Previous Article | Next Article 
Journal of Virology, November 2000, p. 10176-10186, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Transactivation of Latent Marek's Disease
Herpesvirus Genes in QT35, a Quail Fibroblast Cell Line, by
Herpesvirus of Turkeys
T.
Yamaguchi,
S. L.
Kaplan,
P.
Wakenell,
and
K. A.
Schat*
Unit of Avian Health, Department of
Microbiology and Immunology, College of Veterinary Medicine,
Cornell University, Ithaca, New York 14853
Received 17 May 2000/Accepted 21 July 2000
 |
ABSTRACT |
The QT35 cell line was established from a
methylcholanthrene-induced tumor in Japanese quail (Coturnix
coturnix japonica) (C. Moscovici, M. G. Moscovici, H. Jimenez, M. M. Lai, M. J. Hayman, and P. K. Vogt, Cell
11:95-103, 1977). Two independently maintained sublines of QT35 were
found to be positive for Marek's disease virus (MDV)-like genes by
Southern blotting and PCR assays. Sequence analysis of fragments of the
ICP4, ICP22, ICP27, VP16, meq, pp14, pp38, open reading
frame (ORF) L1, and glycoprotein B (gB) genes showed a strong homology
with the corresponding fragments of MDV genes. Subsequently, a serotype
1 MDV-like herpesvirus, tentatively name QMDV, was rescued from QT35
cells in chicken kidney cell (CKC) cultures established from 6- to
9-day-old chicks inoculated at 8 days of embryonation with QT35 cells.
Transmission electron microscopy failed to show herpesvirus particles
in QT35 cells, but typical intranuclear herpesvirus particles were
detected in CKCs. Reverse transcription-PCR analysis showed that the
following QMDV transcripts were present in QT35 cells: sense and
antisense meq, ORF L1, ICP4, and latency-associated
transcripts, which are antisense to ICP4. A transcript of approximately
4.5 kb was detected by Northern blotting using total RNA from QT35
cells. Inoculation of QT35 cells with herpesvirus of turkeys
(HVT)-infected chicken embryo fibroblasts (CEF) but not with uninfected
CEF resulted in the activation of ICP22, ICP27, VP16, pp38, and gB. In
addition, the level of ICP4 mRNA was increased compared to that in QT35 cells. The activation by HVT resulted in the production of pp38 protein. It was not possible to detect if the other activated genes
were translated due to the lack of serotype 1-specific monoclonal antibodies.
| |
INTRODUCTION |
Marek's disease (MD) is a highly
contagious lymphoproliferative disease of chickens caused by the MD
herpesvirus (MDV). Infection with MDV results in a latent infection of
mostly CD4+ T lymphocytes, which may become transformed,
leading to neoplastic disease (50). Serotype 1 (oncogenic)
and serotype 2 (nononcogenic) strains of MDV are grouped within the
Alphaherpesvirinae subfamily, along with serotype 3 herpesvirus of turkeys (HVT) (4). The viral DNA consists of
unique long (UL) and unique short (US)
sequences, each flanked by a pair of inverted repeats designated
terminal repeats (TRL and TRS) and internal
repeats (IRL and IRS). Although the complete
sequence of MDV has not yet been published, many of the genes have been
mapped and sequenced (reviewed in references 46 and
69). Replication of MDV, like that of all
herpesviruses, follows a well-defined pattern of gene expression in
which immediate-early (IE) genes are expressed first. These IE genes
transactivate early and late genes. For example, during replication of
herpes simplex virus (HSV), the ICP4 IE gene transactivates several
early and late genes (14, 15). The MDV homologue of the ICP4
gene of HSV has been located in the IRS (2).
Pratt et al. (41) demonstrated that MDV ICP4 transactivates
the expression of MDV pp38. Based on the similarities of MDV to HSV and
the cascade pattern of MDV gene expression (55), it seems
likely that the MDV genome and the related HVT genome encode proteins
capable of activating MDV and HVT promoters. Tieber et al.
(62) showed that MDV and HVT can transactivate the promoter
region in the long terminal repeat (LTR) of Rous sarcoma virus.
Furthermore, they reported that HVT can efficiently transactivate the
ICP4 and beta-thymidine kinase gene promoters of HSV as well as the
promoter of the IE gene of human cytomegalovirus.
More than 200 lymphoblastoid cell lines have been established from MD
tumors (1, 7-9, 32, 35, 39). Most of these cell lines are
CD4+ CD8
T cells (56). These
lymphoblastoid cell lines are often considered the equivalent of
latently infected cells, based on the limited expression of viral
genes. In addition to the lymphoblastoid cell lines, an MDV-transformed
chicken embryo fibroblast (CEF) cell line has been established, but
this cell line also expresses late MDV genes, such as that for
glycoprotein B (gB) (5).
Three groups of transcripts located in the repeat regions of MDV in MD
lymphoblastoid cell lines have been described. The first group consists
of the latency-associated transcripts (LATs), which are antisense to
ICP4 (see Fig. 1). Several groups have reported the presence of LATs in
MD lymphomas and MD-derived lymphoblastoid cell lines (10, 11, 21,
22, 27, 33); some of these (the MD small RNAs [MSRs]) are
poly(A) negative and are retained in the nuclei (11),
similar to the 1.5- and 2.0-kb LATs described for HSV (64).
Interestingly, the MSRs are also found in nuclei of CEF productively
infected with MDV.
The second and third group of transcripts described for MD lymphomas
and lymphoblastoid cell lines are located in the I2, Q2, and L regions of the repeats flanking the
UL sequence (see Fig. 1). The major transcript, referred to
as meq, produces the Meq protein, which is expressed in all
MDV tumors. The protein has in the N-terminal portion a basic leucine
zipper structure closely resembling proteins encoded by the
jun/fos oncogene family (18). Meq is an
intranuclear protein that binds to the nucleolus and coiled bodies
(23). Overexpression of this protein in RAT-2 cells but not
CEF leads to growth and/or transformation (24), probably by
interaction with the cell cycle regulator CDK2 (25). Two
spliced products have been identified in the meq region. The first one (38) produces a protein (Meq-sp) that still has
the binding characteristics of Meq but lacks the transactivator domain. The function of this protein remains unclear (36). The
second one shares the same carboxy terminus as Meq-sp and has been
named vIL-8 (26). vIL-8 may play an important role during
the early pathogenesis of MDV (52). Interestingly, two open
reading frames (ORFs) antisense to meq have also been
identified. The importance of these ORFs is also unknown at the present
time (37). ORF L1 (34) is the third transcript,
but its function remains unclear. ORF L1 deletion mutants were
generated using the CVI988 strain of MDV. These mutants were able to
establish latency, and virus could be rescued from latent infections,
suggesting that ORF L1 is not important for these functions
(57).
In 1977, Moscovici et al. (30) established several
continuous cell lines from 20-methylcholanthrene (MCA)-induced tumors in Japanese quail (Coturnix coturnix japonica). These cells
lines are free of avian retroviruses, but the presence of MDV in these cell lines has not been examined. QT35 cells are often used for virus
propagation and are susceptible to infection with a wide range of avian
viruses, including avian leukosis virus (ALV) subgroups C, E, and F and
HVT (13, 30) but not serotype 1 MDV (12). In this
paper, the presence of MDV genes in QT35 cells, the subsequent rescue
of a herpesvirus from these cells, and the expression of transcripts of
MDV genes associated with latency and/or transformation in these cells
are reported. In addition, infection of QT35 cells with HVT resulted in
the transactivation of several IE, early, and late genes of MDV.
Subsequently, a herpesvirus was rescued from QT35 cells and was named
QMDV solely for the purpose of differentiating it from chicken MDV
isolates. Moreover, the QT35 cell line provides a new in vitro model
allowing the study of the maintenance of and reactivation from latency
of a truly latent alphaherpesvirus.
| |
MATERIALS AND METHODS |
Cells and viruses.
Two independently maintained sublines (A
and B) of QT35 cells were used. Subline A was received in the
Department of Avian and Aquatic Animal Medicine (currently part of the
Department of Microbiology and Immunology) as passage 47 (p47) in 1982. Cells from this passage were recovered from the liquid nitrogen for this study and used at between p48 and p55. The second subline cannot
be traced completely but was obtained from the laboratory of K. Skeeles
(deceased in 1999) of the University of Arkansas and had never been
propagated in a laboratory working with MDV. In addition, CEF and
chicken kidney cells (CKC) were used. The CEF and CKC cultures were
established from embryos and 2-week-old chicks, respectively, derived
from departmental specific-pathogen-free (SPF) flocks of chickens. CEF,
CKC, and QT35 cells were propagated in an M199-based medium
(51) supplemented with 2, 5, and 4% fetal bovine serum,
respectively, in a humidified CO2 incubator at 38.5°C.
The percentage of serum was reduced to 0.2% after CEF and CKC cultures
became confluent. QT35 cell cultures were subcultured at approximately
weekly intervals. The MDV vaccine strain CVI988 (p47), which is a
serotype 1 MDV (44), and HVT strain FC-126 (67)
were propagated in CEF, while MDV strains JM-16 (p19) (54) and RB-1B (p14) (53) were propagated in CKC. The latter two serotype 1 MDV strains are classified as virulent and very virulent, respectively.
Transactivation of QMDV genes by HVT.
QT35 cells and CEF,
cultured in 25-cm2 flasks (Falcon, Franklin Lakes, N.J.),
were inoculated with 0.5 × 106 CEF containing 1,000 to
2,000 focus-forming units of HVT. QT35 cell cultures were also
inoculated with an equal number of uninfected CEF. Uninfected CEF and
MDV CVI988-infected CEF were used as negative and positive controls,
respectively. RNA was prepared from these cultures after incubation at
38.5°C for 3 to 4 days and analyzed for the presence of MDV
transcripts by reverse transcription (RT)-PCR using primers specific
for MDV serotype 1.
DNA and RNA extraction.
Cellular DNA was extracted from
cultured cells as described by Morgan et al. (29). Briefly,
5 × 106 QT35 cells, CKC, CKC infected with the RB-1B
(p19) strain of MDV, or CEF infected with CVI988 (p53) were washed with
phosphate-buffered saline (PBS) and resuspended in 0.25% Triton
X-100-10 mM Tris-HCl (pH 7.9)-10 mM EDTA. One-tenth volume of 2 M
NaCl was added, and the cells were centrifuged at 14,000 rpm for 10 min. The pellet was resuspended in digestion buffer (0.5% sodium
dodecyl sulfate, 100 mM NaCl, 10 mM Tris-HCl [pH 8.0], 1 mM EDTA) and
incubated for 3 h at 50°C. The solution was extracted once with
phenol and twice with chloroform-isoamyl alcohol (24:1). Total viral an
cellular DNAs were precipitated by the addition of 2 volumes of
absolute ethanol, recovered by centrifugation, dissolved in 100 µl of
10 mM Tris-HCl (pH 7.4)-1 mM EDTA, and stored at 4°C until use.
Cellular RNA was extracted from 5 × 106 QT35 cells or
CEF infected with CVI988 (p53) using a Micro RNA preparation kit
(Stratagene, San Diego, Calif.). RNA pellets were washed twice with
75% ethanol and dissolved in 60 µl of RNase-free H2O.
Subsequently, the following components were added for DNase treatment
prior to RT-PCR: 2 U of RNase-free RQ1 DNase (Promega, Madison, Wis.)
and 8 µl of RQ1 RNase-free DNase 10× reaction buffer to a final
volume of 80 µl. The reaction mixture was incubated at 37°C for 30 min, incubated for 10 min at 65°C to inactivate the DNase, and stored
at 
20°C until use.
Southern and Northern blotting.
One microgram (per lane) of
total DNA extracted from QT35 cells (equivalent to 50,000 cells), CKC,
and RB-1B-infected CKC was digested with BamHI; the
fragments were separated in a 1.5% Tris-acetate-EDTA-agarose gel at
100 V and transferred to a MagnaGraph nylon transfer membrane (MSI,
Westboro, Mass.) by standard techniques. Probes were prepared by
labeling the BamHI-H, and -I2 fragments (16) with 32P using RediprimeII (Amersham
Pharmacia, Piscataway, N.J.). Hybridization was carried out using
Rapid-hyb buffer (Amersham Pharmacia) in a hybridization oven (Hybaid
Instruments, Holbrook, N.Y.), and membranes were exposed to BioMax MS
film (Eastman Kodak Co., Rochester, N.Y.).
Total RNA from QT35 cells and CEF infected with the CVI988 strain of
MDV was used to determine the presence of MDV-specific transcripts. RNA
obtained from 106 cells was loaded in each well of a
nondenaturing Northern Max-Gly gel (Ambion, Austin, Tex.) following the
manufacturer's protocol. Gels were transferred to BrightStar plus
Nylon membranes (Ambion) and hybridized to 32P-labeled
probes using RediprimeII as described above. Membranes were exposed to
BioMax MS film for up to 10 days. Probes for LATs meq, ORF
L1, and pp38 were prepared by PCR using the primers shown in Table
1, and plasmid DNAs for LATs,
meq, and pp38 or RB-1B DNA was used as a template. The
primers for the ICP4 probe consisted of 5'CCCGCCGATGCTGCCCTAAAC3'
and 3'TCCGCCAGACACCTACTCAAG5', and plasmid DNA was
used as a template.
PCR and RT-PCR.
PCR assays were carried out to detect the
presence of ICP4, ICP22, ICP27, ORF L1, pp145, VP16, gB, pp38, and
meq sequences. The location and direction of these genes are
shown in Fig. 1 using the
BamHI restriction map of MDV (16). The primes for the PCR assays and the expected fragment sizes are listed in Table 1.
The nucleotide numbers are based on the accession numbers in GenBank.
The following components were used in the PCR assays, to a final volume
of 50 µl: 2 µl of QT35 cell DNA, which is equivalent to
105 cells; 2.5 U of Taq Gold DNA polymerase
(Perkin-Elmer, Foster City, Calif.); 0.2 mM each deoxynucleoside
triphosphate; PCR buffer II (10 mM Tris-HCl [pH 8.3], 50 mM KCl); 2 mM MgCl2; and 1 µM each pair of primers specific for the
respective genes. The following conditions were used for the PCR:
denaturation at 94°C for 5 min, annealing at 50°C for 30 s,
and extension at 72°C for 45 s, followed by 30 cycles of
denaturation at 94°C for 45 s, annealing at 50°C for 30 s, and extension at 72°C for 45 s; in the last cycle, the
extension was done at 70°C for 7 min. The amplified fragments were
resolved by electrophoresis in 1.5% agarose gels, stained with
ethidium bromide, and visualized on the Eagle Eye II still-video system
(Stratagene).
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
(a) Structure of the MDV genome. UL,
US, and the flanking repeats (TRL,
IRL, IRS, and TRS) are indicated.
(b) BamHI restriction enzyme linkage map (16).
(c) Locations and directions transcription of the genes of interest.
|
|
RT-PCR assays were carried out for the detection of LATs, ICP4, ICP22,
ICP27, VP16, pp38,
meq, ORF L1, and gB transcripts.
cDNA
synthesis and PCR amplification were carried out using a
GeneAmp RNA
PCR kit (Perkin-Elmer) according to the manufacturer's
instructions.
Briefly, RT of RNA was performed with a 10-µl final
volume containing
1 mM deoxynucleoside triphosphate, PCR buffer
II, 1.25 U of murine
leukemia virus reverse transcriptase, 2.5
µM random hexamer or 2.5 µM specific primer and 2 µl of total
RNA, which is equivalent to
1.25 × 10
5 cells. Random hexamers were used as
primers for cDNA synthesis
for the detection of gB, VP16, ICP27, pp38,
meq, ORF L1, and ICP22
transcripts. For the detection of
ICP4 transcripts and LATs, primers
LATs2-5 and LATs2-3 (Table
1),
respectively, were used for cDNA
synthesis. The reaction mixture was
incubated at 42°C for 15 min
and heated at 95°C for 5 min. The
synthesized cDNA was amplified
by PCR as described for DNA.
-Actin
was used in each assay to
ensure that relatively comparable amounts of
cDNA were used and
that a uniform amplification process was
obtained.
PCR products were analyzed by Southern blotting using standard methods
(
48). Probes were prepared from cloned and sequenced
PCR
products obtained from CVI988 DNA. The cloned fragments were
excised by
EcoRI digestion and labeled with digoxigenin (DIG)-11-dUTP
using a random-primer labeling kit (Boehringer Mannheim Biochemicals,
Indianapolis, Ind.). Hybridization was carried out at 68°C for
12 to
16 h, and hybridized DNA bands were detected using a DIG
luminescent detection kit (Boehringer) according to the manufacturer's
instructions.
PCR assays to examine QT35 cells for the presence of ALV
pol
sequences and the reticuloendotheliosis virus LTR were conducted
as
described by Wade et al. (
63).
Nucleotide sequencing.
The PCR products for ICP4, ICP22,
ICP27, VP16, pp38, meq, ORF L1, and gB amplified from QT35
cell DNA, DNA from CKC infected with QMDV, and CVI988-infected CEF DNA
were cloned using a TOPO TA cloning kit (Invitrogen, Carlsbad, Calif.)
and sequenced at the BioResource Center of Cornell University. The
forward universal and M13 reverse primers were used for the sequencing
reactions to obtain the nucleotide sequence in both directions. At
least two different clones originating from the same amplified reaction were sequenced for QT35 cell DNA, CVI988 DNA obtained from CEF, and
QMDV DNA obtained from CKC.
Computer analysis of the nucleic acid sequence data was accomplished
using LASERGENE software (DNASTAR Inc., Madison, Wis.).
The nucleotide
sequences and the deduced amino acid sequences
were aligned with and
compared to published MDV sequences, using
the multiple-sequence
alignment program CLUSTAL W (D. Higgins,
Heidelberg,
Germany).
IFA.
For indirect immunofluorescence assays (IFA),
uninfected QT35 cells, QT35 cells infected with HVT, and CKC infected
with the rescued QMDV were harvested onto coverslips after 72 h
and fixed in cold acetone for 10 min. CKC infected with JM-16 and
uninfected CKC were used as positive and negative controls,
respectively, for the expression of pp38. The coverslips were incubated
for 1 h at 37°C with monoclonal antibody (MAb) H19, kindly
provided by L. F. Lee, Avian Disease and Oncology Laboratory, East
Lansing, Mich.; this MAb detects pp38 of serotype 1 MDV
(20). The coverslips were washed three times with PBS and
incubated for 1 h at 37°C with fluorescein isothiocyanate
(FITC)-conjugated goat anti-mouse immunoglobulin (heavy and light
chains) (Southern Biotechnology Associates, Inc., Birmingham, Ala.).
The coverslips were washed three times with PBS, mounted on microscope
slides with glycerol-PBS (9:1), and examined using a Leitz fluorescence
microscope with epiillumination.
The dual expression of pp38 of type 1 MDV and the HVT glycoprotein
complex consisting of gp100, gp60, and gp49 (
61) in QT35
cells infected with HVT was examined using a double-staining technique
(
65). Coverslips with acetone-fixed cells were incubated in
PBS containing 0.1% Tween 20 (PBS-T) and 3% bovine serum albumin
for
1 h at room temperature (RTe) to block nonspecific binding
sites,
washed in PBS for 5 min, incubated with MAb H19 for 1 h
at RTe,
and washed three times in PBS-T. Subsequently, the coverslips
were
incubated for 1 h at RTe with FITC-conjugated goat Fab anti-mouse
IgG (ICN Biomedicals, Inc., Costa Mesa, Calif.) diluted in PBS-T,
washed three times in PBS-T, and incubated for 1 h at RTe with
MAb
L78, kindly provided L. F. Lee; this MAb is specific for the
HVT
gp100-gp60-gp49 complex (
61). The coverslips were washed
three times in PBS-T, incubated for 1 h at RTe with
tetramethylrhodamine
isothiocyanate (TRITC)-conjugated goat
affinity-purified anti-mouse
IgG (ICN Pharmaceuticals), washed three
times in PBS-T, and mounted
on microscope slides with glycerol-PBS
(9:1). Cells were examined
for the expression of pp38 and HVT
glycoproteins by switching
filters appropriate for exciting FITC and
TRITC,
respectively.
In vitro and in vivo rescue of QMDV from QT35 cells.
Duplicate cultures of primary CEF and CKC were inoculated with
102 to 106 QT35 cells when the cultures were 70 to 90% confluent. These cultures were incubated at 38.5°C in 5%
CO2 and were examined daily for cytopathic effects (CPE)
for 10 days. One blind passage of the inoculated CEF and CKC cultures
were made, and the cultures were incubated and examined for an
additional 10 days. In order to increase the possibility of virus
rescue, 8-day-old chicken embryos from the departmental SPF flock were
inoculated in the allantoic cavity with 107 QT35 cells, and
the eggs were transferred into isolation units and hatched. This
approach had previously been used to enhance the oncogenic potential of
MDV isolate with log oncogenicity (6). Chicks were removed
from the isolators at 6 days of age, and the kidneys were harvested
aseptically and used for cell cultures. Cultures were examined for the
presence or MDV-like foci for 7 days.
TEM.
For transmission electron microscopy (TEM), QT35 cells
and CKC infected with QMDV (p8) were pelleted, fixed in fixation buffer (2% glutaraldehyde, 1% formaldehyde, 0.1% sodium cacodylate), embedded in Epon-Araldite, sectioned at 50 µm, and stained with uranyl acetate and lead citrate. Sections were examined using a Zeiss
10C transmission electron microscope. A total of 1,000 QT35 cells were
examined for the presence of intranuclear herpesvirus particles and
C-type virus particles.
Nucleotide sequence accession numbers.
The GenBank accession
numbers for the QMDV genes described here are as follows:
AF193004 for gB, AF193005 for pp38, AF193003 for ORF L1,
AF193002 for meq, AF193001 for VP16, AF193000 for ICP22,
AF192998 for ICP27, and AF192997 for ICP4. The accession numbers for
gene fragments of MDV strain CVI988 are AF193012 for ORF L1, AF193011
for meq, AF193010 for VP16, AF193009 for ICP22, AF193008 for
ICP27, and AF193006 for ICP4.
| |
RESULTS |
Characterization of QT35 cells.
Herpesvirus particles and
C-type virus particles were not observed in thin sections of 1,000 cells by TEM. The results of PCR assays for detection of
reticuloendotheliosis virus LTR fragments and the ALV pol
gene were negative (data not shown).
Detection of MDV genes in QT35 cells by PCR and Southern
blotting.
Total DNA extracted from QT35 cells was found positive
for MDV by Southern blotting with probes representing several regions of the MDV genome (Fig. 2). Further
studies to characterize the MDV genome in QT35 cells were done by PCR.
Gene fragments were amplified from QT35 DNA prepared from two
independently maintained sublines of QT35 cells with primers for the
MDV ICP4, gB, pp38, and meq genes. These fragments were
identical in size to the corresponding fragments obtained from CVI988
(Fig. 3). Subsequently, fragments of
ICP22, ICP27, VP16, ORF L1, and pp14 were amplified by PCR. All PCR
products obtained from QT35 cells with MDV primers were of the expected
sizes. These products, referred to as QMDV, were cloned and sequenced.
The corresponding CVI988 gene fragments were also amplified, cloned,
and sequenced when the sequences were not available from GenBank.
View larger version (63K):
[in this window]
[in a new window]
|
FIG. 2.
Southern blot hybridization of QT35 cell DNA (lanes 2)
and DNA from CKC infected with the RB-1B strain of MDV (lanes 1),
probed with 32P-labeled BamHI-H (A) and
BamHI-I2(B) probes. Each lane was loaded with
the equivalent of 50,000 cells. DNA from control CKC was negative (data
not shown). The sizes of the fragments (in kilobases) are indicated.
|
|
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 3.
Amplification by PCR of ICP4 (A), pp38 (B),
meq (C), and gB (D) using DNA from CEF infected with MDV
strain CVI988 (lanes 1), QT35 cells (lanes 2), or uninfected CEF (lanes
3). The PCR products were separated by electrophoresis in 1.5% agarose
gels, stained with ethidium bromide, and visualized with an Eagle Eye
II still-video system. The sizes of the amplified fragments are
indicated.
|
|
The comparison of QMDV sequences with MDV sequences in GenBank or with
CVI988 sequences showed that the sequence of QMDV gB
is identical to
that of four MDV strains (RB-1B [GenBank accession
no.
D13713]
[
45], JM [GenBank accession no.
X91985] [M.
A. Sousloparov, unpublished data], the virulent strain Woodlands
no. 1 [GenBank accession no.
U39846] [
70], and CVI988
[our
data]). The sequence of ICP22 is identical to that of two
strains
(the virulent GA strain [GenBank accession no.
M80595 {47}
and GenBank accession no.
L22174 {3}] and CVI988 [our data]),
and that of ORF L1 is identical to that of three strains (GA [GenBank
accession no.
U34965] [
38], RB-1B [GenBank accession
no.
L19763] [
34], and CVI988 [our data]). Minor
sequence differences
were found between the QMDV and the MDV
meq, ICP27, VP16, pp38,
and pp14 genes. These differences
are summarized in Tables
2 and
3. Based on the differences in
nucleotides, several differences
are predicted for the
meq-encoded, VP16, and pp38 amino acid sequences
between
QMDV and MDV (Table
4).
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Sequence differences between MDV pp38 and pp14 genes in
QMDV and MDV strains CVI988, GA, HPRS16, MD5, and RB-1B
|
|
QMDV transcripts in QT35 cells and QT35 cells infected with
HVT.
Examination of QT35 cells for the presence of MDV-specific
transcripts was done by Northern blotting and RT-PCR. Northern blots
were positive when hybridized with the fragment covering ICP4
transcripts (Fig. 4A, lane 1). This
fragment detected a 4.5-kb transcript in QT35 cell RNA when the
double-stranded probe made to detect ICP4 was used. The LAT probe did
not detect any transcripts in QT35 cell DNA (Fig. 4B, lane 1). Several
transcripts were detected with both of those probes and RNA from
CVI988-infected CEF (Fig. 4A and B, lanes 2). Transcripts were not
detected in QT35 cell RNA when ORF L1, meq, and pp38 probes
were used but were present in RNA from CVI988-infected CEF (data not
shown).
View larger version (97K):
[in this window]
[in a new window]
|
FIG. 4.
Northern blot hybridization of total RNA from QT35 cells
(lane 1) and CEF infected with the CVI988 strain of MDV (lanes 2),
probed with 32P-labeled PCR fragments for ICP4 (A) and LATs
(B). The equivalent of 2.5 × 106 cells was loaded in
each lane. Note the transcript for ICP4 in lane 1 (arrowhead).
|
|
The following QMDV transcriptase were detected in QT35 cells by RT-PCR
using random hexamers: ORF L1 (Fig.
5),
ICP4 and/or
LAT (Fig.
6), and
meq (Fig.
7). All amplified
products were of
the predicted sizes and were comparable to the
fragments amplified
from RNA from CEF infected with MDV CVI988.
Transcripts for ICP22,
ICP27, VP16, pp38, or gB were not detected in
QT35 cells, while
the presence of transcripts for pp14 was not
examined.
View larger version (62K):
[in this window]
[in a new window]
|
FIG. 5.
Detection by RT-PCR of transcripts for ORF L1 (L1), gB,
pp38, VP16, ICP27, and ICP22 in QT35 cells, QT35 cells cocultivated
with CEF (QT35/CEF), QT35 cells cocultivated with HVT-infected CEF
(QT35/HVT), CEF infected with HVT (CEF/HVT), and CEF infected with
CVI988 (CEF/CVI988). CEF/HVT and CEF/CVI988 were used as negative and
positive controls, respectively. RT-PCR for actin was used as a
positive control for RNA isolation. cDNA was prepared using reverse
transcriptase (RT); a PCR assay in the absence of RT was used to
determine if contaminating DNA was present. The PCR products were
separated by electrophoresis in 1.5% agarose gels, stained with
ethidium bromide, and visualized with an Eagle Eye II still-video
system. The sizes of the amplified fragments are indicated.
|
|
View larger version (44K):
[in this window]
[in a new window]
|
FIG. 6.
Detection by RT-PCR of transcripts for ICP4 and LATs in
QT35, QT35 cocultivated with CEF (QT35/CEF), QT35 cocultivated with
HVT-infected CEF (QT35/HVT), CEF infected with HVT (CEF/HVT), and CEF
infected with CVI988 (CEF/CVI988). CEF/HVT and CEF/CVI988 were used as
negative and positive controls, respectively. cDNA was prepared using
reverse transcriptase (RT); a PCR assay in the absence of RT was used
to determine if contaminating DNA was present. (A) Locations of primers
used in the RT-PCR assay. The different transcripts, from top to
bottom, are as follows: ICP4 ORF (2), MSRs (10,
11), the 2.2- and 1.8-kb RNAs (27), and the 2.7-kb RNA
)21, 22). The open box indicates an unknown sequence within
the MSRs. The amplified regions for the ICP4 transcript and each
potential LAT predicted with the LATs2-5-LATs2-3 primer pair are
boxed. (B) Detection of transcripts using random-hexamer primers,
LATs2-5, and LATs2-3 to obtain c-DNA from total RNA. The sizes of the
amplified fragments and the types of transcripts are indicated at the
right. The primer used to obtain cDNA and the primer pair used for
amplification are indicated at the left. The PCR products were
separated by electrophoresis in 1.5% agarose gels, stained with
ethidium bromide, and visualized with an Eagle Eye II still-video
system. (C) Southern blot hybridization of amplified LATs and ICP4. The
PCR products were separated by electrophoresis in 1.5% agarose gels,
transferred to membranes by Southern blotting, and hybridized to a
probe prepared from the cloned ICP4 gene from MDV strain CVI988.
|
|
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 7.
Detection by RT-PCR of meq and antisense
meq transcripts in QT35 cells, QT35 cells cocultivated with
CEF (QT35/CEF), QT35 cells cocultivated with HVT-infected CEF
(QT35/HVT), CEF infected with HVT (CEF/HVT), and CEV infected with
CVI988 (CEF/CVI988). CEF/HVT and CEF/CVI988 were used as negative
and positive controls, respectively. cDNA was prepared using reverse
transcriptase (RT); a PCR assay in the absence of RT was used to
determine if contaminating DNA was present. (A) Locations of the
5meq/meqsRT and 3meqRTanti primers in relation to the meq
and antisense meq ORFs and ORF L1. The predicted
amplicon is indicated by a vertically oriented box and
will detect nonspliced meq mRNA or antisense ORF-1,
depending on the primer used to generate the cDNA. (B) Detection of
transcripts by RT-PCR using random-hexamer primers, 3meqRTanti, or
5meq/meqsRT to obtain cDNA. The sizes of the amplified fragments and
the types of transcripts are indicated at the right. The PCR products
were separated by electrophoresis in 1.5% agarose gels, stained with
ethidium bromide, and visualized with an Eagle Eye II still-video
system.
|
|
Infection of QT35 with HVT-infected CEF but not with control CEF
resulted in the activation of gB, pp38, VP16, ICP22, and
ICP27
transcripts (Fig.
5 and Table
5) and an
apparent enhancement
in transcriptional activity for ICP4 (Fig.
6). The
amplified products
were of the predicted sizes and were comparable to
the products
amplified from RNA from CEF infected with CVI988. The
primers
used in the RT-PCR assays (Table
1) failed to amplify
HVT-specific
transcripts, demonstrating that these primers were
specific for
MDV serotype 1 (Fig.
5,
6, and
7). Amplification required
the
use of RT, demonstrating that the products were not the result
of
DNA contamination (Fig.
5,
6, and
7).
The location of the ICP4 ORF is overlapped by an antisense ORF coding
for the LATs. The latter codes for a complex set of
MSRs lacking a
poly(A) tail (
11) as well as a series of mRNAs
(
21,
22,
27) (Fig.
6A). RT-PCR products of the expected
sizes were
amplified from RNAs obtained from QT35 cells, QT35
cells inoculated
with CEF, QT35 cells inoculated with HVT-infected
CEF, and CEF infected
with CVI988 when random hexamers were used
in the RT reaction. Primers
LATs2-5 and LATs2-3 were used in the
RT reaction to obtain cDNAs coding
for ICP4 and LATs, respectively,
to determine if ICP4 transcripts
and/or LATs were present in the
RNA preparations. LATs and ICP4
transcripts were demonstrated
when both primers were used in the RT
reaction but only after
Southern hybridization. The signals for LATs
were stronger than
those for ICP4 transcripts in RNAs obtained from
QT35 cells and
QT35 cells inoculated with CEF, but inoculation of QT35
cells
with HVT-infected CEF resulted in a marked increase for ICP4
transcripts
(Fig.
6B and
C).
The
meq region codes for ORF L1 (
34,
38), the
meq transcript, and a spliced
meq transcript
(
38). In addition, two antisense
ORFs have been identified
(
37) in this region (Fig.
7A). When
random hexamers were
used in the RT reaction, a PCR product of
339 bp was detected in the
meq region for RNAs from QT35 cells,
QT35 cells inoculated
with CEF, QT35 cells inoculated with HVT-infected
CEF, and CEF infected
with CVI988 but not HVT-infected CEF (Fig.
7B). When strand-specific
primers were used for the preparation
of cDNAs, RT-PCR products for
meq and antisense ORF1 were detected
in all samples that
were found positive when random hexamers were
used. Unfortunately, the
DNase treatment of the positive control
(CEF infected with CVI988) was
incomplete in this experiment,
but all other RNA preparations were free
of contaminating DNA
(Fig.
7B).
Detection of serotype 1 MDV-specific pp38 protein in QT35 cells
infected with HVT.
Inoculation of QT35 cells with HVT-infected CEF
resulted in the development of CPE consisting of syncytia and rounded
cells. CPE was not observed after inoculation of QT35 cells with CEF or
in control QT35 cells. MDV pp38 was detected in the syncytia and
rounded cells by IFA with MAb H19, which is specific for pp38 produced
by serotype 1 MDV strains. Dual staining of the QT35 cells infected
with HVT with MAb H19 and the HVT-specific MAb indicated that the
syncytia and rounded cells were positive for HVT and pp38 (Fig.
8). QT35 cells and QT35 cells inoculated
with CEF were negative for pp38.
View larger version (76K):
[in this window]
[in a new window]
|
FIG. 8.
Detection of serotype 1 MDV-specific pp38 in QT35 cells
inoculated with HVT-infected CEF (QT35/HVT). (A) QT35/HVT cells stained
with pp38-specific MAB H19 and FITC-conjugated goat anti-mouse
immunoglobulin (heavy and light chains) [Ig (H+L)]. Note the
cytoplasmic fluorescence. QT35 cells or QT35 cells inoculated with CEF
and treated in a similar way were negative (data not shown). (B)
Positive control for pp38 staining. CKC infected with the JM-16 strain
of MDV were stained as described for panel A. (C and D) QT35/HVT cells
were examined for coexpression of serotype 1 MDV pp38 and an HVT
glycoprotein using MAbs H19 and L78, respectively, FITC-conjugated goat
anti-mouse Ig (H+L), and TRITC-conjugated goat affinity-purified
anti-mouse IgG. Cells were examined for expression of pp38 and HVT
glycoprotein by switching filters appropriate for exciting FITC and
TRITC, respectively.
|
|
Virus isolation and characterization.
CKC and CEF inoculated
with different numbers of QT35 cells did not develop CPE after one
blind passage. In contrast, CPE developed within 4 days in parallel
cultures inoculated with CVI988. Kidney cell cultures were prepared
from two 6-day-old chicks and one 9-day-old chick that had been
inoculated with QT35 cells at 8 days of embryonation. MDV-like CPE
consisting of small clusters of round cells were detected in the
culture from both chicks at 6 days postplating. QMDV (p3) stained
positive for pp38 with MAb H19 in IFA (data not shown). TEM examination
of thin sections revealed typical nonenveloped herpesvirus particles
that were randomly scattered in the nuclei of CKC. Some of the capsids
lacked DNA (Fig. 9).
View larger version (165K):
[in this window]
[in a new window]
|
FIG. 9.
Nonenveloped herpesvirus particles in the nucleus of a
CKC infected with MDV recovered from QT35 cells. Bar, 100 nm.
|
|
Selected fragments of virus-infected CKC were amplified by PCR with the
same primers as those used for the amplification of
QMDV fragments from
QT35 cells. All fragments were identical to
the QT35 fragments (Tables
2 and
3).
| |
DISCUSSION |
The finding that two independently maintained sublines of QT35
cells are positive for an MDV-like virus, or QMDV, was quite unexpected. This result raises important questions concerning the
origin of QMDV in QT35 cells, its potential role in the development of
MCA-induced tumors in Japanese quail, and the development of cell lines
from these tumors. Moreover, the experiments in which QT35 cells were
inoculated with HVT suggest that QT35 cells can be used as a model to
study reactivation of a truly latent alphaherpesvirus, especially
because TEM examination failed to demonstrate herpesvirus particles in
these cells.
Southern hybridization and PCR assays were used to examine QT35 cells
for the presence of MDV-like sequences. Viral DNA representing parts of
the TRL and IRL sequences and adjacent parts of
the UL sequence was detected by Southern hybridization.
Subsequent studies were done by PCR to facilitate cloning and
sequencing of specific gene fragments. All primer combinations yielded
fragments of the expected sizes, and sequence analysis indicated that
the QMDV genes are identical or almost identical to the IE, early, and late genes of MDV. These genes are apparently functional, because infection of QT35 cells with HVT induced the transcription of these
genes, and an MDV-like agent was recovered. Unfortunately, the paucity
of serotype-specific MAbs made it impossible to demonstrate that these
transcripts were also translated, with the exception of pp38, for which
a serotype-specific MAb is available.
Attempts to isolate a herpesvirus from the QT35 cells by cocultivation
with CKC or CEF failed. It was hypothesized that virus might be rescued
after inoculation of chicken embryos, hatching of the chicks, and use
of their kidneys in cell cultures for virus isolation attempts.
This approach was used for the following reasons: (i) MDV is not
transmitted vertically in chickens (66); (ii) cell
cultures are not as sensitive to virus replication as chicks (49); and (iii) inoculation of immunologically incompetent
chicken embryos had previously been used by Calnek et al.
(6) to demonstrate that MDV strains with low oncogenic
potential can result in increased tumor formation. The increased
oncogenicity observed in their study was the consequence of enhanced
viral replication, suggesting that this approach could work for virus
isolation from QT35 cells. A virus with the typical morphology of
nonenveloped herpesvirus particles was indeed isolated from CKC (Fig.
9), as has been described for the cell-associated replication of MDV in
cell cultures (31). This virus probably belongs to serotype
1, based on staining with a serotype 1-specific MAb, and sequence
information of selected fragments suggests that it is similar to QMDV
present in QT35 cells. It is highly unlikely that this virus could be
the result of contamination by horizontal infection of the chicks,
because they were housed in thoroughly disinfected isolators with Hepa filters (Andersen 2000, Peachtree City, Ga.). Imai et al.
(17) were also unable to isolate an MDV-like virus by
inoculation of CKC and CEF cultures with blood from Japanese quail with
lymphoproliferative lesions. However, virus was rescued by inoculation
of quail blood cells into SPF chickens. This group suggested that the
quail virus was different from but related to serotype 1 MDV.
The origin of QMDV sequences in QT35 cells is not clear. The fact
that QMDV sequences were found in two independently maintained QT35
cell lines, one of which has to our knowledge never been in a
laboratory with MDV, argues against laboratory contamination. In
addition, MDV sequences have been detected recently in four other
sublines of QT35 cells (D. Junker, personal communication; V. Zelnik,
personal communication). If it was laboratory contamination, it must
have occurred at least before 1982. Independently of the origin of MDV,
the findings in this paper clearly demonstrate that QMDV is present as
a latent virus that can be fully reactivated in vivo or partially in
QT35 cells by superinfection with HVT. It is possible that QMDV came
from an adventitious infection in the quail that were used to generate
the MCA-induced tumors. Japanese quails can become infected with MDV
when they are kept in close contact with chickens (40).
Japanese quail can also be experimentally infected with chicken MDV
strains causing lesions (19) or only establishing infection
(28). A more intriguing explanation is that an MDV-like
virus is present in Japanese quail either as a complete or as an
incomplete virus. Shih and coworkers (42, 58-60) found that
DNA extracted from atherosclerotic lesions in Japanese quail was
positive for MDV DNA in Southern hybridization assays using
nonspecified fragments from an EcoRI MDV DNA library as a
probe. They were able to develop a quail line after four generations
that was highly susceptible to atherosclerosis. DNA samples extracted
from individual embryos from this highly susceptible line were
all positive for MDV DNA in a dot blot hybridization assay, while DNA
samples from embryos from a more resistant line were either
positive or negative. However, an MDV-like virus could not be isolated
from embryonal or adult tissues, a result which is certainly compatible
with the failure to rescue QMDV from QT35 cells. The suggestion of
vertical transmission of an MDV-like virus in quail is
intriguing, especially because there is no evidence for vertical
transmission in chickens (66).
As with other herpesviruses, the induction and maintenance of latency
in MDV are poorly understood. Transcripts were not detected by Northern
blot hybridization, with the exception of a 4.5-kb fragment detected by
the ICP4 probe. However, this was a double-stranded probe and may
have detected one of the LATs. The use of RT-PCR demonstrated the
presence of additional transcripts. The ORF L 1, LATs, ICP4,
meq, and antisense meq transcripts detected by RT-PCR in QT35 cells have been previously reported for lytic MDV infections and/or for lymphoblastoid cell lines, but the relative contributions to transformation and/or latency have not been fully elucidated for these transcripts. ORF L1 was originally isolated from a
tumor cell line by use of a cDNA library, but this transcript could
also be detected during lytic infection. Schat et al. (57) demonstrated that the deletion of ORF L1 did not interfere with the
establishment of or reactivation from latency. The presence of this
transcript in QT35 cells is certainly compatible with a role in the
transformation process.
MDV ICP4 can transactivate other MDV genes, e.g., the pp38 gene
(41), and activation of ICP4 is probably also a
prerequisite for the reaction of MDV from latency. The findings that
LATs are the major transcripts and ICP4 is the minor transcript
in QT35 cells (Fig. 4), with no reactivation of other IE,
early, or late gene transcripts, suggest that the balance between LATs
and ICP4 is important in maintaining latency in QT35 cells. After
infection with HVT, transcriptional activity for ICP4 increases, and
downstream genes are activated. Studies to determine if the expression
of HVT ICP4 alone is able to cause the transactivation of QMDV ICP4 and
other genes are in progress.
The finding that infection of QT35 cells with HVT causes increased
transcription of ICP4 and the initiation of transcription of two other
IE genes (ICP27 and ICP22) and of early and late genes is of
considerable interest. It suggests that QT35 cells can be used as an in
vitro model to study the molecular mechanisms of reactivation of an
alphaherpesvirus from latency. For example, the roles of ICP4 and ICP27
in the activation of transcription of pp38 and pp14 are currently not
clear. ICP4 and ICP27 can both promote the transcription of pp38 and
pp14 by independent activation of the bidirectional promoter of pp38
and pp14, but apparently not in a cooperative fashion (43).
Current studies are directed toward the elucidation of the role of both
IE genes in the QMDV reactivation cascade in QT35 cells.
| |
ACKNOWLEDGMENTS |
We thank Robert Nordhausen (California Veterinary Diagnostic
Laboratory System, University of California
Davis) for assistance with
TEM; Carol Cardona, P. H. O'Connell, and S. Khan for technical assistance and valuable suggestions; and K. W. Jarosinski and C. J. Markowski for critical reading of the manuscript.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Unit of Avian
Health, Department of Microbiology and Immunology, College of
Veterinary Medicine, Cornell University, Ithaca, NY 14853-6401. Phone:
(607) 253-4032. Fax: (607) 253-3384. E-mail:
kas24{at}cornell.edu.
Present address: Department of Veterinary Microbiology, Faculty of
Agriculture, Gifu University, 1-1 Yanagido, 501-11 Gifu, Japan.
Present address: Department of Population Health and Reproduction,
School of Veterinary Medicine, University of CaliforniaDavis, Davis,
CA 95616.
| |
REFERENCES |
| 1.
|
Akiyama, Y., and S. Kato.
1974.
Two cell lines from lymphomas of Marek's disease.
Biken J.
17:105-116[Medline].
|
| 2.
|
Anderson, A. S.,
A. Francesconi, and R. W. Morgan.
1992.
Complete nucleotide sequence of the Marek's disease virus ICP4 gene.
Virology
189:657-667[CrossRef][Medline].
|
| 3.
|
Brunovskis, P., and L. F. Velicer.
1995.
The Marek's disease virus (MDV) unique short region: alphaherpesvirus-homologous, fowlpox virus-homologous, and MDV-specific genes.
Virology
206:324-338[CrossRef][Medline].
|
| 4.
|
Buckmaster, A. E.,
S. D. Scott,
M. J. Sanderson,
M. E. Boursnell,
N. L. Ross, and M. M. Binns.
1988.
Gene sequence and mapping data from Marek's disease virus and herpesvirus of turkeys: implications for herpesvirus classification.
J. Gen. Virol.
69:2033-2042[Abstract/Free Full Text].
|
| 5.
|
Buranathai, C.,
J. Rodriguez, and C. Grose.
1997.
Transformation of primary chick embryo fibroblasts by Marek's disease virus.
Virology
239:20-35[CrossRef][Medline].
|
| 6.
|
Calnek, B. W.,
J. Fabricant,
K. A. Schat, and K. K. Murthy.
1977.
Pathogenicity of low-virulence Marek's disease viruses in normal versus immunologically compromised chickens.
Avian Dis.
21:346-358[CrossRef][Medline].
|
| 7.
|
Calnek, B. W.,
K. K. Murthy, and K. A. Schat.
1978.
Establishment of Marek's disease lymphoblastoid cell lines from transplantable versus primary lymphomas.
Int. J. Cancer
21:100-107[Medline].
|
| 8.
|
Calnek, B. W.,
W. R. Shek, and K. A. Schat.
1981.
Spontaneous and induced herpesvirus genome expression in Marek's disease tumor cell lines.
Infect. Immun.
34:483-491[Abstract/Free Full Text].
|
| 9.
|
Calnek, B. W.,
B. Lucio,
K. A. Schat, and H. S. Lillehoj.
1989.
Pathogenesis of Marek's disease virus-induced local lesions. 1. Lesion characterization and cell line establishment.
Avian Dis.
33:291-302[CrossRef][Medline].
|
| 10.
|
Cantello, J. L.,
A. S. Anderson, and R. W. Morgan.
1994.
Identification of latency-associated transcripts that map antisense to the ICP4 homolog gene of Marek's disease virus.
J. Virol.
68:6280-6290[Abstract/Free Full Text].
|
| 11.
|
Cantello, J. L.,
M. S. Parcells,
A. S. Anderson, and R. W. Morgan.
1997.
Marek's disease virus latency-associated transcripts belong to a family of spliced RNAs that are antisense to the ICP4 homolog gene.
J. Virol.
71:1353-1361[Abstract].
|
| 12.
|
Cho, B. R.
1981.
A simple in vitro differentiation between turkey herpesvirus and Marek's disease virus.
Avian Dis.
25:839-846[CrossRef][Medline].
|
| 13.
|
Cowen, B. S., and M. O. Braune.
1988.
The propagation of avian viruses in a continuous cell line (QT35) of Japanese quail origin.
Avian Dis.
32:282-297[CrossRef][Medline].
|
| 14.
|
DeLuca, N. A., and P. A. Schaffer.
1985.
Activation of immediate-early, early, and late promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4.
Mol. Cell. Biol.
5:1997-2008[Abstract/Free Full Text].
|
| 15.
|
Dixon, R. A., and P. A. Schaffer.
1980.
Fine-structure mapping and functional analysis of temperature-sensitive mutants in the gene encoding the herpes simplex virus type 1 immediate-early protein VP175.
J. Virol.
36:189-203[Abstract/Free Full Text].
|
| 16.
|
Fukuchi, K.,
M. Sudo,
Y. S. Lee,
A. Tanaka, and M. Nonoyama.
1984.
Structure of Marek's disease virus DNA: detailed restriction enzyme map.
J. Virol.
51:102-109[Abstract/Free Full Text].
|
| 17.
|
Imai, K.,
N. Yuasa,
K. Kobayashi,
K. Nakamura,
K. Tsukamoti, and H. Hihara.
1990.
Isolation of Marek's disease virus from Japanese quail with lymphoproliferative disease.
Avian Pathol.
19:119-129.
|
| 18.
|
Jones, D.,
L. Lee,
J. L. Liu,
H. J. Kung, and J. K. Tillotson.
1992.
Marek's disease virus encodes a basic-leucine zipper gene resembling the fos/jun oncogenes that is highly expressed in lymphoblastoid tumors.
In
Proc. Natl Acad. Sci. USA 89:40432-4046.
|
| 19.
|
Khare, M. L.,
J. Grun, and E. V. Adams.
1975.
Marek's disease in Japanese quail: a pathological, virological and serological study.
Poultry Sci.
54:2066-2068[Medline].
|
| 20.
|
Lee, L. F.,
X. Liu, and R. L. Witter.
1983.
Monoclonal antibodies with specificity for three different serotypes of Marek's disease viruses in chickens.
J. Immunol.
130:1003-1006[Abstract].
|
| 21.
|
Li, D.,
G. O'Sullivan,
L. Greenall,
G. Smith,
C. Jiang, and N. Ross.
1998.
Further characterization of the latency-associated transcription of Marek's disease virus.
Arch. Virol.
143:293-311.
|
| 22.
|
Li, D. S.,
J. Pastorek,
V. Zelnik,
G. D. Smith, and L. J. Ross.
1994.
Identification of novel transcripts complementary to the Marek's disease virus homologue of the ICP4 gene of herpes simplex virus.
J. Gen. Virol.
75:1713-1722[Abstract/Free Full Text].
|
| 23.
|
Liu, J. L.,
L. F. Lee,
Y. Ye,
Z. Qian, and H. J. Kung.
1997.
Nucleolar and nuclear localization properties of a herpesvirus bZIP oncoprotein, Meq.
J. Virol.
71:3188-3196[Abstract].
|
| 24.
|
Liu, J. L.,
Y. Ye,
L. F. Lee, and H. J. Kung.
1998.
Transforming potential of the herpesvirus oncoprotein Meq: morphological transformation, serum-independent growth, and inhibition of apoptosis.
J. Virol.
72:388-395[Abstract/Free Full Text].
|
| 25.
|
Liu, J. L.,
Y. Ye,
Z. Qian,
Y. Qian,
D. J. Templeton,
L. F. Lee, and H. J. Kung.
1999.
Functional interactions between herpesvirus oncoprotein Meq and cell cycle regulator CDK2.
J. Virol.
73:4208-4219[Abstract/Free Full Text].
|
| 26.
|
Liu, J.-L.,
S.-F. Lin,
L. Xia,
P. Brunovskis,
D. Li,
I. Davidson,
L. F. Lee, and H.-J. Kung.
1999.
Meq and v-IL8: cellular genes in disguise?
Acta Virol.
43:94-101[Medline].
|
| 27.
|
McKie, E. A.,
E. Ubukata,
S. Hasegawa,
S. Zhang,
M. Nonoyama, and A. Tanaka.
1995.
The transcripts from the sequences flanking the short components of Marek's disease virus during latent infection form a unique family of 3'-coterminal RNAs.
J. Virol.
69:1310-1314[Abstract].
|
| 28.
|
Mikami, T.,
M. Onuma,
T. T. Hayashi,
M. Narita, and K. Okada.
1975.
Pathogenic and serologic studies of Japanese quail infected with JM strain of Marek's disease herpesvirus.
J. Natl. Cancer Inst.
54:607-614.
|
| 29.
|
Morgan, R. W.,
J. L. Cantello, and C. H. McDermott.
1990.
Transfection of chicken embryo fibroblasts with Marek's disease virus DNA.
Avian Dis.
34:345-351[CrossRef][Medline].
|
| 30.
|
Moscovici, C.,
M. G. Moscovici,
H. Jimenez,
M. M. Lai,
M. J. Hayman, and P. K. Vogt.
1977.
Continuous tissue culture cell lines derived from chemically induced tumors of Japanese quail.
Cell
11:95-103[CrossRef][Medline].
|
| 31.
|
Nazerian, K., and H. G. Purchase.
1970.
Combined fluorescent-antibody and electron microscopy study of Marek's disease virus-infected cell culture.
J. Virol.
5:79-90[Abstract/Free Full Text].
|
| 32.
|
Nazerian, K., and R. L. Witter.
1975.
Properties of a chicken lymphoblastoid cell line from Marek's disease tumor.
J. Natl. Cancer Inst.
54:453-458.
|
| 33.
|
Ohashi, K.,
P. H. O'Connell, and K. A. Schat.
1994.
Characterization of Marek's disease virus BamHI-A-specific cDNA clones obtained from a Marek's disease lymphoblastoid cell line.
Virology
199:275-283[CrossRef][Medline].
|
| 34.
|
Ohashi, K.,
W. Zhou,
P. H. O'Connell, and K. A. Schat.
1994.
Characterization of a Marek's disease virus BamHI-L-specific cDNA clone obtained from a Marek's disease lymphoblastoid cell line.
J. Virol.
68:1191-1195[Abstract/Free Full Text].
|
| 35.
|
Payne, L. N.,
K. Howes,
M. Rennie,
J. M. Bumstead, and A. W. Kidd.
1981.
Use of an agar culture technique for establishing lymphoid cell lines from Marek's disease lymphomas.
Int. J. Cancer
28:757-766[Medline].
|
| 36.
|
Peng, Q., and Y. Shirazi.
1996.
Characterization of the protein product encoded by a splicing variant of the Marek's disease virus Eco-Q gene Meq.
Virology
226:77-82[CrossRef][Medline].
|
| 37.
|
Peng, Q., and Y. Shirazi.
1996.
Isolation and characterization of Marek's disease virus (MDV) cDNAs from a MDV-transformed lymphoblastoid cell line: identification of an open reading frame antisense to the MDV Eco-Q protein (Meq).
Virology
221:368-374[CrossRef][Medline].
|
| 38.
|
Peng, Q.,
M. Zeng,
Z. A. Bhuiyan,
E. Ubukata,
A. Tanaka,
M. Nonoyama, and Y. Shirazi.
1995.
Isolation and characterization of Marek's disease virus (MDV) cDNAs mapping to the BamHI-I2, BamHI-Q2, and BamHI-L fragments of the MDV genome from lymphoblastoid cells transformed and persistently infected with MDV.
Virology
213:590-599[CrossRef][Medline].
|
| 39.
|
Powell, P. C.,
L. N. Payne,
J. A. Frazier, and M. Rennie.
1974.
T lymphoblastoid cell lines from Marek's disease lymphomas.
Nature
251:79-80[CrossRef][Medline].
|
| 40.
|
Pradham, H. K.,
G. C. Mohanty, and A. Mukit.
1985.
Marek's disease in Japanese quails (Coturnix coturnix japonica): a study of natural cases.
Avian Dis.
29:575-582[CrossRef][Medline].
|
| 41.
|
Pratt, W. D.,
J. L. Cantello,
R. W. Morgan, and K. A. Schat.
1994.
Enhanced expression of the Marek's disease virus-specific phosphoproteins after stable transfection of MSB-1 cells with the Marek's disease virus homolog of ICP4.
Virology
201:132-136[CrossRef][Medline].
|
| 42.
|
Pyrzak, R., and J. C. Shih.
1987.
Detection of specific DNA segments of Marek's disease herpes virus in Japanese quail susceptible to atherosclerosis.
Atherosclerosis
68:77-85[CrossRef][Medline].
|
| 43.
|
Ren, D.,
L. F. Lee, and P. M. Coussens.
1996.
Regulatory function of the Marek's disease virus ICP27 gene product, p. 170-175.
In
R. F. Silva, H. H. Cheng, P. M. Coussens, L. F. Lee, and L. F. Velicer (ed.), Current research on Marek's disease. Proceedings of the 5th International Symposium on Marek's disease. American Association of Avian Pathologists, Kennett Square, Pa.
|
| 44.
|
Rispens, B. H.,
J. V. Vloten,
N. Mastenbroek,
H. J. L. Maas, and K. A. Schat.
1972.
Control of Marek's disease in the Netherlands. I. Isolation of an avirulent Marek's disease virus (strain CVI988) and its use in laboratory vaccination trials.
Avian Dis.
16:108-125[CrossRef][Medline].
|
| 45.
|
Ross, L. J.,
M. Sanderson,
S. D. Scott,
M. M. Binns,
T. Doel, and B. Milne.
1989.
Nucleotide sequence and characterization of the Marek's disease virus homologue of glycoprotein B of herpes simplex virus.
J. Gen. Virol.
70:1789-1804[Abstract/Free Full Text].
|
| 46.
|
Ross, L. J. N.
1999.
T-cell transformation by Marek's disease virus.
Trends Microbiol.
7:22-29[CrossRef][Medline].
|
| 47.
|
Sakaguchi, M.,
T. Urakawa,
Y. Hirayama,
N. Miki,
M. Yamamoto, and K. Hirai.
1992.
Sequence determination and genetic content of an 8.9-kb restriction fragment in the short unique region and the internal inverted repeat of Marek's disease virus type 1 DNA.
Virus Gene
6:365-378[CrossRef][Medline].
|
| 48.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 49.
|
Schat, K. A.
1984.
Characteristics of the virus, p. 77-112.
In
L. N. Payne (ed.), Marek's disease. Developments in veterinary virology. Martinus Nijhoff Publishers, Boston, Mass.
|
| 50.
|
Schat, K. A.
1987.
Marek's diseasea model for protection against herpesvirus-induced tumors.
Cancer Surv.
6:1-37.
|
| 51.
|
Schat, K. A., and H. G. Purchase.
1998.
Cell-culture methods, p. 223-234.
In
D. E. Swayne, J. R. Glisson, M. W. Jackwood, J. E. Pearson, and W. M. Reed (ed.), A laboratory manual for the isolation and identification of avian pathogens, 4th ed. American Association of Avian Pathologists, Kennett Square, Pa.
|
| 52.
|
Schat, K. A., and Z. Xing.
2000.
Specific and nonspecific immune responses to Marek's disease virus.
Dev. Comp. Immunol.
24:201-221[CrossRef][Medline].
|
| 53.
|
Schat, K. A.,
B. W. Calnek, and J. Fabricant.
1982.
Characterization of two highly oncogenic strains of Marek's disease virus.
Avian Pathol.
11:593-605[Medline].
|
| 54.
|
Schat, K. A.,
B. W. Calnek,
J. Fabricant, and D. L. Graham.
1985.
Pathogenesis of infection with attenuated Marek's disease virus strains.
Avian Pathol.
14:127-146[Medline].
|
| 55.
|
Schat, K. A.,
A. Buckmaster, and L. J. N. Ross.
1989.
Partial transcription map of Marek's disease herpesvirus in lytically infected cells and lymphoblastoid cell lines.
Int. J. Cancer
44:101-109[Medline].
|
| 56.
|
Schat, K. A.,
C. L. Chen,
V. W. Calnek, and D. Char.
1991.
Transformation of T-lymphocyte subsets by Marek's disease herpesviruses.
J. Virol.
65:1408-1413[Abstract/Free Full Text].
|
| 57.
|
Schat, K. A.,
B. J. L. Hooft van Iddekinge,
H. Boerrigter,
P. H. O'Connell, and G. Koch.
1998.
Open reading frame L1 of Marek's disease herpesvirus is not essential for in vitro and in vivo replication and establishment of latency.
J. Gen. Virol.
79:841-849[Abstract].
|
| 58.
|
Shih, J. C., and D. W. Kelemen.
1995.
Possible role of viruses in atherosclerosis.
Adv. Exp. Med. Biol.
369:89-98[Medline].
|
| 59.
|
Shih, J. C.,
D. W. Kelemen, and S. C. Landers.
1994.
Culture characterization and viral infection of aortic smooth muscle cells from Japanese quail susceptible to atherosclerosis.
Exp. Mol. Pathol.
61:191-202[CrossRef][Medline].
|
| 60.
|
Shih, J. C.,
R. Pyrzak, and J. S. Guy.
1989.
Discovery of noninfections viral genes complementary to Marek's disease herpes virus in quail susceptible to cholesterol-induced atherosclerosis.
J. Nutr.
119:294-298.
|
| 61.
|
Silva, R. F., and L. F. Lee.
1984.
Monoclonal antibody-mediated immunoprecipitation of proteins from cells infected with Marek's disease or turkey herpesvirus.
Virology
136:307-320[CrossRef][Medline].
|
| 62.
|
Tieber, V. L.,
L. L. Zalinskis,
R. F. Silva,
A. Finkelstein, and P. M. Coussens.
1990.
Transactivation of the Rous sarcoma virus long terminal repeat promoter by Marek's disease virus.
Virology
179:719-727[CrossRef][Medline].
|
| 63.
|
Wade, L. L.,
E. W. Polack,
P. H. O'Connell,
G. S. Starrak,
N. Abou-Madi, and K. A. Schat.
1999.
Multicentric lymphoma in a European starling (Sturnus vulgaris).
J. Avian Med. Surg.
13:108-115.
|
| 64.
|
Wagner, E. K., and D. C. Bloom.
1997.
Experimental investigation of herpes simplex virus latency.
Clin. Microbiol. Rev.
10:419-443[Abstract].
|
| 65.
|
Wessel, G. M., and D. R. McClay.
1986.
Two embryonic, tissue-specific molecules identified by a double-label immunofluorescence technique for monoclonal antibodies.
J. Histochem. Cytochem.
34:703-706[Abstract].
|
| 66.
|
Witter, R. L., and J. J. Solomon.
1972.
Prospects for the control of Marek's disease through isolation rearing.
Prog. Immunobiol. Stand.
5:163-168[Medline].
|
| 67.
|
Witter, R. L.,
K. Nazerian,
H. G. Purchase, and G. H. Burgoyne.
1970.
Isolation from turkeys of a cell-associated herpesvirus antigenically related to Marek's disease virus.
Am. J. Vet. Res.
31:525-538[Medline].
|
| 68.
|
Xing, Z.,
Q. Xie,
R. W. Morgan, and K. A. Schat.
1999.
A monoclonal antibody to ICP4 of MDV recognizing ICP4 of serotype 1 and 3 MDV strains.
Acta Virol.
43:113-120[Medline].
|
| 69.
|
Zelnik, V.
1995.
Marek's disease and new approaches to its control.
Acta Virol.
39:53-63[Medline].
|
| 70.
|
Zerbes, M.,
G. A. Tannock,
R. J. Jenner, and P. L. Young.
1994.
Some characteristics of a recent virulent isolate of Marek's disease virus.
Aust. Vet. J.
71:21-22[Medline].
|
Journal of Virology, November 2000, p. 10176-10186, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, G., Raghavan, B., Kotur, M., Cheatham, J., Sedmak, D., Cook, C., Waldman, J., Trgovcich, J.
(2007). Antisense Transcription in the Human Cytomegalovirus Transcriptome. J. Virol.
81: 11267-11281
[Abstract]
[Full Text]
-
Jarosinski, K. W., Osterrieder, N., Nair, V. K., Schat, K. A.
(2005). Attenuation of Marek's Disease Virus by Deletion of Open Reading Frame RLORF4 but Not RLORF5a. J. Virol.
79: 11647-11659
[Abstract]
[Full Text]
-
Gimeno, I. M., Witter, R. L., Hunt, H. D., Reddy, S. M., Lee, L. F., Silva, R. F.
(2005). The pp38 Gene of Marek's Disease Virus (MDV) Is Necessary for Cytolytic Infection of B Cells and Maintenance of the Transformed State but Not for Cytolytic Infection of the Feather Follicle Epithelium and Horizontal Spread of MDV. J. Virol.
79: 4545-4549
[Abstract]
[Full Text]
-
Laurent, S., Esnault, E., Rasschaert, D.
(2004). Single-nucleotide polymorphisms in two Marek's disease virus genes (Meq and gD): application to a retrospective molecular epidemiology study (1982-1999) in France. J. Gen. Virol.
85: 1387-1392
[Abstract]
[Full Text]
Top
Abstract
Introduction
