Previous Article | Next Article 
Journal of Virology, November 2000, p. 10341-10348, Vol. 74, No. 22
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Generation of Subgenomic RNA Directed by a
Satellite RNA Associated with Bamboo Mosaic Potexvirus: Analyses of
Potexvirus Subgenomic RNA Promoter
Yun-Shien
Lee,1
Yau-Heiu
Hsu,2 and
Na-Sheng
Lin1,*
Institute of Botany, Academia Sinica, Taipei,
Taiwan 115,1 and Graduate Institute of
Agricultural Biotechnology, National Chung Hsing University, Taichung,
Taiwan 400,2 Republic of China
Received 30 March 2000/Accepted 15 August 2000
 |
ABSTRACT |
Satellite RNA of bamboo mosaic potexvirus (satBaMV), a
single-stranded positive-sense RNA encoding a nonstructural protein of
20 kDa (P20), depends on bamboo mosaic potexvirus (BaMV) for replication and encapsidation. A full-length cDNA clone of satBaMV was
used to examine the sequences required for the synthesis of potexvirus
subgenomic RNAs (sgRNAs). Subgenomic
promoter-like sequences (SGPs), 107 nucleotides (nt) upstream from the
capsid protein (CP) gene of BaMV-V, were inserted upstream of the start codon of the P20 gene of satBaMV. Insertion of SGPs gave rise to the
synthesis of sgRNA of satBaMV in protoplasts of
Nicotiana benthamiana and leaves of Chenopodium
quinoa when coinoculated with BaMV-V genomic RNA.
Moreover, both the satBaMV cassette and its sgRNA were
encapsidated. From analysis of the SGPs by deletion mutation, we
concluded that an SGP contains one core promoterlike sequence (nt
30
through +16), two upstream enhancers (nt
59 through
31 and
91
through
60), and one downstream enhancer (nt +17 through +52), when
the transcription initiation site is taken as +1. Site-directed
mutagenesis and compensatory mutation to disrupt and restore potential
base pairing in the core promoter-like sequence suggest that the
stem-loop structure is important for the function of SGP in vivo.
Likewise, the insertion of a putative SGP of the BaMV open reading
frame 2 gene or a heterologous SGP of potato virus X resulted in
generation of an sgRNA. The satBaMV cassette should be a
useful tool to gain insight into sequences required for the synthesis
of potexvirus sgRNAs.
 |
INTRODUCTION |
The production of subgenomic
RNAs (sgRNAs) is one of the strategies by which internally
located open reading frames (ORFs) of multicistronic RNA virus may be
expressed and regulated during replication. The capsid proteins (CPs)
of alpha-like superfamily viruses are expressed by sgRNA
transcription (24). The proteins encoded by the triple gene
block of potex-, carla-, furo-, and hordeiviruses and the movement
proteins of tobamo- and tombusviruses are also expressed by the same
strategy (24). Several mechanisms are proposed for the
transcription of sgRNAs. The first is leader-primed transcription, which occurs in the production of coronavirus
sgRNAs. This process involves fusion of noncontinuous
sequences from the 5' leader sequences to the sgRNA by a
discontinuous process (14). Recently, a new model for
coronavirus transcription was proposed. This model predicts that
subgenome-length negative strands containing the common 5' leader
sequence were directly derived from genome RNA and served as a template
for the production of sgRNA (27). The second
mechanism proposed for transcription of sgRNAs is exemplified by transcription of RNA-mediated trans-activation. A
34-nucleotide (nt) trans-activator on red clover necrotic
mosaic virus RNA2 was proposed to bind to the element upstream of the
sgRNA initiation site on RNA1 and to prevent the synthesis of
full-length minus-strand RNA1. This truncated minus-strand RNA1 may
serve as a template for viral RNA-dependent RNA polymerase (RdRp) to
produce the sgRNA (31). Another mechanism proposed
is suitable for most plant viruses, as exemplified by brome mosaic
virus (BMV). SgRNA transcription is directed by subgenomic
promoter-like sequences (SGPs), located 100 to 200 nt upstream of the
start codon of ORFs in the minus-strand template, and recognized by the
viral RdRp (24). In some cases, additional long-distance
RNA-RNA interactions between the SGP sequence and the 5' terminus are
required for the genomic and sgRNA accumulation
(13, 41).
The SGPs of BMV (8, 25, 32) and alfalfa mosaic virus (AMV)
(33, 34) have been extensively characterized in vivo and in
vitro. All of these SGPs contain a "core promoter," which is the
minimum number of sequences required for the synthesis of the
sgRNA, and several "enhancers," which modulate the
function of the core promoter. In addition, RdRp complexes of BMV
(8) and AMV (34) have been shown to bind
initially to two internal sites on the minus strand of RNA3 for
sgRNA synthesis. Recently, sgRNA initiation has
been studied on the small template of minus-strand BMV RNA3, using
purified viral RdRp complexes, which suggests that recognition of the
SGP by the BMV RdRp is sequence specific (1, 30). However,
the secondary structure of the SGP may also facilitate efficient
sgRNA transcription in vivo (1).
For the potexvirus group, two major sgRNAs of about 1.9 to
2.1 kb and 0.9 to 1.0 kb in size, which direct the expression of the
ORF2 protein and the CP, respectively, were detected in the infected
cells (7, 11, 15, 37). Another bicistronic sgRNA of 1.4 kb, which was responsible for the translation of ORF3 and ORF4
proteins, accumulated at a very low level in the infected cells
(36). Alignment of the putative SGPs of ORF2 protein and CP
among potexviruses revealed that the conserved octanucleotide motif
(3'-CAAUUCAA-5') was located upstream from the transcription initiation
sites of the sgRNAs (12, 15, 37). However, the nucleotide sequences and the spacing between the transcription initiation site and the octanucleotide motif vary among potexviruses (12, 15). It has been shown that complementarity between the conserved octanucleotide sequence and the 3' terminus of minus-strand potato virus X (PVX) RNA is important for the synthesis of
sgRNA (13). Mutations that reduced the
complementarity affected the viral RNA replication and accumulation of
sgRNA (12, 13).
Bamboo mosaic potexvirus (BaMV) contains a single-stranded
positive-sense RNA genome of 6.4 kb and belongs to the alphavirus-like superfamily (21, 40). The genome of BaMV contains five
common ORFs (21, 40). ORF1 encodes a putative RdRp of 155 kDa (19, 21). ORF2 to ORF4, which code for triple gene block
proteins of 28, 13, and 6 kDa (21, 40), respectively, are
required for viral cell-to-cell movement (3, 39). The
product of ORF5 is the CP of 25 kDa (15). A satellite RNA
(satBaMV) was found to be associated with the BaMV-V isolate
(22). The satBaMV is a linear molecule of 836 nt and encodes
a 20-kDa protein (P20) (22). The ORF of P20 is not essential
for satBaMV replication and can be replaced with a chloramphenicol
acetyltransferase (CAT) reporter gene to express the CAT protein in
coinoculated plants (23).
In this study, we used the satBaMV cassette to examine the sequences
and structures required for the syntheses of potexvirus sgRNAs. The insertion of the putative SGP of the 1.0-kb
sgRNA of BaMV into the satBaMV cassette resulted in a new
abundant sgRNA of satBaMV. By analyzing the SGP activities of
various mutants, the core promoter-like and enhancer-like sequences of
the 1.0-kb sgRNA were mapped. The generation of an
sgRNA of satBaMV was also confirmed by the insertion of the
putative SGP of the 2.0-kb sgRNA or by a heterologous SGP of
PVX by primer extension. The satBaMV cassette provides a useful tool
for the analysis of sequences or structures required for the synthesis
of potexvirus sgRNAs.
 |
MATERIALS AND METHODS |
Plasmid construction.
Plasmid pBSF4 is a full-length cDNA
clone of satBaMV with a T7 RNA promoter at the 5' end as previously
described (23). pICF4 was constructed by insertion of 107 nt
upstream of the start codon of the CP gene of BaMV-V into the start
codon of the P20 gene of pBSF4 (Fig. 1A).
The DNA fragments corresponding to the putative SGP of the CP gene were
amplified from pBa19 (40) by PCR using primers B43
(5'-TATCCACGACGTTGGAAATAATAATAAAC) and B44 (5'-CGCCCATCGTCCTGGCTTTAGTGTTTAATT). After digestion with
BstXI, the fragments were inserted into BstXI-cut
pBSF4 to generate pICF4.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 1.
Genome organization of BaMV and satBaMV mutants (A) and
the time course accumulation of BaMV-V genomic RNA (B) and
satBaMV mutants (C) in inoculated protoplasts. (A) In these schematic
diagrams of BaMV and satBaMV cassettes, the hatched regions represent
the ORF regions of BaMV (designated ORFs 1 through 5) or satBaMV
(designated P20); the black bar represents the 107 nt upstream of the
CP gene of BaMV (designated SGP); restriction enzyme sites
ApaI, BstXI, and BseRI in pBSF4 are
also indicated as are the positions of primers B56 and BS9. (B and C)
Protoplasts of barley were inoculated with BaMV-L RNA only (lanes 1 through 3) or coinoculated with pBSF4 (lanes 4 through 6) or pICF4
(lanes 7 through 9) transcripts. Total RNAs extracted from 5 × 104 protoplasts at 8 h.p.i. (lanes 1, 4, and 7),
16 h.p.i. (lanes 2, 5, and 8), and 24 h.p.i. (lanes 3, 6, and
9) were glyoxylated and fractionated in a 1% agarose gel, blotted to a
nylon membrane, and hybridized to a BaMV-specific (20) (B)
or satBaMV-specific (23) (C) riboprobe. The star indicates
the position of the 0.7-kb sgRNA transcribed from pICF4.
|
|
Plasmids pICN9, pICN18, pICN36, and pICN54 are modified forms of pICF4
with the addition of the N-terminal 9, 18, 36, and 54 nt of the CP gene
(40), respectively (Fig. 2A).
They were constructed by site-directed mutagenesis using a double-PCR
method (4). For the construction of pICN18, the first PCR
fragment was synthesized from the pICF4 template by primers IC2
(5'-AATTAAACACTAAAGATGTCTGGAACTGGAACGATGGTTCGGAGGAGA) and BS26 (5'-CCTTCTCGAGTCAACTGGTTGGCGCACG) followed by the
second PCR using pICF4 as a template with primer BS19
(5'-TGCCTGCAGTAATACGACTCACTATAGAAAACTCACCGCAACGA) and the
first PCR fragments. The ApaI- and BseRI-digested
secondary PCR fragments were ligated with the ApaI- and
BseRI-cut pICF4 to generate pICN18. To generate pICN9,
pICN36, and pICN54, a similar method was used except that the pICN18
was used as a template and the corresponding primers BSIC23
(5'-CCTCCGAACCATTCCAGACATCTTTAG), BSIC22
(5'-CCTCCGAACCATAGTCCCTCGCCCAGTTCCTGTTCCAGTTCCAG) and BSIC21 (5'-GACCTTGACCTTGTC CTTGACCCGCTCGACCTTGACCACGCCCTCCGTACCAAGCCTCC) were
used instead, respectively.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic diagrams of pICF4 mutants (A) and their
transcription activities (B and C). (A) pICF4 and its mutants carrying
various lengths of SGP sequences extended downstream to the coding
region of the CP gene. The black region represents the 107 nt upstream
of the CP gene of BaMV (designated SGP). The start codon of the CP gene
is indicated. (B) Northern blot analysis was performed on total RNAs
extracted from 5 × 104 protoplasts of N. benthamiana coinoculated with BaMV-L RNA and pICF4 (lane 1), pICN9
(lane 2), pICN18 (lane 3), pICN36 (lane 4), and pICN54 (lane 5)
transcripts at 24 h.p.i. with a satBaMV-specific
riboprobe. The asterisk indicates the position of the 0.7-kb
sgRNA transcribed from satBaMV cassette. (C)
Quantitative analyses of the transcription ratios of pICF4 and its
mutants in coinoculated protoplasts of N. benthamiana were
performed. The transcription ratio was determined by quantifying the
0.7-kb sgRNA relative to that of satBaMV RNA (a),
and the transcription ratio was the transcription ratio of ICF4 mutants
over that of ICF4 at 24 h.p.i. (b). These data were collected in
three independent experiments by PhosphorImager and using the
ImageQuant version 3.3 program (Molecular Dynamics); standard
deviations are indicated.
|
|
pIC3, pIC4, and pIC5 are the 5' end deletion mutants of pICN18 deleted
from nt
91 to
8,
91 to
31, and
91 to
60, respectively, with
the transcription initiation site taken as +1 (Fig.
3B). pIC2 retained only the
30 to +3
sequences of the putative SGP of 1.0-kb sgRNA (Fig. 3B).
pIC8-C/C, pIC9-G/G, pIC10-G/C, and pIC14-CCC are the stem-loop 2 (SL2)
stem region mutants of pICN18 obtained by replacing the GGG (at
positions
9 through 11)/CCC(
24 through
26) with GGC/CCC, GGG/GCC,
GGC/GCC and CCC/CCC, respectively (Fig.
4A). pBSIC7 is the SL2 loop region mutant
of pICN18 in which the conserved octanucleotide motif
3'-CAATTCAA-5' is changed to 3'-CCTAAATA-5' in
the minus strand (Fig. 4A). The DNA fragments corresponding to the SGP
mutants were amplified from pICN18 by double PCR as described for
pICN18, except that the corresponding primers were as follows: BSIC24
(5'-GTGTTTAATTTACAAACACGTCGTGGTAAGCGTC) was used for pIC3;
BSIC4 (5'-AAACTTAACAAACCCTAGCCGTCGTGGTAAGCGTC) was used for
pIC4; BSIC5 (5'-GGTAGCAGTTGCCTCTCGTCGTGGTAAGCGTC) was used
for pIC5; BSIC7 (5'-TAATTTACAAACAAGGGAAATAAATCCAAACCTAGCTGGAG) was used for pIC7; BSIC8
(5'-GTTTAATTTACAAACAAGGCAAACTTAACAAACCCTAG) was used for
pIC8-C/C; BSIC9 (5'-CAAGGGAAACTTAACAAAGCCTAGCTGGAGGTAG) was
used for pIC9-G/G; and BSIC14
(5'-GTGTTTAATTTACAAACAACCCAAACTTAACAAACCCTAG) was used for
pIC14-CCC. To generate pIC2 and pIC10-G/C, the pIC4 and pIC9-G/G
plasmids were used as templates, respectively. Their corresponding
primers were BSIC18 (5'-CTCCTCCGAACCATGTTTACAAACAAGGGAAAC) for pIC2 and BSIC10
(5'-GTTTAATTTACAAACAAGGCAAACTTAACAAAGCCTAG) for pIC10-G/C.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 3.
The secondary structure of the minus-strand SGP sequence
of the 1.0-kb sgRNA of BaMV-V (A), schematic diagrams of
satBaMV mutants (B), and their transcriptional-activity
assays (C through E). (A) The secondary structure was predicted by the
STAR computer program. The stem-loop structures, designated SL1
( G = 1.3 kcal/mol), SL2 ( G = 2.5 kcal/mol), SL3 ( G = 8.3 kcal/mol), and SL4
( G = 4.8 kcal/mol) and 18 nt of the N-terminal CP
gene of BaMV (designated N18) are shown. The asterisk denotes the
transcription initiation site, and the conserved octanucleotide motif
is in bold. (B) For SatBaMV mutants, the numbers of nucleotides for
each structure are given in parentheses. (C through E) For Northern (C
and D) and quantitative (E) analyses of the sgRNAs
transcribed by the mutants, total RNAs were extracted from 5 × 104 protoplasts of N. benthamiana at 24 h.p.i. (C) or 5-mg leaves of C. quinoa at 6 d.p.i. (D).
These RNAs were coinoculated with BaMV-L RNA and the pICN18 (lane 1),
pIC5 (lane 2), pIC4 (lane 3), pIC3 (lane 4), or pIC2 (lane 5)
transcript and were subjected to Northern analyses with a
satBaMV-specific riboprobe. The asterisk indicates the
position of the 0.7-kb sgRNA transcribed from
satBaMV cassettes. (E) For quantitative analyses of the
transcription ratio of satBaMV mutants in protoplasts of
N. benthamiana or in leaves of C. quinoa in three
independent experiments, the transcription ratio (a) and the relative
transcription ratio over that of pICN18 (b) were determined as
described in the legend to Fig. 2.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Predicted secondary structure of SL2 and the schematic
diagrams of satBaMV mutants (A) and their transcription
activities (B and C). (A) Shown are the predicted secondary structure
of SL2 and the schematic diagrams of mutants introduced in SL2. The
boxed and shaded letters represent the mutated nucleotides. The bold
letters indicate the conserved nucleotide motif. (B) Northern blot
analysis of total RNAs extracted from 5 × 104
protoplasts of N. benthamiana coinoculated with BaMV-L RNA
and pICN18 (lane 1), pIC8-C/C (lane 2), pIC9-G/G (lane 3), pIC10-G/C
(lane 4), pIC14-CCC (lane 5), and pIC7 (lane 6) transcripts at 24 h.p.i. with a satBaMV-specific riboprobe. The asterisk
indicates the position of the 0.7-kb sgRNA transcribed from
the satBaMV cassette. (C) The relative ratio was the
transcription ratio of a mutant over that of pICN18 in protoplasts of
N. benthamiana (a) or in leaves of C. quinoa (b).
These data were collected three times from protoplasts and two times
from plants.
|
|
pICORF2 and pICPVX were constructed by insertion of the putative SGPs
of the ORF2 gene of the BaMV-V or of the CP gene of PVX just before the
start codon of the P20 gene of pBSF4 (Fig. 5A). The DNA fragments corresponding to
the putative SGPs of the ORF2 gene of BaMV-V were amplified from pBa19
(40) using primers BSICORF2-1
(5'-TATCCACGACGTTGGCTTTCCATTACCAAAC) and BSICORF2-2 (5'-CGCCCATCGTCCTGGTTAGTTATTAAACTAA) or for the CP gene of
the PVX-Taiwan strain amplified from pPVX-T (Y. H. Hsu,
unpublished data) using primers BSICPVX-1
(5'-TATCCACGACGTTGGAATCAATCACAGTG) and BSICPVX-2
(5'-CGCCCATCGTCCTGGCTTTCGAGTATCAATG) by PCR. After digestion
with BstXI, the corresponding fragments were inserted into
the BstXI site of pBSF4 to generate pICORF2 or pICPVX.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 5.
SgRNA transcription assays of pICORF2 and pICPVX. (A)
Schematic diagrams of ICORF2 and ICPVX. Hatched regions represent the
ORF regions of BaMV, PVX, and satBaMV. The black and dotted
regions represent the SGP of the 2.0-kb sgRNA of BaMV and of
the 0.9-kb sgRNA of PVX, respectively. (B and C) Northern
analyses of total RNAs extracted from 5 × 104
protoplasts of N. benthamiana at 24 h.p.i. (lanes 1 through 3) or 5-mg leaves of C. quinoa at 6 d.p.i.
(lanes 4 through 6) coinoculated with BaMV-L RNA and pICORF2 (lanes 1 and 4), pICF4 (lanes 2 and 5), and pICPVX (lanes 3 and 6) transcripts
with a BaMV (B) or satBaMV (C) riboprobe. The asterisk
indicates the position of the 0.7-kb sgRNA transcribed from
satBaMV cassettes.
|
|
For all the constructs, the DNA sequences flanking the inserted or
replaced fragment were confirmed by sequencing.
Virus purification and viral-RNA extraction.
BaMV-L is an
isolate derived from BaMV-V and is free of satellite RNA (22,
23). Purification of BaMV virions from infected Chenopodium
quinoa and extraction of viral RNA were previously described
(17, 19). The purified RNAs were dissolved in sterile distilled water, quantitated by UV absorption, and stored at
150°C until use.
Protoplast and plant inoculation, RNA extraction, and Northern
blot analyses.
Preparation and RNA inoculation of protoplasts from
Nicotiana benthamiana or barley (Hordeum vulgare
L. "Laker") were as previously described (18). For each
inoculation, protoplasts of 2 × 105 cells were
inoculated with 1.0 µg of BaMV-L RNA only or coinoculated with 1.0 µg of satBaMV transcripts by the polyethylene glycol method
(18). Coinoculation of C. quinoa plants with
BaMV-L and satBaMV mutants was also as previously described
(22, 23) except that each inoculum contained a mixture of
0.1 µg of BaMV-L RNA and 0.1 µg of satBaMV transcripts
per leaf. Total RNA extraction, glyoxylation, and Northern blot
analyses were carried out as previously described (23).
Extraction of mRNA from total RNAs was according to the instructions of
the Straight A's mRNA isolation system (Novagen). For Northern blot
analyses, genomic and satBaMV RNAs were detected by
32P-labeled probes specific for the 3' end of
genomic RNA (20) and satBaMV RNA
(23), respectively. The hybridized membranes were exposed by
PhosphorImager (Molecular Dynamics) and quantified by ImageQuant,
version 3.3 (Molecular Dynamics).
Primer extension and DNA sequencing.
Primer extensions were
performed using total RNAs extracted from leaves of C. quinoa or using mRNA extracted from infected protoplasts of
N. benthamiana as templates. Total RNA or mRNA was annealed
with primer B56 (sequences complementary to nt 5631 through 5647, the
CP region of the BaMV-V isolate) (40) or primer BS9
(sequences complementary to nt 338 through 352, the P20-coding region
of satBaMV) (22). For all experiments, 500 pM
primer was mixed with 5-µl RNA samples extracted from 5 mg of
C. quinoa leaves or from 4 × 105
protoplasts. Primer extensions were carried out as previously described
(15). Extension products were analyzed on 6%
polyacrylamide-7 M urea gel containing 0.5× TBE (133 mM Tris-HCl [pH
8.3], 44 mM boric acid, and 2.5 mM EDTA) and exposed by
PhosphorImager. The DNA sequences were determined by the chain
termination procedure, using Sequenase, version 2.0 (Amersham).
 |
RESULTS |
Transcription of sgRNA via satBaMV
cassette.
To explore the possibility of sgRNA being
transcribed from the satBaMV cassette, a full-length
satBaMV-derived cDNA clone, pICF4, was constructed, in which
the putative SGP of the BaMV CP gene with 107 nt was inserted just
before the start codon of the P20 gene of satBaMV (Fig. 1A).
This putative SGP contains the whole intercistronic region of 41 nt
between ORF4 and ORF5 of BaMV-V (40) and its upstream
sequences extended downstream of the first AUG, thus avoiding the
possible interference of ORFs from the expression of the P20 gene in
pICF4 satBaMV. The 5' end of the putative SGP lies within the
C-terminal coding region of ORF4 and contains multiple stop codons. The
activity of the SGP was analyzed by coinoculation of barley protoplasts
with BaMV-V genomic RNA (designated BaMV-L RNA and free of
satBaMV) and pICF4 transcripts. Protoplasts inoculated with
BaMV-L RNA alone or coinoculated with wild-type pBSF4 transcripts were
used as controls. Protoplast samples were harvested every 8 h
postinoculation (h.p.i.), and total RNA was extracted. Northern blot
analyses with the BaMV-specific probe revealed that all of the
genomic RNAs accumulated to similar levels regardless of
whether the inocula contained the satBaMV transcripts,
indicating that the presence of the satBaMV transcripts did
not significantly affect helper virus replication (Fig. 1B). Genomic
RNAs were first detectable at 8 h.p.i., quickly increased from
8 to 16 h.p.i., and further continued to increase to 24 h.p.i. This pattern of increasing accumulation was also observed
for pBSF4 and pICF4 by the satBaMV-specific probe (Fig. 1C).
An additional RNA about 0.7 kb in length, presumably transcribed from
the functional SGP, was detectable at 8 h.p.i. but increased
greatly by 24 h.p.i. in pICF4 coinoculated protoplasts (Fig. 1C,
lanes 7 through 9). No such RNA was detectable in the protoplasts
coinoculated with pBSF4 transcripts (Fig. 1C, lanes 4 through 6). It
should be noted that the level of satBaMV decreased when
sgRNA was expressed (Fig. 1C, lanes 7 through 9). When
the transcription ratio was determined by the quantity of 0.7-kb
sgRNA transcribed over its satBaMV RNA, the
transcription ratio of ICF4 was only 4% at 8 h.p.i., increased to
40% at 16 h.p.i., and reached a level of 70% at 24 h.p.i.
(Fig. 1C).
When the same experiment was performed with C. quinoa plants
and the leaves were harvested every 3 days postinoculation (d.p.i.), results similar to those with protoplasts were obtained (Fig. 6A and B). The 0.7-kb RNA detected in
protoplasts was also detectable in C. quinoa leaves when
coinoculated with pICF4 transcripts. However, the transcription ratios
were higher than those in protoplasts, reaching levels of 90, 110, and
80% at 3, 6, and 9 d.p.i., respectively (Fig. 6B, lanes 3, 6, and
9). To determine whether the 0.7-kb RNA was encapsidated, viral RNAs
were extracted from the purified virions of coinoculated leaves of
C. quinoa. As previously shown (15), in addition
to genomic RNA, BaMV-L contained the encapsidated sgRNAs which were detectable by ethidium bromide (EtBr)
staining of the agarose gel (Fig. 6C, lane 1). pBSF4 and pICF4
were also visualized in virion RNA preparations stained with EtBr;
however, the 0.7-kb sgRNA was only barely visible (Fig. 6C,
lanes 2 and 3). The encapsidation of pICF4 and 0.7-kb sgRNA
was further confirmed by Northern blot analysis with the
satBaMV-specific probe (Fig. 6D). It is interesting to note
that this sgRNA was rather poorly encapsidated compared to
satBaMV.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 6.
Time course accumulation of BaMV-V genomic RNA,
satBaMV, and its derived sgRNA in infected leaves
of C. quinoa. (A and B) Total RNAs extracted from 5-mg
leaves inoculated with BaMV-L RNA only (lanes 1, 4, and 7) or together
with pBSF4 (lanes 2, 5, and 8) or pICF4 (lanes 3, 6, and 9) transcripts
at 3 d.p.i. (lanes 1 through 3), 6 d.p.i. (lanes 4 through
6), and 9 d.p.i. (lanes 7 through 9) were subjected to Northern
blotting with a BaMV-specific (20) (A) or
satBaMV-specific (23) (B) riboprobe. (C and D) For
staining (C) and Northern blot analysis (D) of encapsidated
satBaMV and its sgRNA, virion RNAs were purified
from 0.2 g of C. quinoa leaves and inoculated with
BaMV-L RNA only (lane 1) or with pBSF4 (lane 2), and pICF4 (lane 3)
transcripts were separated by electrophoresis in a 1% agarose gel and
stained with EtBr (C) or analyzed by Northern hybridization with the
satBaMV probe (D). The asterisks indicate the position of the
0.7-kb sgRNA transcribed from pICF4.
|
|
Identification of the 5' terminus of the 0.7-kb
sgRNA.
Presumably, if the 0.7-kb RNA is synthesized via
the SGP of 1.0-kb sgRNA in the satBaMV cassette,
the 5' terminus of 0.7-kb RNA should be identical to that of the 1.0-kb
sgRNA, which is located 12 nt downstream from the
octanucleotide motif (15; also Fig.
7A, lane 1). To map the 5' terminus of
the 0.7-kb RNA, primer extension was performed by using total RNAs
extracted from C. quinoa leaves coinoculated with pICF4
transcripts as templates. The primer BS9 (complementary to the P20 gene
of satBaMV [Fig. 1A]) extended a predominant and a minor
product (Fig. 7B, lane 1). The former was at a position identical to
that of the 1.0-kb sgRNA, indicating that the 0.7-kb RNA was
indeed transcribed from the SGP in the satBaMV cassette. The
minor product, with one nucleotide difference from the predominant one,
may have arisen from insertion of a residue complementary to the cap
structure as suggested by White and Mackie (38).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 7.
Identification of the 5' termini of sgRNAs by
primer extension. Total RNAs (lanes 1) extracted from C. quinoa leaves infected with BaMV-L RNA only (A) or together with
pICF4 (B) were hybridized with primer B56 (complementary to the CP gene
of BaMV) (A) or primer BS9 (complementary to the P20 gene of
satBaMV) (B) for primer extension. The products were
displayed on a 6% polyacrylamide-7 M urea sequencing gel. Lanes A, C,
G, and T contained the products of a dideoxynucleotide-sequencing
reaction performed on cDNA clone pBa19 of BaMV-V genomic RNA
(40) with primer B56 (A) and on pICF4 with primer BS9 (B).
Arrows indicate the position of the transcription initiation site.
Letters represent the sequences between the octanucleotide motif (in
italics) and the transcription initiation site.
|
|
Enhancement of sgRNA transcription by extension of the
SGP to the CP coding region.
To test whether the extension of the
SGP to the coding region of the CP gene can enhance sgRNA
transcription, plasmids containing various extensions of SGP toward the
CP-coding region were constructed. The first 9, 18, 36, and 54 nt of
the CP gene were added downstream of the SGP sequences of pICF4 to make
plasmids pICN9, pICN18, pICN36, and pICN54, respectively (Fig. 2A). The
transcriptional activity of pICF4 and its variants was assayed in
coinoculated protoplasts of N. benthamiana at 24 h.p.i
(Fig. 2B). In three independent experiments, the transcription ratios
of pICN9, pICN18, pICN36, and pICN54 were enhanced to levels that were
118, 127, 230, and 200%, respectively, over that of pICF4 (Fig. 2C).
Similar results for pICN18 were also obtained with inoculated C. quinoa leaves (data not shown).
Deletion analyses of the SGP of 1.0-kb sgRNA.
As
shown in Fig. 3A, the secondary structure of the minus-strand SGP of
1.0-kb sgRNA was predicted by the STAR computer program. This
structure contained four stem-loops (nt
91 through
60,
59 through
31,
30 through
8, and
7 through +16, designated SL4, SL3,
SL2, and SL1, respectively, when the transcription initiation site was taken as +1). SL1 contained the transcription initiation site,
and SL2 contained the conserved octanucleotides among the potexviruses.
To dissect the functional domain of SGP, four deletion mutants were
generated in this region by site-directed mutagenesis (Fig. 3B). pIC5,
pIC4, and pIC3 are mutants containing progressive SGP deletions from
the 5' end of pICN18, in which SL4 was deleted in pIC5; both SL4 and
SL3 were deleted in pIC4, while SL4, SL3, and SL2 were deleted in pIC3.
The pIC2 contained SL2 as well as the truncated SL1 (nt
8 through
+3). The overall structures of these mutated SGP regions were predicted
not to change, by the STAR program.
When assayed in protoplasts of N. benthamiana at 24 h.p.i., Northern blot analyses revealed that the transcription ratios of pICN18, pIC5, and pIC4, were 66, 38, and 19%, respectively, whereas
the transcription of pIC3 and pIC2 had dropped to 8 and 7%,
respectively (Fig. 3C and 3E). The relative transcription levels of
pIC5 and pIC4 were 58 and 30% that of pICN18, respectively, while the
transcription activities of pIC3 and pIC2 were significantly lower,
with levels only 12 and 11% that of pICN18, respectively (Fig. 3E).
Although similar relative transcription levels were also obtained in
the coinoculated leaves of C. quinoa at 6 d.p.i., plasmids ICN18, IC5, and IC4 resulted in transcription ratios that were
substantially higher in C. quinoa leaves than in N. benthamiana protoplasts in three independent experiments (Fig. 3D and E). For instance, the transcription ratios in C. quinoa leaves increased to 195% for pICN18, 128% for pIC5, and
68% for pIC4. In summary, the SL1 and SL2 of SGP maintained in pIC4
supported about one-third (30 to 34%) of the activity of pICN18 for
sgRNA transcription, and one additional stem-loop in pIC5
supported about two-thirds (58 to 65%) of the activity in vivo.
Mutants pIC3, with SL1 only, and pIC2, with SL2 and truncated SL1, both greatly reduced their transcription abilities. These data suggest that
SL2 and SL1 are required for functional SGP and that SL3 and SL4 can
enhance the sgRNA transcription level.
Mutational analyses of SL2.
From the results described above,
the stem structure SL2 is essential for sgRNA transcription.
Four mutants were constructed in the stem of SL2 (Fig. 4A). pIC8-C/C,
pIC9-G/G, and pIC14-CCC disrupted the stem structure in the SL2 by
replacing the GGG (nt
9 through
11)/CCC (nt
24 through
26) with GGC/CCC, GGG/GCC, and CCC/CCC, respectively. pIC10-G/C
restored potential base pairing, which was disrupted in pIC8-C/C and
pIC9-G/G by replacing the GGG/CCC with GGC/GCC. The predicted
structures for the site-directed mutants pIC8, pIC9, and pIC14 revealed
no existence of SL2 or small SL2 structures but no other stem-loop
structures in SGP were altered. However, the SL2 structures were indeed
restored in compensatory mutant pIC10.
The transcription ratios of these mutants were analyzed in inoculated
protoplasts of N. benthamiana at 24 h.p.i. In three independent experiments, the relative transcription ratios of the
base-pairing-disrupted mutants pIC8-C/C, pIC9-G/G, and pIC14-CCC dropped to 27, 25, and 3%, respectively, when compared to the transcription ratio of pICN18. However, the compensatory mutant pIC10-G/C increased to 85% (Fig. 4B and 4C). Similar relative transcription levels compared to pICN18 were also obtained in the
coinoculated leaves of C. quinoa at 7 d.p.i. (Fig. 4C).
Since the loop structure of SL2 contains the conserved octanucleotides
which are known to be important for potexviruses replication (14,
39), a plasmid, pIC7, derived from pICN18 was constructed in
which the octanucleotide motif 3'-CAATTCAA-5' in the minus strand was changed into 3'-CCTAAATA-5' (Fig. 4A). A
transcriptional-activity assay of pIC7 revealed that it exhibited only
9% activity compared with pICN18, both in coinfected protoplasts of
N. benthamiana at 24 h.p.i. (Fig. 4B and 4C) and leaves
of C. quinoa at 7 d.p.i. (Fig. 4C). In summary, the SL2
stem-disrupted mutants or octanucleotide mutant significantly decreased
the SGP activity whereas the compensatory mutant restored the SGP
activity. These data indicate that the conserved octanucleotides in the
loop region and the stem structure of SL2 play an essential role in the
functional SGP.
Transcription activity of SGP of 2.0-kb sgRNA.
In
general, the two major 2.0- and 1.0-kb sgRNAs of BaMV were
easily detected in the inoculated protoplasts, but the 2.0-kb RNA
occurred in much lower levels in the infected plants (15) (see also Fig. 5B). To assay the transcription activity of the putative
SGP of the BaMV 2.0-kb sgRNA, plasmid pICORF2 was constructed in which the satBaMV cassette contained the 130 nt upstream
of the start codon of the ORF2 gene (Fig. 5A). Inoculation of pICORF2 also resulted in the generation of a 0.7-kb sgRNA, with a
transcriptional level 20% that of pICF4, when protoplasts were
coinoculated with BaMV-L RNA (Fig. 5C, lane 1). However, this 0.7-kb
RNA was only barely detectable in coinoculated leaves of C. quinoa at 6 d.p.i. (Fig. 5C, lane 4) and also at 1, 2, or
3 d.p.i. (data not shown) by Northern blot analysis. This is
consistent with our previous data that the 2.0-kb sgRNA
accumulated substantially in protoplasts but much less in infected
leaves (15) (Fig. 5B, lanes 1 and 4).
To analyze the transcription initiation site of the 0.7-kb RNA
generated by pICORF2, primer extension was performed using total RNA
extracted from infected leaves as a template. The primer BS9
extended a product terminating 12 nt downstream of the octanucleotide motif of SGP of the ORF2 gene (Fig. 8A,
lane 2). The position of the product corresponded to the 5'
terminus of the BaMV 2.0-kb sgRNA as determined by Lee et al.
(15), even though its quantity was only 5% of that of
pICF4 (data not shown). This may explain the low accumulation of
sgRNA transcribed by pICORF2 in leaves. Primer extension
analysis of mRNA extracted from coinoculated N. benthamiana
protoplasts showed similar results (Fig. 8A, lane 1). We concluded that
the sgRNA was indeed transcribed by the SGP of the BaMV
2.0-kb sgRNA but was differentially expressed compared with
the 1.0-kb sgRNA.

View larger version (113K):
[in this window]
[in a new window]
|
FIG. 8.
Primer extension analyses of the sgRNAs
transcribed by pICORF2 (A) and pICPVX (B). Messenger RNAs extracted
from 2 × 105 protoplasts of N. benthamiana at 24 h.p.i. (lane 1) or total RNAs extracted
from 5-mg leaves of C. quinoa at 6 d.p.i. (lane 2)
coinoculated with pICORF2 (A) or pICPVX (B) transcripts and BaMV-L RNA
were hybridized with primer BS9 for primer extension. The products were
displayed on a 6% polyacrylamide-7 M urea sequencing gel. Lanes A, C,
G, and T contained the products of a dideoxynucleotide sequencing
reaction performed on cDNA clone pICORF2 (A) or pICPVX (B) with primer
BS9. Arrows indicate the positions of the transcription initiation
sites, and letters represent the sequences between the octanucleotide
motif (in italics) and the transcription initiation sites.
|
|
Transcription of sgRNA by a heterologous SGP in the
satBaMV cassette.
The specificity and transcription
efficiency of the sgRNA directed by a heterologous SGP were
analyzed using the satBaMV cassette. Plasmid pICPVX was
generated to carry the putative SGP of the 0.9-kb sgRNA of
PVX. pICPVX gave rise to a 0.7-kb sgRNA at a transcription level of 20% of that in protoplasts coinoculated with pICF4 at 24 h.p.i. (Fig. 5C, lane 3). This 0.7-kb sgRNA was detected at a
reduced level in leaves at 6 d.p.i. (Fig. 5C, lane 6). Analyses of
primer extension indicated that the 5' terminus of the 0.7-kb RNA
mapped 13 nt downstream of the octanucleotide motif (Fig. 8B,
lanes 1 and 2), a position which corresponds to that of the PVX 0.9-kb
sgRNA as determined by Kim and Hemenway (12).
Evidently, the heterologous SGP can be utilized in the
satBaMV cassette with a reduced efficiency.
 |
DISCUSSION |
SatBaMV cassette as an assay system to characterize the SGP
in vivo.
The mutation of viral RNA in the SGP region has
added greatly to our understanding of the mechanism of sgRNA
transcription. These mutants may affect the accumulation of gene
products of sgRNA and thus interfere with viral replication.
For instance, the SGP of AMV was characterized by the duplicated SGPs
(34), and the position of duplicated SGPs may affect
sgRNA transcription (5, 6). Moreover, the SGPs of
coronavirus (35) and Sindbis virus (16) were
characterized by insertion of SGP into the defective interfering (DI)
RNA. The viability and stability of DI RNAs are dependent on the site
of insertion or on the developmental stage of the DI RNAs
(28). In this study, we used the satBaMV cassette to characterize the SGP in vivo. The advantages of using the
satBaMV system are that (i) the satBaMV can
replicate autonomously in the presence of a helper virus, (ii) the
satBaMV does not interfere with the replication of the helper
virus, and (iii) the satBaMV accumulates at a higher level
than the helper virus in the infected cells (15). To the
best of our knowledge, this is the first report that satellite RNA can
provide an assay system to characterize SGPs in vivo.
Although sgRNA could be generated via the satBaMV
cassette in the coinoculated protoplasts of barley or N. benthamiana and leaves of C. quinoa, the transcription
ratio of the satBaMV cassette varied. The SGP of BaMV 1.0-kb
sgRNA showed more activity in infected leaves than in
infected protoplasts (Fig. 3D and E), whereas the SGP of BaMV 2.0-kb
sgRNA had an adverse effect (Fig. 5C, lanes 1 and 4). Of
special note in our study, SGP mutants exhibited similar
relative-transcription levels to those of the wild-type pICN18 in
coinoculated protoplasts and leaves (Fig. 3E). However, transcripts
derived from infectious cDNA clones containing the modified SGP region
upstream of the CP gene of PVX showed poor replication in infected
plants, even though considerable accumulation of those mutants was
observed in the infected protoplasts (12, 13). This may
prove the additional advantage of using the satBaMV cassette
to characterize the SGP.
Mapping the SGP of 1.0-kb sgRNA.
The secondary
structure of the minus-strand SGP of 1.0-kb sgRNA was
predicted by the computer STAR program to comprise four consecutive
stem-loops (Fig. 3A). The existence of the predicted SL1, SL2, SL3, and
SL4 was supported by enzymatic probing with RNase T1, RNase
T2, RNase V1, and RNase A (N. S. Lin and
C. P. Cheng, unpublished data). The results from satBaMV
cassettes carrying the various SGP sequences showed that the sequences
between nt
30 and +16 contained two stable RNA stem-loop structures,
SL1 and SL2, required for basal SGP activity (Fig. 3A). The core
promoter of BaMV 1.0-kb sgRNA contains 46 nt. Extension of
the SGP to the 5' border nt
59 and
91 enhanced the SGP
activity two- and threefold, respectively. These results are consistent
with those found in other alpha-like superfamily viruses which
contain some modulated enhancers to stimulate and/or modulate gene
expression in addition to the core promoter-like sequences
(24). Similarly, extension of the SGP into the N-terminal 36 nt of the CP gene enhanced SGP activity twofold. Such a downstream
enhancer extended into the ORF was known to sgRNAs coding for
CP of a number of RNA viruses (2, 10, 29). The upstream and
downstream enhancers of BaMV 1.0-kb sgRNA were located at the
coding region of ORF4 and the CP gene, respectively. It is an
intriguing question how the genetic information at these locations can
be used as a coding region for protein and as a promoter region for
sgRNA synthesis.
When the sequences of SL2 were further analyzed by site-directed
mutagenesis, the results showed that the stem-region-disrupted mutants
abolished the SGP activity, whereas the compensatory mutant restored
the SGP activity, indicating that the stem structure was important for
the SGP-directed sgRNA transcription in vivo. However, the
sgRNA transcription of PVX required complementarity between
the conserved octanucleotide motif and the 3'-terminal sequences of
the minus-strand genomic RNA (13). This
long-distance RNA-RNA interaction between the octanucleotide motif and
the terminal sequences affected genomic RNA accumulation and
the sgRNA transcription (12, 13). Growing
evidence also shows that different functional long-distance
interactions occur in a variety of plus-strand RNA viruses for the
regulation of sgRNA synthesis (13, 41). In the pICF4 satBaMV, the octanucleotide motif of SGP may
interact with the 3' end of minus-strand BaMV genomic RNA in
trans (complementarity of 8 nt in the first 11 nt) or with
the 3' end of minus-strand satBaMV RNA in cis
(complementarity of 10 nt in the first 11 nt), which may facilitate the
sgRNA synthesis via the RNA-RNA interaction. However,
octanucleotide motif mutant pIC7, whose complementarity with the
terminus of satBaMV was reduced to 5 bp, resulted in barely
detectable sgRNA accumulation (Fig. 4).
The activity of SGP of 2.0-kb sgRNA.
Analyses of the
SGP of 2.0-kb sgRNA with the satBaMV cassette
showed that its activity is less efficient than that of the SGP of
1.0-kb sgRNA. The positional effect in the genomic
RNA can be excluded since we inserted both SGPs into the same position. pICORF2 exhibited significant activity for sgRNA
transcription in coinoculated protoplasts (Fig. 5C, lane 1) whereas
much less activity was detected in leaves of C. quinoa (Fig.
5C, lane 4). A consistently detected level was found in 2.0-kb
sgRNA in the BaMV-infected protoplasts and leaves of C. quinoa (15) (Fig. 5B, lanes 1 and 4). The mechanism for
the down-regulation of the 2.0-kb sgRNA in infected leaves
remains to be further investigated although the secondary structure of
the SGP of the 2.0-kb sgRNA predicted by the STAR program
revealed a similar structure to that of 1.0-kb SGP. The SL1 and SL2
structures displayed on the 1.0-kb SGP are present in 2.0-kb SGP. The
conserved octanucleotide motif and transcription site of the 2.0-kb SGP
are also located at the loop region of SL2 and SL1, respectively.
The activity of heterologous SGP in satBaMV
cassette.
The pICPVX could direct sgRNA transcription by
the SGP of PVX 0.9-kb sgRNA in this satBaMV
cassette system. This transcription activity was low but significantly
above the background (Fig. 5C). The SGPs of BaMV and PVX share 45%
identity in sequence at the 3' terminal 40 nt of SGPs. In pICPVX, there
also exists a complementarity between the octanucleotide and the
3' end of minus-strand satBaMV genomic RNA in
cis (complementarity, 10 nt in the first 11 nt);
however, the stable stem-loop structures were absent in the SGP of
0.9-kb sgRNA of PVX as predicted by the STAR program. In
members of alphaviruses of plant and animal origin, the required nucleotides within the sgRNA promoter for sgRNA
synthesis are highly conserved (24, 26, 30). The RdRp of
alphaviruses, such as BMV (30) and Sindbis virus
(9), can utilize the heterologous SGPs of other alphaviruses
for sgRNA synthesis. Our results also favor the conserved
mechanism of the recognition of RdRp for the synthesis of
sgRNAs of alphaviruses.
 |
ACKNOWLEDGMENTS |
We thank Michael M. C. Lai for critical reading of the
manuscript and Hsin-Chuan Chen for technical assistance.
This research was supported in part by National Science Council Project
grants NSC 86-2311-B-001-034-B13 and NSC 87-2311-B-001-007-B13 and by
the Academia Sinica, Taipei, Taiwan, Republic of China.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Botany, Academia Sinica, Taipei, Taiwan 115, Republic of China. Phone: 886-2-2789-9590, ext. 124. Fax: 886-2-2782-7954. E-mail:
nslin{at}sinica.edu.tw.
 |
REFERENCES |
| 1.
|
Adkins, S.,
R. W. Siegel,
J. H. Sun, and C. C. Kao.
1997.
Minimal templates directing accurate initiation subgenomic RNA synthesis in vitro by the brome mosaic virus RNA-dependent RNA polymerase.
RNA
3:634-647[Abstract].
|
| 2.
|
Balmori, E.,
D. Gilmer,
K. Richards,
H. Guilley, and G. Jonard.
1993.
Mapping the promoter for subgenomic RNA synthesis on beet necrotic yellow vein virus RNA 3.
Biochimie
75:517-521[Medline].
|
| 3.
|
Beck, D. L.,
D. M. V. Guilford,
M. T. Andersen, and R. L. S. Forster.
1991.
Triple gene block proteins of white clover mosaic potexvirus are required for transport.
Virology
183:695-702[CrossRef][Medline].
|
| 4.
|
Chang, R. C.,
J. C. Chen, and J. F. Shaw.
1996.
Facile purification of highly active recombinant Staphylococcus hyicus lipase fragment and characterization of a putative Lid region.
Biochem. Biophy. Res. Commun.
228:774-779[CrossRef][Medline].
|
| 5.
|
Chapman, S.,
T. A. Kavanagh, and D. C. Baulcombe.
1992.
Potato virus X as a vector for gene expression in plants.
Plant J.
2:549-557[Medline].
|
| 6.
|
Culver, J. N.,
K. Lehto,
S. M. Close,
M. E. Hilf, and W. O. Dawson.
1993.
Genomic position affects the expression of tobacco mosaic virus movement and coat protein genes.
Proc. Natl. Acad. Sci. USA
90:2055-2059[Abstract/Free Full Text].
|
| 7.
|
Dolja, V. V.,
D. P. Grama,
S. Y. Morozov, and J. G. Atabekov.
1987.
Potato virus X-related single- and double-stranded RNAs.
FEBS Lett.
214:308-312[CrossRef].
|
| 8.
|
French, R., and P. Ahlquist.
1988.
Characterization and engineering of sequences controlling in vivo synthesis of brome mosaic virus subgenomic RNA.
J. Virol.
62:2411-2420[Abstract/Free Full Text].
|
| 9.
|
Hertz, J. M., and H. V. Huang.
1992.
Utilization of heterologous alphavirus junction sequences as promoters by Sindbis virus.
J. Virol.
66:857-864[Abstract/Free Full Text].
|
| 10.
|
Johnston, J. C., and D. M. Rochon.
1995.
Deletion analysis of the promoter for the cucumber mosaic necrosis virus 0.9-kb subgenomic RNA.
Virology
214:100-109[CrossRef][Medline].
|
| 11.
|
Kim, K. H., and C. Hemenway.
1996.
The 5' nontranslated region of potato virus X RNA affects both genomic and subgenomic RNA synthesis.
J. Virol.
70:5533-5540[Abstract/Free Full Text].
|
| 12.
|
Kim, K. H., and C. Hemenway.
1997.
Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.
Virology
232:187-197[CrossRef][Medline].
|
| 13.
|
Kim, K. H., and C. L. Hemenway.
1999.
Long-distance RNA-RNA interactions and conserved sequence elements affect potato virus X plus-strand RNA accumulation.
RNA
5:636-645[Abstract].
|
| 14.
|
Lai, M. M., and D. Cavanagh.
1997.
The molecular biology of coronaviruses.
Adv. Virus Res.
38:1-100.
|
| 15.
|
Lee, Y. S.,
B. Y. Lin,
Y. H. Hsu,
B. Y. Chang, and N. S. Lin.
1998.
Subgenomic RNAs of bamboo mosaic potexvirus-V isolate are packaged into virions.
J. Gen. Virol.
79:1825-1832[Abstract].
|
| 16.
|
Levis, R.,
S. Schlesinger, and H. V. Huang.
1990.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
J. Virol.
64:1726-1733[Abstract/Free Full Text].
|
| 17.
|
Lin, N. S., and C. C. Chen.
1991.
Association of bamboo mosaic virus (BaMV) and BaMV-specific electron-dense crystalline bodies with chloroplasts.
Phytopathology
81:1551-1555.
|
| 18.
|
Lin, N. S.,
T. Y. Huang, and Y. H. Hsu.
1992.
Infection of barley protoplasts with bamboo mosaic virus RNA.
Bot. Bull. Acad. Sin.
33:271-275.
|
| 19.
|
Lin, N. S.,
F. Z. Lin,
T. Y. Huang, and Y. H. Hsu.
1992.
Genome properties of bamboo mosaic virus.
Phytopathology
82:731-734.
|
| 20.
|
Lin, N. S.,
Y. J. Chai,
T. Y. Huang,
T. Y. Chang, and Y. H. Hsu.
1993.
Incidence of bamboo mosaic potexvirus in Taiwan.
Plant Dis.
77:448-450.
|
| 21.
|
Lin, N. S.,
B. Y. Lin,
W. W. Lo,
C. C. Hu,
T. Y. Chow, and Y. H. Hsu.
1994.
Nucleotide sequence of the genomic RNA of bamboo mosaic potexvirus.
J. Gen. Virol.
75:2513-2518[Abstract/Free Full Text].
|
| 22.
|
Lin, N. S., and Y. H. Hsu.
1994.
A satellite RNA associated with bamboo mosaic potexvirus.
Virology
202:707-714[CrossRef][Medline].
|
| 23.
|
Lin, N. S.,
Y. S. Lee,
B. Y. Lin,
C. W. Lee, and Y. H. Hsu.
1996.
The open reading frame of bamboo mosaic potexvirus satellite RNA is not essential for its replication and can be replaced with a bacterial gene.
Proc. Natl. Acad. Sci. USA
93:3138-3142[Abstract/Free Full Text].
|
| 24.
|
Maia, I. G.,
K. Seron,
A.-L. Haenni, and F. Bernardi.
1996.
Gene expression from viral RNA genomes.
Plant Mol. Biol.
32:367-391[CrossRef][Medline].
|
| 25.
|
Marsh, L. E.,
T. W. Dreher, and T. C. Hall.
1988.
Mutational analysis of the core and modulator sequences of the BMV RNA3 subgenomic promoter.
Nucleic Acids Res.
16:981-995[Abstract/Free Full Text].
|
| 26.
|
Ou, J. H.,
C. M. Rice,
L. Dalgarno,
E. G. Strauss, and J. H. Strauss.
1982.
Sequence studies of several alphavirus genomic RNAs in the region containing the start of the subgenomic RNA.
Proc. Natl. Acad. Sci. USA
79:5253-5239.
|
| 27.
|
Sawicki, S. G., and D. L. Sawicki.
1998.
A new model for coronavirus transcription.
Adv. Exp. Med. Biol.
440:215-219[Medline].
|
| 28.
|
Scholthof, H. B., and K.-B. G. Scholthof.
1996.
Plant virus gene vectors for transient expression of foreign proteins in plants.
Annu. Rev. Phytopathol.
34:299-323[CrossRef][Medline].
|
| 29.
|
Shivprasad, S.,
G. P. Pogue,
D. J. Lewandowski,
J. Hidalgo,
J. Donson,
L. K. Grill, and W. O. Dawson.
1999.
Heterologous sequences greatly affect foreign gene expression in tobacco mosaic virus-based vectors.
Virology
255:312-323[CrossRef][Medline].
|
| 30.
|
Siegel, R. W.,
S. Adkins, and C. C. Kao.
1997.
Sequence-specific recognition of a subgenomic RNA promoter by a viral RNA polymerase.
Proc. Natl. Acad. Sci. USA
94:11238-11243[Abstract/Free Full Text].
|
| 31.
|
Sit, T. L.,
A. A. Vaewhongs, and S. A. Lommel.
1998.
RNA-mediated trans-activation of transcription from a viral RNA.
Science
281:829-832[Abstract/Free Full Text].
|
| 32.
|
Smirnyagina, E.,
Y. H. Hsu,
N. Chua, and P. Ahlquist.
1994.
Second-site mutations in the brome mosaic virus RNA3 intercistronic region partially suppress a defect in coat protein mRNA transcription.
Virology
198:427-436[CrossRef][Medline].
|
| 33.
|
Van der Kuyl, A. C.,
K. Langereis,
C. J. Houwing,
E. M. J. Jaspars, and J. F. Bol.
1990.
cis-acting elements involved in replication of alfalfa virus RNA in vitro.
Virology
176:346-354[CrossRef][Medline].
|
| 34.
|
van der Vossen, E. A. G.,
T. Notenboom, and J. F. Bol.
1995.
Characterization of sequences controlling the synthesis of alfalfa mosaic virus subgenomic RNA in vivo.
Virology
212:663-672[CrossRef][Medline].
|
| 35.
|
van Marle, G.,
W. Luytjes,
R. G. van der Most,
T. van der Straaten, and W. J. Spaan.
1995.
Regulation of coronavirus mRNA transcription.
J. Virol.
69:7851-7856[Abstract].
|
| 36.
|
Verchot, J.,
S. M. Angell, and D. C. Baulcombe.
1998.
In vivo translation of the triple gene block of potato virus X requires two subgenomic mRNAs.
J. Virol.
72:8316-8320[Abstract/Free Full Text].
|
| 37.
|
White, K. A.,
J. B. Bancroft, and G. A. Mackie.
1992.
Mutagenesis of a hexanucleotide sequence conserved in potexvirus RNAs.
Virology
189:817-820[CrossRef][Medline].
|
| 38.
|
White, K. A., and G. A. Mackie.
1990.
Control and expression of 3' open reading frames in clover yellow mosaic virus.
Virology
179:576-584[CrossRef][Medline].
|
| 39.
|
Wung, C. H.,
Y. H. Hsu,
D. Y. Liou,
W. C. Huang,
N. S. Lin, and B. Y. Chang.
1999.
Identification of the RNA-binding sites of the triple gene block protein 1 of bamboo mosaic potexvirus.
J. Gen. Virol.
80:1119-1126[Abstract].
|
| 40.
|
Yang, C. C.,
J. S. Liu,
C. P. Lin, and N. S. Lin.
1997.
Nucleotide sequence and phylogenetic analysis of a bamboo mosaic potexvirus isolate from common bamboo (Bambusa vulgaris McClure).
Bot. Bull. Acad. Sin.
38:77-84.
|
| 41.
|
Zhang, G.,
V. Slowinski, and K. A. White.
1999.
Subgenomic mRNA regulation by a distal RNA element in a (+)-strand RNA virus.
RNA
5:550-561[Abstract].
|
Journal of Virology, November 2000, p. 10341-10348, Vol. 74, No. 22
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Verchot-Lubicz, J., Ye, C.-M., Bamunusinghe, D.
(2007). Molecular biology of potexviruses: recent advances. J. Gen. Virol.
88: 1643-1655
[Abstract]
[Full Text]