Previous Article | Next Article 
Journal of Virology, November 2000, p. 10112-10121, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Differences in Determinants Required for Complex
Formation and Transactivation in Related VP16 Proteins
Matthew
Grapes
and
Peter
O'Hare*
Marie Curie Research Institute, Oxted, Surrey
RH8 OTL, United Kingdom
Received 1 June 2000/Accepted 26 July 2000
 |
ABSTRACT |
VP16-H is an essential structural protein of herpes simplex virus
type 1 (HSV-1) and is also a potent activator of virus immediate-early (IE) gene expression. Current models of functional determinants within
VP16-H indicate that it consists of two domains, an N-terminal domain
involved in recruiting VP16-H to a multicomponent DNA binding complex
with two host proteins, Oct-1 and host cell factor (HCF), and an acidic
C-terminal domain exclusively involved in transactivation. VP16-E, from
equine herpesvirus 1 (EHV-1), exhibits strong conservation with the
N-terminal domain of VP16-H but, with the exception of a short segment
at the extreme C terminus, lacks almost the entire acidic C-terminal
domain. Studies of key activation determinants within the C terminus of
VP16-H would predict that VP16-E may activate poorly, if at all.
However, VP16-E is a potent activator of both EHV-1 and HSV-1 IE gene
transcription. We show that VP16-E does not follow the simple
two-domain model of VP16-H. Thus, despite the conservation in the
N-terminal domains, this region in VP16-E is not sufficient for
assembly into the DNA binding complex with Oct-1 and HCF. The short
conserved determinant close to the C terminus is completely dispensable
in VP16-H but is absolutely required in VP16-E. In activation studies,
the potency of intact VP16-E was not recapitulated in chimeric proteins
in which it was fused with a GAL4 DNA binding domain. Furthermore, a
chimeric protein consisting of the C-terminal region of VP16-E fused to the N-terminal domain of VP16-H, while able to promote complex formation, nevertheless exhibited very weak activation. These results
indicate that the mode of recruitment of the activation domain, i.e.,
through complex formation with Oct-1 and HCF, may be crucial for
activation and that key determinants required for activation in VP16-E,
and possibly VP16-H, may involve interactions between regions of the C
terminus and the N terminus rather than discrete domains with
independent functions.
 |
INTRODUCTION |
VP16 is encoded by the UL48 gene of
herpes simplex virus type 1 (HSV-1) and is an essential structural
protein, assembled into the tegument of the virion at approximately
1,200 to 1,500 molecules per particle (14). It is also a
potent activator of the transcription of viral immediate-early (IE)
genes (2, 3, 32). Transcriptional activation is initiated by
the recruitment of VP16, together with two cellular proteins, Oct-1
(9, 30, 33, 38) and host cell factor (HCF) (17, 50,
51), into a multicomponent complex formed on regulatory sites
(TAATGARAT motifs) present within each of the IE gene
promoters (for reviews, see references 29 and
49). Previous analyses from several laboratories are
consistent with a model of VP16 whereby the functions of recruitment to
the DNA binding complex and transcriptional activation are separate
activities located in two discrete domains (4, 10, 43). An
amino-terminal domain, refined to within residues 49 to 390, is
involved in the binding of VP16 to HCF and the recruitment of this
binary complex to the Oct-1-DNA complex (11). Analysis by
limited proteolysis demonstrated that the region at about residue 370 within this domain is present in a surface-exposed loop
(13); results from site-directed mutagenesis showed that,
while complex formation is sensitive to alterations in other regions,
key residues involved in interactions with Oct-1 and HCF are located
within residues 360 to 390 (1, 11, 21, 48).
VP16 extends for another 100 residues beyond the C-terminal boundary of
the domain required for complex formation, and this C-terminal
extension is highly enriched in acidic amino acids (6, 31).
This region encompasses determinants required for transcriptional
activation, since C-terminal truncations or insertions within the
intact protein abolished activation without having any detectable
effect on complex formation (1, 10, 35, 48). However, most
studies of the determinants involved in transcriptional activation per
se have been performed in the context of fusion proteins in which the
C-terminal region has been fused to a heterologous DNA binding domain,
e.g., that from the yeast GAL4 protein, and activation has been studied
with target promoters containing GAL4 recognition sites (4,
37). From such studies, the C-terminal region has been generally
recognized as a physical and functional domain which can be split
broadly into two subdomains, the H1 or N region (residues 410 to 452)
and the H2 or C region (residues 453 to 490) (35, 43, 46).
Although the net negative charge in the C-terminal region contributes
to activation, the pattern of hydrophobic and aromatic residues appears
to be more critical, with particularly important residues being
phenylalanines at position 442 in H1 (N) and at positions 473, 475, and
479 in H2 (C) (5, 35, 46). The number of targets proposed to
bind to the VP16 activation domain is confusingly large and includes
members of the basal transcription initiation complex (18, 23,
39), mediator proteins and RNA polymerase II holoenzyme (15,
19), histone acetylases (44), and many other members
of the transcriptional apparatus, and it is presently difficult to
reconcile a role for all of these factors in a physiologically relevant
way (for a review, see reference 41). Moreover,
comparison with the homologues of VP16 from other alphaherpesviruses
has emphasized some of the difficulties in understanding the detailed
mechanism of activation.
For example, within the VP16 homologues from bovine herpesvirus 1 (BHV-1), equine herpesvirus 1 (EHV-1), and varicella-zoster virus
(VZV), the N terminus is well conserved, but there is significant divergence in the C terminus among these proteins. Indeed, based on the
known requirements within VP16-H and the differences found within the C
termini, it was predicted that, e.g., the EHV-1 homologue might not
activate IE gene expression (40). However, each of the VP16
species, including that of EHV-1, has been reported to activate IE gene
expression (8, 22, 25, 28, 34). The C terminus of the EHV-1
protein (termed VP16-E for ease of reference in this work) exhibits
some homology with that of VP16-H but appears to be a truncated version
and does not have the same preponderance of negatively charged
residues. However, this region of VP16-E has been shown to be required
for its transcriptional activity (8).
As part of a program to clarify the mechanisms involved in IE gene
activation, we sought to directly compare VP16-H and VP16-E, particularly with respect to the involvement of C-terminal regions in
complex formation and transactivation. Our results indicate some
significant differences between the two proteins, since a determinant
within the C terminus of VP16-E is required for the assembly of the
complex with Oct-1 and HCF. Paradoxically, this region, while
representing a selectively conserved segment within the otherwise
diverged C termini, is dispensable in VP16-H. Moreover, we show that
the activities of GAL4 fusion proteins do not reflect the activities of
the intact parental proteins, indicating that the mode of recruitment
of the activation domain may be crucial for activation. Key
determinants required for activation in VP16-E, and possibly VP16-H,
may involve interactions between regions of the C terminus and the N
terminus rather than discrete domains with independent functions.
 |
MATERIALS AND METHODS |
Cells, transfections, and CAT assays.
COS-1 and Vero cells
were grown in Dulbecco's modified minimal essential medium containing
10% newborn calf serum. Transfections were performed by the calcium
phosphate method with various amounts of expression plasmids made up to
2 µg with pUC19 DNA as described previously (11). Cells
were harvested approximately 40 h after transfection and assayed
for chloramphenicol acetyltransferase (CAT) activity exactly as
described previously (11).
Plasmids.
VP16-H cloned in pcDNA1 (Invitrogen) was
transferred from the parental construct (26) into pcDNA1/amp
as a HindIII-EcoRI fragment. VP16-E was
initially produced by PCR amplification of gene 12 from EHV-1 strain
Ab1 in vector GE126 (8). Alignment of the coding sequences
of various VP16 species indicated that in this original construct,
translation of VP16-E may have initiated from an upstream in-frame
methionine, yielding a protein with an extra 30 residues. VP16-E was
therefore recloned by PCR amplification with primers containing
EcoRI and XbaI sites at the 5' and 3' ends,
respectively. The 5' primer was positioned to amplify from the next
available methionine, yielding a protein about 30 residues shorter than
the original one. The fragment was inserted between the
EcoRI and XbaI sites of pcDNA1/amp to yield the
expression vector for wild-type VP16-E, pcDNA1/amp.VP16-E. (The lack of
30 residues from the original construct had no deleterious effect on
activity but appeared to increase the efficiency of expression.) Mutations in VP16-E were introduced by subcloning from plasmids GE130,
GE134, GE135, GE136, and GE137, which contain mutant VP16-E species
(8), by swapping the C-terminal
BglII-HpaI fragment of the parental vector with
the corresponding fragment from each of the mutants in the GE series of
plasmids to yield VP16-E.(1-425), VP16-E.(1-445), VP16-E.(
444),
VP16-E.(
442-444), and VP16-E.(
442-445).
A further truncation was produced to yield VP16-E.(1-393) by digesting
pcDNA1/amp.VP16-E with PshAI and XbaI and then
using an annealed oligonucleotide to replace the coding frame
downstream of residue 393 with a termination codon and an
XbaI site. All of the VP16-H and VP16-E variants examined
were therefore expressed in identical backgrounds. GAL-VP16-E was
produced by digesting pcDNA1/amp.VP16-E with EcoRI and
XbaI and cloning the appropriate fragment into the GAL
fusion vector pM3 (36) to yield an in-frame fusion between
the GAL4 DNA binding domain and the complete VP16-E protein. This
vector was subcloned back into pcDNA1/amp.VP16-E using BglII
to create pcDNA1/amp.GAL-VP16-E. The GAL4-VP16-H acidic domain
fusion, pPO64 (46), contains just the C-terminal 80 residues of VP16-H, while pGal4-VP16-H contains full-length VP16-H and was
produced by inserting the BamHI-PstI fragment of
MK6 (13) into the GAL vector pM2 (36).
The chimera of VP16-H and VP16-E was produced by PCR amplification of
residues 393 to 448 from the C-terminal end of VP16-E.
The PCR fragment
introduced a
SalI site at the 5' end and a
BglII
site at the 3' end, and the fragment was cloned into
SalI-
BglII-digested
pGE138 (
8). This
procedure created a fusion protein linking
the N-terminal region up to
position 411 of VP16-H in frame to
the C-terminal region beginning at
position 393 of VP16-E. This
chimera, designated pMG3, was subcloned
into the pcDNA1/amp backbone
by digestion of pMG3 with
AgeI
and
HpaI and insertion of the appropriate
fragment into
pcDNA1/amp.VP16-H to form VP16-H/E.
A version of VP16-E (pSV5-VP16-E) containing an epitope tag (from the
paramyxovirus SV5 matrix protein) at its N terminus
was constructed by
first inserting the SV5 epitope tag into pcDNA1/amp
and then cloning
into this vector the
BamHI-
HpaI fragment of
pcDNA1/amp.VP16-E.
This construction introduced an extra 36 bp between
the SV5 tag
and the start of the VP16-E reading frame which, together
with
the SV5 tag, added 24 residues to the N terminus of VP16-E.
SV5-VP16-E.(1-393)
was produced by digesting pcDNA1/amp.VP16-E(1-393)
with
SalI and
HpaI and ligating the resulting
fragment into pSV5-VP16-E.
Target reporter vectors used in CAT assays were as follows. For
analysis of VP16-E and VP16-H, the constructs were pCAT_TAAT
(
8), which contains the CAT gene driven by the natural EHV-1
IE gene promoter region (

360 to +78) encompassing four octamer
binding sites, and pAB5, which contains the CAT gene driven by
the
HSV-1 IE110 gene promoter-regulatory region (

165 to +150).
For
analysis of the GAL4 fusion proteins, the target plasmid was
pUAS10CAT
(
4), which contains two strong and two weaker GAL4
binding
sites.
Gel retardation assays.
Binding reactions were carried out
as previously described (16) using 0.02 µl (0.2 ng) of the
purified POU domain, in vitro-translated HCF, and 1 ng of the
end-labeled probe. VP16 species were supplied by in vitro translation
(TnT; Promega) or from soluble extracts of transfected cells prepared
as described previously. The probes encompassed the E1 octamer site of
the EHV-1 IE gene promoter (AGCTGAGGAGACGCATGCAGATGAGATGTGCATCGAGG)
(8) or the octamer motif at position
160 of the
HSV-1 IE110 gene promoter (TAAT24) as previously described
(CCATGGAGATCTCGTGCATGCTAATGATATTCTTCCATGG) (underlined sequences indicate the octamer site within the probe) (47). Poly(dI-dC) was routinely added to the mixture at 1 µg per reaction to reduce nonspecific binding. The mixture was
incubated with the labeled probe for 15 min, and the complexes were
resolved in nondenaturing 6% polyacrylamide (acrylamide-bisacrylamide, 37:5) gels in 0.5× Tris-borate-EDTA (TBE). Electrophoresis was performed at a constant voltage of 200 V for 90 min. The gels were
dried, and complexes were detected by autoradiography.
Immunofluorescence.
COS-1 cells to be processed for
immunofluorescence were seeded at 1.25 × 105 cells
per well in six-well cluster plates (Costar) on 25-mm glass coverslips.
Approximately 40 h after transfection, cells were washed with
phosphate-buffered saline (PBS), fixed for 15 min with ice-cold
methanol, and blocked in PBS containing 10% calf serum (blocking
solution) for 20 min. Monoclonal antibody against the SV5 tag was added
in the same solution (1:2,000) for 20 min. VP16-H was detected by using
the monoclonal antibody LP1 as previously described (20).
For secondary antibodies, fluorescein isothiocyanate-conjugated anti-mouse immunoglobulin G (Vector Laboratories) was used at a
dilution of 1:100 and tetramethyl rhodamine isothiocyanate-conjugated anti-rabbit immunoglobulin G (Sigma) was used at a dilution of 1:200.
These antibodies were added in blocking solution and incubated for 20 min. After three 5-min washes in PBS, the coverslips were mounted in
Vector Shield (Vector Laboratories) and visualized using either a
Bio-Rad MRC600 confocal microscope or a Zeiss LSM 410 confocal
microscope. Images were processed with Adobe Photoshop software.
 |
RESULTS |
Requirements for a conserved determinant in the extreme C
terminus.
A schematic summary of the relationship between the
VP16-H and VP16-E proteins is shown in Fig.
1a. A more detailed alignment of the
C-terminal region and an indication of some of the variants used in
this work are illustrated in Fig. 1b. The N-terminal regions of the
proteins, corresponding approximately up to residue 390 of VP16-H, are
well conserved. However, after these regions, there is a notable
divergence in the sequences, indicated by a transition from yellow to
green shading, where VP16-B, VP16-E, and VZV VP16 exhibit continued
conservation but VP16-H does not (Fig. 1b). After this section, the
C-terminal region of VP16-E is much shorter than that of VP16-H, is not
noticeably acidic, and completely lacks the section around the critical
phenylalanine residue 442. The exception to the general lack of
homology between the C-terminal regions is found at the extreme C
terminus, where a short section of approximately 15 residues is well
conserved. This section is within the region of VP16-H which we
previously termed H2 (46) and, for the sake of clarity, has
been labeled in this work (Fig. 1b) as the H2 core conserved region
(H2.CCR).

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of activation by VP16-H and VP16-E. (a)
Schematic representation of the similarities between VP16-H and VP16-E.
The N-terminal shaded regions are well conserved, while the C-terminal
regions are not, with the exception of a short section retained in both
species, as discussed in the text. (b) Primary sequence alignment of
the VP16 homologues extending from residue 357 in VP16-H. Yellow
shading indicates the region well conserved in all species, while green
shading indicates the region which appears to be selectively conserved
in VP16-E, VP16-B, and VZV VP16. The H2.CCR at the extreme C termini of
all species is highlighted, while the C-terminal boundaries of variants
of VP16-E analyzed in this work are indicated. (c) Comparison of
activation by VP16 variants. The CAT reporter construct pCAT_TAAT
(8), which contains the EHV-1 IE gene promoter region ( 360
to +78), was transfected (200 ng) into Vero cells either alone ( ) or
together with the indicated VP16 constructs (at doses of 1, 10, and 100 ng). Cells were harvested 40 h later, and aliquots were assayed
for CAT activity. (d) As for panel c but with the VP16-H constructs
indicated and the target vector pAB5, which contains the HSV-1 IE110
gene promoter from 165 to +150 (30).
|
|
Transactivation by VP16-E and its variants was examined in
transfection assays using a CAT reporter construct,
pCAT_TAAT,
which contains the native EHV-1 IE gene promoter
(

360 to +78)
and encompasses four octamer elements (
8).
Direct comparison
was made with VP16-H and additional VP16-E variants.
The target
vector (200 ng) was cotransfected with VP16-H,
VP16-H.(1-453),
VP16-H.(1-411), VP16-E, and a deletion mutant which
lacks the
H2.CCR, VP16-E.(1-425), at doses of 1, 10, or 100 ng. The
results
demonstrate that VP16-E was as potent an activator as VP16-H
(Fig.
1c, cf. lanes 2 to 4 and 8 to 10). Deletion of the C-terminal
23 residues encompassing the H2.CCR completely abrogated transactivation
by VP16-E (Fig.
1c, lanes 11 to 13). However, in contrast, deletion
of
all H2 C-terminal 37 residues from VP16-H, encompassing the
conserved
section, had comparatively little effect on activation
(Fig.
1d).
Similar results were obtained irrespective of the target
IE gene
promoter and are consistent with earlier observations
(
11,
42). VP16-H.(1-411), which lacks the entire acidic domain,
was
inactive, as expected (Fig.
1b, lanes 5 to 7). While the results
for
VP16-E.(1-425) are consistent with previous findings (
8),
the direct comparison shown here illustrates two points. First,
wild-type VP16-E which, compared to VP16-H, contains a truncated,
nonacidic C-terminal region, is as potent an activator as VP16-H;
second, a short extreme C-terminal determinant which has been
specifically conserved despite the overall lack of conservation
within
the C terminus is paradoxically critical for VP16-E activity
but
dispensable in VP16-H.
Differences in requirements for recruitment to the DNA binding
complex.
Although the C-terminal region of VP16-H is not required
(10) for the assembly of the octamer binding complex (TRF-C)
with Oct-1 and HCF, it was nonetheless possible that the failure of VP16-E.(1-425) to activate expression was due to a failure to be
recruited into the corresponding complex. To examine this possibility, wild-type VP16-E, VP16-E.(1-425), and several additional C-terminal deletion variants were expressed in vitro and assayed for the ability
to promote complex formation in gel retardation assays. Each of the
proteins was expressed in vitro at approximately the same level (Fig.
2a), and equal amounts of the products
were incubated with in vitro-translated HCF, the purified POU domain
(0.25 ng), and the E1 octamer probe from the EHV-1 IE gene promoter
(Fig. 2b). Independent binding of the POU domain to the E1 probe was observed (Fig. 2b, POU), together with a complex (asterisk) which originated from the TnT control lysate and was observed in all experiments to various degrees. The formation of TRF-C (Fig. 2b, Complex) was observed dependent upon the addition of both VP16-E and
HCF (lanes 3 to 5). Either component alone failed to promote complex
formation (Fig. 2b, lanes 1 and 2). Surprisingly, deletion of the
C-terminal 23 residues [VP16-E.(1-425)] almost completely eliminated
complex formation (Fig. 2b, lanes 7 to 9). A variant containing a
further deletion to residue 393 similarly failed to promote complex
formation (data not shown). Smaller deletions within and around the
extreme C terminus had little effect on complex formation (Fig. 2b,
lanes 10 to 25). Note that the relatively poorer complex formation
observed in this experiment for the wild-type and VP16-E.(
442-445)
species was not a reproducible effect (see, e.g., Fig. 3; also, data
not shown).

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 2.
Complex formation by VP16-E and variants. (a) VP16-E
variants were translated in vitro in a rabbit reticulocyte system (50 µl) in the presence of [35S]methionine, and equal
amounts (1 µl) were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and detected by
autoradiography. Positions of molecular size markers (in kilodaltons)
are indicated on the left. (b) Equal amounts of in vitro translation
reactions for the species indicated (1, 2, or 4 µl) were incubated
with the E1 octamer probe, the purified POU domain, and HCF, supplied
from a separate in vitro translation reaction. The position of the
complex dependent on all components is indicated. Independent binding
of the POU domain is indicated by POU, while a nonspecific complex
formed by a component of the reticulocyte extract is indicated by an
asterisk. The position of unbound probe is marked as DNA. The results
for each VP16 species are shown in four lanes, the first lane of which
lacks HCF. Thus, complex formation by competent variants is seen to be
dependent upon HCF. The control lanes (lanes 1) show that HCF is not
sufficient for complex formation, which requires the appropriate VP16
species.
|
|
To provide additional evidence for a defect in complex formation of the
VP16-E.(1-425) variant, we expressed the VP16-E species
in vivo and
examined complex formation using soluble extracts.
The results were
identical to those obtained using the proteins
expressed in vitro.
Thus, VP16-E.(1-425) was almost completely
defective, while
VP16-E.(1-445) was similar to the parental species
(Fig.
3a). A summary of the results for complex
formation, together
with previous results on the transcriptional
activity of these
mutants (
8), is shown in Fig.
3b. Two
points are of note. First,
unlike that of VP16-H and notwithstanding
the homology in the
region, the N-terminal region of VP16-E is not an
independent
domain, sufficient for complex formation with Oct-1 and
HCF. In
some way, whether directly or indirectly by influencing the
presentation
of the N-terminal region, the C-terminal 20 residues
mapping between
positions 425 and 445 and encompassing the H2.CCR are
required
for complex formation. Second, certain residues within this
same
C-terminal region are also specifically required for
transcriptional
activity, since we show that the mutant
VP16-E.(

442-445) is able
to promote complex formation, while earlier
results showed that
this mutant was virtually inactive in the induction
of IE gene
expression (reference
8 and data not
shown).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
(a) Requirement for a determinant located between
positions 425 and 445 for VP16-E complex formation. COS-1 cells were
transfected (2 µg of DNA) with an expression vector for wild-type
VP16-E, VP16-E.(1-445), or VP16-E.(1-425), and soluble extracts were
made 40 h after transfection as described in Materials and
Methods. Extracts in the amounts indicated (microliters) were incubated
with the purified Oct-1 POU domain, in vitro-translated HCF, and
radiolabeled EHV-1 E1 probe. Complexes were then separated on a
nondenaturing TBE-6% polyacrylamide gel. The nonspecific complex
formed by a component in the reticulocyte extract is indicated by a
single asterisk, while a component likely representing endogenous Oct-1
in the soluble extract is indicated by a double asterisk. Free probe
(DNA), POU binding, and the POU-HCF-VP16 complex are indicated by
arrows. Controls in lanes 1 and 2 and the first lane of each series
show that the complex was dependent upon HCF and competent VP16-E.
Deletion of the 20 residues from positions 445 to 425 abolished complex
formation. (b) Summary of each of the VP16-E constructs and their
function in complex formation (Comp.) (this work) and IE gene
transactivation (Act) (8; this work). Salient
features include the lack of complex formation by VP16-E.(1-425) and
the competence for complex formation of VP16-E.( 442-445), despite
its lack of transactivation. In this summary, activation was indicated
as negative when it measured less than 10% of control values.
|
|
Cellular compartmentalization of VP16-E.
To examine the
compartmentalization of VP16-E in comparison to that of VP16-H, VP16-E
and variants were tagged at their N termini with an epitope tag (from
the SV5 matrix protein), and localization in transfected COS-1 cells
was assessed by immunofluorescence. Cells were fixed in cold methanol,
and VP16-E was detected with the anti-SV5 monoclonal antibody. VP16-E
typically showed a significant degree of nuclear accumulation, with
lower but detectable amounts in the cytoplasm, particularly in cells
with a higher level of expression (Fig.
4a). Nuclear accumulation of VP16-E was
more pronounced than that of VP16-H which, in a parallel analysis, was
found in a diffuse, predominantly cytoplasmic pattern, as previously
reported (20). Patterns for VP16-E.(1-425) and
VP16-E.(1-393) exhibited no significant differences in
compartmentalization relative to wild-type VP16-E (Fig. 4a), and
overall levels of expression were similar (Fig. 4b). The results help
support the proposal that there was no gross disruption of VP16-E by
virtue of the C-terminal deletions and that the failure to promote
activation in vivo was due to a failure to promote complex formation
for variants VP16-E.(1-425) and VP16-E.(1-393).


View larger version (65K):
[in this window]
[in a new window]
|
FIG. 4.
Localization of VP16-E. (a) Expression vectors (1 µg)
for epitope-tagged VP16-E (w/t), VP16-E.(1-425), and VP16-E.(1-393)
were transfected into COS-1 cells, which were fixed and processed for
immunofluorescence as described in Materials and Methods. Each VP16
species exhibited significant nuclear accumulation, with little
difference between variants. (b) Levels of expression were detected in
aliquots of total sodium dodecyl sulfate lysates of the transfected
cells after separation by electrophoresis and Western blotting with the
SV5 monoclonal antibody. Wild-type VP16-E, VP16-E.(1-425),
VP16-E.( 442-445), and VP16-E.(1-393) are shown in lanes 1 to 4, respectively. Positions of molecular size markers (in kilodaltons) are
indicated on the left.
|
|
Activation by GAL-VP16-E.
The method usually used to uncouple
requirements for DNA binding (whether through protein-protein
interactions, as for VP16, or via direct DNA binding) from those for
transcriptional activation per se is to link the candidate activation
domain to an independent DNA binding domain, for example, that of the
GAL4 protein. However, since deletion of the H2.CCR had little effect
on VP16-H but had a profound effect on VP16-E, it seemed likely that
other determinants, possibly within the N-terminal region itself, were
involved in activation by VP16-E, acting as the equivalent of the H1
region of the VP16-H C-terminal activation domain. Indeed, a region
close to the N terminus of VP16-E, between residues 23 and 46 (our
numbering system; previously labeled as residues 53 to 77), has been
indicated to share some homology with the H1 region of VP16-H
(35).
Therefore, in order to examine activation by VP16-E separately from
TRF-C formation, we fused the entire VP16-E open reading
frame to the
GAL4 DNA binding domain and tested the activity of
the fusion protein
on an upstream activation sequence-containing
target reporter gene.
Activity was compared with that of GAL4
fusion proteins containing the
entire VP16-H open reading frame
or just the VP16-H activation domain
(Fig.
5b). For the sake of
comparison of
the two assay systems, we also included a direct
parallel examination
of the activity of native VP16-E and VP16-H
on the native EHV-1 IE gene
promoter (Fig.
5a). While, as expected
from the above results, VP16-E
was as potent as VP16-H (Fig.
5a),
GAL4.VP16-E surprisingly
was significantly weaker than GAL4.VP16-H
and in fact
exhibited an activity barely above background (Fig.
5b). The expression
of GAL4 fusion proteins was examined by Western
blot analysis of
transfected-cell extracts with an anti-GAL4 antibody,
and expression
levels were found to be similar, indicating that
the lack of activity
was not due to a deficiency in expression
levels (data not shown). It
is also noteworthy that while GAL4.VP16-H,
containing intact
VP16-H, exhibited significant activity, it was
nevertheless weaker than the fusion protein containing the isolated
activation
domain Gal4.Acid. This result is considered together with
the
lack of activity of the GAL4.VP16-E protein in the Discussion.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison of activation by intact VP16 species versus
GAL fusions. (a) Vero cells were transfected with the EHV-1 IE gene
target construct pCAT_TAAT (200 ng) alone ( ) or together with 1, 10, or 100 ng of the VP16-H and VP16-E expression vectors as indicated,
and CAT activity was assayed. (b) COS-1 cells were transfected with the
upstream activation sequence target construct pUAS10CAT (475 ng) alone
( ) or together with 10, 100, or 1,000 ng of the GAL4 fusion
constructs as indicated. The relative strength of VP16-E when the
intact proteins were assayed is not reflected in the context of the
GAL4 fusion proteins.
|
|
Clearly, the potent activity of the native VP16-E protein was not
recapitulated in the context of GAL4 fusion proteins. One
explanation
for this result is that the activation function of
VP16-E was dependent
on or linked to the mode of DNA binding and
therefore that a comparison
of transcriptional activation by VP16-E
and VP16-H required analysis in
the context of recruitment via
HCF and Oct-1 in TRF-C. To this end, we
constructed a VP16-H/E
chimeric protein comprising the N-terminal
domain of VP16-H linked
to the C-terminal region of VP16-E. Note that
such a chimera had
been produced previously (
8); in it,
eight residues from the
extreme C terminus of VP16-E had been fused to
the N-terminal
domain of VP16-H. The construct exhibited little
activity. However,
from our analysis of the alignments (Fig.
1b), there
was clearly
a more extended region of conservation within the C
terminus of
VP16-E, beginning at residue 393, which is selectively
retained
in VP16-B (from BHV-1) and VZV VP16 but not in VP16-H. It was
possible that determinants within this latter region were required
for
activity and were not included in the earlier analysis. We
therefore
constructed a VP16-H/E chimeric protein linking the
N-terminal
complex-forming region from VP16-H (up to residue 411)
to the
C-terminal region of VP16-E from residue 393 to the end
(Fig.
6c). Thus, the VP16-E region encompassed
not only the H2.CCR
but also the region conserved in VP16-E, VP16-B,
and the VZV VP16
homologues.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 6.
Lack of activation by VP16-H/E. (a) COS-1 cells were
transfected with the HSV-1 IE gene reporter construct pAB5 (100 ng)
alone ( ) or together with expression vectors for VP16-E, VP16-H, and
the VP16-H/E chimera [VP16-H.(1-411) plus VP16-E.(393-448)] at doses
of 1, 10, and 100 ng, and CAT activity was measured. (b) Levels of
expression of VP16-H and VP16-H/E from cells transfected with 100 ng of
DNA were compared. Whole-cell extracts were separated on a sodium
dodecyl sulfate-10% polyacrylamide gel, and the products were
transferred to nitrocellulose and probed with the anti-VP16 monoclonal
antibody LP1. Positions of molecular size markers (in kilodaltons) are
indicated on the left.
|
|
Cells were transfected with the target construct containing the HSV-1
IE110 gene promoter region, and activation by VP16-H,
VP16-E, and
VP16H/E was compared. The results demonstrate that
while VP16-H and
VP16-E were equally potent, the VP16-H/E chimera
surprisingly exhibited
extremely weak activity (Fig.
6a). In control
experiments with
monoclonal antibody LP1, which reacts against
an N-terminal determinant
of VP16 and could be used to detect
both species, the VP16-H/E chimera
and VP16-H were expressed in
vivo at very similar levels (Fig.
6b).
Although the C terminus
of VP16-H can be deleted without a significant
effect on the assembly
of TRF-C, it was possible that linking the C
terminus of VP16-E
to VP16-H may have had some dominant negative effect
and that
the failure of VP16-H/E to activate expression was due to a
failure
to promote complex formation. We therefore compared complex
formation
by VP16-H and VP16-H/E in gel retardation assays (Fig.
7). The
two species were translated in
vitro and incubated in similar
increasing doses with the purified POU
domain, HCF, and the IE110
octamer-GARAT probe. The results demonstrate
that VP16-H and VP16-H/E
were equally proficient in the assay (Fig.
7a,
lanes 5 to 11);
thus, the exchange of the acidic domain of VP16-H for
the C-terminal
domain of VP16-E seems to have little effect on complex
assembly.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
Complex formation by VP16-H/E. (a) VP16-H and VP16-H/E
were translated in vitro in reticulocyte lysates, and equal amounts of
the lysates (in microliters) were incubated with purified POU in the
presence or absence of in vitro-expressed HCF exactly as described in
the legend to Fig. 2, with the exception that poly(dI-dC) (1 µg) was
included as a nonspecific competitor. The samples were analyzed on a
nondenaturing TBE-6% polyacrylamide gel. Free probe (DNA), POU
binding, and the POU-HCF-VP16 complex are indicated by arrows. Low
amounts of the nonspecific band from the TnT lysate are marked by an
asterisk. (b) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
of in vitro-translated VP16-H and VP16-H/E fusion proteins. Positions
of molecular size markers (in kilodaltons) are indicated on the left.
(c) Schematic summary of determinants in VP16-H and VP16-E. H1 and H2
represent redundant determinants in the C terminus of VP16-H, and H2 is
a conserved determinant in VP16-E. N1 represents an N-terminal
determinant in VP16-E to account for activation by native VP16-E but
not by the VP16-H/E chimera, despite the ability of the latter to
promote complex formation.
|
|
 |
DISCUSSION |
VP16 is a potent activator of HSV-1 IE gene expression, the study
of which has yielded significant insights into eukaryotic transcriptional regulation. From such studies, the view has emerged that VP16 comprises two independent domains, a large N-terminal domain
involved in binding Oct-1, HCF, and DNA to form the DNA binding complex
and a C-terminal domain involved in activation per se. To examine this
view further, we have taken the approach of comparing requirements
within the C-terminal regions of two related VP16 species, VP16-H and
VP16-E, from HSV-1 and EHV-1, respectively, for recruitment into the
DNA binding complex containing Oct-1 and HCF and for activation. The
results indicate that VP16-E does not appear to conform to the
previously described view of VP16-H of segregation into two independent
domains. In VP16-E, a determinant within the extreme C terminus is
directly involved in complex formation or somehow ensures correct
presentation of the determinants in the N terminus.
The specific requirement in VP16-E for this C-terminal region in
complex formation is something of a paradox. On the one hand, the
extreme C termini encompass a short determinant (the H2.CCR) which is
conserved, despite the overall lack of similarity in the C termini.
Deletion of this determinant may therefore have been expected to have a
consequence on some activity. This is the case for VP16-E, in that such
deletion abolishes transactivation by affecting complex formation. On
the other hand, in VP16-H, the removal of the acidic domain, including
the H2.CCR determinant, has no effect on complex formation
(10). Thus, for VP16-E, the view of the C terminus as being
exclusively involved in some aspect of transactivation is not accurate.
Notwithstanding that VP16-E retains a high degree of homology with
determinants required for complex formation in the N-terminal domain of
VP16-H, it appears that features within the C terminus are
required for complex assembly. It is noteworthy, though, that
certain residues within the H2.CCR may be specifically involved in
activation, since we show that the mutant VP16-E.(
442-445) retained
complex-forming activity while being inactive in transactivation
(8).
The overlap between determinants involved in complex formation and
those required for transactivation makes analysis of structure-function relationships difficult. To examine activation distinct from complex formation, we fused the entire VP16-E protein to the DNA binding domain
of GAL4 and compared activation by VP16-E and VP16-H in the native
context to that in the GAL4 fusion setting. While the native proteins
exhibited approximately equal activities, in the context of the GAL4
fusions, VP16-E was significantly weaker than VP16-H, exhibiting little
activity. These results indicate two main points. First, the use of
artificial GAL fusion proteins may not reflect the true nature of
activation domains, both in qualitative and in quantitative terms.
Results from this work and previous work (26) indicate that
the GAL4-acidic domain fusion protein is unusually potent and is in
fact considerably more potent than GAL4 fused to the entire VP16-H
protein. A positive interpretation of this result could be that the
extremely potent activity of the GAL4-acidic domain protein does
represent the activity of the acidic domain of native VP16-H when, for
example, it becomes released or exposed for full activity through its
normal assembly pathway. On the other hand, it is conceivable that the mechanism involved in activation by the GAL4-acidic domain fusion protein does not truly reflect that of the native protein. An alteration in the function of VP16 in the context of a GAL4 chimera has
been suggested previously (12). That work showed that VP16-H acting on its native promoter could enhance activation only when in a
promoter-proximal position, while GAL-VP16-H.(411-490) could additionally activate from a distal position. A related phenomenon was
observed with certain HOX proteins, where identification of the
activation domains of the HOX proteins varied dramatically depending on
the context of the proteins (45). Analysis of the binding of
HOXD9 as a monomer to a HOX binding site located the activation domain
to within residues 76 to 264. However, when the same analysis was
carried out using a GAL4 DNA binding domain fused to the HOX protein,
only the N-terminal 75 amino acids contained a potential activation
domain; this same region, however, could be deleted in a native setting
with virtually no effect (45). These and other results from
similar types of analysis of other regulatory proteins indicate that
caution in the interpretation of the results of studies in the context
of GAL4 fusion proteins seems justifiable. It is possible that the mode
of DNA binding has direct consequences on the mechanism of activation,
for example, in the presentation of the activation domain. With that in
mind, we proceeded to construct a VP16 chimera, but here, too, we
obtained surprising results.
Our rationale was to explore similarities and differences in VP16-H and
VP16-E by constructing a chimera, informed by a previous analysis of
the sufficiency of the N-terminal domain of VP16-H for complex
formation and our alignment of the homologues to indicate where
transitions or boundaries in functional sections may occur. Furthermore, recent determination of the crystal structure of VP16-H
indicates that there is little ordered structure beyond residue 345, presumably indicative of a disordered unfolded region which appears to
have little influence on the folding of the N-terminal core domain
(24). Thus, a reasonable expectation would be that linking
the complete N-terminal region to the C-terminal region of a related
protein would have little effect on folding. We selected the region of
VP16-E to be linked on the basis of the alignments and the transition
at residue 393 (of VP16-E) to a C-terminal section showing good
conservation in the VP16-B, VP16-E, and VZV VP16 species (Fig. 1b). The
chimera was expressed normally; the N terminus folded normally, as
indicated by the ability of the chimeric protein to promote complex
formation, yet it activated transcription extremely poorly. The salient
comparison is between native VP16-E and VP16-H/E. Both retain the
C-terminal region, both promote complex formation, yet VP16-E is a
potent activator and VP16H/E exhibits little activity. One explanation
for this result, illustrated schematically in Fig. 7c, could be that
for VP16, there exist two C-terminal determinants, H1 and H2, which are
redundant for transactivation, with the result that deletion of H2 has
little effect. This notion would be consistent with previous results
(10, 35, 42). It is reasonable to suggest that VP16-E has
only one C-terminal determinant, equivalent to H2, and that deletion of
this region renders the protein inactive. However, since the VP16-H/E
chimera is also inactive, the explanation requires a difference between
the N termini of VP16-H and VP16-E, with the latter possessing an extra
determinant, N1, not present in VP16-H and required together with H2
for activation.
An N-terminal region in VP16-E (residues 23 to 46) exhibiting some
similarity to H1 has been previously reported (27), and this
may be the difference between the two proteins; however, we note that
this region in VP16-E does exhibit conservation with the extreme N
terminus of VP16-H. The determinant would also need to be qualitatively
distinct from the VP16-H H1 determinant, which appears to suffice in
the absence of H2, while the N terminus of VP16-E does not. An
alternative explanation is that in both proteins, the N- and C-terminal
determinants always function in conjunction. Thus, in VP16-H,
activation could be mediated by an N1-H1 or an N1-H2 interaction, while
in VP16-E, there would be only an N1-H2 determinant. This explanation,
however, is further complicated by the requirement in VP16-E for H2 in
complex formation itself; it is possible that in VP16-E an interaction
between the N and C termini is required for complex formation, while in
VP16-H the N-terminal region is sufficient. An additional chimera in which additional N-terminal regions of VP16-E are spliced into the
VP16-H/E chimera may exhibit restored function and identify differences
between the two proteins.
Finally, however, the basis for the clear selective conservation of the
H2.CCR in each of the homologous remains to be established. In this
respect, we have previously shown that VP16-H interacts with another
tegument protein, VP22, that the C-terminal domain is required, and
furthermore that residues in the H2.CCR are involved in this
interaction (7). It is possible that the other VP16 homologues interact with the corresponding VP22 species and that the
conservation within the H2.CCR is related to this activity. Moreover,
it is possible that any interaction between the VP16 H2.CCR and VP22 in
the virion is relevant to presentation of the activation domain early
after entry, i.e., in activation, or late in infection, when activation
may be suppressed. We are currently examining this proposition with
cotransfection assays.
In summary, our results indicate that the simplified model of discrete
domains within VP16-H for complex formation and activation may not
apply to other VP16 homologues and that GAL4 fusion proteins may not
reflect determinants or activities of the parental proteins. The result
is that at least in certain VP16 species, the separation of
determinants involved in recruitment to DNA binding complexes from
those involved in activation may be more complicated than previously appreciated.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Marie Curie
Research Institute, The Chart, Oxted, Surrey RH8 OTL, United Kingdom.
Phone: 44 1883 715028. Fax: 44 1883 714375. E-mail:
P.OHare{at}mcri.ac.uk.
Present address: Montreal Neurological Institute, Montreal, Quebec,
Canada H3A 2B4.
 |
REFERENCES |
| 1.
|
Ace, C. I.,
M. A. Dalrymple,
F. H. Ramsay,
V. G. Preston, and C. M. Preston.
1988.
Mutational analysis of the herpes simplex virus type 1 trans-inducing factor Vmw65.
J. Gen. Virol.
69:2595-2605[Abstract/Free Full Text].
|
| 2.
|
Batterson, W., and B. Roizman.
1983.
Characterization of the herpes simplex virion-associated factor responsible for the induction of alpha genes.
J. Virol.
46:371-377[Abstract/Free Full Text].
|
| 3.
|
Campbell, M. E.,
J. W. Palfreyman, and C. M. Preston.
1984.
Identification of herpes simplex virus DNA sequences which encode a trans-acting polypeptide responsible for stimulation of immediate early transcription.
J. Mol. Biol.
180:1-19[CrossRef][Medline].
|
| 4.
|
Cousens, D. J.,
R. Greaves,
C. R. Goding, and P. O'Hare.
1989.
The C-terminal 79 amino acids of the herpes simplex virus regulatory protein, Vmw65, efficiently activate transcription in yeast and mammalian cells in chimeric DNA-binding proteins.
EMBO J.
8:2337-2342[Medline].
|
| 5.
|
Cress, W. D., and S. J. Triezenberg.
1991.
Critical structural elements of the VP16 transcriptional activation domain.
Science
251:87-90[Abstract/Free Full Text].
|
| 6.
|
Dalrymple, M. A.,
D. J. McGeoch,
A. J. Davison, and C. M. Preston.
1985.
DNA sequence of the herpes simplex virus type 1 gene whose product is responsible for transcriptional activation of immediate early promoters.
Nucleic Acids Res.
13:7865-7869[Abstract/Free Full Text].
|
| 7.
|
Elliott, G.,
G. Mouzakitis, and P. O'Hare.
1995.
VP16 interacts via its activation domain with VP22, a tegument protein of herpes simplex virus, and is relocated to a novel macromolecular assembly in coexpressing cells.
J. Virol.
69:7932-7941[Abstract].
|
| 8.
|
Elliott, G. D.
1994.
The extreme carboxyl terminus of the equine herpesvirus 1 homolog of herpes simplex virus VP16 is essential for immediate-early gene activation.
J. Virol.
68:4890-4897[Abstract/Free Full Text].
|
| 9.
|
Gerster, T., and R. G. Roeder.
1988.
A herpesvirus trans-activating protein interacts with transcription factor OTF-1 and other cellular proteins.
Proc. Natl. Acad. Sci. USA
85:6347-6351[Abstract/Free Full Text].
|
| 10.
|
Greaves, R., and P. O'Hare.
1989.
Separation of requirements for protein-DNA complex assembly from those for functional activity in the herpes simplex virus regulatory protein Vmw65.
J. Virol.
63:1641-1650[Abstract/Free Full Text].
|
| 11.
|
Greaves, R. F., and P. O'Hare.
1990.
Structural requirements in the herpes simplex virus type 1 transactivator Vmw65 for interaction with the cellular octamer-binding protein and target TAATGARAT sequences.
J. Virol.
64:2716-2724[Abstract/Free Full Text].
|
| 12.
|
Hagmann, M.,
O. Georgiev, and W. Schaffner.
1997.
The VP16 paradox: herpes simplex virus VP16 contains a long-range activation domain but within the natural multiprotein complex activates only from promoter-proximal positions.
J. Virol.
71:5952-5962[Abstract].
|
| 13.
|
Hayes, S., and P. O'Hare.
1993.
Mapping of a major surface-exposed site in the herpes simplex virus protein Vmw65 to a region of direct interaction in a transcription complex assembly.
J. Virol.
67:852-862[Abstract/Free Full Text].
|
| 14.
|
Heine, J. W.,
R. W. Honess,
E. Cassai, and B. Roizman.
1974.
Proteins specified by herpes simplex virus. XII. The virion polypeptides of type 1 strains.
J. Virol.
14:640-651[Abstract/Free Full Text].
|
| 15.
|
Hengartner, C. J.,
C. M. Thompson,
J. Zhang,
D. M. Chao,
S.-M. Liao,
A. J. Koleske,
S. Okamura, and R. A. Young.
1995.
Association of an activator with an RNA polymerase II holoenzyme.
Genes Dev.
9:897-910[Abstract/Free Full Text].
|
| 16.
|
Hughes, T. A.,
S. LaBoissiere, and P. O'Hare.
1999.
Analysis of functional domains of the host cell factor involved in VP16 complex formation.
J. Biol. Chem.
274:16437-16443[Abstract/Free Full Text].
|
| 17.
|
Katan, M.,
A. Haigh,
C. P. Verrijzer,
P. C. van der Vliet, and P. O'Hare.
1990.
Characterization of a cellular factor which interacts functionally with Oct-1 in the assembly of a multicomponent transcription complex.
Nucleic Acids Res.
18:6871-6880[Abstract/Free Full Text].
|
| 18.
|
Klemm, R. D.,
J. A. Goodrich,
S. Zhou, and R. Tjian.
1995.
Molecular cloning and expression of the 32-kDa subunit of human TFIID reveals interactions with VP16 and TFIIB that mediate transcriptional activation.
Proc. Natl. Acad. Sci. USA
92:5788-5792[Abstract/Free Full Text].
|
| 19.
|
Koleske, A. J., and R. A. Young.
1994.
An RNA polymerase II holoenzyme responsive to activators.
Nature
368:466-469[CrossRef][Medline].
|
| 20.
|
LaBoissiere, S.,
T. Hughes, and P. O'Hare.
1999.
HCF-dependent nuclear import of VP16.
EMBO J.
18:480-490[CrossRef][Medline].
|
| 21.
|
Lai, J. S., and W. Herr.
1997.
Interdigitated residues within a small region of VP16 interact with Oct-1, HCF, and DNA.
Mol. Cell. Biol.
17:3937-3946[Abstract].
|
| 22.
|
Lewis, J. B.,
Y. G. Thompson, and G. B. Caughman.
1994.
Transcriptional control of the equine herpesvirus 1 immediate early gene.
Virology
197:788-792.
|
| 23.
|
Lin, Y.-S.,
I. Ha,
E. Maldonado,
D. Reinberg, and M. Green.
1991.
Binding of general transcription factor TFIIB to an acidic activating region.
Nature
353:569-571[CrossRef][Medline].
|
| 24.
|
Liu, Y.,
W. Gong,
C. C. Huang,
W. Herr, and X. Cheng.
1999.
Crystal structure of the conserved core of the herpes simplex virus transcriptional regulatory protein VP16.
Genes Dev.
13:1692-1703[Abstract/Free Full Text].
|
| 25.
|
Misra, V.,
A. C. Bratanich,
D. Carpenter, and P. O'Hare.
1994.
Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.
J. Virol.
68:4898-4909[Abstract/Free Full Text].
|
| 26.
|
Misra, V.,
S. Walker,
S. Hayes, and P. O'Hare.
1995.
The bovine herpesvirus alpha gene trans-inducing factor activates transcription by mechanisms different from those of its herpes simplex virus type 1 counterpart VP16.
J. Virol.
69:5209-5216[Abstract].
|
| 27.
|
Moriuchi, H.,
M. Moriuchi,
R. Pichyangkura,
S. J. Triezenberg,
S. E. Straus, and J. I. Cohen.
1995.
Hydrophobic cluster analysis predicts an amino-terminal domain of varicella-zoster virus open reading frame 10 required for transcriptional activation.
Proc. Natl. Acad. Sci. USA
92:9333-9337[Abstract/Free Full Text].
|
| 28.
|
Moriuchi, H.,
M. Moriuchi,
S. E. Straus, and J. I. Cohen.
1993.
Varicella-zoster virus open reading frame 10 protein, the herpes simplex virus VP16 homolog, transactivates herpesvirus immediate-early gene promoters.
J. Virol.
67:2739-2746[Abstract/Free Full Text].
|
| 29.
|
O'Hare, P.
1993.
The virion transactivator of herpes simplex virus.
Semin. Virol.
4:145-155.
|
| 30.
|
O'Hare, P., and C. R. Goding.
1988.
Herpes simplex virus regulatory elements and the immunoglobulin octamer domain bind a common factor and are both targets for virion transactivation.
Cell
52:435-445[CrossRef][Medline].
|
| 31.
|
Pellett, P. E.,
J. L. McKnight,
F. J. Jenkins, and B. Roizman.
1985.
Nucleotide sequence and predicted amino acid sequence of a protein encoded in a small herpes simplex virus DNA fragment capable of trans-inducing alpha genes.
Proc. Natl. Acad. Sci. USA
82:5870-5874[Abstract/Free Full Text].
|
| 32.
|
Post, L. E.,
S. Mackem, and B. Roizman.
1981.
Regulation of alpha genes of herpes simplex virus: expression of chimeric genes produced by fusion of thymidine kinase with alpha gene promoters.
Cell
24:555-565[CrossRef][Medline].
|
| 33.
|
Preston, C. M.,
M. C. Frame, and M. E. Campbell.
1988.
A complex formed between cell components and an HSV structural polypeptide binds to a viral immediate early gene regulatory DNA sequence.
Cell
52:425-434[CrossRef][Medline].
|
| 34.
|
Purewal, A. S.,
R. Allsopp,
M. Riggio,
E. A. Telford,
S. Azam,
A. J. Davison, and N. Edington.
1994.
Equid herpesviruses 1 and 4 encode functional homologs of the herpes simplex virus type 1 virion transactivator protein, VP16.
Virology
198:385-389[CrossRef][Medline].
|
| 35.
|
Regier, J. L.,
F. Shen, and S. J. Triezenberg.
1993.
Pattern of aromatic and hydrophobic amino acids critical for one of two subdomains of the VP16 transcriptional activator.
Proc. Natl. Acad. Sci. USA
90:883-887[Abstract/Free Full Text].
|
| 36.
|
Sadowski, I.,
B. Bell,
P. Broad, and M. Hollis.
1992.
GAL4 fusion vectors for expression in yeast or mammalian cells.
Gene
118:137-141[CrossRef][Medline].
|
| 37.
|
Sadowski, I.,
J. Ma,
S. Triezenberg, and M. Ptashne.
1988.
GAL4-VP16 is an unusually potent transcriptional activator.
Nature
335:563-564[CrossRef][Medline].
|
| 38.
|
Stern, S.,
M. Tanaka, and W. Herr.
1989.
The Oct-1 homoeodomain directs formation of a multiprotein-DNA complex with the HSV transactivator VP16.
Nature
341:624-630[CrossRef][Medline].
|
| 39.
|
Stringer, K. F.,
C. J. Ingles, and J. Greenblatt.
1990.
Direct and selective binding of an acidic transcriptional activation domain to the TATA-box factor TFIID.
Nature
345:783-786[CrossRef][Medline].
|
| 40.
|
Telford, E. A.,
M. S. Watson,
K. McBride, and A. J. Davison.
1992.
The DNA sequence of equine herpesvirus-1.
Virology
189:304-316[CrossRef][Medline].
|
| 41.
|
Triezenberg, S. J.
1995.
Structure and function of transcriptional activation domains.
Curr. Opin. Genet. Dev.
5:190-196[CrossRef][Medline].
|
| 42.
|
Triezenberg, S. J.,
R. C. Kingsbury, and S. L. McKnight.
1988.
Functional dissection of VP16, the trans-activator of herpes simplex virus immediate early gene expression.
Genes Dev.
2:718-729[Abstract/Free Full Text].
|
| 43.
|
Triezenberg, S. J.,
K. L. LaMarco, and S. L. McKnight.
1988.
Evidence of DNA:protein interactions that mediate HSV-1 immediate early gene activation by VP16.
Genes Dev.
2:730-742[Abstract/Free Full Text].
|
| 44.
|
Utley, R. T.,
K. Ikeda,
P. A. Grant,
J. Cotes,
D. J. Steger,
A. Eberharter,
S. John, and J. L. Workman.
1998.
Transcriptional activators direct histone acetyltransferase complexes to nucleosomes.
Nature
394:498-502[CrossRef][Medline].
|
| 45.
|
Vigano, M. A.,
G. Di Rocco,
V. Zappavigna, and F. Mavilio.
1998.
Definition of the transcriptional activation domains of three human HOX proteins depends on the DNA-binding context.
Mol. Cell. Biol.
18:6201-6212[Abstract/Free Full Text].
|
| 46.
|
Walker, S.,
R. Greaves, and P. O'Hare.
1993.
Transcriptional activation by the acidic domain of Vmw65 requires the integrity of the domain and involves additional determinants distinct from those necessary for TFIIB binding.
Mol. Cell. Biol.
13:5233-5244[Abstract/Free Full Text].
|
| 47.
|
Walker, S.,
S. Hayes, and P. O'Hare.
1994.
Site-specific conformational alteration of the Oct-1 POU domain-DNA complex as the basis for the differential recognition by Vmw65 (VP16).
Cell
79:841-852[CrossRef][Medline].
|
| 48.
|
Werstuck, G., and J. P. Capone.
1989.
Mutational analysis of the herpes simplex virus trans-inducing factor Vmw65.
Gene
75:213-224[CrossRef][Medline].
|
| 49.
|
Wilson, A. C.,
M. A. Cleary,
J. S. Lai,
K. LaMarco,
M. G. Peterson, and W. Herr.
1993.
Combinatorial control of transcription: the herpes simplex virus VP16-induced complex.
Cold Spring Harbor Symp. Quant. Biol.
58:167-178[Abstract/Free Full Text].
|
| 50.
|
Wilson, A. C.,
K. LaMarco,
M. G. Peterson, and W. Herr.
1993.
The VP16 accessory protein HCF is a family of polypeptides processed from a large precursor protein.
Cell
74:115-125[CrossRef][Medline].
|
| 51.
|
Xiao, P., and J. P. Capone.
1990.
A cellular factor binds to the herpes simplex virus type 1 transactivator Vmw65 and is required for Vmw65-dependent protein-DNA complex assembly with Oct-1.
Mol. Cell. Biol.
10:4974-4977[Abstract/Free Full Text].
|
Journal of Virology, November 2000, p. 10112-10121, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
von Einem, J., Schumacher, D., O'Callaghan, D. J., Osterrieder, N.
(2006). The {alpha}-TIF (VP16) Homologue (ETIF) of Equine Herpesvirus 1 Is Essential for Secondary Envelopment and Virus Egress. J. Virol.
80: 2609-2620
[Abstract]
[Full Text]
-
Pellerin, M., Lopez-Aguirre, Y., Penin, F., Dhumeaux, D., Pawlotsky, J.-M.
(2004). Hepatitis C Virus Quasispecies Variability Modulates Nonstructural Protein 5A Transcriptional Activation, Pointing to Cellular Compartmentalization of Virus-Host Interactions. J. Virol.
78: 4617-4627
[Abstract]
[Full Text]
-
Boyer, J. L., Swaminathan, S., Silverstein, S. J.
(2002). The Epstein-Barr Virus SM Protein Is Functionally Similar to ICP27 from Herpes Simplex Virus in Viral Infections. J. Virol.
76: 9420-9433
[Abstract]
[Full Text]
-
Loiacono, C. M., Myers, R., Mitchell, W. J.
(2002). Neurons Differentially Activate the Herpes Simplex Virus Type 1 Immediate-Early Gene ICP0 and ICP27 Promoters in Transgenic Mice. J. Virol.
76: 2449-2459
[Abstract]
[Full Text]
-
Zhou, H.-J., Wong, C.-M., Chen, J.-H., Qiang, B.-Q., Yuan, J.-G., Jin, D.-Y.
(2001). Inhibition of LZIP-mediated Transcription through Direct Interaction with a Novel Host Cell Factor-like Protein. J. Biol. Chem.
276: 28933-28938
[Abstract]
[Full Text]