Previous Article | Next Article 
Journal of Virology, November 2000, p. 10142-10152, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Infectious Epstein-Barr Virus Lacking Major
Glycoprotein BLLF1 (gp350/220) Demonstrates the Existence of Additional
Viral Ligands
Annette
Janz,1
Muhsin
Oezel,2
Christian
Kurzeder,3
Josef
Mautner,1
Dagmar
Pich,1
Manuela
Kost,1
Wolfgang
Hammerschmidt,1 and
Henri-Jacques
Delecluse1,*
Department of Gene
Vectors1 and Clinical Cooperation Group,
Gene Therapy of Hematopoietic Neoplasia,3
GSF-National Research Center for Environment and Health, 81377 Munich,
and Robert-Koch Institute, 13353 Berlin,2 Germany
Received 14 March 2000/Accepted 11 August 2000
 |
ABSTRACT |
The binding of the viral major glycoprotein BLLF1 (gp350/220) to
the CD21 cellular receptor is thought to play an essential role during
infection of B lymphocytes by the Epstein-Barr virus (EBV). However,
since CD21-negative cells have been reported to be infectible with EBV,
additional interactions between viral and cellular molecules seem to be
probable. Based on a recombinant genomic EBV plasmid, we deleted the
gene that encodes the viral glycoprotein BLLF1. We tested the ability
of the viral mutant to infect different lymphoid and epithelial cell
lines. Primary human B cells, lymphoid cell lines, and nearly all of
the epithelial cell lines that are susceptible to wild-type EBV
infection could also be successfully infected with the viral mutant in
vitro, although the efficiency of infection with BLLF1-negative virus was clearly lower than the one observed with wild-type EBV. Our studies
show that the interaction between BLLF1 and CD21 is not absolutely
required for the infection of lymphocytes and epithelial cells,
indicating that viral molecules other than BLLF1 can mediate the
binding of EBV to its target cells. In this context, our results further suggest the hypothesis that additional cellular molecules, apart from CD21, allow virus entry into these cells.
 |
INTRODUCTION |
Herpesviruses carry large genomes
that code for more than 200 proteins. The complexity of the genomes
allows these viruses to adopt different protein expression profiles,
e.g., lytic replication versus latent infection (reviewed in reference
25). Herpesviruses encode several glycoproteins that
allow binding to different cell types. This phenomenon has been well
studied in the case of herpes simplex virus (HSV), for which four
different viral receptors have been identified to date (12, 28,
40). These multiple viral receptors may explain the ability of
HSV type 1 (HSV-1) to infect cells of various lineages, including
epithelial cells and neuronal cells. Other members of the herpesvirus
family show a much more restricted cell tropism. The Epstein-Barr virus
(EBV), for example, efficiently infects and immortalizes human primary B lymphocytes, but its ability to infect other cells, in particular those of epithelial origin, is quite limited, at least in vitro (25). Infection of B lymphocytes has been shown to be
mediated by binding of the N-terminal region of the BLLF1 viral
glycoprotein to its receptor, CD21, which also serves as the lymphocyte
receptor for the C3d molecule, a member of the complement cascade
(11, 29-31). The BLLF1 viral late glycoprotein, also termed
gp350/220, is the most abundantly expressed glycoprotein in the viral
envelope and the major antigen responsible for stimulating the
production of neutralizing antibodies in vivo (46). Not only
does the BLLF1 glycoprotein mediate EBV adsorption to CD21, but binding
also induces capping of the receptor and endocytosis of the virus into B lymphocytes (43).
The EBV host range is not restricted to B lymphocytes, since the viral
genome has been identified in a number of human carcinomas, ranging
from nasopharynx carcinoma to gastric adenocarcinomas (25).
However, studies of the infection of epithelial cells by EBV have been
limited because EBV does not readily infect epithelial cell lines in
vitro. More recently, an increasing number of studies have reported on
the successful infection of epithelial cells from established cell
lines or of primary gastric cells (17, 48). It has been
demonstrated that cocultivation of EBV-positive cell lines with various
epithelial cell lines, including nasopharynx carcinoma cell lines and
keratinocytes, proved to be particularly efficient in infecting target
cells with EBV (5, 17).
The mechanism of entry in these cases is not well understood. Whether
the CD21 molecule acts as a receptor for EBV on these epithelial cells
has been debated. In particular, one group reported a low level of
expression of CD21 in the 293 cell line, a cell line of epithelial
origin that is easily infectible by EBV, whereas others could not
detect any expression of CD21 in these cells (10, 17).
According to these reports, it has been proposed that EBV may infect
these cells via a CD21-dependent as well as a CD21-independent pathway,
suggesting the existence of a second cellular receptor. Such a model
indirectly implies that either BLLF1 is able to bind to two different
cellular receptors or a viral molecule other than BLLF1 is involved in
binding of EBV to its target cells.
To distinguish between these hypotheses, we have constructed an EBV
viral mutant lacking the BLLF1 gene and investigated the ability of
this mutant to infect various cell lines and primary cells, including
known EBV target cells. Our data show that the BLLF1 gene product is
dispensable for infection of known EBV target cells and various
epithelial cells, suggesting the existence of a different viral ligand
that might interact with a cellular receptor besides CD21 on these cells.
 |
MATERIALS AND METHODS |
Cells.
The 293 cell line used in this study is a human
embryonic epithelial kidney cell line that has been transformed by the
introduction of the E1a and E1b genes of the adenovirus type 5 DNA
(13). Raji is a human EBV-positive Burkitt's cell line
(35). Raji 2.2.5 is an immunoselected mutant of Raji cells
that is negative for HLA class II antigen expression due to a deletion
in the CIITA gene (1, 20, 42). B lymphocytes from peripheral
blood buffy coats were purified on a Ficoll cushion after T-cell
rosetting by using sheep erythrocytes as described previously
(50). HaCat is an immortalized human keratinocyte cell line
that bears mutated alleles of p53 (2, 22), HEp-2 is a human
laryngeal carcinoma cell line (ATCC), and HeLa is a human cervix
adenocarcinoma cell line (ATCC). Vero is an African green monkey kidney
cell line (36), and BHK cells are baby hamster kidney cells
(18). All cell lines, with the exception of HeLa cells, were
grown in RPMI 1640 medium supplemented with 10% fetal calf serum. HeLa
cells were grown in Dulbecco modified Eagle medium-25 mM HEPES
supplemented with 10% fetal calf serum (FCS).
Recombinant EBV plasmid.
To generate a BLLF1-negative
mutant, the recBCD Escherichia coli strain BJ5183
(16) was transformed with the EBV genome, cloned onto a
mini-F factor replicon. This EBV plasmid, p2089, carries the F factor
origin of replication, the chloramphenicol resistance gene, the gene
for the green fluorescent protein (GFP) under the control of the
cytomegalovirus (CMV) promoter, and the hygromycin resistance gene as a
selectable marker in eukaryotic cells (8). To introduce a
functional deletion of BLLF1, the subclone p58.20 containing the
ClaI H fragment from EBV strain B95.8, which encompasses EBV
coordinates 88247 to 93260, was used. The
XhoI-Bsu36I fragment containing parts of the
BLLF1 gene was replaced by the tetracycline resistance gene from the
pCP16 plasmid (6) to yield p2192. This cloning step resulted
in the deletion of amino acids 79 to 630 of the BLLF1 protein (EBV
coordinates 90263 to 91916) and a frameshift of the remaining coding
sequences by the insertion of the tetracycline resistance gene. The
plasmid p2192 was linearized with AvrII to generate a
6,059-bp fragment consisting of the modified BLLF1 gene flanked by EBV
sequences of approximately 1 kb in size. The linearized fragment was
transformed into BJ5183 bacteria carrying the whole EBV genome cloned
in p2089 to induce homologous recombination via the EBV flanking
regions. After double selection with chloramphenicol (final
concentration, 15 µg/ml of Luria broth [LB] agar) and tetracycline
(final concentration, 10 µg/ml of LB agar), DNA from resistant
colonies was prepared and analyzed using various restriction enzymes to
confirm correct recombination. Plasmid DNA from positive clones was
then electroporated into the recA E. coli strain DH10B
(Gibco BRL) for further propagation of the mutant EBV plasmid.
Transfection of cells and stable cell clone selection with
hygromycin.
Transfection of cell lines with plasmid DNA was
performed using lipid micelles (Lipofectamine; Gibco BRL). The day
before transfection, cells were seeded into six-well cluster plates. For transfection, cells were placed in Optimem minimal medium for
2 h and incubated with DNA embedded in lipid micelles for 4 h. For selection of stable cell clones carrying EBV plasmid DNA, cells
from one well were transferred to a tissue culture dish, 140 mm in
diameter, 1 day posttransfection, and hygromycin was added to the
culture medium (100 µg/ml). Three to four weeks later, single
outgrowing clones were harvested and expanded. The cell lines were
called 293-BLLF1-KO cells.
Southern blot analysis.
DNA extraction from cells, DNA
digestion, and hybridization were performed as described previously
(8).
Plasmid rescue in E. coli.
Circular EBV plasmid DNA
was extracted from 293-BLLF1-KO cells as described previously
(14). Extracted DNA was transformed into the E. coli DH10B strain by electroporation (1800 V; 25 µF; 100
).
Transformed bacterial clones were selected with medium containing
chloramphenicol and tetracycline as described above.
Production of infectious EBV particles.
293-BLLF1-KO cells
carrying the BLLF1-negative EBV genome and 293-B95.8/F cells harboring
the wild-type EBV plasmid (8) were transfected in six-well
cluster plates with an expression plasmid (0.5 µg/well) encoding the
BZLF1 gene product that can induce the EBV lytic phase (15).
In order to complement the BLLF1-negative mutants, cells were
cotransfected with 0.5 µg of the BZLF1 expression plasmid and 1 µg
of an expression plasmid derived from pcDNA3.1(+) (Invitrogen) that
expresses BLLF1 under the control of a CMV promoter (p2385). At 72 h postinfection, viruses were harvested and filtered through a
1.2-µm-pore-size filter. Virus concentration was achieved by
ultracentrifugation at 20,000 × g for 2 h in a
fixed-angle rotor. Virus pellets were carefully resuspended in medium,
again filtered, and used for infection.
Immunostaining procedures.
Induced cells were washed with
phosphate-buffered saline (PBS) and fixed on a glass slide for 15 min
with pure acetone. Cells were incubated for 30 min at 37°C with a
mouse monoclonal antibody directed either against gp125, a member of
the viral capsid antigen complex (Chemicon) (dilution, 1:1,000 in
PBS-2% FCS), against BLLF1 (72A1, a supernatant from a hybridoma cell
line obtained from the American Type Culture Collection), or gp85
(monoclonal antibody E1D1, kindly provided by L. M. Hutt-Fletcher). After several washes with PBS, cells were incubated
with a secondary goat anti-mouse IgG antibody conjugated with the Cy-3
fluorochrome (dilution, 1:100; Dianova). After repeated washings with
PBS, cells were embedded in a 10% PBS-glycerol solution, and
immunostainings were analyzed by using an Axiovert inverted
epifluorescence microscope (Zeiss).
Infection of cells with virus supernatant.
Cell lines were
infected with 1 ml of concentrated supernatants containing either BLLF1
mutant virus, BLLF1 mutant virus complemented with the BLLF1 expression
plasmid, or wild-type EBV. Target cells were incubated in 24-well
cluster plates for 3 days before GFP expression was evaluated by UV
microscopy and fluorescence-activated cell sorter (FACS) analysis. The
culture medium was supplemented with tetradecanoyl phorbol acetate
(TPA) (final concentration, 20 ng/ml) and butyrate (final
concentration, 3 mM) at day 2 postinfection to enhance expression of
the GFP gene. Primary B lymphocytes (4 × 106)
isolated from peripheral blood buffy coats were infected with 1 ml of
filtered supernatant and incubated overnight. In combination with WI38
fibroblasts that act as a feeder layer, B cells (1.5 × 105/well) were then plated into 96-well cluster plates and
fed once a week with fresh medium. Outgrowing clones were expanded with medium supplemented with 20% FCS.
Inhibition of EBV infection.
The ability of the monoclonal
antibody FE8 (34) to inhibit EBV infection was tested using
Raji cells, 293 cells, and the 293-TB subclone. Cells (105
of each cell line) were incubated with increasing amounts of mFE8 (0, 0.56, 2.8, and 5.6 µg/ml) for 20 min at 37°C. Afterwards, 0.5 ml of
supernatant containing either BLLF1-negative EBV or mutant EBV
complemented with BLLF1 was added to the cells and incubated overnight.
Supernatant from mock-transfected 293-BLLF1-KO cells was used as a
negative control. The next day, supernatant and antibody were removed,
and the cells were supplied with fresh medium. After an additional
24 h, GFP-positive cells were evaluated by FACS analysis and UV microscopy.
FACS analysis.
Cells were harvested 3 days after infection,
washed twice with PBS-2% FCS solution, and analyzed for GFP
fluorescence by flow cytometry using a FACScan (Coulter).
Mock-transfected 293-B95.8/F cells (carrying the wild-type EBV plasmid)
were used as a negative control. For detection of CD21 surface
expression, 3 × 105 cells were harvested, washed with
PBS-2% FCS, and incubated for 30 min on ice with different monoclonal
antibodies directed against human CD21 (HB5) (ATCC) and FE8
(34); antibodies were used at a concentration of
approximately 20 µg/ml). After two washings with PBS-2% FCS, cells
were incubated for 30 min with a goat anti-mouse IgG antibody
conjugated with the Cy-3 fluorochrome. Cells that were incubated with
the second antibody only provided a negative control. After repeated
washings with PBS, CD21 expression was evaluated by flow cytometry
using a FACScan (Becton Dickinson).
Electron microscopy.
Thin-section preparation of
293-BLLF1-KO cells that had been induced with the BZLF1 expression
plasmid was performed as previously described (32). Sections
were evaluated at 80 kV using a Zeiss 902 electron microscope.
RT-PCR.
Total RNA was extracted from 106 Raji,
HeLa, 293, and 293-TB cells by using the High Pure RNA Isolation Kit
(Boehringer Mannheim) according to the manufacturer's protocol. The
integrity of isolated RNA was examined by loading 1 µg of RNA onto a
1% agarose-formaldehyde gel. Afterwards, cDNA synthesis was performed
with 1 µg of isolated RNA. Oligo(dT)12-18 (100 pmol) was
added to each RNA sample, and the mixture was heated to 65°C for 10 min followed by quick chilling on ice. First strand buffer (5×; Gibco
BRL), dithiothreitol (final concentration, 10 mM), and dNTP mix (final
concentration, 0.5 mM) were added and incubated at 42°C for 2 min.
Superscript II reverse transcriptase (200 U) was added, and the mix was
incubated for an additional 1 h. The reverse transcription (RT)
reaction was stopped by heating to 95°C for 5 min. Subsequently, each
PCR was carried out with a 1/10 volume of the RT reaction corresponding to cDNA synthesized from 100 ng of total RNA. The sense primer 5'
GTTGTTCAGGTACCTTCCGC 3' and the antisense primer 5'
TAGGAAGTGCTGGACACTCG 3', used to detect CD21-specific
transcripts, are described in reference 48 and gave
rise to PCR products of 327 bp in size. For each PCR, 0.2 mM dNTPs, 1.5 mM MgCl2, 2 pmol of each primer, 10× buffer, and 2 U of
Gold Star DNA polymerase (Eurogentec) were mixed with cDNA in a total
volume of 50 µl. The mixture was subjected to 35 cycles of
amplification, each cycle consisting of 95°C for 45 s, 55°C
for 45 s, and 72°C for 1 min. The PCR products were electrophoresed using a 1% agarose gel.
 |
RESULTS |
Construction of a BLLF1-negative EBV mutant strain.
The
complete EBV genome has been recently cloned in E. coli with
the aid of an F plasmid (8). It also carries the genes for
hygromycin resistance in eukaryotic cells and chloramphenicol resistance in E. coli and the gene encoding the enhanced
GFP. To construct the BLLF1 knockout mutant, a linear DNA fragment carrying the BLLF1 gene which had been disrupted by insertion of the
tetracycline resistance gene was introduced into the wild-type EBV
plasmid by homologous recombination in the recA-positive, recBC-negative E. coli strain BJ5183 (Fig.
1A). After selection for chloramphenicol
and tetracycline resistance, the EBV plasmid DNA from single colonies
was analyzed with several restriction enzymes (data not shown). The
BLLF1-negative viral DNA was transformed into the recA E. coli strain DH10B via electroporation. A restriction enzyme
analysis of the plasmid DNA from the BLLF1-negative mutant and of
wild-type EBV DNA confirmed a correct fragment pattern of the EBV
mutant genome (Fig. 1B).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 1.
Mutant EBV lacking its major glycoprotein BLLF1. (A)
Construction of the BLLF1-negative EBV mutant genome by homologous
recombination in the recBCD E. coli strain BJ5183. The
diagram shows schematically the wild-type EBV genome carrying the BLLF1
gene and a linearized fragment in which most of the BLLF1 sequence was
replaced by the gene for tetracycline resistance (Tet). Since this
linearized fragment used for targeted allelic exchange also carries EBV
sequences that flank the BLLF1 gene, homologous recombination with the
wild-type EBV F factor plasmid can take place. After transformation of
the BLLF1/Tet fragment into the bacterial strain BJ5183, clones
carrying recombinant EBV plasmids were selected for chloramphenicol
(Cam) and tetracycline resistance. (B) Restriction fragment analysis of
EBV BLLF1-KO DNA in comparison with wild-type B95.8/F factor DNA (wt).
BLLF1-negative EBV plasmid DNA was purified from a chloramphenicol- and
tetracycline-resistant DH10B E. coli clone and digested with
EcoRI or BamHI. The restriction pattern of
BLLF1-KO mutant DNA was compared with the one obtained for wild-type
EBV DNA. Modified DNA fragments are indicated by arrows. As expected
from the predicted BamHI restriction pattern, the
introduction of the tetracycline resistance gene into the BLLF1 gene
leads to the appearance of an additional 6.2-kb BamHI
fragment and the disappearance of one of the two 5-kb fragments that
are seen after digestion of wild-type EBV DNA. Similarly, the
EcoRI restriction pattern obtained after digestion of the
BLLF1 mutant EBV DNA shows a predicted additional fragment of 9.3 kb
that correlates with the disappearance of one of the two 8.5-kb
fragments obtained when wild-type EBV DNA is analyzed. (C) Southern
blot analysis of 293-BLLF1-KO cells harboring the BLLF1-negative EBV
mutant strain compared to 293-B95.8/F cells carrying the wild-type EBV
plasmid. Total genomic DNA from these cells was digested with the
BamHI restriction enzyme. After agarose gel electrophoresis
and Southern blotting, the DNA was hybridized with a probe derived from
the BLLF1/Tet fragment that was used to introduce the BLLF1 KO
mutation. The probe spanning nucleotide coordinates 88335 to 93167 of
the B95.8 EBV sequence with a deletion of 90263 to 91916 (see Materials
and Methods) identifies a characteristic 6.2-kb signal in DNA from
293-BLLF1-KO cells, compared to a 5-kb band observed in 293 cells
carrying wild-type virus (see also panel B). The faint signals at 7.9 kb that are observed with BLLF1-negative virus and with wild-type virus
represent remaining BLLF1 sequences that partially hybridize with the
probe.
|
|
Establishment of a 293 cell clone that stably produces
BLLF1-negative EBV virions.
The production of virus stocks
containing BLLF1-negative EBV requires the establishment of a
permissive cell line that carries the mutant EBV plasmid. To this aim,
the BLLF1-negative EBV genome was transfected into 293 cells, and
stable hygromycin-resistant cell clones that carried the mutated EBV
plasmid episomally were selected. Fig. 1C shows a Southern blot
analysis of genomic DNA from one of the hygromycin-resistant clones,
using as a probe the BLLF1/Tet fragment that had been introduced into
the EBV genome (see also Fig. 1A). This cell clone was termed
293-BLLF1-KO and was used for all the following experiments. The
293-BLLF1-KO cells contain the correct BLLF1 knockout genome, as
confirmed by a DNA rescue experiment. Plasmid DNA was extracted from
these cells and transformed into the E. coli strain DH10B
via electroporation. After selection for chloramphenicol and
tetracycline resistance, DNA from outgrowing colonies was again
examined by restriction enzyme analysis and proved to yield the same
pattern as shown in Fig. 1B (data not shown). The cell clone was then
tested for the ability to support the lytic cycle of EBV. To this aim,
cells were transiently transfected with an expression plasmid encoding the immediate-early protein BZLF1. Three days after induction, immunostaining of the induced cells with an antibody directed against
gp125, a lytic viral protein of the VCA complex, and with an antibody
directed against another viral late gene product, the glycoprotein
gp85, was performed. Approximately 16% of the 293-BLLF1-KO cells
proved to be positive for the expression of the late gene products
gp125 and gp85 (Fig. 2 and data not
shown). Immunostaining of the induced 293-BLLF1-KO cells with the
neutralizing monoclonal antibody 72A1, directed against the N terminus
of the BLLF1 glycoprotein, did not yield any signal, as expected for a
BLLF1 knockout mutant (Fig. 2). The maturation and egress of the
BLLF1-KO viral particles were analyzed by electron microscopy using
lytically induced 293-BLLF1-KO cells, as shown in Fig.
3. Viral capsids could be observed in the
nucleus and in the cytoplasm after budding through the nucleus
membrane.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 2.
Lytically induced 293-BLLF1-KO cells do not show any
expression of the BLLF1 gene product. 293-B95.8/F cells carrying
wild-type EBV DNA as a positive control and 293-BLLF1-KO cells carrying
BLLF1-negative DNA were induced with BZLF1, harvested 3 days after
induction, and fixed in pure acetone. Expression of gp125 and BLLF1 was
detected by immunostaining using a monoclonal antibody directed either
against gp125 or against the BLLF1 protein. In a second step, staining
was visualized by incubating the cells with a goat anti-mouse IgG
antibody conjugated with the Cy-3 fluorochrome. 293-B95.8/F cells show
positive staining for gp125 (A) and BLLF1 (B), whereas induced
293-BLLF1-KO cells only show expression of gp125 (C) and are negative
for the BLLF1 protein (D).
|
|

View larger version (107K):
[in this window]
[in a new window]
|
FIG. 3.
Maturation of EBV virions is not dependent on BLLF1
expression. 293-BLLF1-KO cells were induced by transient transfection
of BZLF1 and harvested 3 days after induction for preparation of thin
sections. Electron microscopy analysis of these cell sections show
different stages of EBV maturation. (A) A viral capsid budding from the
nucleus membrane in a 293-BLLF1-KO cell is shown. (B) Viral capsids
that are transported to the plasma membrane are shown. Viral capsids
are indicated by arrows.
|
|
The BLLF1-negative EBV mutant is still able to infect and
immortalize primary B lymphocytes.
Previous work has shown that
preincubation of primary B lymphocytes with BLLF1 peptides encompassing
the binding motif for the cellular CD21 molecule, prior to incubation
with EBV, abolished the outgrowth of EBV-transformed B cells
(29). To address the question of whether primary B
lymphocytes can be infected and immortalized with the BLLF1-negative
EBV mutant, we performed infection assays with human primary B
lymphocytes as target cells. The cells were incubated with supernatants
containing either wild-type EBV, BLLF1-negative EBV, or mutant EBV
complemented with BLLF1 in trans. The complementation of the
BLLF1 mutant phenotype was achieved by transient cotransfection of
293-BLLF1-KO cells with BZLF1 and an expression plasmid encoding BLLF1
under the control of the CMV promoter. The expression of the BLLF1
protein was confirmed by immunostaining as described above (data not
shown). As shown in Table 1, we could
successfully establish EBV-positive immortalized B lymphocytes using
supernatants containing BLLF1-negative EBV, although the frequency of
immortalization was reduced compared to immortalization by wild-type
EBV. Southern blot analysis of genomic DNA extracted from three
independent clones, using cell clones derived from wild-type EBV
infection as a positive control, confirmed the BLLF1-negative status of
the immortalized B-cell clones (Fig. 4).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4.
Southern blot analysis of total DNA from immortalized
B-cell clones that were established after infection with either
BLLF1-KO EBV (lanes 1 to 3), complemented BLLF1-KO EBV (lanes 4 to 6),
or wild-type EBV (lanes 7 to 9). Ten micrograms of extracted DNA was
digested with BamHI, separated by gel electrophoresis, and
blotted as described previously (6). Hybridization was
performed with the probe consisting of the BLLF1/Tet fragment that was
used for homologous recombination as described in the legend to Fig.
1C. As expected, hybridization with DNA from B-cell clones derived
after infection with BLLF1-negative EBV or transiently complemented
mutant EBV showed a 6.2-kb signal corresponding to the fragment that
carries the mutated BLLF1 gene (lanes 1 to 6). Weaker signals of 7.9 kb
represent remaining flanking BLLF1 sequences that are partially
recognized by the probe. B-cell lines established with virus stocks
derived from the 293-B95.8/F cells (lanes 7 to 9) showed the predicted
5-kb band representing wild-type BLLF1 sequences.
|
|
BLLF1-negative EBV infects Raji cells at a lower frequency.
Our experiments with primary B cells suggested that BLLF1 is
dispensable for the infection of human B cells. In order to extend this
observation, we performed infection experiments with the various
supernatants (see above) using Raji cells, a Burkitt lymphoma cell
line, as target cells. GFP-positive Raji cells could be observed after
incubation with the supernatant from induced 293-BLLF1-KO cells, as
shown in Fig. 5. FACS analysis revealed
an efficiency of infection that was a factor of 10 to 12 lower with
BLLF1-negative virus stocks than the one obtained with wild-type EBV or
with mutant viruses that were complemented with BLLF1. The observation that Raji cells can also be successfully infected with BLLF1-negative EBV further demonstrates that the deletion of BLLF1 reduces but does
not abrogate virus entry into B cells. Therefore, an alternative pathway, independent of BLLF1, most likely mediates virus entry into
these cells.

View larger version (137K):
[in this window]
[in a new window]
|
FIG. 5.
Infection of Raji cells by various EBV stocks, including
BLLF1-negative EBV, as detected by GFP expression. Raji cells
(105) were incubated with 1 ml of supernatant containing
either wild-type EBV (I), mutant EBV lacking BLLF1 (II), or mutant EBV
complemented with a BLLF1 expression plasmid (III). Successful
infection was detected after 72 h by GFP expression using an
Axiovert inverted epifluorescence microscope, as shown in the right
panels. The left panels show the corresponding cells via phase-contrast
light microscopy (magnification, ×200).
|
|
It has been suggested that HLA class II molecules act as a coreceptor
for infection of B cells by EBV (
23). We wanted to
know
whether these molecules participate in mediating infection
of Raji
cells with the BLLF1-negative EBV mutant. To this aim,
we used the Raji
2.2.5 cell line that does not show any detectable
expression of class
II antigens (
1,
20). These cells were
incubated with
supernatants containing either BLLF1-negative EBV
virions,
BLLF1-complemented mutant EBV, or wild-type EBV as a
control. All three
supernatants proved to be infectious, as indicated
by GFP expression
(Table
2). The efficiency of infection,
dependent
on the supernatants used, decreased by a factor of about 5 to
9 compared to the rates of infection observed with common Raji
cells
(Table
2), indicating that HLA class II molecules are not
absolutely
required for successful infection of Raji cells even
in the absence of
the BLLF1 glycoprotein.
The data of these experiments listed in Table
2 most likely do not
represent definitive numbers, since it is not possible
to determine the
virus titer of the BLLF1-KO mutant by standard
infection assays.
Although 293-BLLF1-KO cells and BLLF1-complemented
293-BLLF1-KO cells
exhibit approximately the same efficiency of
induction of the lytic
cycle, as observed by immunostaining assays
(data not shown), we cannot
exclude completely the possibility
that BLLF1 plays a role in virus
assembly and egress. Nevertheless,
our experiments demonstrate that
virus entry into B cells takes
place even in the absence of the major
EBV attachment
glycoprotein.
BLLF1 is dispensable for the infection of various epithelial
cells.
Since it has been reported that epithelial cells can be
infected with EBV, we wanted to investigate whether the infection of
epithelial cells depends on the expression of BLLF1. Supernatants from
induced 293-BLLF1-KO cells were used to infect 293 cells, which have
been shown to be infectible by EBV in vitro (10, 17). Our
293 cell line proved to be rather heterogeneous with regard to the
efficiency of EBV infection (data not shown). Therefore, four rounds of
single-cell selection were performed under limiting dilution
conditions, and 30 clones of each round were tested for the ability to
become infected with EBV. One of these 293 subclones, termed 293-TB,
proved to be about three times more susceptible to EBV infection than
the parental 293 population (see Table 2). The 293 cells and the 293-TB
cells were infected with the BLLF1-KO mutant virus. Figure
6 shows GFP-positive 293 cells 3 days
after incubation of the cells with supernatants containing the BLLF1 mutant virus. The results presented here show that both the parental 293 cells and the 293-TB cells can be infected with the BLLF1-negative EBV mutant. In the presence of BLLF1, the rate of infection increased up to threefold, as listed in Table 2 (see also Fig. 6). Infection with
wild-type EBV revealed numbers of GFP-positive cells comparable to
those observed with BLLF1-complemented mutant EBV (Table 2).

View larger version (112K):
[in this window]
[in a new window]
|
FIG. 6.
Infection of 293 cells and of 293-TB cells with viral
supernatants containing either BLLF1-negative EBV (I) or mutant EBV
complemented with a BLLF1 expression plasmid (II). GFP expression was
detected 3 days after incubation of the cells with viral supernatants,
as shown in the right panels for each cell type.
|
|
To investigate the relevance of this observation made with 293 cells,
we further analyzed different cell lines for characteristics
of their
susceptibilities to infection by EBV. As described above,
HaCat cells,
a human keratinocyte cell line, the human laryngeal
carcinoma cell line
HEp-2, HeLa cells, and the nonhuman cell lines
Vero and BHK were
infected with supernatants containing either
wild-type EBV, mutant EBV
negative for BLLF1, or mutant EBV complemented
with BLLF1. Vero cells,
which are known to be readily infectible
with HSV-1 (
36),
could be infected with all three virus stocks
in a comparable manner
(Table
2). Infection of HEp-2 cells with
EBV was inefficient and could
be observed only with wild-type
EBV. In the case of the cell lines
HaCat, HeLa, and BHK, no GFP-positive
cells could be detected,
suggesting that these cells are resistant
to wild-type EBV infection as
well as to infection with BLLF1-negative
EBV.
Due to contradictory reports about the expression of CD21 on epithelial
cells (
10,
17), both the parental 293 cells and
the
particular 293-TB subclone were analyzed for CD21 surface
expression
(Fig.
7A). Using different monoclonal
antibodies directed
against CD21 (see Materials and Methods), we could
observe only
a minimal shift for 293-TB cells, whereas 293 cells did
not show
any CD21 surface expression by FACS analysis. In addition, we
performed RT-PCR using primers specific for the short consensus
repeats
(SCR) 1 and 2 of CD21 (
48), which had been shown to
be
necessary for binding of EBV (
4). cDNA from Raji cells was
used as a positive control, and cDNA from HeLa cells, which had
been
shown to be resistant to EBV infection, was used as a negative
control.
As shown in Fig.
7B, positive signals could be observed
for Raji cells,
293 cells, and 293-TB cells. HeLa cells proved
to be negative for the
detection of CD21-specific mRNA transcripts.
Since FACS analysis might
not be sensitive enough to detect minute
amounts of CD21 molecules on
the cell surface, we performed an
infection inhibition experiment using
the monoclonal antibody
FE8, which had been demonstrated to block EBV
infection of B cells
as efficiently as the OKB7 monoclonal antibody
(
31,
34). Raji
cells, 293 cells, and 293-TB cells were
preincubated with increasing
concentrations of FE8 and subsequently
incubated with supernatants
containing either BLLF1-negative EBV or
mutant EBV complemented
with BLLF1. As a control, Raji cells were
preincubated in parallel
with the HB5 antibody, which also detects CD21
but does not block
EBV entry (
45). Two days postinfection,
cells were harvested
and GFP-positive cells were evaluated by FACS
analysis and UV
microscopy. UV microscopy was preferentially used with
virus stocks
containing BLLF1-negative EBV due to low infection
efficiencies
in the course of this experiment. The results of the
blocking
experiments are illustrated in Fig.
7C. As expected, infection
of Raji cells with BLLF1-complemented mutant EBV can be strongly
inhibited by the FE8 antibody, whereas blocking of CD21 shows
no or
little influence on the infection by EBV lacking the BLLF1
glycoprotein. Pretreatment of Raji cells with the control antibody
HB5
led to a decrease of about 28% in the rate of infection with
complemented mutant virus, whereas no inhibition of BLLF1-KO EBV
infection was observed (data not shown). Results of the control
experiment using the HB5 antibody suggest that variations in the
range
observed after BLLF1-KO EBV infection of Raji cells might
be considered
not significant and probably reflect unspecific
hindrances. Taking this
observation into account, our results
indicated that the infection of
Raji cells with BLLF1-negative
EBV was independent of the interaction
between BLLF1 and CD21.
This assumption also seems to apply to 293 and
293-TB cells, since
we did not observe a difference in infection
efficiency with our
BLLF1 mutant strain after application of the FE8
antibody. However,
using BLLF1-complemented EBV, infection of the
original 293 cells
as well as the 293-TB cells can also be inhibited,
as observed
in the case of Raji cells (Fig.
7C). This indicates that
minute
amounts of CD21 on the surfaces of the different 293 cells might
mediate virus entry via interaction with BLLF1.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
Expression of CD21 in Raji cells and different
epithelial cell lines. (A) FACS analysis of Raji cells, HeLa cells, 293 cells, and 293-TB cells for human CD21 surface expression. Cells
(3 × 105 for each cell line) were incubated with two
anti-CD21 monoclonal antibodies (HB5 and FE8) and subsequently
incubated with a Cy3-conjugated goat anti-mouse IgG antibody. As
negative controls, each cell sample was incubated with the second
antibody only. The results shown are representative of two independent
experiments. (B) RT-PCR analysis. cDNA (100 ng) was used to amplify
CD21-specific mRNA transcripts in Raji cells, HeLa cells, 293 cells,
and 293-TB cells. (C) Infection inhibition experiment using the
monoclonal antibody FE8. Cells (105) were incubated with
increasing amounts of the antibody for 20 min at 37°C. As indicated,
0.5 ml of supernatant containing either complemented mutant EBV
(designated `wt EBV') or BLLF1-negative EBV was added and incubated
for 24 h. Afterwards, supernatant and antibody were removed, and
fresh medium was added to the cells. After an additional 24 h,
cells were evaluated for GFP expression. As controls, Raji cells were
incubated with increasing amounts of the HB5 antibody, as described for
FE8, prior to infection with BLLF1-KO EBV or complemented BLLF1 mutant
virus (data not shown).
|
|
Other epithelial cell lines used in this series of experiments were
negative for CD21 surface expression by FACS analysis.
Vero cells that
are susceptible to EBV infection did not show
any CD21 expression.
Since the rates of infection of Vero cells
listed in Table
2 suggest
that BLLF1 plays a minor role, if any,
in the mode of virus entry into
this cell line, the CD21 status
of these cells was not further
investigated by other
means.
 |
DISCUSSION |
EBV codes for an envelope glycoprotein, BLLF1, which is known to
play an important role in infection of B cells by binding to the CD21
protein. EBV is also able to infect epithelial cells in vitro
(39) and in vivo. The first evidence for EBV infecting an
epithelial target in vivo was the finding that the viral genome is
regularly present in nasopharyngeal carcinomas (25, 51). Many other examples of tumors of epithelial origin, also apart from the
nasopharynx, were found to be EBV positive, e.g., salivary gland
carcinomas (37) and gastric tumors of the more common adenocarcinoma type (25, 38). However, the route whereby EBV enters epithelial target cells in vivo has not been elucidated to date.
It has been reported that some human epithelial cell lines express low
levels of CD21 in vitro, but in nasopharyngeal carcinoma cells, CD21 is
not detectable (25). Therefore, the question of whether an
additional EBV receptor exists on epithelial cells has been addressed
by several groups (10, 48, 49). The existence of a second
EBV receptor might also point to an additional viral molecule, apart
from BLLF1, that interacts with this receptor.
To further investigate the mode of EBV entry into its target cells, we
have constructed a recombinant EBV strain lacking a functional BLLF1
gene. This mutant virus strain was not impaired with regard to the
expression of late genes, such as those for gp125 and gp85, after
induction of the lytic cycle. Maturation of virus proved to be normal
as analyzed by electron microscopy, strongly suggesting that formation
of viral particles is not dependent on the expression of BLLF1.
Complementation experiments with a BLLF1 expression plasmid gave rise
to fully infectious particles, demonstrating that the modifications
introduced into the viral genome were confined to the BLLF1 gene. The
host range of the BLLF1 mutant viruses was evaluated by using different
cell lines as target cells. Supernatants containing BLLF1-negative EBV
were incubated with human primary B lymphocytes, Raji cells, and
various epithelial cell lines.
We show here that cell lines that can become infected with wild-type
EBV are also susceptible to infection with BLLF1-negative EBV (Table
2), except for the HEp-2 cell line, in which infection could be
observed with wild-type EBV only. Since the rate of infection of HEp-2
cells with wild-type virus was extremely low, no conclusion can be
drawn with regard to the susceptibility of this cell line to infection
with BLLF1-negative EBV. Although the efficiency of infection was less
with BLLF1-negative EBV, primary B lymphocytes and Raji cells could be
successfully infected. In addition, the HLA class II-negative Raji
2.2.5 cell line could be infected with the BLLF1 mutant virus strain.
However, the rate of infection decreased with both wild-type and
BLLF1-negative EBV compared to that for normal Raji cells.
The results of the experiments using primary B lymphocytes and Raji
cells are contradictory to previous reports, since binding of BLLF1 to
CD21 on B cells was thought to be a prerequisite for virus entry. By
preincubating B cells with multimeric BLLF1-derived peptides, Nemerow
et al. showed that inhibition of the interaction between BLLF1 and CD21
abolishes the ability of EBV to infect and transform B cells
(29). In addition, Tanner et al. observed blocking of EBV
adsorption by using either soluble BLLF1 or a derivative of the BLLF1
protein in which the amino terminus was deleted (44).
However, preincubation of B cells with multimeric BLLF1 peptides or
soluble BLLF1 protein might lead to unspecific steric hindrances that
impede access of other viral ligands to the target cell. This
hypothesis could provide an explanation for the different conclusions
made by these groups and us. Our results clearly show that BLLF1 is
dispensable for infection and immortalization of B lymphocytes in vitro
as well as for infection of lymphoid cells like Raji cells and the HLA
class-II negative Raji 2.2.5 subclone. These data suggest the existence
of an additional EBV molecule which is able to partially complement the
BLLF1-negative phenotype and mediates binding of EBV to its target
cells. From the CD21 blocking experiments with Raji cells, we can
further conclude that entry of EBV lacking its major glycoprotein most likely involves an additional receptor besides CD21 on B cells.
Alternative binding mechanisms are known for other herpesviruses, such
as the alphaherpesviruses HSV-1 and -2. The gC glycoprotein of HSV-1,
e.g., is required for the initial attachment of the virus via cell
surface heparan sulfate. A second glycoprotein, gB, also contributes,
although to a lesser extent, to the binding of heparan sulfate. Mutant
viruses lacking gC were more impaired in binding than mutants depleted
of gB (21). Apart from these glycoproteins, HSV-1 encodes
another viral envelope glycoprotein, gD. This glycoprotein interacts
with additional human receptors, including HVEM or HveA, a member of
the tumor necrosis factor receptor family (28), and HveC,
the herpesvirus entry protein C, which shows homologies to the
poliovirus receptor (12). Recognition of one of these
receptors by gD is thought to trigger fusion of the viral envelope with
the cell membrane. A related mode of infection is known from the study
of the human cytomegalovirus, a betaherpesvirus. In this case, the
gC-II glycoprotein complex was found to be the major component that
possesses the ability to bind to immobilized heparin (19).
In addition, the most abundant envelope glycoprotein, gB, is also able
to interact with heparan sulfate (3, 7). Besides this
initial interaction, gB associates with a different class of receptors,
e.g., annexin II (33) or other yet-undefined nonheparin
components (3).
There are several EBV envelope glycoproteins that are known to be
important for mediating virus entry. The complex consisting of the
glycoproteins gp85 and gp25, e.g., triggers fusion of the virus
envelope with the cell membrane (26, 47). A third
glycoprotein of this complex, gp42, has been reported to bind to HLA
class II molecules (24, 41). These molecules have been
proposed to function as a coreceptor required for EBV infection of B
lymphocytes (23). However, our results, in agreement with
those of Faggioni et al. (9), show that HLA class II
molecules at least are not absolutely required for the infection of
Raji cells. In addition, since the BLLF1-negative strain is still able
to infect the HLA class II-negative Raji clone, it seems most likely
that HLA class II molecules also do not play a crucial role in
mediating the BLLF1-independent mode of infection. Nevertheless, a role
of gp42 in this infectious pathway cannot be excluded so far. There are still a number of EBV glycoproteins, e.g., gN, gM, gp78, and gp150, with yet-unknown functions that might contribute to the pathway of EBV
entry in the absence of BLLF1.
With regard to epithelial cells, we could show that supernatants
containing BLLF1-negative EBV infect human 293 cells as well as the
293-TB subclone that had been selected for its higher susceptibility to
EBV infection. As was already observed in the case of B lymphocytes, the rate of infection was lower in the absence of BLLF1. After complementation of the BLLF1-negative virus in trans, the
rate of infection of 293 cells and the 293 subclone reached the level observed with wild-type EBV. These observations again refer to the
existence of an additional EBV envelope protein that is able to
partially compensate for the lack of BLLF1 function during the
infection of human epithelial cells.
In the past, the expression of CD21 on epithelial cells and its role in
EBV infection of these cells have been debated. It has been shown that
some epithelial cell lines, such as 293 or primary epithelial cells
that line the pharyngeal mucosa, especially in less-differentiated
stages, express relatively low levels of CD21 (10, 49).
Infection of these epithelial cells was believed to be mediated by
binding of BLLF1 to CD21, as is known to be the case for B cells. In
our hands, 293 cells were found to be negative for CD21 surface
expression by FACS analysis. However, in contrast to the results of
Imai et al. (17), we were able to detect CD21 mRNA by
performing RT-PCR. This finding might suggest that the cell surface
expression of CD21 could be regulated in a posttranscriptional way. The
data from the infection inhibition experiment showed that blocking of
CD21 led to a decrease in 293 and 293-TB cell infection by
BLLF1-complemented mutant EBV. This observation rather supports the
hypothesis that small amounts of CD21 molecules might mediate entry of
wild-type EBV into this cell line. In the case of the 293-TB subclone,
the higher susceptibility to EBV infection, compared to the parental
293 cell population, can be most likely explained by selection for the
surface expression of CD21 molecules on these cells. On the other hand,
infection of 293 cells and 293-TB cells with BLLF1-negative EBV could
not be inhibited by blocking of the CD21 receptor. Therefore, we could demonstrate, as observed for Raji cells, that attachment of BLLF1-KO EBV also occurs via an additional receptor on epithelial cells. A very
recent work by Molesworth et al. suggests a possible binding activity
for gH in the mode of EBV entry into CD21-negative epithelial cells
(27). Regarding our data on infection of 293 cells, this report might offer an attractive model for an interaction of a viral
glycoprotein different from BLLF1 with a so-far-unknown receptor on
epithelial cells. So far, no conclusions about the identity of such a
viral ligand can be drawn from our results.
In summary, we could demonstrate that an Epstein-Barr virus strain that
lacks its major attachment protein BLLF1 is able to infect human B
lymphocytes and epithelial cells in vitro using an as yet undetermined
viral ligand. Moreover, our data show that such an additional viral
binding protein most likely interacts with a cellular receptor
different from CD21 on B cells and on epithelial cells, such as 293 cells. These findings might prove relevant with regard to the
elucidation of the pathway used during EBV infection in vivo.
 |
ACKNOWLEDGMENTS |
We thank Katja Dunckelmann and Bärbel Jungnickl for
technical and photographic assistance with EM analysis. We also thank Elisabeth Kremmer for supplying monoclonal antibody 72AI and for help
in determination of the FE8 antibody concentration. We further thank
Wolfgang M. Prodinger for kindly supplying FE8 and HB5 antibodies and
Lindsey Hutt-Fletcher for providing the monoclonal antibody E1D1. We
thank Anna Meier and Olivier Gires for help with the FACS analysis.
This work was supported by Public Health Service grant CA70723 and
grants Ha 1354/3 and SFB 455 from the Deutsche Forschungsgemeinschaft.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: GSF-Institute of
Clinical Molecular Biology and Tumor Genetics, Marchioninistr. 25, 81377 Munich, Germany. Phone: 49-89-7099513. Fax: 49-89-7099500. E-mail: Delecluse{at}gsf.de.
 |
REFERENCES |
| 1.
|
Accolla, R. S.
1983.
Human B cell variants immunoselected against a single Ia antigen subset have lost expression of several Ia antigen subsets.
J. Exp. Med.
157:1053-1058[Abstract/Free Full Text].
|
| 2.
|
Boukamp, P.,
R. T. Petrussevska,
D. Breitkreutz,
J. Hornung,
A. Markham, and N. E. Fusenig.
1988.
Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line.
J. Cell Biol.
106:761-771[Abstract/Free Full Text].
|
| 3.
|
Boyle, K. A., and T. Compton.
1998.
Receptor-binding properties of a soluble form of human cytomegalovirus glycoprotein B.
J. Virol.
72:1826-1833[Abstract/Free Full Text].
|
| 4.
|
Carel, J. C.,
B. L. Myones,
B. Frazier, and V. M. Holers.
1990.
Structural requirements for C3d,g/Epstein-Barr virus receptor (CR2/CD21) ligand binding, internalization, and viral infection.
J. Biol. Chem.
265:12293-12299[Abstract/Free Full Text].
|
| 5.
|
Chang, Y.,
C. H. Tung,
Y. T. Huang,
J. Lu,
J. Y. Chen, and C. H. Tsai.
1999.
Requirement for cell-to-cell contact in Epstein-Barr virus infection of nasopharyngeal carcinoma cells and keratinocytes.
J. Virol.
73:8857-8866[Abstract/Free Full Text].
|
| 6.
|
Cherepanov, P. P., and W. Wackernagel.
1995.
Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant.
Gene
158:9-14[CrossRef][Medline].
|
| 7.
|
Compton, T.,
D. M. Nowlin, and N. R. Cooper.
1993.
Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate.
Virology
193:834-841[CrossRef][Medline].
|
| 8.
|
Delecluse, H. J.,
T. Hilsendegen,
D. Pich,
R. Zeidler, and W. Hammerschmidt.
1998.
Propagation and recovery of intact, infectious Epstein-Barr virus from prokaryotic to human cells.
Proc. Natl. Acad. Sci. USA
95:8245-8250[Abstract/Free Full Text].
|
| 9.
|
Faggioni, A.,
C. Zompetta,
M. Cirone,
G. Barile,
L. Frati, and R. Accolla.
1990.
Superinfection by Epstein-Barr virus of a subset of Raji cells is independent of HLA class-II antigens.
Int. J. Cancer
45:989[Medline].
|
| 10.
|
Fingeroth, J. D.,
M. E. Diamond,
D. R. Sage,
J. Hayman, and J. L. Yates.
1999.
CD21-dependent infection of an epithelial cell line, 293, by Epstein-Barr virus.
J. Virol.
73:2115-2125[Abstract/Free Full Text].
|
| 11.
|
Fingeroth, J. D.,
J. J. Weis,
T. F. Tedder,
J. L. Strominger,
P. A. Biro, and D. T. Fearon.
1984.
Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2.
Proc. Natl. Acad. Sci. USA
81:4510-4514[Abstract/Free Full Text].
|
| 12.
|
Geraghty, R. J.,
C. Krummenacher,
G. H. Cohen,
R. J. Eisenberg, and P. G. Spear.
1998.
Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor.
Science
280:1618-1620[Abstract/Free Full Text].
|
| 13.
|
Graham, F. L.,
J. Smiley,
W. C. Russell, and R. Nairn.
1977.
Characteristics of a human cell line transformed by DNA from human adenovirus type 5.
J. Gen. Virol.
36:59-74[Abstract/Free Full Text].
|
| 14.
|
Griffin, B. E.,
E. Bjorck,
G. Bjursell, and T. Lindahl.
1981.
Sequence complexity of circular Epstein-Barr virus DNA in transformed cells.
J. Virol.
40:11-19[Abstract/Free Full Text].
|
| 15.
|
Hammerschmidt, W., and B. Sugden.
1988.
Identification and characterization of oriLyt, a lytic origin of DNA replication of Epstein-Barr virus.
Cell
55:427-433[CrossRef][Medline].
|
| 16.
|
Hanahan, D.
1983.
Studies on transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 17.
|
Imai, S.,
J. Nishikawa, and K. Takada.
1998.
Cell-to-cell contact as an efficient mode of Epstein-Barr virus infection of diverse human epithelial cells.
J. Virol.
72:4371-4378[Abstract/Free Full Text].
|
| 18.
|
Jarrett, O., and I. Macpherson.
1968.
The basis of the tumorigenicity of BHK 21 cells.
Int. J. Cancer
3:654-662[Medline].
|
| 19.
|
Kari, B., and R. Gehrz.
1992.
A human cytomegalovirus glycoprotein complex designated gC-II is a major heparin-binding component of the envelope.
J. Virol.
66:1761-1764[Abstract/Free Full Text].
|
| 20.
|
Koch, W.,
S. Candeias,
J. Guardiola,
R. Accolla,
C. Benoist, and D. Mathis.
1988.
An enhancer factor defect in a mutant Burkitt lymphoma cell line.
J. Exp. Med.
167:1781-1790[Abstract/Free Full Text].
|
| 21.
|
Laquerre, S.,
R. Argnani,
D. B. Anderson,
S. Zucchini,
R. Manservigi, and J. C. Glorioso.
1998.
Heparan sulfate proteoglycan binding by herpes simplex virus type 1 glycoproteins B and C, which differ in their contributions to virus attachment, penetration, and cell-to-cell spread.
J. Virol.
72:6119-6130[Abstract/Free Full Text].
|
| 22.
|
Lehman, T. A.,
R. Modali,
P. Boukamp,
J. Stanek,
W. P. Bennett,
J. A. Welsh,
R. A. Metcalf,
M. R. Stampfer,
N. Fusenig,
E. M. Rogan, et al.
1993.
p53 mutations in human immortalized epithelial cell lines.
Carcinogenesis
14:833-839[Abstract/Free Full Text].
|
| 23.
|
Li, Q.,
M. K. Spriggs,
S. Kovats,
S. M. Turk,
M. R. Comeau,
B. Nepom, and L. M. Hutt-Fletcher.
1997.
Epstein-Barr virus uses HLA class II as a cofactor for infection of B lymphocytes.
J. Virol.
71:4657-4662[Abstract].
|
| 24.
|
Li, Q.,
S. M. Turk, and L. M. Hutt-Fletcher.
1995.
The Epstein-Barr virus (EBV) BZLF2 gene product associates with the gH and gL homologs of EBV and carries an epitope critical to infection of B cells but not of epithelial cells.
J. Virol.
69:3987-3994[Abstract].
|
| 25.
|
Miller, G.
1990.
Epstein-Barr virus: biology, pathogenesis, and medical aspects.
In
B. N. Fields, and D. M. Knipe (ed.), Virology, 2nd ed., vol. 2. Raven press, New York, N.Y.
|
| 26.
|
Miller, N., and L. M. Hutt-Fletcher.
1988.
A monoclonal antibody to glycoprotein gp85 inhibits fusion but not attachment of Epstein-Barr virus.
J. Virol.
62:2366-2372[Abstract/Free Full Text].
|
| 27.
|
Molesworth, S. J.,
C. M. Lake,
C. M. Borza,
S. M. Turk, and L. M. Hutt-Fletcher.
2000.
Epstein-Barr virus gH is essential for penetration of B cells but also plays a role in attachment of virus to epithelial cells.
J. Virol.
74:6324-6332[Abstract/Free Full Text].
|
| 28.
|
Montgomery, R. I.,
M. S. Warner,
B. J. Lum, and P. G. Spear.
1996.
Herpes simplex virus-1 entry into cells mediated by a novel member of the TNF/NGF receptor family.
Cell
87:427-436[CrossRef][Medline].
|
| 29.
|
Nemerow, G. R.,
R. A. Houghten,
M. D. Moore, and N. R. Cooper.
1989.
Identification of an epitope in the major envelope protein of Epstein-Barr virus that mediates viral binding to the B lymphocyte EBV receptor (CR2).
Cell
56:369-377[CrossRef][Medline].
|
| 30.
|
Nemerow, G. R.,
C. Mold,
V. K. Schwend,
V. Tollefson, and N. R. Cooper.
1987.
Identification of gp350 as the viral glycoprotein mediating attachment of Epstein-Barr virus (EBV) to the EBV/C3d receptor of B cells: sequence homology of gp350 and C3 complement fragment C3d.
J. Virol.
61:1416-1420[Abstract/Free Full Text].
|
| 31.
|
Nemerow, G. R.,
R. Wolfert,
M. E. McNaughton, and N. R. Cooper.
1985.
Identification and characterization of the Epstein-Barr virus receptor on human B lymphocytes and its relationship to the C3d complement receptor (CR2).
J. Virol.
55:347-351[Abstract/Free Full Text].
|
| 32.
|
Ozel, M.,
G. Pauli, and H. R. Gelderblom.
1988.
The organization of the envelope projections on the surface of HIV.
Arch. Virol.
100:255-266[CrossRef][Medline].
|
| 33.
|
Pietropaolo, R. L., and T. Compton.
1997.
Direct interaction between human cytomegalovirus glycoprotein B and cellular annexin II.
J. Virol.
71:9803-9807[Abstract].
|
| 34.
|
Prodinger, W. M.,
M. G. Schwendinger,
J. Schoch,
M. Kochle,
C. Larcher, and M. P. Dierich.
1998.
Characterization of C3dg binding to a recess formed between short consensus repeats 1 and 2 of complement receptor type 2 (CR2; CD21).
J. Immunol.
161:4604-4610[Abstract/Free Full Text].
|
| 35.
|
Pulvertaft, R. J. V.
1964.
Cytology of Burkitt's tumour (African lymphoma).
Lancet
i:238-240[CrossRef].
|
| 36.
|
Rhim, J. S.,
K. Schell,
B. Creasy, and W. Case.
1969.
Biological characteristics and viral susceptibility of an African green monkey kidney cell line (Vero).
Proc. Soc. Exp. Biol. Med.
132:670-678[CrossRef][Medline].
|
| 37.
|
Saemundsen, A. K.,
H. Albeck,
J. P. Hansen,
N. H. Nielsen,
M. Anvret,
W. Henle,
G. Henle,
K. A. Thomsen,
H. K. Kristensen, and G. Klein.
1982.
Epstein-Barr virus in nasopharyngeal and salivary gland carcinomas of Greenland Eskimoes.
Br. J. Cancer
46:721-728[Medline].
|
| 38.
|
Shibata, D., and L. M. Weiss.
1992.
Epstein-Barr virus-associated gastric adenocarcinoma.
Am. J. Pathol.
140:769-774[Abstract].
|
| 39.
|
Sixbey, J. W.,
E. H. Vesterinen,
J. G. Nedrud,
N. Raab-Traub,
L. A. Walton, and J. S. Pagano.
1983.
Replication of Epstein-Barr virus in human epithelial cells infected in vitro.
Nature (London)
306:480-483[CrossRef][Medline].
|
| 40.
|
Spear, P. G.
1993.
Entry of alphaherpesviruses into cells.
Semin. Virol.
4:167-180.
|
| 41.
|
Spriggs, M. K.,
R. J. Armitage,
M. R. Comeau,
L. Strockbine,
T. Farrah,
B. Macduff,
D. Ulrich,
M. R. Alderson,
J. Mullberg, and J. I. Cohen.
1996.
The extracellular domain of the Epstein-Barr virus BZLF2 protein binds the HLA-DR beta chain and inhibits antigen presentation.
J. Virol.
70:5557-5563[Abstract/Free Full Text].
|
| 42.
|
Steimle, V.,
L. A. Otten,
M. Zufferey, and B. Mach.
1993.
Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome).
Cell
75:135-146[CrossRef][Medline].
|
| 43.
|
Tanner, J.,
J. Weis,
D. Fearon,
Y. Whang, and E. Kieff.
1987.
Epstein-Barr virus gp350/220 binding to the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis.
Cell
50:203-213[CrossRef][Medline].
|
| 44.
|
Tanner, J.,
Y. Whang,
J. Sample,
A. Sears, and E. Kieff.
1988.
Soluble gp350/220 and deletion mutant glycoproteins block Epstein-Barr virus adsorption to lymphocytes.
J. Virol.
62:4452-4464[Abstract/Free Full Text].
|
| 45.
|
Tedder, T. F.,
L. T. Clement, and M. D. Cooper.
1984.
Expression of C3d receptors during human B cell differentiation: immunofluorescence analysis with the HB-5 monoclonal antibody.
J. Immunol.
133:678-683[Abstract].
|
| 46.
|
Thorley-Lawson, D. A., and C. A. Poodry.
1982.
Identification and isolation of the main component (gp350-gp220) of Epstein-Barr virus responsible for generating neutralizing antibodies in vivo.
J. Virol.
43:730-736[Abstract/Free Full Text].
|
| 47.
|
Yaswen, L. R.,
E. B. Stephens,
L. C. Davenport, and L. M. Hutt-Fletcher.
1993.
Epstein-Barr virus glycoprotein gp85 associates with the BKRF2 gene product and is incompletely processed as a recombinant protein.
Virology
195:387-396[CrossRef][Medline].
|
| 48.
|
Yoshiyama, H.,
S. Imai,
N. Shimizu, and K. Takada.
1997.
Epstein-Barr virus infection of human gastric carcinoma cells: implication of the existence of a new virus receptor different from CD21.
J. Virol.
71:5688-5691[Abstract].
|
| 49.
|
Young, L. S.,
D. Clark,
J. W. Sixbey, and A. B. Rickinson.
1986.
Epstein-Barr virus receptors on human pharyngeal epithelia.
Lancet
i:240-242[CrossRef].
|
| 50.
|
Zeidler, R.,
P. Meissner,
G. Eissner,
S. Lazis, and W. Hammerschmidt.
1996.
Rapid proliferation of B cells from adenoids in response to Epstein-Barr virus infection.
Cancer Res.
56:5610-5614[Abstract/Free Full Text].
|
| 51.
|
zur Hausen, H.,
H. Schulte-Holthausen,
G. Klein,
W. Henle,
G. Henle,
P. Clifford, and L. Santesson.
1970.
EB-virus DNA in biopsies of Burkitt tumors and anaplastic carcinomas of the nasopharynx.
Nature (London)
228:1056-1057[CrossRef][Medline].
|
Journal of Virology, November 2000, p. 10142-10152, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Feederle, R., Mehl-Lautscham, A. M., Bannert, H., Delecluse, H.-J.
(2009). The Epstein-Barr Virus Protein Kinase BGLF4 and the Exonuclease BGLF5 Have Opposite Effects on the Regulation of Viral Protein Production. J. Virol.
83: 10877-10891
[Abstract]
[Full Text]
-
Stevenson, P. G., Simas, J. P., Efstathiou, S.
(2009). Immune control of mammalian gamma-herpesviruses: lessons from murid herpesvirus-4. J. Gen. Virol.
90: 2317-2330
[Abstract]
[Full Text]
-
Sorem, J., Jardetzky, T. S., Longnecker, R.
(2009). Cleavage and Secretion of Epstein-Barr Virus Glycoprotein 42 Promote Membrane Fusion with B Lymphocytes. J. Virol.
83: 6664-6672
[Abstract]
[Full Text]
-
Gill, M. B., Wright, D. E., Smith, C. M., May, J. S., Stevenson, P. G.
(2009). Murid herpesvirus-4 lacking thymidine kinase reveals route-dependent requirements for host colonization. J. Gen. Virol.
90: 1461-1470
[Abstract]
[Full Text]
-
Feederle, R., Bannert, H., Lips, H., Muller-Lantzsch, N., Delecluse, H.-J.
(2009). The Epstein-Barr Virus Alkaline Exonuclease BGLF5 Serves Pleiotropic Functions in Virus Replication. J. Virol.
83: 4952-4962
[Abstract]
[Full Text]
-
Neuhierl, B., Feederle, R., Adhikary, D., Hub, B., Geletneky, K., Mautner, J., Delecluse, H.-J.
(2009). Primary B-Cell Infection with a {Delta}BALF4 Epstein-Barr Virus Comes to a Halt in the Endosomal Compartment yet Still Elicits a Potent CD4-Positive Cytotoxic T-Cell Response. J. Virol.
83: 4616-4623
[Abstract]
[Full Text]
-
Reimer, J. J., Backovic, M., Deshpande, C. G., Jardetzky, T., Longnecker, R.
(2009). Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis. J. Virol.
83: 734-747
[Abstract]
[Full Text]
-
Young, K. A., Herbert, A. P., Barlow, P. N., Holers, V. M., Hannan, J. P.
(2008). Molecular Basis of the Interaction between Complement Receptor Type 2 (CR2/CD21) and Epstein-Barr Virus Glycoprotein gp350. J. Virol.
82: 11217-11227
[Abstract]
[Full Text]
-
Granato, M., Feederle, R., Farina, A., Gonnella, R., Santarelli, R., Hub, B., Faggioni, A., Delecluse, H.-J.
(2008). Deletion of Epstein-Barr Virus BFLF2 Leads to Impaired Viral DNA Packaging and Primary Egress as Well as to the Production of Defective Viral Particles. J. Virol.
82: 4042-4051
[Abstract]
[Full Text]
-
Lee, J.-H., Terzaghi, W., Gusmaroli, G., Charron, J.-B. F., Yoon, H.-J., Chen, H., He, Y. J., Xiong, Y., Deng, X. W.
(2008). Characterization of Arabidopsis and Rice DWD Proteins and Their Roles as Substrate Receptors for CUL4-RING E3 Ubiquitin Ligases. Plant Cell
20: 152-167
[Abstract]
[Full Text]
-
Young, K. A., Chen, X. S., Holers, V. M., Hannan, J. P.
(2007). Isolating the Epstein-Barr Virus gp350/220 Binding Site on Complement Receptor Type 2 (CR2/CD21). J. Biol. Chem.
282: 36614-36625
[Abstract]
[Full Text]
-
Medina-Palazon, C., Gruffat, H., Mure, F., Filhol, O., Vingtdeux-Didier, V., Drobecq, H., Cochet, C., Sergeant, N., Sergeant, A., Manet, E.
(2007). Protein Kinase CK2 Phosphorylation of EB2 Regulates Its Function in the Production of Epstein-Barr Virus Infectious Viral Particles. J. Virol.
81: 11850-11860
[Abstract]
[Full Text]
-
Chiu, Y.-F., Tung, C.-P., Lee, Y.-H., Wang, W.-H., Li, C., Hung, J.-Y., Wang, C.-Y., Kawaguchi, Y., Liu, S.-T.
(2007). A comprehensive library of mutations of Epstein Barr virus. J. Gen. Virol.
88: 2463-2472
[Abstract]
[Full Text]
-
Hutt-Fletcher, L. M.
(2007). Epstein-Barr Virus Entry. J. Virol.
81: 7825-7832
[Full Text]
-
Gaudreault, E., Fiola, S., Olivier, M., Gosselin, J.
(2007). Epstein-Barr Virus Induces MCP-1 Secretion by Human Monocytes via TLR2. J. Virol.
81: 8016-8024
[Abstract]
[Full Text]
-
Gillet, L., Gill, M. B., Colaco, S., Smith, C. M., Stevenson, P. G.
(2006). Murine gammaherpesvirus-68 glycoprotein B presents a difficult neutralization target to monoclonal antibodies derived from infected mice. J. Gen. Virol.
87: 3515-3527
[Abstract]
[Full Text]
-
Grabusic, K., Maier, S., Hartmann, A., Mantik, A., Hammerschmidt, W., Kempkes, B.
(2006). The CR4 region of EBNA2 confers viability of Epstein-Barr virus-transformed B cells by CBF1-independent signalling.. J. Gen. Virol.
87: 3169-3176
[Abstract]
[Full Text]
-
Feederle, R., Neuhierl, B., Baldwin, G., Bannert, H., Hub, B., Mautner, J., Behrends, U., Delecluse, H. J.
(2006). Epstein-Barr Virus BNRF1 Protein Allows Efficient Transfer from the Endosomal Compartment to the Nucleus of Primary B Lymphocytes. J. Virol.
80: 9435-9443
[Abstract]
[Full Text]
-
Kirschner, A. N., Omerovic, J., Popov, B., Longnecker, R., Jardetzky, T. S.
(2006). Soluble Epstein-Barr Virus Glycoproteins gH, gL, and gp42 Form a 1:1:1 Stable Complex That Acts Like Soluble gp42 in B-Cell Fusion but Not in Epithelial Cell Fusion. J. Virol.
80: 9444-9454
[Abstract]
[Full Text]
-
Turk, S. M., Jiang, R., Chesnokova, L. S., Hutt-Fletcher, L. M.
(2006). Antibodies to gp350/220 Enhance the Ability of Epstein-Barr Virus To Infect Epithelial Cells. J. Virol.
80: 9628-9633
[Abstract]
[Full Text]
-
Minoura-Etoh, J., Gotoh, K., Sato, R., Ogata, M., Kaku, N., Fujioka, T., Nishizono, A.
(2006). Helicobacter pylori-associated oxidant monochloramine induces reactivation of Epstein-Barr virus (EBV) in gastric epithelial cells latently infected with EBV.. J Med Microbiol
55: 905-911
[Abstract]
[Full Text]
-
Gill, M. B., Gillet, L., Colaco, S., May, J. S., de Lima, B. D., Stevenson, P. G.
(2006). Murine gammaherpesvirus-68 glycoprotein H-glycoprotein L complex is a major target for neutralizing monoclonal antibodies. J. Gen. Virol.
87: 1465-1475
[Abstract]
[Full Text]
-
Shannon-Lowe, C. D., Neuhierl, B., Baldwin, G., Rickinson, A. B., Delecluse, H.-J.
(2006). From the Cover: Resting B cells as a transfer vehicle for Epstein-Barr virus infection of epithelial cells. Proc. Natl. Acad. Sci. USA
103: 7065-7070
[Abstract]
[Full Text]
-
Shannon-Lowe, C., Baldwin, G., Feederle, R., Bell, A., Rickinson, A., Delecluse, H.-J.
(2005). Epstein-Barr virus-induced B-cell transformation: quantitating events from virus binding to cell outgrowth. J. Gen. Virol.
86: 3009-3019
[Abstract]
[Full Text]
-
Omerovic, J., Lev, L., Longnecker, R.
(2005). The Amino Terminus of Epstein-Barr Virus Glycoprotein gH Is Important for Fusion with Epithelial and B Cells. J. Virol.
79: 12408-12415
[Abstract]
[Full Text]
-
Ahsan, N., Kanda, T., Nagashima, K., Takada, K.
(2005). Epstein-Barr Virus Transforming Protein LMP1 Plays a Critical Role in Virus Production. J. Virol.
79: 4415-4424
[Abstract]
[Full Text]
-
Farina, A., Feederle, R., Raffa, S., Gonnella, R., Santarelli, R., Frati, L., Angeloni, A., Torrisi, M. R., Faggioni, A., Delecluse, H.-J.
(2005). BFRF1 of Epstein-Barr Virus Is Essential for Efficient Primary Viral Envelopment and Egress. J. Virol.
79: 3703-3712
[Abstract]
[Full Text]
-
McShane, M. P., Longnecker, R.
(2004). Cell-surface expression of a mutated Epstein-Barr virus glycoprotein B allows fusion independent of other viral proteins. Proc. Natl. Acad. Sci. USA
101: 17474-17479
[Abstract]
[Full Text]
-
Stewart, J. P., Silvia, O. J., Atkin, I. M. D., Hughes, D. J., Ebrahimi, B., Adler, H.
(2004). In Vivo Function of a Gammaherpesvirus Virion Glycoprotein: Influence on B-Cell Infection and Mononucleosis. J. Virol.
78: 10449-10459
[Abstract]
[Full Text]
-
Luna, R. E., Zhou, F., Baghian, A., Chouljenko, V., Forghani, B., Gao, S.-J., Kousoulas, K. G.
(2004). Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein K8.1 Is Dispensable for Virus Entry. J. Virol.
78: 6389-6398
[Abstract]
[Full Text]
-
Silva, A. L., Omerovic, J., Jardetzky, T. S., Longnecker, R.
(2004). Mutational Analyses of Epstein-Barr Virus Glycoprotein 42 Reveal Functional Domains Not Involved in Receptor Binding but Required for Membrane Fusion. J. Virol.
78: 5946-5956
[Abstract]
[Full Text]
-
de Lima, B. D., May, J. S., Stevenson, P. G.
(2004). Murine Gammaherpesvirus 68 Lacking gp150 Shows Defective Virion Release but Establishes Normal Latency In Vivo. J. Virol.
78: 5103-5112
[Abstract]
[Full Text]
-
Ikeda, A., Merchant, M., Lev, L., Longnecker, R., Ikeda, M.
(2004). Latent Membrane Protein 2A, a Viral B Cell Receptor Homologue, Induces CD5+ B-1 Cell Development. J. Immunol.
172: 5329-5337
[Abstract]
[Full Text]
-
Isobe, Y., Sugimoto, K., Yang, L., Tamayose, K., Egashira, M., Kaneko, T., Takada, K., Oshimi, K.
(2004). Epstein-Barr Virus Infection of Human Natural Killer Cell Lines and Peripheral Blood Natural Killer Cells. Cancer Res.
64: 2167-2174
[Abstract]
[Full Text]
-
Spear, P. G., Longnecker, R.
(2003). Herpesvirus Entry: an Update. J. Virol.
77: 10179-10185
[Full Text]
-
Hiriart, E., Bardouillet, L., Manet, E., Gruffat, H., Penin, F., Montserret, R., Farjot, G., Sergeant, A.
(2003). A Region of the Epstein-Barr Virus (EBV) mRNA Export Factor EB2 Containing an Arginine-rich Motif Mediates Direct Binding to RNA. J. Biol. Chem.
278: 37790-37798
[Abstract]
[Full Text]
-
Humme, S., Reisbach, G., Feederle, R., Delecluse, H.-J., Bousset, K., Hammerschmidt, W., Schepers, A.
(2003). The EBV nuclear antigen 1 (EBNA1) enhances B cell immortalization several thousandfold. Proc. Natl. Acad. Sci. USA
100: 10989-10994
[Abstract]
[Full Text]
-
Dirmeier, U., Neuhierl, B., Kilger, E., Reisbach, G., Sandberg, M. L., Hammerschmidt, W.
(2003). Latent Membrane Protein 1 Is Critical for Efficient Growth Transformation of Human B Cells by Epstein-Barr Virus. Cancer Res.
63: 2982-2989
[Abstract]
[Full Text]
-
Neuhierl, B., Feederle, R., Hammerschmidt, W., Delecluse, H. J.
(2002). Glycoprotein gp110 of Epstein-Barr virus determines viral tropism and efficiency of infection. Proc. Natl. Acad. Sci. USA
99: 15036-15041
[Abstract]
[Full Text]
-
Gruffat, H., Batisse, J., Pich, D., Neuhierl, B., Manet, E., Hammerschmidt, W., Sergeant, A.
(2002). Epstein-Barr Virus mRNA Export Factor EB2 Is Essential for Production of Infectious Virus. J. Virol.
76: 9635-9644
[Abstract]
[Full Text]
-
Maruo, S., Yang, L., Takada, K.
(2001). Roles of Epstein-Barr virus glycoproteins gp350 and gp25 in the infection of human epithelial cells. J. Gen. Virol.
82: 2373-2383
[Abstract]
[Full Text]
-
Lee, W., Hwang, Y.-H., Lee, S.-K., Subramanian, C., Robertson, E. S.
(2001). An Epstein-Barr Virus Isolated from a Lymphoblastoid Cell Line Has a 16-Kilobase-Pair Deletion Which Includes gp350 and the Epstein-Barr Virus Nuclear Antigen 3A. J. Virol.
75: 8556-8568
[Abstract]
[Full Text]
-
Haan, K. M., Aiyar, A., Longnecker, R.
(2001). Establishment of Latent Epstein-Barr Virus Infection and Stable Episomal Maintenance in Murine B-Cell Lines. J. Virol.
75: 3016-3020
[Abstract]
[Full Text]