Previous Article | Next Article 
Journal of Virology, November 2000, p. 9937-9945, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Functional Characterization of the Dimer Linkage
Structure RNA of Moloney Murine Sarcoma Virus
Hinh
Ly,1,
Donald P.
Nierlich,2,3
John C.
Olsen,4,5 and
Andrew H.
Kaplan1,4,6,*
Departments of Microbiology and
Immunology1 and
Medicine,4 Lineberger
Comprehensive Cancer Center,6
Cystic Fibrosis/Pulmonary Research and Treatment
Center,5 School of Medicine, University of North
Carolina at Chapel Hill, Chapel Hill, North Carolina, and
Department of Microbiology, Immunology, and Molecular
Genetics2 and Molecular Biology
Institute,3 UCLA School of Medicine, Los
Angeles, California
Received 12 June 2000/Accepted 4 August 2000
 |
ABSTRACT |
Several determinants that appear to promote the dimerization of
murine retroviral genomic RNA have been identified. The interaction between these determinants has not been extensively examined. Previously, we proposed that dimerization of the Moloney murine sarcoma
virus genomic RNAs relies upon the concentration-dependent interactions
of a conserved palindrome that is initiated by separate G-rich
stretches (H. Ly, D. P. Nierlich, J. C. Olsen, and A. H. Kaplan, J. Virol. 73:7255-7261, 1999). The cooperative action of
these two elements was examined using a combination of genetic and
antisense approaches. Dimerization of RNA molecules carrying both the
palindrome and G-rich sequences was completely inhibited by an
oligonucleotide complementary to the palindrome; molecules lacking the
palindrome could not dimerize in the presence of oligomers that
hybridize to two G-rich sequences. The results of spontaneous dimerization experiments also demonstrated that RNA molecules lacking
either of the two stretches of guanines dimerized much more slowly than
the full-length molecule which includes the dimer linkage structure
(DLS). However, the addition of an oligonucleotide complementary to the
remaining stretch of guanines restored the kinetics of dimerization to
wild-type levels. The ability of this oligomer to rescue the kinetics
of dimerization was dependent on the presence of the palindrome,
suggesting that interactions within the G-rich regions produce changes
in the palindrome that allow dimerization to proceed with maximum
efficiency. Further, unsuccessful attempts to produce heterodimers
between constructs lacking various combinations of these elements
indicate that the G-rich regions and the palindrome do not interact
directly. Finally, we demonstrate that both of these elements are
important in maintaining efficient viral replication. Modified
antisense oligonucleotides targeting the DLS were found to reduce the
level of viral vector titer production. The reduction in viral titer is
due to a decrease in the efficiency of viral genomic RNA encapsidation.
Overall, our data support a dynamic model of retroviral RNA
dimerization in which discrete dimerization elements act in a concerted fashion.
 |
INTRODUCTION |
Each retroviral particle contains
two plus-strand molecules of the viral genomic RNA. The two molecules
are noncovalently linked near their 5' ends in a region known as the
dimer linkage structure (DLS); numerous studies have suggested that
maintenance of the RNA dimer plays an important role in a number of
steps in viral replication (reviewed in reference
22).
Despite the preponderance of evidence supporting a requirement that
retroviral RNAs form dimers, the exact nature of the DLS has not been
clearly defined. The results of electron microscopy and sedimentation
studies indicate that the two RNAs are held together noncovalently near
their 5' ends (3, 9, 11, 18). Several investigators have
identified a number of potential cis-acting determinants of
dimerization in this region, although the precise role(s) played by
each determinant in promoting dimer formation remains obscure. A
phylogenetically conserved palindrome has been identified in the 5'
untranslated region and has been demonstrated to be an important
determinant of dimerization in some studies (5, 7, 8, 17,
23-26). Other investigators have emphasized the role of
conserved purine motifs in promoting dimerization through the formation
of purine quartets (1, 2, 15, 29). Finally, Oroudjev and
colleagues identified a conserved stem-loop structure upstream of the
palindrome that appears to support dimerization in vitro
(20).
Recently, we proposed a model for the dimerization of Moloney murine
sarcoma virus (MuSV) DLS RNA in which two downstream G-rich regions act
in concert with the palindrome to allow dimerization to proceed
(12). This study extends those observations by examining the
function of these determinants in an in vitro dimerization system and
the impact these determinants have on viral replication. Using a
combination of genetic and antisense approaches, we demonstrate that
interactions in the G-rich regions enhance the rate of dimerization and
that this effect is mediated through the palindrome. Overall, our
experimental results suggest that dimerization of the MuSV DLS RNA is
promoted by the coordinated action of several redundant RNA
determinants and that the presence of these determinants plays an
important role in viral replication.
 |
MATERIALS AND METHODS |
Preparation of RNA samples.
The pLNBS plasmid is a modified
version of the pLNL6-based pLN plasmid (J. C. Olsen, unpublished
data) containing the MuSV DLS and a neomycin resistance gene (described
previously [12]). Numbering of the nucleotides is
assigned according to the recently submitted MuSV sequence to GenBank
(AF033813).
DNA fragments used as templates in the in vitro transcription reaction
were synthesized via PCR amplification using the MuSV DLS region of
pLNBS as a template. The forward primers contain a T7 promoter sequence
and sequences identical to either the primer-binding site (PBS) at
nucleotide (nt) 105 (5'TAATACGACTCACTATAGGGCGATGGGGGCTCGTCCGGGAT3') or the
BsiE I site at nt 310 (5'GAACATAATACGACTCACTATAGGGCGACCCGGCCGCA3'). The reverse
primer begins at the putative initiation site of the gag
gene (position 557) and ends at position 535 (5'CTAATTTTCAGACAAATACAGAAAC3'). PCR products were analyzed
on a 1.0% agarose gel prior to purification using a QIAquick PCR
purification kit (Qiagen, Valencia, Calif.). Samples were eluted from
the columns with 50 µl of RNase-free water (Sigma, St. Louis, Mo.).
Transcription mixtures (20 µl) contained 1 µg of DNA template, 0.5 mM (each) unlabeled ATP, GTP, UTP, 50 µM unlabeled CTP,
and 2.5 µM
[

-
32P]CTP (Amersham, Arlington Heights, Ill.). The
reaction was performed
with a T7 MAXIscript kit as suggested by the
manufacturer (Ambion,
Austin, Tex.). RNA transcripts were separated by
electrophoresis
on 5% polyacrylamide (PA)-8 M urea gels at 250 V for
2 h in 1×
TBE buffer (90 mM Tris-borate, 2 mM EDTA). RNA samples
were eluted
from gels with elution buffer (Ambion). The purified RNAs
were
then ethanol precipitated and resuspended in 100 µl of water
(Sigma)
and stored at

70°C. The products were quantified with a
Beckman
LS6500 scintillation counter. Full-length RNA transcript refers
to in vitro-transcribed MuSV RNA that contains an unaltered DLS
signal.
RNA dimerization assay.
For a standard dimerization assay,
8-µl portions of ~1.5 nM
-32P-labeled RNA were
heated at 95°C for 3 min, chilled on ice for 3 min, and 2 µl of
D5× buffer (500 mM NaCl, 250 mM Tris-HCl [pH 7]) were added. The
samples were then incubated at 60°C for 1 h. The samples were
chilled and separated by electrophoresis on 5% nondenaturing
polyacrylamide gels in the presence of 1× TBE buffer. Gels were dried
and exposed directly on a phosphorimager screen for 18 to 20 h.
The amount of dimer formation was quantitated using a model 445SI
PhosphorImager system and ImageQuaNT image analysis software. The
fraction of RNA in dimeric form was estimated by taking the ratio of
dimeric RNA to the sum of both the monomeric and dimeric species. Dimer
inhibition assays were carried as outlined above except that antisense
oligonucleotides (60 µM) (Table 1) were
added before heat denaturation. In some instances, the
oligonucleotides were 5' end labeled with [
-32P]ATP
using bacteriophage T4 polynucleotide kinase (Gibco-BRL, Grand Island,
N.Y.). The labeled oligomers were purified through a G-25 column
(Amersham). The kinetic comparisons of f105-557, f105-557
Pal, and
f105-557
G5 RNAs were done in a manner similar to the standard
dimerization reaction, except that the incubation times varied as
indicated in the figures and that f105-557
Pal was incubated at
55°C rather than at 60°C (see Fig. 4A). To assay heterodimer
formation, various RNA fragments, each at 1.5 nM concentration, were
combined and used in the standard dimerization assay (see Fig. 5).
Cell culture, transfections, and infections.
GP + E86
murine ecotropic packaging cells (12), PA-317 murine
amphotropic packaging cells (ATCC CRL 9078), and NIH 3T3 murine fibroblast cells (ATCC CRL 1658) were maintained in Dulbecco's modified Eagle's medium containing a high level of glucose (4.5 g/liter) and 10% newborn calf serum, 10% fetal calf serum, and 10%
calf serum, respectively. The polyclonal cell line expressing the
wild-type MuSV DLS sequence was made by first transfecting 5.0 × 105 PA-317 cells with 20 µg of pLNBS DNA by calcium
phosphate precipitation (Calcium Phosphate Transfection System;
Gibco-BRL).
Virus particles were collected from the transfection supernatant
48 h posttransfection. Various concentrations of the viral
supernatants (10
2- to 10
5-fold dilutions) were
used to infect 2.5 × 10
5 GP + E86 cells in the
presence of 8 µg of Polybrene per ml as
described previously
(
19). G418-resistant colony formation was
measured in medium
supplemented with 500 µg of Geneticin (Gibco-BRL)
per ml
(
19). Approximately 200 G418-resistant colonies were
trypsinized, pooled, and stored in freezing solution Dulbecco's
modified Eagle's medium containing a high level of glucose [4.5
g/liter], 10% fetal calf serum, 10% dimethyl
sulfoxide).
Prior to treatment with morpholino oligonucleotides (GeneTools, LLC,
Corvallis, Oreg.), 5 × 10
5 polyclonal cells
expressing the wild-type MuSV DLS sequence (passage
39) were seeded
into each well of a six-well culture plate in
1 ml of growth medium
lacking Geneticin. Morpholino oligonucleotide
is a modified nucleotide
analog in which the deoxyribose moiety
of DNA is replaced by a
six-membered morpholine ring and the charged
phosphodiester nucleoside
linkage is substituted by an uncharged
phosphoramidate bond
(
28). The oligonucleotides were introduced
into the
polyclonal cells by the method of Summerton et al. (
27).
Briefly, 24 h postseeding, the cell medium was replaced with 1
ml
of fresh medium containing 10 µM morpholino oligonucleotide.
Cells
were gently scraped off the surface of the well with a sterile
cell
scraper (Costar, Cambridge, Mass.) and transferred to a new
well. The
medium, containing released virus particles, was collected
24 h
later and filtered through a 0.2-µm-pore-size filter (Schleicher
& Schuell, Keene, N.H.). Viral titers were determined by measuring
G418-resistant colony formation on NIH 3T3 cells as described
previously (
12,
19).
RT-PCR analyses.
Viral genomic RNAs from oligomer-treated
and untreated samples were isolated from cells and viral supernatants
using the Trizol reagent (Gibco-BRL) and the Qiagen viral RNA miniprep
kit (Qiagen), respectively. Prior to RNA extraction, the virus
supernatants were concentrated via centrifugation at 25,000 rpm (Tomy
TX-160) for 30 min. The sample was treated with 10 U of RQ1 DNase in
1× DNase buffer for 1 h at 37°C (Promega, Madison, Wis.). The
RNAs were extracted with phenol-chloroform and precipitated with
ammonium acetate as previously described (12). Similar DNase
treatment (minus the phenol-chloroform extraction step) was applied to
the virus supernatants prior to RNA extraction. Cell-isolated RNA (1.0 µg) (optical density at 260 nm) and various volumes of
virion-isolated RNA (5, 10, and 20 µl) were each used as the template
in the single-step reverse transcriptase PCR (RT-PCR) as suggested by
the manufacturer (18 cycles at 55°C annealing temperature) (Ambion).
The oligonucleotides used in the RT-PCR are RTPCRup primer
(5'GTTATGCGCCTGCGTCTGTACT3') and RTPCRdn primer
(5'CATATCCTGACGGGGTCGGA3'), which correspond to viral nt 223 to 244 and 387 to 406, respectively. RTPCRup primer (50 µM) was 5'
end labeled with [
-32P]ATP using bacteriophage T4
polynucleotide kinase (Gibco-BRL). A mixture of control primers (50 µM) (Ambion), which correspond to the constitutively expressed
cellular ribosomal protein S15 subunit, was also 5' end labeled. The
labeled products were purified through a G-25 column (Amersham). Each
primer (5 µM) was used in the one-step RT-PCR as suggested by the
manufacturer (Ambion). A quarter of the PCR product was denatured
(95°C for 5 min) and separated on a 5% PA-8 M urea gel at 150 V. PhosphorImager and related softwares (Molecular Dynamics) were used to
quantify the PCR products on the gels (see Fig. 6A).
RNase H cleavage assay.
Mixtures of DLS RNA transcripts (1.5 nM) and either modified (morpholino) or unmodified DNA oligomers (60 µM) were allowed to anneal by heating the samples to 95°C for 3 min
and cooling on ice. After adding the First-Strand MuLV RT buffer (1×)
(Gibco-BRL), the samples were allowed to dimerize at 60°C for 1 h. At the end of the incubation time, samples were again chilled on ice
for 3 min prior to the addition of 10 U of MuLV RT enzyme (Gibco-BRL). The mixtures were then incubated at 37°C for an additional hour before being denatured and separated on 5% PA-8 M urea gels (see Fig.
7).
 |
RESULTS |
Antisense DNA oligonucleotides binding to the palindrome or G-rich
regions alter in vitro dimerization of MuSV DLS RNA.
We began by
examining the effects of antisense DNA oligonucleotides on spontaneous
dimer formation of a region of the MuSV genome containing the DLS (Fig.
1). Initially, antisense DNA
oligonucleotides binding to various regions of the DLS were tested to
determine whether they would interfere with the dimerization of the
full-length DLS RNA (f105-503), which contains both the palindrome and
G-rich sequences (Fig. 2). Although
oligonucleotides binding to the palindrome (antiPal) effectively
inhibited dimer formation of the full-length DLS RNAs, other
oligonucleotides targeting either the PBS or the G-rich sequences had
little effect (Fig. 2, compare lane 4 to lanes 3, 5, and 6).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Representation of the MuSV genome. Numbering is with
respect to the viral mRNA, which begins at the transcriptional start
site and ends at the poly(A) site (GenBank accession no. AF033813).
Viral long terminal repeats, the gag, pol, and
v-mos genes, and the sequences of interest (i.e., PBS, DLS,
the Pal palindrome, G5 and G3 G-rich motifs, and the gag
initiation site AUG) are shown. (B) The primary DLS sequence and
antisense oligonucleotides are shown. Solid underlines indicate the
positions of the modified (morpholino) oligonucleotides relative to the
primary sequence. Broken underlines show the positions of the
unmodified oligonucleotides. Oligonucleotides: 1 and 1', modified and
unmodified antiPBS, respectively; 2 and 2', modified and unmodified
antiPal, respectively; 3, modified antiCon1; 4, modified antiCon2; 5 and 5', modified and unmodified antiG5; and 6 and 6', modified and
unmodified antiG3, respectively. See Table 1 for the sequences of the
antisense oligonucleotides. The positions of the PBS, Pal, G5, and G3
sequences are shown in boldface and are noted above the sequences.
|
|

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
Dimerization of the full-length RNA (f105-503) is
inhibited by the antiPal oligonucleotide. -32P-labeled
RNA (1.5 nM) was incubated with various unlabeled oligonucleotides (60 µM) at 60°C for 1 h before separation on a 5% nondenaturing
PA gel as described in Materials and Methods. Whenever a combination of
oligonucleotides was used (lanes 7 and 8), the final concentration of
each oligonucleotide was 30 µM. Pal palindromic sequence and G5 and
G3, two consecutive guanines, are shown at the top. The positions of
monomeric RNA (M) and dimeric RNA (D) are shown
to the right of the gel. The oligonucleotides are given over the lanes
(No Oligo, no oligonucleotides; , anti).
|
|
We extended these observations by examining the dimerization of a DLS
fragment lacking the palindrome (f310-557) (Fig.
3).
In contrast to the full-length
fragment (f105-503), spontaneous
dimerization of this fragment
(f310-557) was inhibited by the
addition of a combination of
oligonucleotides directed against
both G-rich regions (antiG3 and
antiG5). Formation of dimers did
not appear to be affected by the
addition of either antiG3 or
antiG5 oligonucleotides alone. However,
the addition of antiG3
and antiG5 oligomers also effectively inhibited
dimerization of
the full-length DLS fragment containing a 10-nt
deletion within
the palindrome (data not shown). Of note, experiments
using radiolabeled
oligonucleotides with unlabeled DLS RNA indicate
that the antiG3
and antiG5 oligonucleotides bind to both dimeric and
monomeric
forms of the genomic RNA (Fig.
3, lanes 3' to 5'). The
inhibitory
effect of the oligomers was not as pronounced at high
concentrations
of RNA, however (compare Fig.
2 and
3).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
Dimerization of an RNA molecule lacking the Pal sequence
(f310-557) is inhibited by a combination of the antiG-rich
oligonucleotides. Unlabeled f310-557 (1 µg) was dimerized in the
presence of 60 µM 5'-end-labeled DNA oligonucleotide for 1 h at
60°C prior to separation on a 5% PA gel. The RNA was stained with
100 µg of ethidium bromide per ml in 1× TBE buffer for 15 min (A).
After being photographed, the gel was then dried and exposed directly
onto a phosphorimager screen for 18 to 20 h (B). The positions of
monomeric RNA (M) and dimeric RNA (D) are shown
to the right of the gel. The oligonucleotides are shown over the gel
(No Oligo, no oligonucleotides; , anti).
|
|
RNA molecule lacking one of the G-rich sequences (f105-557
G5)
dimerizes more slowly than wild type but can be kinetically enhanced by
an antiG3 oligomer.
Our previous study indicated that at low
concentration, the dimerization of MuSV DLS RNA is initiated by contact
between the G-rich sequences (12). The effects of these
determinants on the rate of dimerization were examined by assaying the
conversion of monomers to dimers over time.
Dimerization of a full-length DLS fragment lacking either the
palindrome (f105-557

Pal) (Fig.
4A,
lanes 6 to 10) or one of
the G-rich stretches (f105-557

G5) (lanes 11 to 15) was slower
than dimerization of the wild-type fragment (lanes 1 to 5). In
contrast to the wild-type fragment, for which dimers were
apparent
by 7.5 min (lane 2), dimerization of a fragment missing the
stretch
of five guanines was not appreciable until 30 min had elapsed
(lane 14). However, when the incubation time was extended to more
than
6 h, dimerization of f105-557

G5 reached the same level as
that
of the full-length f105-557 fragment (Fig.
4B).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 4.
Dimerization of f105-557 G5 is delayed compared to
that of the full-length f105-557, but it can be kinetically enhanced by
the antiG3 ( G3) oligonucleotide. (A) The standard dimer inhibition
assay was conducted as outlined in Materials and Methods, except that
the individual reaction was terminated by chilling on ice at the end of
the appropriate incubation times (0, 7.5, 15, 30, and 60 min) until
separation on a 5% PA gel. (B) Kinetics of dimerization. The mean
values (as percentages) of the dimeric species of the RNA fragments in
the presence or absence of the antiG3 oligomer ( G3) were plotted and
compared. The standard deviation at each time point is less than 8.0%
for at least a duplicate set of reaction mixtures. WT, wild type
(f105-557); Pal, f105-557 Pal; G5, f105-557 G5.
|
|
Remarkably, the addition of the antiG3 oligonucleotide to the construct
lacking the G5 sequence (f105-557

G5) restored the
rate of
dimerization (Fig.
4A, lanes 16 to 20). Dimerization of
this RNA in the
presence of the antiG3 oligomer followed the same
kinetics as the
full-length fragment (Fig.
4B). The ability of
this oligonucleotide to
rescue dimerization was dependent on the
presence of the palindrome;
the addition of the antiG3 oligonucleotide
had no effect on the rate of
dimerization for either the RNA in
which the palindrome had been
deleted or for the wild-type DLS
molecule (Fig.
4A, lanes 21 to
30).
Heterodimer formation data suggest that there is no direct physical
interaction between the palindrome and G-rich sequences.
RNAs
containing either one or both of the dimerization determinants were
used to evaluate whether there is a direct physical interaction between
the palindrome and G-rich regions. We tested the ability of various
truncated and full-length DLS RNAs to form heterodimers. As expected,
the truncated RNA fragments could form homodimers efficiently under the
proper conditions (Fig. 5, lanes 1 to 4, 7, and 8). Further, the truncated fragments could form heterodimers
with the full-length DLS RNAs (lanes 9 to 12). However, no heterodimer
formation was noted between two RNA fragments which contained only the
palindrome (f105-339) or the G-rich motifs (f310-557) (lane 6). These
results suggest that the elements form discrete dimerization units and
that there is no direct interaction between them.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 5.
Heterodimer formation shows no direct interaction
between the kissing loop and the G-rich sequences. The standard
dimerization reaction was performed as outlined (Materials and Methods)
except that, in some instances, a combination of different RNAs (1.5 nM
[each] RNA) was codimerized in a single reaction mixture (lanes 6, 10, and 12). Also, reaction mixtures containing f105-339 RNA are
supplemented with 0.5 µg of identical but unlabeled product. The
different RNAs are indicated by numbers as follows: 1, f105-339; 2, f310-557; 3, f105-557. The positions of monomeric RNA (M), dimeric RNA
(D), and heterodimers (HD) are shown to the left and right of the
gel.
|
|
Viral vector production is impaired by antisense oligonucleotide
targeting the DLS sequence.
We also examined the roles of these
dimerization domains by attempting to inhibit viral replication in a
MuSV-based vector system using antisense oligonucleotides that bind to
these domains. These experiments were performed by assessing the
effects of morpholino antisense oligonucleotides on viral titer (Table
2). Large effects on titer were obtained
by using the oligonucleotides that bound to either the palindrome or
the G5 region (Table 2). These effects were comparable to those seen
with an antisense oligonucleotide complementary to the PBS and greater
than the decline in titer obtained with an antiNeo oligomer, which
hybridizes to the initiation site of the neomycin phosphotransferase
gene. Little or no effect on titer was seen with several control
oligonucleotides that were complementary to sequences between the
palindrome and G5 (antiGcon1 and antiGcon2) (Fig. 1). We tested these
oligomers because other groups have suggested that these regions may
play a role in dimerization in vitro (16, 30).
Viral titer reduction can be attributed, in part, to the reduced
efficiency of viral genomic RNA encapsidation.
To help define the
point in the viral life cycle that was influenced by the antisense
oligonucleotide treatment, we decided to determine the level of
encapsidated genomic RNA (Fig. 6A). Both
the antiPal and antiG5 oligomers reduced the viral genomic RNA
packaging by approximately 70% relative to that of the untreated sample; treatment with the other oligomers had little or no effect on
the level of RNA encapsidation (Fig. 6B). The moderate reductions in RNA packaging observed for the oligomer-treated samples are consistent with the results obtained from deletion analyses of these
similar regions in the related MuLV virus (16). As expected, no marked reduction in viral RNA packaging was observed for the antiPBS
and antiNeo samples, although the titers produced from cells treated
with these oligomers were reduced by three- to sixfold (Table 2).

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 6.
Reduction of viral genomic RNA encapsidation due to
antisense DNA oligomers. (A) RT-PCR amplification of viral genomic
RNAs. Polyclonal cells expressing the wild-type DLS sequence were
treated either with one of a series of antisense DNA oligomers or with
a medium control. RNAs were isolated from cells or virions. Various
volumes of virion-isolated RNAs (5, 10, and 20 µl [indicated by the
height of the triangle over each set of three lanes]) and 1.0 µg of
cell-isolated RNAs were RT-PCR amplified. vRNA and S15 are PCR products
amplified from viral RNA and control ribosomal protein S15 message,
respectively. , anti; ( ) RT, one-step RT-PCR mixture lacking MuLV
RT; Water, one-step RT-PCR mixture lacking the RNA substrate. (B)
Relative reduction of genomic RNA packaging. Percentage reductions in
genomic RNA encapsidation of the oligomer-treated samples relative to
that of the untreated mixture were compared.
|
|
Hybridization of the antisense DNA oligomers to the target RNA does
not alter the integrity of the genomic RNA inside the virions.
We
were concerned that the formation of RNA-DNA hybrids produced by
morpholino oligomer treatment may render the viral genome more
susceptible to RNase H activity of the viral RT inside the virions. To
examine this possibility, mixtures of viral DLS RNA and either modified
(morpholino) or unmodified DNA oligomers were allowed to anneal. The
mixtures were then treated with the MuLV RT enzyme and separated on 5%
PA-8 M urea gels (Fig. 7). While RT
could effectively cleave the target RNAs in the presence of the
unmodified oligomers (lanes 3, 5, and 7), it could not modify the RNA
samples that contained the modified oligomers (lanes 4, 6, and 8).
These observations suggest that the morpholino oligomers used in our
viral culture system did not render the viral genomic RNA susceptible
to RT-associated RNase H cleavage.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of modified (Morph) and unmodified (Phos)
antisense DNA oligomers (oligo) on the stability of the target RNA.
Viral RNAs are cleaved by the MuLV RT enzyme in the presence of
unmodified DNA oligomers (lanes 3, 5, and 7) into the expected RNA
products (antiPal [ Pal], 300- and 130-nt fragments; antiG5 [
G5], 210- and 220-nt fragments; antiCon1 [ Con1], 200- and 240-nt
fragments). Viral RNAs are not altered in the presence of modified
oligonucleotides (lanes 4, 6, and 8). The presence (+) or absence ( )
of the RT enzyme is indicated over the gel.
|
|
 |
DISCUSSION |
We previously demonstrated that spontaneous dimerization of the
MuSV DLS RNA is dependent upon the cooperative interactions between the
sequences that comprise the palindrome and the G-rich motifs
(12). Here we extend these observations by exploring the
interactions between these two domains. Our results support a role for
both of these determinants in promoting dimerization and suggest that
the two domains function cooperatively to allow dimerization to proceed
with maximum efficiency.
Our data demonstrate that an antisense oligonucleotide directed against
the palindrome is sufficient to block spontaneous dimerization of the
full-length DLS fragment. Although oligomers complementary to the
G-rich regions were unable to block dimerization of the full-length DLS
molecule, they did inhibit dimerization of RNAs lacking the palindrome.
This observation is consistent with a model in which the interaction of
the G-rich regions is in a pathway preceding the final state of
dimerization. Overall, the influence of the antisense oligomers on in
vitro dimerization is in keeping with a process in which the two
domains contribute to the formation of the dimer.
It is interesting to note that when the antiG3 or antiG5 oligomers are
added singly, they bind to both the dimeric and monomeric forms of the
RNA and do not appear to inhibit dimerization of RNAs lacking the
palindrome. Further, when the radiolabeled antiG-rich oligomers are
added together, they produce a more intense monomer band (Fig. 3, lane
5'), suggesting that either G-rich region can function in
dimerization. Overall, the results of these experiments combined with
those reported previously indicate that dimeric RNAs lacking the Pal
sequence are held together by the G-rich sequences and that
simultaneous hybridization of these elements by both antiG-rich
oligomers completely blocks dimer formation.
We noted that dimerization for an RNA molecule lacking one of the
G-rich regions is delayed. This delay is completely rescued by the
addition of a DNA oligomer that hybridizes to the other stretch of
guanines. Our results also demonstrate that the ability of this antiG3
oligomer to promote dimerization is dependent on the presence of the
palindrome. Therefore, it appears that an interaction in the region of
the guanines is required in order for dimerization to occur at the same
rate as the full-length DLS RNA and that this interaction is mediated
through the presence of the palindrome. This observation supports the
view of RNA dimerization as a dynamic process.
Our data are in accord with a dynamic model of the dimerization of MuLV
genomic RNA proposed by several investigators (5, 8). De
Tapia and colleagues have suggested that the association of the
palindromes is a slow process that is kinetically enhanced by sequences
downstream (5). In their model, the initial interactions involve stem-loop structures downstream from the kissing loop that
allow rapid structural rearrangement of the monomeric RNA. They propose
that these initial interactions increase the fraction of RNA conformers
that are available to dimerize via the palindrome (5).
Accordingly, the secondary structure of the MuLV DLS is predicted to
undergo dimerization-induced conformational changes, as indicated by
changes in reactivity to chemical probing agents in solution
(30). More specifically, besides the changes observed for
the kissing-loop structure, sequences downstream from it are predicted
to undergo almost complete structural rearrangement in the RNA dimer
(29). It is interesting to note that the five guanines
deleted in the MuSV f105-557
G5 fragment are analogous to a MuLV
sequence predicted to be part of a stem-loop structure that was
proposed to participate in the initial intermolecular interactions between RNA molecules (8).
Our data and the data of others suggest that rearrangements in RNA
determinants downstream from the palindrome accompany dimerization. However, the precise nature of these interactions had not been defined
and the possibility that these determinants may interact directly with
each other had not been examined. We addressed this question by
attempting to produce heterodimers between RNA molecules containing one
or both of these elements (Fig. 5). The results of these experiments
indicate that an RNA monomer containing only one of these elements can
pair only with a monomer containing the same element. Therefore,
although both the palindrome and the downstream elements participate in
the final dimer, they do not appear to interact directly with each
other. Overall, these results are consistent with the data obtained
from the successful heterodimer formation between full-length DLS RNAs
from the various retroviruses (15) and suggest that these
elements form discrete dimerization domains.
The conclusion that both of these determinants play an important role
in dimerization and/or other aspects of viral replication is further
supported by our viral infectivity data. We demonstrate that an
oligomer complementary to either of the stretches of guanines also has
a significant effect on viral replication (Table 2). The reductions in
viral vector titer can, in part, be explained by the attenuation of the
viral genomic RNA encapsidation efficiency (Fig. 6). Nevertheless, the
defect in RNA packaging alone could not account for the full reduction
effect observed with the viral vector titer production. These results
suggest that aspects of viral replication other than RNA encapsidation
may be affected by changes that disrupt dimerization.
Overall, our data support a multistage model of RNA dimerization in
which initial interactions between two RNA molecules involve the
regions encompassing the stretches of guanines. These initial interactions induce subsequent changes in the palindrome that allow
dimerization to proceed. It has been suggested that dimerization of the
retroviral genomic RNA plays an important role in several aspects of
viral replication including RNA encapsidation and reverse transcription
(22). It has also been noted that retroviral assembly is
very efficient at selectively packaging dimers of RNA of viral, but not
cellular, origin (11). A mechanism for RNA dimerization that
relies on multiple determinants that act sequentially would meet the
challenge of maintaining specificity while providing the redundancy
that might be expected for a critical biologic function. We are
currently extending our evaluation of the biologic and structural roles
played by these elements.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant K11 AI01107 to
A.H.K. and a seed grant from the UCLA AIDS Institute to D.P.N.
H.L. was supported in part by the UCLA Presidential Research Fellowship and the UNC Graduate Research Fellowship (Ki Ha Chang Memorial Fellowship).
We thank Natalie Thornburg, John Sechelski, Nan N. Lee, Amy T. A. Tran, Timothy Moran, Liza Kim, Sami Yusuf, Peter Bui, James Matsunaga,
and Steve Pettit for their help. We also thank Kevin M. Weeks for
critical reading of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: CB#7030, 547 Burnett-Womack, UNC-Chapel Hill, Chapel Hill, NC 27599-7030. Phone:
(919) 966-2536. Fax: (919) 966-6714. E-mail:
akaplan{at}med.unc.edu.
Present address: University of California, San Francisco, CA 94143.
 |
REFERENCES |
| 1.
|
Awang, G., and D. Sen.
1993.
Mode of dimerization of HIV-1 genomic RNA.
Biochemistry
32:11453-11457[CrossRef][Medline].
|
| 2.
|
Baudin, F.,
R. Marquet,
C. Isel,
J.-L. Darlix,
B. Ehresmann, and C. Ehresmann.
1993.
Functional sites in the 5' region of human immunodeficiency virus type 1 RNA from defined structural domains.
J. Mol. Biol.
229:382-397[CrossRef][Medline].
|
| 3.
|
Bender, W.,
Y.-H. Chien,
S. Chattopadhyay,
P. K. Vogt,
M. B. Gardner, and N. Davidson.
1978.
High-molecular-weight RNAs of AKR, NZB, and wild mouse viruses and avian reticuloendotheliosis virus all have similar dimer structures.
J. Virol.
25:888-896[Abstract/Free Full Text].
|
| 4.
|
Clever, J. L., and T. G. Parslow.
1997.
Mutant human immunodeficiency virus type 1 genomes with defects in RNA dimerization or encapsidation.
J. Virol.
71:3407-3414[Abstract].
|
| 5.
|
De Tapia, M.,
V. Metzler,
M. Mougel,
B. Ehresmann, and C. Ehresmann.
1998.
Dimerization of MoMuLV genomic RNA: redefinition of the role of the palindromic stem-loop H1 (278-303) and new roles for stem-loops H2 (310-352) and H3 (355-374).
Biochemistry
37:6077-6085[CrossRef][Medline].
|
| 6.
|
Fu, W., and A. Rein.
1993.
Maturation of dimeric viral RNA of Moloney murine leukemia virus.
J. Virol.
67:5443-5449[Abstract/Free Full Text].
|
| 7.
|
Girard, P. M.,
B. Bonnet-Mathoniere,
D. Muriaux, and J. Paoletti.
1995.
A short autocomplementary sequence in the 5' leader region is responsible for dimerization of MoMuLV genomic RNA.
Biochemistry
34:9785-9794[CrossRef][Medline].
|
| 8.
|
Girard, P. M.,
H. de Rocquigny,
B. P. Roques, and J. Paoletti.
1996.
A model of psi dimerization: destabilization of the C278-G303 stem-loop by the nucleocapsid protein (NCp10) of MoMuLV.
Biochemistry
35:8705-8714[CrossRef][Medline].
|
| 9.
|
Kung, H. J.,
S. Hu,
W. Bender,
J. M. Bailey,
N. Davidson,
M. O. Nicolson, and R. M. McAllister.
1976.
RD-114, baboon, and woolly monkey viral RNAs compared in size and structure.
Cell
7:609-620[CrossRef][Medline].
|
| 10.
|
Laughrea, M., and L. Jette.
1994.
A 19-nucleotide sequence upstream of the 5' major splice donor is part of the dimerization domain of human immunodeficiency virus 1 genomic RNA.
Biochemistry
33:13464-13474[CrossRef][Medline].
|
| 11.
|
Linial, M. L., and A. D. Miller.
1990.
Retroviral RNA packaging: sequence requirements and implications.
Curr. Top. Microbiol. Immunol.
157:125-152[Medline].
|
| 12.
|
Ly, H.,
D. P. Nierlich,
J. C. Olsen, and A. H. Kaplan.
1999.
Moloney murine sarcoma virus genomic RNAs dimerize via a two-step process: a concentration-dependent kissing-loop interaction is driven by initial contact between consecutive guanines.
J. Virol.
73:7255-7261[Abstract/Free Full Text].
|
| 13.
|
Maisel, J.,
W. Bender,
S. Hu,
P. H. Duesberg, and N. Davidson.
1978.
Structure of 50 to 70S RNA from Moloney sarcoma viruses.
J. Virol.
25:384-394[Abstract/Free Full Text].
|
| 14.
|
Markowitz, D.,
S. Goff, and A. Bank.
1988.
A safe packaging cell line for gene transfer: separating viral genes on two different plasmids.
J. Virol.
62:1120-1124[Abstract/Free Full Text].
|
| 15.
|
Marquet, R.,
F. Baudin,
C. Gabus,
J.-L. Darlix,
M. Mougel,
C. Ehresmann, and B. Ehresmann.
1991.
Dimerization of human immunodeficiency virus (type 1) RNA: stimulation by cations and possible mechanism.
Nucleic Acids Res.
91:2349-2357.
|
| 16.
|
Moguel, M.,
Y. Zhang, and E. Barklis.
1996.
cis-Active structural motifs involved in specific encapsidation of Moloney murine leukemia virus RNA.
J. Virol.
70:5043-5050[Abstract/Free Full Text].
|
| 17.
|
Muriaux, D.,
P.-M. Girard,
B. Bonnet-Mathoniere, and J. Paoletti.
1995.
Dimerization of HIV-1Lai RNA at low ionic strength: an autocomplementary sequence in the 5' leader region is evidenced by an antisense oligonucleotide.
J. Biol. Chem.
270:8209-8216[Abstract/Free Full Text].
|
| 18.
|
Murti, K. G.,
M. Bondurant, and A. Tereba.
1981.
Secondary structural features in the 70S RNAs of Moloney murine leukemia and Rous sarcoma viruses as observed by electron microscopy.
J. Virol.
37:411-419[Abstract/Free Full Text].
|
| 19.
|
Olsen, J. C., and J. Sechelski.
1995.
Use of sodium butyrate to enhance production of retroviral vectors expressing CFTR cDNA.
Hum. Gene Ther.
6:1195-1202[Medline].
|
| 20.
|
Oroudjev, E. M.,
P. C. E. Kang, and L. A. Kohlstaedt.
1999.
An additional dimer linkage structure in Moloney murine leukemia virus RNA.
J. Mol. Biol.
291:603-613[CrossRef][Medline].
|
| 21.
|
Paillart, J. C.,
R. Marquet,
E. Skripkin,
B. Ehresmann, and C. Ehresmann.
1994.
Mutational analysis of the bipartite dimer linkage structure of human immunodeficiency virus type 1 genomic RNA.
J. Biol. Chem.
269:27486-27493[Abstract/Free Full Text].
|
| 22.
|
Paillart, J. C.,
R. Marquet,
E. Skripkin,
C. Ehresmann, and B. Ehresmann.
1996.
Dimerization of retroviral genomic RNAs: structural and functional implications.
Biochimie
78:639-653[Medline].
|
| 23.
|
Paillart, J. C.,
E. Skripkin,
B. Ehresmann,
C. Ehresmann, and R. Marquet.
1996.
A loop-loop "kissing" complex is the essential part of the dimer linkage of genomic HIV-1 RNA.
Proc. Natl. Acad. Sci. USA
93:5572-5577[Abstract/Free Full Text].
|
| 24.
|
Paoletti, J.,
M. Mougel,
N. Tounekti,
P. M. Girard,
C. Ehresmann, and B. Ehresmann.
1993.
Spontaneous dimerization of retroviral MoMuLV RNA.
Biochimie
75:681-686[Medline].
|
| 25.
|
Prats, A.-C.,
C. Roy,
P. Wan,
M. Erard,
V. Housset,
C. Gabus,
C. Paoletti, and J.-L. Darlix.
1990.
cis Elements and trans-acting factors involved in dimer formation of murine leukemia virus RNA.
J. Virol.
64:774-783[Abstract/Free Full Text].
|
| 26.
|
Skripkin, E.,
J. C. Paillart,
R. Marquet,
B. Ehresmann, and C. Ehresmann.
1994.
Identification of the primary site of the human immunodeficiency virus type 1 RNA dimerization in vitro.
Proc. Natl. Acad. Sci. USA
91:4945-4949[Abstract/Free Full Text].
|
| 27.
|
Summerton, J.,
D. Stein,
S. B. Huang,
P. Matthews,
D. Weller, and M. Partridge.
1997.
Morpholino and phosphorothioate antisense oligomers compared in cell-free and in-cell systems.
Antisense Nucleic Acid Drug Dev.
7:63-70[Medline].
|
| 28.
|
Summerton, J., and D. Weller.
1997.
Morpholino antisense oligomers: designs, preparation, and properties.
Antisense Nucleic Acid Drug Dev.
7:187-195[Medline].
|
| 29.
|
Sundquist, W. I., and S. Heaphy.
1993.
Evidence for interstrand quadruplex formation in the dimerization of human immunodeficiency virus type 1 genomic RNA.
Proc. Natl. Acad. Sci. USA
90:3393-3397[Abstract/Free Full Text].
|
| 30.
|
Tounekti, N.,
M. Mougel,
C. Roy,
R. Marquet,
J.-L. Darlix,
J. Paoletti,
B. Ehresmann, and C. Ehresmann.
1992.
Effect of dimerization on the conformation of the encapsidation Psi domain of Moloney murine leukemia virus RNA.
J. Mol. Biol.
223:205-220[CrossRef][Medline].
|
Journal of Virology, November 2000, p. 9937-9945, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Izmailova, E., Aldovini, A.
(2002). Functional Analysis of the Murine Sarcoma Virus RNA Packaging Sequence. J. Virol.
76: 4643-4648
[Abstract]
[Full Text]
-
Ly, H., Parslow, T. G.
(2002). Bipartite Signal for Genomic RNA Dimerization in Moloney Murine Leukemia Virus. J. Virol.
76: 3135-3144
[Abstract]
[Full Text]