNA was achieved by coupled reverse transcription-PCR
with the HCV-specific degenerate primers HCV E2-F1
(5'-CGCATGGCiTGGGAyATGATG-3') and HCV E2-R1
(5'-CGCGCACrAAGTAsGGyACT-3'. Between 2 and 8 µl of
amplified product was then subjected to a second PCR amplification using the forward and reverse primers specific for each genotype (forward primers 1a [CGAAGCTTCATATGATCGCTGGTGCTCACTG
G], 1b
[CGCATATGGAGCTCGCGGGGGCCCACTGGGGAGT], 2a
[CGCTCGAGCCATGGTTGGCGGGGCTCATTGGGGC]
and 2b
[CGCTCGAGCCATGGTTTTCGGCGGCCATTGGGTG]; reverse primers 1a
[GCGGATCCCTGCAGCTACAAACTGGCTTGAAGAATCCA], 1b [GCTCTAGACT GCAGCTATATGCCAGCCTGGAGCACCAT], 2a
[TCGAATTCGGATCCTACAAAGCACCTTTTAGGAGATAAGC], and 2b
[TCGAATTCGGATCCTACAGAGACGCTTTAAGGAGGTAGGC]).
The amplified products were purified and digested with the
appropriate restriction enzymes (restriction sites in the primers are
underlined). The digested DNAs were then ligated into similarly
digested pVOTE-1 or pVOTE-2 vector (38). Expression of HCV
E2 protein from vaccinia virus constructs was verified by Western blot
analysis of transiently transfected CV-1 cells. The genotypes of the
cloned E2 proteins were confirmed by DNA sequencing of the entire
insert, using dye terminator methodologies and an automated DNA
sequencer (Applied Biosystems, Foster City, Calif.). Plasmids that
produced intact HCV E2 were then used to generate recombinant vaccinia
virus by homologous recombination into the hemagglutinin locus of
vaccinia virus strain VWA (38) as described elsewhere
(27). Recombinant vaccinia virus was grown and measured
using BSC-1 cells; titers of recombinant virus ranged between 5 × 108 and 10 × 108 PFU/ml.
HCV E2 ELISA.
Monolayers of HeLa cells were grown to 80%
confluence and infected at 5 PFU/cell with both VWA and recombinant
vaccinia virus or VWA only. HCV recombinants were mixed with wild-type
vaccinia virus with an intact hemagglutinin gene to minimize vaccinia
virus-induced cytopathic effect observed with hemagglutinin-deficient
virus (36). Cells were harvested after 1 day of infection.
Extracts were prepared by washing the cells with phosphate-buffered
saline (PBS) and then resuspending ~25 × 106 cells
in 1 ml of lysis buffer (150 mM NaCl, 20 mM Tris [pH 7.5], 0.5%
deoxycholate, 1.0% Nonidet-P40, 1 mM EDTA, Pefabloc [0.5 mg/ml;
Boehringer Mannheim, Indianapolis, Ind.], aprotinin [2 µg/ml],
leupeptin [2 µg/ml], pepstatin [1 µg/ml]). Extracts prepared in
this manner contained approximately 25 µg of E2 protein per ml.
Nuclei were pelleted by centrifugation at 18,000 × g
at 4°C for 10 min, and resulting cytoplasmic extracts were stored at 4°C and used for enzyme-linked immunosorbent assay (ELISA) within 24 h of preparation. Microtiter plates were prepared by coating wells with 500 ng of purified Galanthus nivalis lectin (GNA;
Sigma, St. Louis, Mo.) in 100 µl of PBS for 1 h at 37°C. Wells
were washed with Tris-buffered saline (TBS; 150 mM NaCl, 20 mM Tris-HCl
[pH 7.5]) and then blocked with 150 µl of BLOTTO (TBS plus 0.1%
Tween 20, 2.5% normal goat serum, and 2.5% nonfat dry milk) by
incubation for 1 h at RT. Plates were washed twice with TBS
followed by the addition of 15 µl of extract in 100 µl of BLOTTO.
After 1.5 h at RT, plates were washed three times with TBS
followed by the addition of unlabeled antibodies at various
concentrations. Plates were incubated for 1.5 h and washed three
times with TBS; then 100 µl of anti-human IgG-alkaline phosphatase
conjugate (Promega, Madison, Wis.) diluted 1/5,000 in BLOTTO was added.
After 1 h at RT, the plates were washed four times with TBS
followed by 30 min of incubation with a 1-mg/ml solution of
p-nitrophenyl phosphate (PNPP). Absorbance was measured at
405 nm with a multiwell plate reader (Du Pont Co., Wilmington, Del.).
Assessment of CD81-E2 binding.
Prior to the identification
of CD81 as the HCV E2 ligand, the second extracellular domain was
termed EC2 (24); however, to prevent confusion between E2
and EC2, we have opted to refer to this region as the large
extracellular loop (LEL). The LELs of human and murine CD81 (CD81-LEL)
were expressed as fusion proteins with glutathione
S-transferase (GST) using the pGEX vector (GST-2T). The
proteins were constructed and purified as described previously (12). Five different assays to assess the interaction of
recombinant E2 proteins with CD81-LEL were performed. Flow cytometric
assessments of E2 binding to CD81 (NOB assays) were performed using
methods and HCV E2 proteins previously described (19, 35).
Briefly, 1 µg of the HCV E2 1a protein produced in mammalian cells
(35) was mixed with serial dilution of antibodies (from 0.1 to 300 µg/ml) and incubated for 30 min at 37°C. Molt-4 cells
(105) were added to the mixture and incubated on ice for
1 h. After washing, the amount of HCV-E2 bound to Molt-4 cells was
assessed by flow cytometry. The NOB titer is defined as the antibody
concentration that results in 50% inhibition of E2 binding.
Antibody capture assays were performed by coating microtiter plate
wells with 100 ng of purified CD81-LEL or nonrecombinant GST diluted in
PBS. After 1 h at 37°C, wells were washed once with TBS and
blocked by incubation with 150 µl of BLOTTO for 1 h at RT. Each
well received test antibody and 15 µl of extract from vaccinia
virus-infected BSC-1 cells diluted in BLOTTO to a final volume of 100 µl (approximately 300 to 400 ng of E2 for a final concentration of
~4 µg/ml). Plates were incubated overnight with gentle agitation at
4°C. Wells were then washed three times with TBS followed by addition
of appropriate alkaline phosphate-conjugated secondary antibody and
PNPP substrate as described above.
Inhibition assays were performed by coating microtiter plate wells with
100 ng of purified human or murine CD81-LEL or 500
ng of GNA. After
1 h at 37°C, wells were washed once with TBS
and blocked by
incubation with 150 µl of BLOTTO for 1 h at RT.
The wells were
then washed once with TBS, and various dilutions
of test sera or
monoclonal antibodies were added in a total volume
of 50 µl.
Concurrently, extract from BSC-1 cells infected with
HCV E2-expressing
vaccinia virus was combined with BLOTTO at a
ratio of 30% extract to
70% BLOTTO, and biotinylated HMAb CBH-4G
was added to a final
concentration of 8 µg/ml. The mixture was
incubated at RT for 20 min,
and 50 µl was added to wells already
containing test antibody
(resulting in 15 µl of extract/~400 ng
of HCV E2 in each well). The
plates were incubated overnight with
gentle agitation at 4°C. Wells
were then washed three times with
TBS followed by the addition of 100 µl of 1/1,000-diluted alkaline
phosphatase-conjugated streptavidin
(Amersham-Pharmacia Biotech,
Piscataway, N.J.). Plates were incubated
for 1 h at RT and washed,
and alkaline phosphatase activity was
quantitated with PNPP substrate
as described above. Background signals
for binding of E2 to human
CD81 were determined from wells coated with
murine CD81-LEL; background
signals obtained from E2 binding to
GNA-coated wells were obtained
from extracts of BSC-1 cells infected
with wild-type vaccinia
virus. Signals obtained with biotinylated
CBH-4G and E2 in the
presence of competing antibody were compared to
signals obtained
from CBH-4G and E2 in the absence of competing
antibody.
Binding of antibodies to preformed E2-CD81 complexes was assessed by
coating microtiter plates with 100 ng of purified CD81-LEL
or murine
CD81-LEL diluted in PBS. After 1 h at 37°C, wells were
washed
once with TBS and blocked by incubation with 150 µl of
BLOTTO for
1 h at RT. Extract from BSC-1 cells infected with HCV
E2-expressing vaccinia virus was then diluted in 100 µl of BLOTTO,
added to CD81-coated plates, and incubated overnight with gentle
agitation at 4°C. Wells were then washed three times with TBS
followed by addition of increasing concentrations of test antibodies,
also diluted in 100 µl of BLOTTO. After 1.5 h at room
temperature,
wells were washed and alkaline phosphate-conjugated
secondary
antibody was added. After incubation for 1 h, wells were
washed
and bound antibody was detected with PNPP
substrate.
The virion-CD81 binding assay was performed as previously described
(
30). Briefly, 1/4-inch polystyrene beads (Pierce, Rockford,
Ill.) were coated overnight with 50 µg of purified recombinant
LEL-TRX protein (
30) per ml in a citrate buffer (pH 4.0) at
room temperature and then blocked for 1 h with 2% bovine serum
albumin in 50 mM Tris-Cl (pH 8)-1 mM EDTA-100 mM NaCl (TEN) buffer.
Serum containing 5 × 10
5 HCV RNA genomes was diluted
in 200 µl of TEN buffer with 10 µg
of purified monoclonal
antibodies and incubated for 1 h at 4°C.
The diluted serum was
then added to the coated beads and incubated
at 37°C for 1 to 2 h. After removal of supernatant, each bead
was washed five times with
15 ml of TEN buffer, and bound virus
was extracted using a commercially
available kit (Qiagen, Basel,
Switzerland). PCR-mediated evaluation of
the RNA copy number was
performed using a PE Applied Biosystems 7700 sequence detection
system as described elsewhere (
30). The
copy number of HCV RNA
molecules bound to the polystyrene beads was
subtracted from values
obtained from CD81-coated beads. The percent
inhibition of virion
binding to CD81-LEL-coated beads was calculated by
dividing the
number of HCV RNA copies bound in presence of test
antibody by
the number bound in the presence of an irrelevant
antibody.
 |
RESULTS |
Identification of HCV HMAbs.
HCV-infected individuals were
identified by commercial HCV ELISA. Individuals with a high-titer
antibody response to HCV E2 (measured at an optical density [OD] of
405 nm) were identified by IFA with fixed Sf9 cells infected with
recombinant baculovirus expressing HCV 1a E2 protein. The individual
selected as the B-cell donor was infected with HCV genotype 1b, had a
strong antibody response to HCV E2, and had a neutralization of binding
assay titer of 1/5,000, which is relatively rare in HCV-infected
individuals (19, 35). Alanine aminotransferase values of the
donor ranged between 29 and 49 IU (normal is <45) for six blood
samples obtained over a period of 27 months. Screening of supernatants
from EBV-activated cell cultures was performed by IFA against both HCV
E1 and E2. No activated B cells expressing antibodies to HCV E1 were
isolated. EBV-activated cells from 30 wells were selected for
electrofusions to mouse-human heteromyelomas. Ten of the human
hybridomas were cloned by limiting dilution and produced in bulk for
subsequent studies (Table 1). All of the
HMAbs were IgG1. Sequencing of these IgG1 genes confirmed that each of
the 10 hybridomas was derived from an independent B cell and expressed
unique CDR3 regions (H. C. Chan, K. G. Hadlock, S. K. H. Foung, and S. Levy, submitted for publication).
Reactivity of HCV HMAbs with HCV E2 of multiple genotypes.
The
complete coding sequence of HCV E2 from isolates of HCV genotypes 1a,
1b, 2a, and 2b were PCR amplified from HCV-positive sera and expressed
with vaccinia virus using the pVOTE (38) transfer vector
(constructs Q1a, Q1b, Q2a, and Q2b for HCV genotypes 1a, 1b, 2a, and
2b, respectively). Genotype selection was based on its divergence and
frequency among HCV-infected individuals in the United States
(25). The amplified fragments expressed the final 39 amino
acids of E1, all of E2, and the amino-terminal 98 amino acids of NS2.
Previous studies indicated that similar fragments were correctly
processed into full-length E2 when expressed in vaccinia virus
(32). Western blot analysis of extracts prepared from
infected cells with a murine monoclonal antibody to HCV E2 verified
correct expression (data not shown). DNA sequence analysis was
performed over the E2 region of the HCV constructs (Fig.
1). The E2 amino acid sequences of Q1a,
Q1b, Q2a, and Q2b were approximately 90% homologous with E2 sequences
from previously sequenced full-length genomes of genotypes 1a, 1b, 2a,
and 2b (reference 1 and references therein). In
particular, isolate Q1a was 90.1% homologous and Q1b was 79.9%
homologous with the HCV-1 isolate used in the isolation of the HMAbs
(Table 2). The most divergent E2
sequences were those of Q1a and Q2b, which were 70% homologous at the
amino acid level. As expected, significant diversity was seen in HVR-1
in all of the E2 proteins.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 1.
Amino acid sequences of HCV E2 proteins. The amino acid
sequences of the E2 regions of constructs Q1a, Q1b, Q2a, and Q2b are
compared to that of the HCV-1 isolate of HCV (5). A dot
indicates a conserved amino acid. Amino acids are numbered according to
position in the polyprotein of HCV-1.
|
|
The lectin GNA has been used extensively in the purification of HCV
envelope proteins and E2 proteins purified by GNA affinity
chromatography are immunogenic in animal models and efficiently
recognized by sera from HCV-infected individuals (
6,
32).
To
minimize handling and manipulation, HCV E2 was captured directly
from
cytoplasmic extracts onto microtiter plates with GNA, using
methods
similar to those previously described (
3). All 10 HCV
HMAbs
bound to two or more of the HCV E2 constructs (Fig.
2),
and no specific signal was obtained
with a control HMAb (R04,
specific to a cytomegalovirus [CMV]
protein). The HMAbs with the
highest relative affinities and levels of
reactivity to E2 proteins
of all four genotypes were CBH-7 and CBH-8C,
followed by HMAbs
CBH-5, -2, and -8E. HMAb CBH-4G exhibited
significantly greater
reactivity to HCV E2 proteins of genotypes 2a and
2b, while HMAb
CBH-11 was markedly less reactive with Q1a E2 protein.
HMAb CBH-17
and to a lesser extent CBH-4D and CBH-4B exhibited
preferential
binding to E2 proteins of genotype 1a or 1b relative to E2
proteins
of genotype 2a or 2b. These variations were not a result of
variable
efficiencies of capture of the different E2 proteins since the
maximum signals obtained with the E2 proteins were very comparable
in
all experiments. In conclusion, six antibodies, CBH-2, -4G,
-5, -7, -8C, and -8E, exhibited significant reactivity with all
HCV E2
constructs, indicating that the epitopes recognized by
these HMAbs
are conserved in E2 proteins of genotypes 1 and 2.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
HCV antibody reactivity with E2 protein of divergent HCV
genotypes. HCV E2 protein expressed by 6 × 105 HeLa
cells infected with vaccinia virus Q1a ( ), Q1b ( ), Q2a ( ), or
Q2b ( ) was captured onto wells coated with 500 ng of GNA. Wells were
washed and blocked, and bound protein was incubated with the indicated
HCV HMAbs and control HMAb (R04) to a CMV protein (14).
Values are the mean specific binding (extracts of cells infected with
vaccinia virus expressing HCV E2 protein wild-type vaccinia
extracts) of replicate wells. Reactivity of HCV and control HMAbs with
proteins from wild-type vaccinia virus-infected cells did not exceed an
absorbance of 0.04. Error bars indicate 1 standard deviation from the
mean.
|
|
These HCV HMAbs were identified by a screening method designed to
maximize the selection of antibodies to conformational epitopes.
This was verified by comparing the reactions of the HCV HMAbs
to both
native and denatured HCV 1b E2 proteins (Fig.
3). As shown
above, all 10 HCV HMAbs
recognized native HCV 1b E2. Treatment
of HCV E2 by heating to 56°C
in the presence of 0.5% sodium dodecyl
sulfate and 5 mM dithiothreitol
resulted in complete abrogation
of reactivity for 9 of the 10 HCV
HMAbs. The exception, HMAb CBH-17,
retained approximately 90% of its
reactivity with the denatured
E2 protein. Western blot analysis of
CBH-17 confirmed that it
was weakly reactive with HCV envelope proteins
as expressed by
Q1a or Q1b (data not shown).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 3.
Nine HCV HMAbs fail to recognize denatured HCV E2.
Proteins derived from HeLa cells infected with vaccinia virus Q1b and
VWA or VWA alone (gray bars) were either left untreated (white bars) or
denatured by incubation with 0.5% sodium dodecyl sulfate and 5 mM
dithiothreitol for 15 min at 56°C (black bars). After treatment,
proteins were diluted 1:5 in BLOTTO and captured onto wells coated with
500 ng of GNA. Wells were washed and blocked, and bound protein was
incubated at 5 µg/ml with HCV HMAbs (x axis) and control
HMAb (R04). Bound antibody was detected as described in Materials and
Methods. Values for native and denatured HCV 1b are the mean signals
obtained from replicate wells. Signals from single wells of native and
denatured proteins derived from VWA-infected HeLa cells were
indistinguishable and also averaged. Error bars indicate 1 standard
deviation from the mean.
|
|
Effect of HCV HMAbs on E2 binding to CD81.
Recently, the human
tetraspanin protein CD81 has been demonstrated to specifically bind to
E2, with the involved site localized to CD81-LEL (previously referred
to as EC2) (30). The ability of the HMAbs to inhibit binding
of HCV 1a E2- to CD81-expressing target cells was assessed via flow
cytometry (also referred to as the NOB assay [35]).
HMAbs CBH-4D, -4B, -4G, and -17 did not block the binding of E2
to target cells at concentrations of less than 25 µg/ml (Table
3). HMAbs CBH-2, -5, -7, -8C, -8E, and -11 achieved 50% inhibition of E2 binding at concentrations of 1 to 10 µg/ml and can be classified as NOB positive. To confirm results
obtained by flow cytometry using E2 proteins of multiple genotypes, we
assessed whether the HCV HMAbs could inhibit the interaction of HCV E2
with CD81. Microtiter plates were first coated with purified
CD81-LEL-GST fusion protein to which excess HCV E2 was added in the
presence of the HCV HMAbs. Because HCV E2 binds specifically to human
CD81 (12, 35), the E2 proteins were produced in the green
monkey kidney cell line BSC-1 to minimize the effect of endogenous
CD81. Neither HCV HMAbs nor control antibodies were captured by
purified nonrecombinant GST, nor were the HCV or control antibodies
captured by CD81 when combined with extracts of BSC-1 cells infected
with wild-type vaccinia virus (data not shown).
No signal was detected when antibodies CBH-2, -5, -7, -8C, -8E, and -11 were added concurrently with E2 of genotypes 1a, 1b,
2a, and 2b to
CD81-coated plates (Table
3). In contrast, positive
signals were
obtained with HMAbs CBH-4G, CBH-4B, CBH-4D, and CBH-17
in a manner
consistent with the reactivity of these HMAbs with
GNA-captured E2
(compare binding levels in Fig.
2 and Table
3).
In particular, CBH-4G
reacted with E2 captured onto CD81-coated
plates to equivalent extents
with E2 proteins of all four genotypes
tested. Incubation of increasing
concentrations of HMAbs CBH-4G,
-4B, -4D, and -17 with recombinant 1b
E2 in CD81-coated plates
indicated that these antibodies achieved 50%
of maximum binding
at concentrations of less than 5 µg/ml (Fig.
4). Binding of E2
and antibody to the
CD81-coated plates was not observed with a
control HMAb, nor did
incubation of the NOB-positive HMAbs CBH-2,
CBH-7, and CBH-8C with 1b
E2 generate any signal. Thus, HMAbs
CBH-4G, -4B, -4D, and -17 react
with E2 in E2-CD81 complexes as
readily as they react to E2 bound to
GNA.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Capture of HCV HMAbs and E2 onto CD81-coated plates.
Proteins derived from 15 µl of extract derived from BSC-1 cells
infected with vaccinia virus Q1b and VWA were combined with the
indicated concentrations (x axis) of antibody in a total
volume of 100 µl of BLOTTO. The antibody-protein mixture was then
added to microtiter plate wells coated with 100 ng of a GST-CD81-LEL
fusion protein or nonrecombinant GST and incubated overnight at 4°C.
Wells were washed, and bound antibody was detected as described in
Materials and Methods. Signals obtained for antibody captured by
CD81-coated wells were subtracted from signals obtained from GST-coated
wells and averaged. R04 is an isotype matched HMAb that recognizes a
CMV protein (14). Values are the average of duplicate wells.
Error bars indicate 1 standard deviation from the mean.
|
|
The failure of HMAbs CBH-2, -5, -7, -8C, -8E, and -11 to react in the
antibody capture experiments could be due to the antibodies
failing to
bind to CD81-E2 complexes or due to the antibodies
inhibiting the
formation of CD81-E2 complexes. To discriminate
between these
possibilities, HMAb CBH-4G was biotinylated and
incubated with HCV E2
proteins to label E2 with the biotinylated
antibody. The labeled E2 was
then combined with increasing concentrations
of antibody and added to
microtiter plates coated with GNA (which
would bind all E2 protein) or
CD81-LEL. Results obtained with
five of the HMAbs and a control are
presented in Fig.
5. None
of the
antibodies significantly inhibited binding of the labeled
1a or 2a E2
protein to GNA-coated plates. Thus, HMAbs CBH-2, -5,
-7, -8C, and -11 did not displace the antibody label on the E2,
nor did an irrelevant
HMAb, R04, inhibit binding of labeled E2
to either GNA or CD81. In
contrast, HMAbs CBH-2, -5, -7, and -8C
inhibited binding of labeled 1a
or 2a E2 to CD81-LEL. Similar
results were obtained with HMAbs CBH-2,
-5, -7, and -8C with 1b
and 2b E2 proteins and with HMAb CBH-8E and all
four E2 proteins
(data not shown). CBH-11 inhibited binding of 1b, 2b
(data not
shown), and 2a E2 but not 1a E2 (Fig.
5) to CD81-LEL,
consistent
with the reactivity of this HMAb to E2 only. The 50%
inhibition
values for HMAbs CBH-2, -5, -7, -8C, and -8E ranged from 0.4 to
6.0 µg/ml, consistent with values obtained in the NOB assay (Table
3) or in the E2 binding assays (Fig.
2).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Antibody-mediated inhibition of E2 binding to CD81.
Extract derived from BSC-1 cells infected with vaccinia virus Q1a and
VWA ( , ) or Q2a and VWA ( , ) were diluted in BLOTTO, and
biotinylated HMAb CBH-4G was added to a final concentration of 8 µg/ml. The mixture was incubated for 20 min to allow for
antibody-mediated labeling of E2. Then aliquots of the labeled E2
proteins were combined with an equal volume of BLOTTO containing
increasing amounts (x axis) of competing test antibody
(indicated above graph) in wells coated with GNA (closed symbols) or
human CD81-LEL (open symbols). R04 is an isotype-matched HMAb that
recognizes a CMV protein (14). After overnight incubation at
4°C, wells were washed, strepavidin-conjugated alkaline phosphatase
was added, and bound CBH-4G-E2 was detected as described in Materials
and Methods. Results are expressed as the percentage signal obtained
relative to wells with no competing antibody. Signals are the average
values of duplicate wells. Error bars indicate 1 standard deviation
from the mean.
|
|
Results from the flow cytometry and in vitro inhibition assays
indicated that HMAbs CBH-2, -5, -7, -8C, -8E, and -11 inhibited
the
binding of E2 to CD81. The inhibitory activity of the HMAbs
could be
due either to steric hindrance of E2 binding to CD81
or to binding of
the HMAbs initiating a conformational change
in E2 that prevented E2
from subsequently binding to CD81. These
alternative mechanisms were
assessed by the ability of HMAbs CBH-2,
-5, -7, -8C, -8E, and -11 to
bind to preformed complexes of CD81-LEL
and recombinant E2 (Fig.
6). Results obtained with these
antibodies
were compared to results obtained with CBH-4G and a control
antibody.
No reactivity was observed with any of the E2-CD81 complexes
and
the control antibody. Consistent with the results of the binding
inhibition assay, HMAb CBH-4G efficiently recognized preformed
CD81-E2
complexes with E2 proteins of genotypes 1a, 1b, 2a, and
2b. Thus,
similar amounts of HCV-E2 complexes were formed using
HCV E2 of each
genotype tested. HMAbs CBH-2, -5, -7, -8C, -8E,
and -11 did not react
with preformed 1b E2-CD81 complexes. However,
HMAb CBH-7 recognized
complexes of HCV 1a E2 with CD81. HMAbs
CBH-2, -5, -7, and -8E
recognized complexes of HCV 2b E2 with
CD81 and HMAbs CBH-7, CBH-5,
CBH-8C, and CBH-11 recognized complexes
of HCV 2a E2 with CD81. Thus,
all six HMAbs that inhibit the interaction
of E2 with CD81 can bind to
some but not all CD81-E2 complexes.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Reactivity of HCV HMAbs to preformed CD81-E2
complexes. Proteins derived from 3 × 105 BSC-1 cells
infected with vaccinia virus VWA with Q1a ( , ), Q1b ( , ),
Q2a ( , ), and Q2b ( , ) were added to microtiter plate wells
coated with human CD81-LEL (closed symbols and solid lines) or murine
CD81-LEL (open symbols and dotted lines) and incubated overnight at
4°C. Wells were washed and then incubated with increasing amounts
(x axis) of the indicated HCV HMAb. Bound antibody was
detected as described in Materials and Methods. Values for murine CD81
are derived from a single determination. Values for human CD81 are the
means of duplicate wells. Error bars indicate 1 standard deviation from
the mean.
|
|
Since recombinant HCV E2 proteins may not mimic the structure of E2 on
the surface of a virion, we asked whether antibodies
that blocked
recombinant E2 binding to CD81 were capable of interfering
with virus
binding to CD81. Because of the lack of HCV culture
assays in vitro, we
took advantage of a PCR assay developed to
demonstrate binding of
envelope-associated HCV RNA to CD81 (
30).
Briefly, the
CD81-LEL was attached to polystyrene beads and incubated
with
infectious plasma containing a known amount of HCV 1a RNA
molecules.
After washing, the amount of CD81-associated virus
was measured by
quantitative RT-PCR. HMAbs CBH-2, CBH-5, CBH-7,
and CBH-11 were
evaluated at a concentration of 10 µg/ml, which
was sufficient to
achieve greater than 65% inhibition of E2 binding
to CD81 in the NOB
and protein inhibition assays (Table
3 and
Fig.
5). No inhibition of
virus binding was observed with a control
antibody or with antibody
CBH-7 or CBH-11. In contrast, preincubation
of infectious plasma with
10 µg each of HMAbs CBH-2 and CBH-5
per ml inhibited HCV binding to
CD81 by 70 and 80% percent, respectively
(Fig.
7). These results support the view that
HMAbs CBH-2 and
CBH-5 can bind HCV virions and have the potential to
inhibit binding
of virions to CD81 in vivo.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 7.
HMAbs CBH-2 and CBH-5 inhibit binding of HCV virions to
CD81. Number of HCV RNA molecules bound to polystyrene beads
(x axis) after HCV 1a chimpanzee serum was combined with 10 µg of the indicated antibodies (y axis) and then
allowed to bind to beads coated with CD81-LEL. The virion binding
experiment was performed as described in Materials and Methods.
|
|
 |
DISCUSSION |
This study provides support for the contention that the majority
of antibodies capable of inhibiting the interaction of HCV E2 with CD81
are developed to conformational epitopes conserved across genotypes
1 and 2. By producing HMAbs, our approach directly analyzes the human
immune response to HCV. We chose an individual with a 2-year history of
normal alanine aminotransferase values as the donor for
antigen-specific B cells since an asymptomatic infection was more
likely to reflect an effective humoral immune response containing
HCV-related disease. This individual also had a high NOB titer. In the
study by Rosa et al., (35), 60% of 34 HCV-infected
individuals exhibited essentially no NOB activity and the remainder
exhibited minimal inhibition of E2 binding to CD81. Thus, the antibody
response of the B-cell donor used in the production of the HMAbs
described herein is exceptional and cannot be assumed to be
representative of the antibody response observed in the majority of
HCV-infected individuals. We are currently using the HCV HMAbs
described in this report to determine the prevalence and titers of
similar antibodies in other HCV-infected individuals.
The B-cell donor was infected with genotype 1b. In an effort to obtain
cross-reactive antibodies, we used HCV 1a E2 proteins to identify HMAbs
to HCV E2. All of the HMAbs also reacted with E2 from a heterologous
HCV 1b isolate, Q1b, that was 80% homologous with the HCV 1a isolate
used in the selection of HMAbs. We do not, unfortunately, have sequence
information on the HCV 1b isolate from the B-cell donor. It is
therefore not possible to comment on the relatedness of Q1b to the
homologous 1b isolate. All of the isolated hybridomas secreted
antibodies with IgG1 heavy chains, which corroborates recent data
indicating that the antibody response to HCV E2 is dominated by IgG1
antibodies (4). Nine of the HMAbs recognized conformational
epitopes sensitive to denaturation of full-length HCV E2. Future
studies with E2 deletion mutants or E2 fragments will be required to
determine if the epitopes recognized by the HMAbs can be
encompassed in discrete domains of E2. Four HMAbs, CBH-4D, -4B, -4G,
and -17, did not inhibit the formation of HCV E2-CD81 complexes. One of
these antibodies, CBH-4G, reacted with HCV E2-CD81 complexes of
genotypes 1a, 1b, 2a, and 2b, confirming that E2 proteins of genotype 2 are capable of binding to CD81-LEL. The broad reactivity of HMAb CBH-4G
with E2-CD81 complexes makes it a useful reagent for quantifying titers of antibody capable of inhibiting binding of E2 with CD81 in HCV sera.
Six of the HMAbs recognizing conformational epitopes, CBH-2, -5, -7, -8C, -8E, and -11, inhibited the binding of HCV E2 proteins with
CD81-LEL and can be referred to as inhibitory or NOB positive. However,
all six antibodies were able to bind to preformed E2-CD81-LEL complexes with some of the same E2 proteins that they efficiently inhibited from binding CD81. Five of the six inhibitory antibodies were
reactive with preformed complexes of 2a or 2b E2 proteins with CD81-LEL
and not 1a or 1b E2 complexes with CD81. This implies that the tertiary
structure of genotype 2 E2 differs from that of genotype 1 E2. However,
the ability of an inhibitory antibody to bind to CD81-E2 complexes did
not strictly correlate with genotype (i.e., HMAb CBH-7 bound complexes
of 1a E2 with CD81-LEL and HMAb CBH-8C did not bind complexes of 2b E2
with CD81-LEL). Thus, the amino acid sequences that underlie the
reactivity of inhibitory HMAbs with CD81-E2 complexes may be subject to
mutation in vivo. This raises the possibility that sequences in
variable regions of E2 affect the reactivity of inhibitory HMAbs with
CD81-E2 complexes, even though the actual epitopes recognized by
the HMAbs appear to be highly conserved. We also note that the
differences in reactivity of the six inhibitory HMAbs with CD81-E2
complexes suggest that the antibodies recognize multiple distinct
epitopes. Competition and mutagenesis studies should clarify the
total number of unique epitopes recognized by the inhibitory HMAbs.
Previous studies have suggested that the binding site for CD81 in E2 is
dependent on E2 conformation (12, 35). The reactivity of the
six inhibitory antibodies with preformed E2-CD82 complexes indicates
that the epitopes recognized by these antibodies do not directly
overlap the CD81 binding site. If the binding sites of the HMAbs and
CD81 overlapped, steric hindrance should have prevented simultaneous
binding of E2 with the HMAb and CD81. A second possibility is that
the epitopes recognized by the inhibitory HMAbs are located
nearby to the CD81 binding site, so that a complex of antibody and E2
has a reduced affinity for CD81 due to antibody-mediated steric
hindrance. However, the very similar binding patterns of the six
inhibitory HMAbs and the noninhibitory HMAb CBH-4G with complexes of
genotype 2 E2 and CD81 argue that the epitopes are equivalently
accessible. The most likely explanation is that the affinity of the
HMAbs for E2 was higher than the affinity of CD81-LEL for E2. Once an
antibody-E2 complex was formed, the inhibitory antibodies stabilized E2
protein in a conformation that had a low affinity for CD81. If a
complex of E2 and CD81 was already formed, accessibility of the
antibody to its epitope may have been affected by the altered
conformation of the E2 in the CD81 complex. Alternatively, the
epitopes recognized by the NOB-positive antibodies may always be
exposed in a CD81-E2 complex, but subsequent binding of the antibody to
this epitope may have a variable ability to dissociate E2 from CD81
(i.e., binding of CBH-5 to a complex of 1a E2 and CD81 results in
dissociation of 1a E2 from CD81, and binding of CBH-5 to a complex of
2a E2 and CD81 is not sufficient to dissociate 2a E2 from CD81). In the
first case, the E2 protein remains associated with CD81; in the second
case, the E2 protein would not be present. We are currently exploring
the use of biotinylated CBH-4G and other epitope tags to attempt to
differentiate between these two possibilities.
Two of the inhibitory antibodies, CBH-2 and CBH-5, were able to prevent
the binding of intact HCV virions to CD81. Two other inhibitory
antibodies, CBH-7 and CBH-11, did not inhibit the interaction of HCV
virions with CD81. The failure of CBH-11 to inhibit binding of HCV
virions to CD81 may reflect the poor reactivity of CBH-11 with HCV some
1a isolates (such as isolate Q1a). HMAbs CBH-2 and CBH-5 did not bind
preformed 1a E2-CD81-LEL complexes and inhibited binding of virions to
CD81. CBH-7 bound to preformed 1a E2-CD81-LEL complexes and did not
inhibit binding of virions to CD81. Therefore, failure to bind to
preformed complexes of E2 and CD81 may be a better predictor of the
ability of an antibody to prevent binding of HCV virions to CD81 in
vivo than is inhibition of formation of the CD81-E2 complex. One
implication of this proposal would be that of the inhibitory HMAbs,
CBH-2 has the greatest potential to effectively inhibit binding of
multiple isolates of HCV to CD81 in vivo. The other inhibitory HMAbs
would have only limited ability to inhibit binding of HCV 2a/2b virions
to CD81. However, testing of CBH-2 and other inhibitory antibodies with
HCV virions and recombinant E2 proteins generated from the same sera
would be required to confirm this.
The observation that a fraction of the E2 antibodies isolated from this
HCV PCR-positive B-cell donor could inhibit the interaction of E2 with
CD81 raises an important question. If the B-cell donor had a high titer
of potentially neutralizing antibodies, why did this individual
continue to exhibit plasma viremia? The most obvious explanation is
that CD81 is not the primary receptor for HCV. Antibodies recognizing
different epitopes that interfere with the binding of HCV to the
putative primary receptor would be the antibodies with neutralization
activity. The donor may have had a relatively low titer of this type of
antibody. If one assumes that CD81 is involved in HCV infectivity, a
second explanation is that antibodies that can inhibit the binding of
E2 to CD81 will neutralize the infectivity of the majority of HCV
virions but have little effect on cells that are already infected.
Studies of the infectivity of HCV innocula in chimpanzee have
demonstrated that antibody-coated virions exhibit markedly reduced
infectivity compared to free virions (17). Other studies
with HCV sera have found that the ability of virions from sera to
attach and enter target cells is critically dependent on whether the
virions are free or coated with antibodies (21). In
addition, studies of E2 expression in mammalian systems indicate that
little or no envelope protein is expressed on the cell surface (8,
32). Thus, antibodies would have limited opportunity to bind to
infected cells. Clearance of cells that are HCV infected would
therefore depend on the action of cytotoxic T lymphocytes, which may or may not be effective (reviewed in reference 33).
Assuming that CD81 is a receptor or coreceptor for HCV, individuals
with a strong NOB-positive antibody response to E2 may be at a steady
state in which minimal de novo infection of susceptible cells occurs while the existing infected cells persist and continue to induce liver
damage. Studies in which HCV antisera with high and low NOB activity
are assessed for infectivity in naive chimpanzees will be required to
more firmly establish a correlation between inhibition of E2-CD81
binding and true virus neutralization.
Overall, multiple HMAbs that recognized conserved epitopes and
could inhibit the interaction of HCV E2 with CD81 were obtained from an
HCV-infected individual with a high-titer immune response to E2. The
antibodies that recognize these epitopes will be useful as reagents
to better define the structure of HCV E2. The antibodies will also be
very useful reagents in assessing the importance of the interaction
between HCV E2 and CD81 in HCV infection. More importantly, if CD81 is
confirmed to be a receptor or coreceptor for HCV, the antibodies that
inhibited binding of HCV virions to human CD81, CBH-2, and CBH-5 have
the potential to mediate virus neutralization. The absence of a true in
vitro model for virus neutralization, however, will require that the
fundamental proof be obtained by the ability of selected HMAbs to
prevent or modify HCV infection in appropriate animal models. If
successful, broadly reactive neutralizing antibodies will
likely have therapeutic utility. Analogous to the success achieved with
hepatitis B immunoglobulin in liver transplantation (7, 26),
one possible application is to suppress HCV infection in liver
transplant recipients with broadly reactive neutralizing HMAbs.
 |
ACKNOWLEDGMENTS |
We thank Ann Warford, Stanford University, for providing HCV
genotype-specific sera and genotype testing. Lily Chan, National University of Singapore, generously provided DNA sequencing of the Q1b
isolate. Other DNA sequencing was performed by Zhen-yong Keck, whose
help and thoughtful comments we gratefully acknowledge. We also thank
Sonal Rajyaguru for technical assistance and Wanda Washington for
administrative assistance.
This work was supported in part by PHS grants DA-06596 and HL-33811 to
S.K.H.F., AI40035 and NIH P51 R13986 to R.E.L., and CA-34233 to S.L.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Stanford Medical
School Blood Center, 800 Welch Rd., Palo Alto, CA 94304. Phone: (650) 723-6481. Fax: (650) 498-6283. E-mail:
sfoung{at}leland.stanford.edu.
 |
REFERENCES |
| 1.
|
Bukh, J.,
R. H. Miller, and R. H. Purcell.
1995.
Genetic heterogeneity of hepatitis C virus: quasispecies and genotypes.
Semin Liver Dis.
15:41-62[Medline].
|
| 2.
|
Burioni, R.,
P. Plaisant,
A. Manin,
D. Rosa,
V. Delli Carri,
F. Bugli,
L. Solforosi,
S. Abrignani,
P. E. Varaldo,
G. Fadda, and M. Clementi.
1998.
Dissection of human humoral immune response against hepatitis C virus E2 glycoprotein by repertoire cloning and generation of recombinant Fab fragments.
Hepatology
28:810-814[CrossRef][Medline].
|
| 3.
|
Cardoso, M. S.,
K. Siemoneit,
D. Sturm,
C. Krone,
D. Moradpour, and B. Kubanek.
1998.
Isolation and characterization of human monoclonal antibodies against hepatitis C virus envelope glycoproteins.
J. Med. Virol.
55:28-34[CrossRef][Medline].
|
| 4.
|
Chen, C.,
M. Sallberg,
A. Sonnerborg,
O. Weiland,
L. Mattsson,
L. Jin,
A. Birkett,
D. Peterson, and D. R. Milich.
1999.
Limited humoral immunity in hepatitis C infection.
Gastroenterology
116:153.
|
| 5.
|
Choo, Q.-L.,
K. H. Richman,
J. H. Han,
K. Berger,
C. Lee,
C. Dong,
C. Gallegos,
D. Coit,
A. Medina-Selby,
P. J. Barr,
A. J. Weiner,
D. W. Bradley,
G. Kuo, and M. Houghten.
1991.
Genetic organization and diversity of the hepatitis C virus.
Proc. Natl. Acad. Sci. USA
88:2451-2455[Abstract/Free Full Text].
|
| 6.
|
Choo, Q.-L.,
G. Kuo,
R. Ralston,
A. Weiner,
D. Chien,
G. Van Nest,
J. Han,
K. Berger,
K. Thudium,
C. Kuo,
J. Kansopon,
J. McFarland,
A. Tabrizi,
K. Ching,
B. Moss,
L. B. Cummins,
M. Houghten, and E. Muchmore.
1994.
Vaccination of chimpanzees against infection by the hepatitis C virus.
Proc. Natl. Acad. Sci. USA
91:1294-1298[Abstract/Free Full Text].
|
| 7.
|
Dickson, R. C.
1998.
Management of posttransplantation viral hepatitis hepatitis B.
Liver Transplant. Surg.
4(5 Suppl. 1):S73-S78[Medline].
|
| 8.
|
Dubuisson, J.,
H. H. Hsu,
R. C. Cheung,
H. B. Greenberg,
D. G. Russell, and C. M. Rice.
1994.
Formation and intracellular localization of hepatitis C virus envelope glycoprotein complexes expressed by recombinant vaccinia and Sindbis viruses.
J. Virol.
68:6147-6160[Abstract/Free Full Text].
|
| 9.
|
Farci, P.,
H. J. Alter,
D. C. Wong,
R. H. Miller,
S. Govindarajan,
R. Engle,
M. Shapiro, and R. H. Purcell.
1994.
Prevention of hepatitis C virus infection in chimpanzees after antibody-mediated in vitro neutralization.
Proc. Natl. Acad. Sci. USA
91:7792-7796[Abstract/Free Full Text].
|
| 10.
|
Farci, P.,
A. Shimoda,
D. Wong,
T. Cabezon,
D. De Gioannis,
A. Strazzera,
Y. Shimizu,
M. Shapiro,
H. J. Alter, and R. H. Purcell.
1996.
Prevention of hepatitis C virus infection in chimpanzees by hyperimmune serum against the hypervariable region 1 of the envelope 2 protein.
Proc. Natl. Acad. Sci. USA
93:15394-15399[Abstract/Free Full Text].
|
| 11.
|
Feray, C.,
M. Gigou,
D. Samuel,
B. Ducot,
P. Maisonneuve,
M. Reynes,
A. Bismuth, and H. Bismuth.
1998.
Incidence of hepatitis C in patients receiving different preparations of hepatitis B immunoglobulins after liver transplantation.
Ann. Intern. Med
128:810-816[Abstract/Free Full Text].
|
| 12.
|
Flint, M.,
C. Maidens,
L. D. Loomis-Price,
C. Shotton,
J. Dubuisson,
P. Monk,
A. Higginbottom,
S. Levy, and J. A. McKeating.
1999.
Characterization of hepatitis C virus E2 glycoprotein interaction with a putative cellular receptor, CD81.
J. Virol.
73:6235-6244[Abstract/Free Full Text].
|
| 13.
|
Habersetzer, F.,
A. Fournillier,
J. Dubuisson,
D. Rosa,
S. Abrignani,
C. Wychowski,
I. Nakano,
C. Treppo,
C. Desgranges, and G. Inchauspe.
1998.
Characterization of human monoclonal antibodies specific to the hepatitis C virus glycoprotein E2 with in vitro binding neutralization properties.
Virology
249:32-41[CrossRef][Medline].
|
| 14.
|
Hadlock, K. G.,
J. Rowe,
S. Perkins,
P. Bradshaw,
G.-Y. Song,
C. Cheng,
J. Yang,
R. Gascon,
J. Halmos,
S.-M. Rehman,
M. McGrath, and S. K. H. Foung.
1997.
Neutralizing human monoclonal antibodies to conformational epitopes of human T-cell lymphotropic virus type 1 and 2 gp46.
J. Virol.
71:5828-5840[Abstract].
|
| 15.
|
Harada, S.,
R. Suzuki,
A. Ando,
Y. Watanabe,
S. Yagi,
T. Miyamura, and I. Saito.
1994.
Establishment of a cell line constitutively expressing E2 glycoprotein of hepatitis C virus and humoral response of hepatitis C patients to the expressed protein.
J. Gen. Virol.
76:1223-1231[Abstract/Free Full Text].
|
| 16.
|
Hijikata, M.,
N. Kato,
Y. Ootsuyama,
M. Nakagawa,
S. Ohkoshi, and K. Shimotohno.
1991.
Hypervariable regions in the putative glycoprotein of hepatitis C virus.
Biochem. Biophys. Res. Commun.
175:220-228[CrossRef][Medline].
|
| 17.
|
Hijikata, M.,
Y. K. Shimizu,
H. Kato,
A. Iwamoto,
J. W. Shih,
H. J. Alter,
R. H. Purcell, and H. Yoshikura.
1993.
Equilibrium centrifugation studies of hepatitis C virus: evidence for circulating immune complexes.
J. Virol.
67:1953-1958[Abstract/Free Full Text].
|
| 18.
|
Houghton, M.
1996.
Hepatitis C viruses, p. 1035-1058.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Virology. Lippincott-Raven, Philadelphia, Pa.
|
| 19.
|
Ishii, K.,
D. Rosa,
Y. Watanabe,
T. Katayama,
H. Harada,
C. Wyatt,
K. Kiyosawa,
H. Aizaki,
Y. Matsuura,
M. Houghton,
S. Abrignani, and T. Miyamura.
1998.
High titers of antibodies inhibiting the binding of envelope to human cells correlate with natural resolution of chronic hepatitis C.
Hepatology
28:1117-1120[CrossRef][Medline].
|
| 20.
|
Kato, N.,
H. Sekiya,
Y. Ootsuyama,
T. Nakazawa,
M. Hijikata,
S. Ohkoshi, and K. Shimotohno.
1993.
Genetic drift in hypervariable region 1 of the viral genome in persistent hepatitis C virus infection.
J. Virol.
67:3923-3930[Abstract/Free Full Text].
|
| 21.
|
Kimura, Y.,
K. Hayashida,
H. Ishibashi,
Y. Niho,
K. Akazawa, and Y. Yanagi.
1998.
Attachment of Hepatitis C virus to cultured cells: a novel predictive factor for successful interferon therapy.
J. Med. Virol.
56:25-32[CrossRef][Medline].
|
| 22.
|
Lanford, R. E.,
L. Notvall,
D. Chavez,
R. White,
G. Frenzel,
C. Simonsen, and J. Kim.
1993.
Analysis of hepatitis C virus capsid, E1, and E2/NS1 proteins expressed in insect cells.
Virology
197:225-235[CrossRef][Medline].
|
| 23.
|
Lesniewski, R.,
G. Okasinski,
R. Carrick,
C. Van Sant,
S. Desai,
R. Johnson,
J. M. Scheffel,
B. Moore, and I. Mushahwar.
1995.
Antibody to hepatitis C virus second envelope (HCV-E2) glycoprotein: a new marker of HCV infection closely associated with viremia.
J. Med. Virol.
45:415-422[Medline].
|
| 24.
|
Levy, S.,
S. C. Todd, and H. T. Maecker.
1998.
CD81 (TAPA-1): a molecule involved in signal transduction and cell adhesion in the immune system.
Annu. Rev. Immunol.
16:89-109[CrossRef][Medline].
|
| 25.
|
Mahaney, K.,
V. Tedeschi,
G. Maertens,
A. M. Di Bisceglie,
J. Veergalla,
J. H. Hoffnagle, and R. Sallie.
1994.
Genotypic analysis of hepatitis C virus in American patients.
Hepatology
20:1405-1411[Medline].
|
| 26.
|
Markowitz, J. S.,
P. Martin,
A. J. Conrad,
J. F. Markmann,
P. Seu,
H. Yersiz,
J. A. Goss,
P. Schmidt,
A. Pakrasi,
L. Artinian,
N. G. Murray,
D. K. Imagawa,
C. Holt,
L. I. Goldstein,
R. Stribling, and R. W. Busuttil.
1998.
Prophylaxis against hepatitis B recurrence following liver transplantation using combination lamivudine and hepatitis B immune globulin.
Hepatology
28:585-589[CrossRef][Medline].
|
| 27.
|
Moss, B., and P. Earl.
1994.
Expression of proteins in mammalian cells using vaccinia viral vectors, p. 16.15.1-16.18.10.
In
F. Ausubel, R. Brent, and R. Kingston (ed.), Current protocols in molecular biology, vol. 2. John Wiley & Sons, New York, N.Y.
|
| 28.
|
Perkins, S., and S. Foung.
1995.
Stabilizing antibody secretion of human Epstein-Barr virus-activated B-lymphocytes with hybridoma formation by electrofusion.
Methods Mol. Biol.
48:295-307[Medline].
|
| 29.
|
Piazza, M.,
L. Sagliocca,
G. Tosone,
V. Guadagnino,
M. A. Stazi,
R. Orlando,
B. Guglielmo,
R. Domenico,
S. Abrignani,
F. Palumbo,
A. Manzin, and M. Clementi.
1997.
Sexual transmission of the hepatitis C virus and efficacy of prophylaxis with intramuscular immune serum globulin.
Arch. Intern. Med.
157:1537-1544[Abstract/Free Full Text].
|
| 30.
|
Pileri, O.,
Y. Uematsu,
S. Campagnoli,
G. Galli,
F. Falugi,
R. Petracca,
A. J. Weiner,
M. Houghton,
D. Rosa,
G. Grandi, and S. Abrignani.
1998.
Binding of hepatitis C virus to CD81.
Science
282:938-941[Abstract/Free Full Text].
|
| 31.
|
Puntoriero, G.,
A. Meola,
A. Lahm,
S. Zucchelli,
B. B. Ercole,
R. Tafi,
M. Pezzanera,
M. U. Mondelli,
R. Cortese,
A. Tramontano,
G. Galfre, and A. Nicosia.
1998.
Towards a solution for hepatitis C virus hypervariability: mimotopes of the hypervariable region 1 can induce antibodies cross-reacting with a large number of viral variants.
EMBO J.
17:3521-3533[CrossRef][Medline].
|
| 32.
|
Ralston, R.,
K. Thudium,
K. Berger,
C. Kuo,
B. Gervase,
J. Hall,
M. Selby,
G. Kuo,
M. Houghton, and Q.-L. Choo.
1993.
Characterization of hepatitis C virus envelope glycoprotein complexes expressed by recombinant vaccinia viruses.
J. Virol.
67:6753-6761[Abstract/Free Full Text].
|
| 33.
|
Rehermann, B., and F. V. Chisari.
2000.
Cell mediated immune response to the hepatitis C virus.
Curr. Top. Microbiol. Immunol.
242:299-325[Medline].
|
| 34.
|
Rice, C. M.
1999.
Is CD81 the key to hepatitis C virus entry?
Hepatology
29:990-992[CrossRef][Medline].
|
| 35.
|
Rosa, D.,
S. Campagnoli,
C. Moretto,
E. Guenzi,
L. Cousens,
M. Chin,
C. Dong,
A. J. Weiner,
J. Y. N. Lau,
Q.-L. Choo,
D. Chien,
P. Pileri,
M. Houghten, and S. Abrignani.
1996.
A quantitative test to estimate neutralizing antibodies to the hepatitis C virus: cytofluorimetric assessment of envelope glycoprotein 2 binding to target cells.
Proc. Natl. Acad. Sci. USA
93:1759-1763[Abstract/Free Full Text].
|
| 36.
|
Seki, M.,
M. Oie,
Y. Ichihashi, and H. Shida.
1990.
Hemadsorption and fusion inhibition activities of hemagglutinin analyzed by vaccinia virus mutants.
Virology
175:372-384[CrossRef][Medline].
|
| 37.
|
Shimizu, Y. K.,
M. Hijikata,
A. Iwamoto,
H. J. Alter,
R. H. Purcell, and H. Yoshikura.
1994.
Neutralizing antibodies against hepatitis C virus and the emergence of neutralization escape mutant viruses.
J. Virol.
68:1494-1500[Abstract/Free Full Text].
|
| 38.
|
Ward, G. A.,
C. K. Stover,
B. Moss, and T. R. Fuerst.
1995.
Stringent chemical and thermal regulation of recombinant gene expression by vaccinia virus vectors in mammalian cells.
Proc. Natl. Acad. Sci. USA
92:6773-6777[Abstract/Free Full Text].
|
| 39.
|
Weiner, A. J.,
M. J. Brauer,
J. Rosenblatt,
K. H. Richman,
J. Tung,
K. Crawford,
F. Bonino,
G. Saracco,
Q.-L. Choo,
M. Houghton, and J. H. Han.
1991.
Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins.
Virology
180:842-848[CrossRef][Medline].
|
| 40.
|
Weiner, A. J.,
H. M. Geysen,
C. Christopherson,
J. E. Hall,
T. J. Mason,
G. Saracco,
F. Bonino,
K. Crawford,
C. D. Marion,
K. A. Crawford,
M. Brunetto,
P. J. Barr,
T. Miyamura,
J. McHutchinson, and M. Houghton.
1992.
Evidence for immune selection of hepatitis C virus (HCV) putative envelope glycoprotein variants: potential role in chronic HCV infections.
Proc. Natl. Acad. Sci. USA
89:3468-3472[Abstract/Free Full Text].
|
Journal of Virology, November 2000, p. 10407-10416, Vol. 74, No. 22
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Broering, T. J., Garrity, K. A., Boatright, N. K., Sloan, S. E., Sandor, F., Thomas, W. D. Jr., Szabo, G., Finberg, R. W., Ambrosino, D. M., Babcock, G. J.
(2009). Identification and Characterization of Broadly Neutralizing Human Monoclonal Antibodies Directed against the E2 Envelope Glycoprotein of Hepatitis C Virus. J. Virol.
83: 12473-12482
[Abstract]
[Full Text]
-
Sapparapu, G., Planque, S. A., Nishiyama, Y., Foung, S. K., Paul, S.
(2009). Antigen-specific Proteolysis by Hybrid Antibodies Containing Promiscuous Proteolytic Light Chains Paired with an Antigen-binding Heavy Chain. J. Biol. Chem.
284: 24622-24633
[Abstract]
[Full Text]
-
Haid, S., Pietschmann, T., Pecheur, E.-I.
(2009). Low pH-dependent Hepatitis C Virus Membrane Fusion Depends on E2 Integrity, Target Lipid Composition, and Density of Virus Particles. J. Biol. Chem.
284: 17657-17667
[Abstract]
[Full Text]
-
Keck, Z.-y., Li, S. H., Xia, J., von Hahn, T., Balfe, P., McKeating, J. A., Witteveldt, J., Patel, A. H., Alter, H., Rice, C. M., Foung, S. K. H.
(2009). Mutations in Hepatitis C Virus E2 Located outside the CD81 Binding Sites Lead to Escape from Broadly Neutralizing Antibodies but Compromise Virus Infectivity. J. Virol.
83: 6149-6160
[Abstract]
[Full Text]
-
Witteveldt, J., Evans, M. J., Bitzegeio, J., Koutsoudakis, G., Owsianka, A. M., Angus, A. G. N., Keck, Z.-Y., Foung, S. K. H., Pietschmann, T., Rice, C. M., Patel, A. H.
(2009). CD81 is dispensable for hepatitis C virus cell-to-cell transmission in hepatoma cells. J. Gen. Virol.
90: 48-58
[Abstract]
[Full Text]
-
Gal-Tanamy, M., Keck, Z.-Y., Yi, M., McKeating, J. A., Patel, A. H., Foung, S. K. H., Lemon, S. M.
(2008). In vitro selection of a neutralization-resistant hepatitis C virus escape mutant. Proc. Natl. Acad. Sci. USA
105: 19450-19455
[Abstract]
[Full Text]
-
Machida, K., Kondo, Y., Huang, J. Y., Chen, Y.-C., Cheng, K. T.-H., Keck, Z., Foung, S., Dubuisson, J., Sung, V. M.-H., Lai, M. M. C.
(2008). Hepatitis C Virus (HCV)-Induced Immunoglobulin Hypermutation Reduces the Affinity and Neutralizing Activities of Antibodies against HCV Envelope Protein. J. Virol.
82: 6711-6720
[Abstract]
[Full Text]
-
Keck, Z.-Y., Olson, O., Gal-Tanamy, M., Xia, J., Patel, A. H., Dreux, M., Cosset, F.-L., Lemon, S. M., Foung, S. K. H.
(2008). A Point Mutation Leading to Hepatitis C Virus Escape from Neutralization by a Monoclonal Antibody to a Conserved Conformational Epitope. J. Virol.
82: 6067-6072
[Abstract]
[Full Text]
-
Keck, Z.-Y., Li, T.-K., Xia, J., Gal-Tanamy, M., Olson, O., Li, S. H., Patel, A. H., Ball, J. K., Lemon, S. M., Foung, S. K. H.
(2008). Definition of a Conserved Immunodominant Domain on Hepatitis C Virus E2 Glycoprotein by Neutralizing Human Monoclonal Antibodies. J. Virol.
82: 6061-6066
[Abstract]
[Full Text]
-
Owsianka, A. M., Tarr, A. W., Keck, Z.-Y., Li, T.-K., Witteveldt, J., Adair, R., Foung, S. K. H., Ball, J. K., Patel, A. H.
(2008). Broadly neutralizing human monoclonal antibodies to the hepatitis C virus E2 glycoprotein. J. Gen. Virol.
89: 653-659
[Abstract]
[Full Text]
-
Meyer, K., Ait-Goughoulte, M., Keck, Z.-Y., Foung, S., Ray, R.
(2008). Antibody-Dependent Enhancement of Hepatitis C Virus Infection. J. Virol.
82: 2140-2149
[Abstract]
[Full Text]
-
Perotti, M., Mancini, N., Diotti, R. A., Tarr, A. W., Ball, J. K., Owsianka, A., Adair, R., Patel, A. H., Clementi, M., Burioni, R.
(2008). Identification of a Broadly Cross-Reacting and Neutralizing Human Monoclonal Antibody Directed against the Hepatitis C Virus E2 Protein. J. Virol.
82: 1047-1052
[Abstract]
[Full Text]
-
Tarr, A. W., Owsianka, A. M., Jayaraj, D., Brown, R. J. P., Hickling, T. P., Irving, W. L., Patel, A. H., Ball, J. K.
(2007). Determination of the human antibody response to the epitope defined by the hepatitis C virus-neutralizing monoclonal antibody AP33. J. Gen. Virol.
88: 2991-3001
[Abstract]
[Full Text]
-
McCaffrey, K., Boo, I., Poumbourios, P., Drummer, H. E.
(2007). Expression and Characterization of a Minimal Hepatitis C Virus Glycoprotein E2 Core Domain That Retains CD81 Binding. J. Virol.
81: 9584-9590
[Abstract]
[Full Text]
-
Helle, F., Goffard, A., Morel, V., Duverlie, G., McKeating, J., Keck, Z.-Y., Foung, S., Penin, F., Dubuisson, J., Voisset, C.
(2007). The Neutralizing Activity of Anti-Hepatitis C Virus Antibodies Is Modulated by Specific Glycans on the E2 Envelope Protein. J. Virol.
81: 8101-8111
[Abstract]
[Full Text]
-
Brown, R. J. P., Tarr, A. W., McClure, C. P., Juttla, V. S., Tagiuri, N., Irving, W. L., Ball, J. K.
(2007). Cross-genotype characterization of genetic diversity and molecular adaptation in hepatitis C virus envelope glycoprotein genes. J. Gen. Virol.
88: 458-469
[Abstract]
[Full Text]
-
Keck, Z.-Y., Xia, J., Cai, Z., Li, T.-K., Owsianka, A. M., Patel, A. H., Luo, G., Foung, S. K. H.
(2007). Immunogenic and Functional Organization of Hepatitis C Virus (HCV) Glycoprotein E2 on Infectious HCV Virions. J. Virol.
81: 1043-1047
[Abstract]
[Full Text]
-
McLinden, J. H., Kaufman, T. M., Xiang, J., Chang, Q., Klinzman, D., Engel, A. M., Hess, G., Schmidt, U., Houghton, M., Stapleton, J. T.
(2006). Characterization of an Immunodominant Antigenic Site on GB Virus C Glycoprotein E2 That Is Involved in Cell Binding. J. Virol.
80: 12131-12140
[Abstract]
[Full Text]
-
Majid, A. M., Ezelle, H., Shah, S., Barber, G. N.
(2006). Evaluating Replication-Defective Vesicular Stomatitis Virus as a Vaccine Vehicle. J. Virol.
80: 6993-7008
[Abstract]
[Full Text]
-
Dreux, M., Pietschmann, T., Granier, C., Voisset, C., Ricard-Blum, S., Mangeot, P.-E., Keck, Z., Foung, S., Vu-Dac, N., Dubuisson, J., Bartenschlager, R., Lavillette, D., Cosset, F.-L.
(2006). High Density Lipoprotein Inhibits Hepatitis C Virus-neutralizing Antibodies by Stimulating Cell Entry via Activation of the Scavenger Receptor BI. J. Biol. Chem.
281: 18285-18295
[Abstract]
[Full Text]
-
Bertaux, C., Dragic, T.
(2006). Different domains of CD81 mediate distinct stages of hepatitis C virus pseudoparticle entry.. J. Virol.
80: 4940-4948
[Abstract]
[Full Text]
-
Eren, R., Landstein, D., Terkieltaub, D., Nussbaum, O., Zauberman, A., Ben-Porath, J., Gopher, J., Buchnick, R., Kovjazin, R., Rosenthal-Galili, Z., Aviel, S., Ilan, E., Shoshany, Y., Neville, L., Waisman, T., Ben-Moshe, O., Kischitsky, A., Foung, S. K. H., Keck, Z.-Y., Pappo, O., Eid, A., Jurim, O., Zamir, G., Galun, E., Dagan, S.
(2006). Preclinical Evaluation of Two Neutralizing Human Monoclonal Antibodies against Hepatitis C Virus (HCV): a Potential Treatment To Prevent HCV Reinfection in Liver Transplant Patients. J. Virol.
80: 2654-2664
[Abstract]
[Full Text]
-
Rouille, Y., Helle, F., Delgrange, D., Roingeard, P., Voisset, C., Blanchard, E., Belouzard, S., McKeating, J., Patel, A. H., Maertens, G., Wakita, T., Wychowski, C., Dubuisson, J.
(2006). Subcellular Localization of Hepatitis C Virus Structural Proteins in a Cell Culture System That Efficiently Replicates the Virus. J. Virol.
80: 2832-2841
[Abstract]
[Full Text]
-
Machida, K., Cheng, K. T. H., Sung, V. M.-H., Levine, A. M., Foung, S., Lai, M. M. C.
(2006). Hepatitis C Virus Induces Toll-Like Receptor 4 Expression, Leading to Enhanced Production of Beta Interferon and Interleukin-6. J. Virol.
80: 866-874
[Abstract]
[Full Text]
-
Keck, Z.-Y., Li, T.-K., Xia, J., Bartosch, B., Cosset, F.-L., Dubuisson, J., Foung, S. K. H.
(2005). Analysis of a Highly Flexible Conformational Immunogenic Domain A in Hepatitis C Virus E2. J. Virol.
79: 13199-13208
[Abstract]
[Full Text]
-
Owsianka, A., Tarr, A. W., Juttla, V. S., Lavillette, D., Bartosch, B., Cosset, F.-L., Ball, J. K., Patel, A. H.
(2005). Monoclonal Antibody AP33 Defines a Broadly Neutralizing Epitope on the Hepatitis C Virus E2 Envelope Glycoprotein. J. Virol.
79: 11095-11104
[Abstract]
[Full Text]
-
Keck, Z.-Y., Op De Beeck, A., Hadlock, K. G., Xia, J., Li, T.-K., Dubuisson, J., Foung, S. K. H.
(2004). Hepatitis C Virus E2 Has Three Immunogenic Domains Containing Conformational Epitopes with Distinct Properties and Biological Functions. J. Virol.
78: 9224-9232
[Abstract]
[Full Text]
-
Keck, Z.-Y., Sung, V. M. H., Perkins, S., Rowe, J., Paul, S., Liang, T. J., Lai, M. M. C., Foung, S. K. H.
(2004). Human Monoclonal Antibody to Hepatitis C Virus E1 Glycoprotein That Blocks Virus Attachment and Viral Infectivity. J. Virol.
78: 7257-7263
[Abstract]
[Full Text]
-
Heo, T.-H., Chang, J.-H., Lee, J.-W., Foung, S. K. H., Dubuisson, J., Kang, C.-Y.
(2004). Incomplete Humoral Immunity against Hepatitis C Virus Is Linked with Distinct Recognition of Putative Multiple Receptors by E2 Envelope Glycoprotein. J. Immunol.
173: 446-455
[Abstract]
[Full Text]
-
Op De Beeck, A., Voisset, C., Bartosch, B., Ciczora, Y., Cocquerel, L., Keck, Z., Foung, S., Cosset, F.-L., Dubuisson, J.
(2004). Characterization of Functional Hepatitis C Virus Envelope Glycoproteins. J. Virol.
78: 2994-3002
[Abstract]
[Full Text]
-
Cocquerel, L., Kuo, C.-C., Dubuisson, J., Levy, S.
(2003). CD81-Dependent Binding of Hepatitis C Virus E1E2 Heterodimers. J. Virol.
77: 10677-10683
[Abstract]
[Full Text]
-
Lozach, P.-Y., Lortat-Jacob, H., De Lacroix De Lavalette, A., Staropoli, I., Foung, S., Amara, A., Houles, C., Fieschi, F., Schwartz, O., Virelizier, J.-L., Arenzana-Seisdedos, F., Altmeyer, R.
(2003). DC-SIGN and L-SIGN Are High Affinity Binding Receptors for Hepatitis C Virus Glycoprotein E2. J. Biol. Chem.
278: 20358-20366
[Abstract]
[Full Text]
-
Roccasecca, R., Ansuini, H., Vitelli, A., Meola, A., Scarselli, E., Acali, S., Pezzanera, M., Ercole, B. B., McKeating, J., Yagnik, A., Lahm, A., Tramontano, A., Cortese, R., Nicosia, A.
(2003). Binding of the Hepatitis C Virus E2 Glycoprotein to CD81 Is Strain Specific and Is Modulated by a Complex Interplay between Hypervariable Regions 1 and 2. J. Virol.
77: 1856-1867
[Abstract]
[Full Text]
-
Cocquerel, L., Quinn, E. R., Flint, M., Hadlock, K. G., Foung, S. K. H., Levy, S.
(2002). Recognition of Native Hepatitis C Virus E1E2 Heterodimers by a Human Monoclonal Antibody. J. Virol.
77: 1604-1609
[Abstract]
[Full Text]
-
Clayton, R. F., Owsianka, A., Aitken, J., Graham, S., Bhella, D., Patel, A. H.
(2002). Analysis of Antigenicity and Topology of E2 Glycoprotein Present on Recombinant Hepatitis C Virus-Like Particles. J. Virol.
76: 7672-7682
[Abstract]
[Full Text]
-
Meyer, K., Basu, A., Przysiecki, C. T., Lagging, L. M., Di Bisceglie, A. M., Conley, A. J., Ray, R.
(2002). Complement-Mediated Enhancement of Antibody Function for Neutralization of Pseudotype Virus Containing Hepatitis C Virus E2 Chimeric Glycoprotein. J. Virol.
76: 2150-2158
[Abstract]
[Full Text]
-
Quinn, E. R., Chan, C. H., Hadlock, K. G., Foung, S. K. H., Flint, M., Levy, S.
(2001). The B-cell receptor of a hepatitis C virus (HCV)-associated non-Hodgkin lymphoma binds the viral E2 envelope protein, implicating HCV in lymphomagenesis. Blood
98: 3745-3749
[Abstract]
[Full Text]
-
Bugli, F., Mancini, N., Kang, C.-Y., Di Campli, C., Grieco, A., Manzin, A., Gabrielli, A., Gasbarrini, A., Fadda, G., Varaldo, P. E., Clementi, M., Burioni, R.
(2001). Mapping B-Cell Epitopes of Hepatitis C Virus E2 Glycoprotein Using Human Monoclonal Antibodies from Phage Display Libraries. J. Virol.
75: 9986-9990
[Abstract]
[Full Text]
-
Owsianka, A., Clayton, R. F., Loomis-Price, L. D., McKeating, J. A., Patel, A. H.
(2001). Functional analysis of hepatitis C virus E2 glycoproteins and virus-like particles reveals structural dissimilarities between different forms of E2. J. Gen. Virol.
82: 1877-1883
[Abstract]
[Full Text]
-
Chan, C. H., Hadlock, K. G., Foung, S. K. H., Levy, S.
(2001). VH1-69 gene is preferentially used by hepatitis C virus-associated B cell lymphomas and by normal B cells responding to the E2 viral antigen. Blood
97: 1023-1026
[Abstract]
[Full Text]