Previous Article | Next Article 
Journal of Virology, November 2000, p. 10096-10103, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Infection of Dendritic Cells by the Maedi-Visna
Lentivirus
Susanna
Ryan,*
Laurence
Tiley,
Ian
McConnell, and
Barbara
Blacklaws
Centre for Veterinary Science, Department of
Clinical Veterinary Medicine, University of Cambridge, Cambridge
CB3 OES, United Kingdom
Received 16 May 2000/Accepted 3 August 2000
 |
ABSTRACT |
The early stages of lentivirus infection of dendritic cells have
been studied in an in vivo model. Maedi-visna virus (MVV) is a natural
pathogen of sheep with a tropism for macrophages, but the infection of
dendritic cells has not been proven, largely because of the
difficulties of definitively distinguishing the two cell types.
Afferent lymphatic dendritic cells from sheep have been phenotypically
characterized and separated from macrophages. Dendritic cells purified
from experimentally infected sheep have been demonstrated not only to
carry infectious MVV but also to be hosts of the virus themselves. The
results of the in vivo infection experiments are supported by
infections of purified afferent lymph dendritic cells in vitro, in
which late reverse transcriptase products are demonstrated by PCR. The
significance of the infection of afferent lymph dendritic cells is
discussed in relation to the initial spread of lentivirus infection and
the requirement for CD4 T cells.
 |
INTRODUCTION |
Maedi-visna virus (MVV)
is the prototype virus for the Lentivirus genus of the
Retroviridae family (14). MVV shares many characteristics with the lentivirus human immunodeficiency virus (HIV),
including the establishment of persistent infection associated with
chronic active lymphoproliferation, which in sheep affects primarily
the lungs, joints, central nervous system, and mammary glands (7,
12). Unlike the immunodeficiency viruses, MVV does not produce
severe immunodeficiency. Given that a good immune response is mounted
to MVV (3, 5, 6), this makes the persistence of the virus
and its inevitable fatality more surprising.
The recovery of virus from infected sheep has always been from cells of
the monocyte/macrophage lineage. These are the classical cell hosts in
vivo for MVV (22, 23, 52), although using in situ PCR
amplification and RNA in situ hybridization techniques, MVV DNA and RNA
have been identified in other cell types, including bronchiolar and
mammary epithelial cells (8, 68; C. G. Vitali, E. Sanna, G. Braca, L. Boreo, G. Rossi, and A. Leoni, Abstr. 3rd European Workshop on Ovine and Caprine Retroviruses, abstr. 23, 1997).
There is one report which suggests that blood dendritic cells may be
infected with MVV (23).
In vitro and in vivo infection of dendritic cells with HIV is now
firmly established, and evidence indicates that dendritic cell
infection is important in the development of protective immune responses, in the spread and persistence of virus, and in the immune
dysfunction which characterizes AIDS (11). Dendritic cells
are central players in the initiation of immune responses, being the
most potent of antigen-presenting cells and also being necessary for
the priming of native T cells. Immature dendritic cells strategically
patrol the peripheral tissues, where they are specialized to acquire
antigens. As they migrate to the draining lymph nodes, they mature into
effective antigen-presenting cells and consequently can present an
antigenic snapshot of the periphery to T cells in the draining lymph
nodes. Use of a rhesus macaque model to study early infection events
with the lentivirus simian immunodeficiency virus indicates that
dendritic cells may be the first cells to encounter the virus and
become infected and are the primary cells for dissemination
(67). Infection of dendritic cells with MVV would help to
provide insight into the failure of the immune response to clear virus
and the initial dissemination of infection into lymphoid and peripheral tissues.
We chose to investigate the possible infection of the afferent lymph
subset of dendritic cells because these are the most relevant type with
regard to early peripheral infection and the initial establishment of
an immune response. In addition, relatively large numbers of these
cells can be purified ex vivo by afferent lymph cannulation,
eliminating the need for artificial culture and minimizing the
potential for the induction of phenotypic changes. Efferent cannulation
of prefemoral and popliteal lymphatics is an established model to study
the early events in lymphoid tissue following MVV infection
(5). By cannulating pseudoafferent lymphatic vessels, we
were able to infect sheep subcutaneously and intradermally in the
drainage area and directly sample the flow of dendritic cells migrating
in afferent lymph on their way to the local lymph node. This in vivo
model maximizes the physiological and immunological relevance of the data.
 |
MATERIALS AND METHODS |
Experimental animals and in vivo infections.
Adult Finnish
Landrace crossed sheep, 2 to 5 years old, were supplied by the Moredun
Research Institute, Edinburgh, Scotland. All sheep used were tested MVV
seronegative prior to starting the experiments. The prefemoral lymph
nodes were surgically removed, and no less than 8 weeks later the
consequent pseudoafferent lymphatic vessel was surgically cannulated
(29, 35). After a minimum of 4 days of postoperative
recovery, sheep were inoculated subcutaneously and intradermally in the
prefemoral lymph node drainage area with 106 50% tissue
culture infective doses (TCID50) of autologous MVV. Afferent lymph was collected two to three times daily, and cell populations were analyzed over the period of patent cannulation by flow
cytometry, cocultivation assays, immunocytochemistry, and in situ hybridization.
Autologous virus production.
Autologous virus was prepared
by infecting autologous ovine skin cell monolayers derived from
individual sheep skin biopsies with MVV strain EV1 (63) as
described elsewhere (3). The titer of each virus stock was
determined on skin fibroblasts, and the concentration was calculated by
the quantal method of Reed and Muench (51). Heat-inactivated
virus was prepared by incubation at 56°C for 30 min, and inactivation
was confirmed by virus titration.
Cocultivation assays.
Infectious virus was detected by
cocultivation of serial dilutions of afferent lymph cells or lymph
plasma on ovine skin fibroblast monolayers in Dulbecco modified Eagle
medium with 5% fetal calf serum (FCS) as described previously
(3). Infection was scored by the presence of syncytia, and
representative samples were also stained for MVV Gag p15 by
immunocytochemistry using monoclonal antibody 415 (kindly donated by
D. J. Houwers), detected with peroxidase-conjugated rabbit
immunoglobulins (Ig) to mouse Ig (Dako) and 3-amino-9-ethyl carbazole
for color development. The nature of the samples meant that it was not
always possible to use the same number of starting cells in the serial
dilutions; therefore, the sensitivity of the assay varied. Where no
infectious virus was detected, the sensitivity of the assay is
expressed as the maximum TCID50 which might have been
detected if the dilution series had commenced with one serial dilution
fold more cells and if 100% of wells with these cells contained virus.
Metrizamide density gradient.
Afferent lymph samples were
enriched for large granular cells by centrifuging the cell suspension
over a discontinuous gradient of 14.5% (wt/vol) metrizamide (Nyegaard)
at 800 × g for 30 min at 4°C (10, 28).
Low-density cells at the interface were harvested and used as a source
of partially purified dendritic cells, referred to as metrizamide
gradient cells.
Immunocytochemistry and in situ hybridization.
Cytospins of
afferent lymph cells were paraformaldehyde fixed and blocked in
phosphate-buffered saline (PBS) with 0.01% Tween 80, 2% normal rabbit
serum, and 2% normal sheep serum before incubation with primary
monoclonal antibody. After three washes in PBS-0.01% Tween 80, the
slides were incubated with alkaline phosphatase-conjugated rabbit Ig to
mouse Ig, and a color reaction was developed with Sigma fast red.
Monoclonal antibodies used were VPM19 for major histocompatibility
complex (MHC) class I (31) and CC20 for CD1b, generously
provided by Chris Howard, Institute for Animal Health, Compton, United
Kingdom (37). Digoxigenin-labeled sense and antisense
riboprobes were prepared from a PCR-amplified fragment of 1514 MVV
gag kindly given by Franziska Lechner, Institute of Veterinary Virology, University of Bern (bases 822 to 1564 [66]) and from a PCR product of tat EV1 MVV
(MVV EV1 bases 5696 to 5981 [63]). In situ
hybridization was performed as described previously (43)
except that proteinase K was used at a concentration of 10 µg/ml, the
tat probe was used at 0.1 ng/ml, and the gag
probe was used at 0.5 ng/ml. Sense probes were always included as
negative controls and always produced no signal from the samples.
Nonspecific esterase staining.
Cells were cytocentrifuged,
then formaldehyde-acetone fixed, and stained for nonspecific esterase
activity using the active diazonium salt hexazotized pararosaniline and
-naphthyl acetate (39). Cell nuclei were counterstained
with 2% chloroform-washed methyl green.
Flow cytometry and FACS analysis.
Cells were washed in PBS
with 0.1% bovine serum albumin and 0.01% sodium azide (omitted for
fluorescence-activated cell sorting [FACS]). They were blocked in
10% normal rabbit serum in PBS for 30 min prior to incubation with
primary antibody and/or biotinylated antibody for 40 min on ice. After
two washes, cells were incubated in isotype-specific, fluorescein
isothiocyanate (FITC)-conjugated, anti-mouse antibodies for 20 min
and/or streptavidin-phycoerythrin. FACS analysis was performed on a
Becton Dickinson FACSort using CellQuest software. FACS sorting was
performed on Becton Dickinson FACStar and FACStarplus sorters. Dead
cells and erythrocytes were excluded using forward scatter and side
scatter electronic gating. Analysis gates for positive staining were
set using isotype control antibodies to indicate background staining
and autofluorescence. Monoclonal antibodies used were ST4 for CD4
(47), SBU-T8 for CD8 (50), DU2-104 as a
pan-B-cell marker (49), CC98 for WC6, a marker known to be
expressed on ovine afferent dendritic cells (16), OM1 for
CD11c
chain (26, 53), 3.29 for the mannose receptor (a
kind gift from A. Lanzavecchia) (62), VPM54 for MHC class II
DR
chain (17), VPM36 for MHC class II DQ
chain (17), VPM19 for MHC class I heavy chain (31),
CC20 for CD1b (37), and VPM65 for CD14 (25).
In vitro infection and PCR.
Cells were resuspended to
106 cells/ml in DNase-treated MVV EV1 (0.06 TCID50/cell) in medium with 2% FCS. They were incubated at
37°C for 2 h before the cells were diluted to 1.9 × 105 cells/ml in medium containing 10% FCS and returned to
the incubator for a further 24 or 48 h.
The medium for afferent lymph cells was supplemented with 10% lymph
node conditioned medium prepared as described elsewhere (28). Cells were harvested into PCR lysis buffer (50 mM KCl, 10 mM Tris-HCl [pH 8.3], 2.5 mM MgCl2, 0.1 mg of
gelatin/ml, 0.45% Nonidet P-40, 0.45% Tween 20, 10 µg of proteinase
K/ml) and incubated for 60 min at 56°C. DNA was extracted from the
cell lysates by phenol-chloroform extraction, and the concentration was
determined using a PicoGreen double-stranded DNA (dsDNA) quantitation
reagent kit from Molecular Probes Inc.
Nested PCR was performed in reaction mix volumes of 20 µl with
deoxynucleoside triphosphates at a final concentration of 0.225
mM
each, MgCl
2 at 2 mM,
Taq DNA polymerase at 0.04 U/µl, and each
primer at a final concentration of 1 µM. For the
first-round PCR,
the primers
(ACTGTCAGG[A/G]CAGAGAACA[A/G]ATGCC, EV1 nucleotide
positions 8914 to 8938, and CTCTCTTACCTTACTTCAGG,
complementary
to nucleotides 328 to 309 ;[[
57;]]), deoxynucleoside triphosphates,
and
template DNA were heated to 94°C for 1 min 30 s and then held
at
80°C while the remaining reaction components were added. This
was
followed by 30 cycles of 94, 55, and 72°C consecutively, each
for
30 s. Then 1 µl from the first reaction was used as the DNA
template in the second round of PCR, which used primers
AAGTCATGTA(G/T)CAGCTGATGCTT
(9049 to 9071) and
TTGCACGGAATTAGTAACG (129 to 111) and consisted
of 94°C for
1.5 min followed by 30 cycles of 94, 50, and 72°C
consecutively, each
for 30
s.
Monocyte-derived macrophages.
Monocyte-derived macrophages
were prepared from ovine blood and maintained in culture as described
elsewhere (45). After 5 days in culture, some cells were
harvested as uninfected controls and cytospin preparations were made.
Others were infected as described above for PCR. To produce heavily
infected controls for immunocytochemistry and in situ hybridization,
macrophages were infected with MVV EV1 at a multiplicity of infection
of 0.5 TCID50/cell in medium with 2% FCS. After a 2-h
incubation at 37°C, additional full maintenance medium was added;
cells were monitored for 4 to 5 days before being harvested for cytospins.
 |
RESULTS |
Presence of cell-associated MVV in afferent lymph.
The model
being used is subcutaneous and intradermal infection of sheep with MVV.
This is known to cause infection of the draining lymph node, indicating
transport of virus from the skin to the lymph node in the afferent
lymph (5). To verify this route and to establish whether
virus was cell associated and/or free in lymph plasma, the presence of
infectious virus in afferent lymph was monitored by cocultivation of
dilutions of lymph plasma or afferent lymph cells with monolayers of
indicator ovine skin fibroblasts.
Cell-associated infectious virus was detected in six acutely infected
sheep. Figure
1A depicts the data from
four sheep over
variable periods for which cannulae remained patent.
Cells were
separated by metrizamide density gradient centrifugation for
analysis
of the infectious cell populations. Regardless of individual
variation
in titers and time to appearance of infectivity, in all
instances
an enrichment for large, granular low-density cells by a
metrizamide
gradient increased the virus titer (Fig.
1A). Afferent
lymph contains
memory T lymphocytes, few B cells, up to 10% veiled
dendritic
cells, and some macrophages (
10,
48). Veiled
dendritic cells
represent the dendritic cell population migrating from
the skin.
The low-density fraction of cells from the metrizamide
gradient
purifies both dendritic cells and macrophages (
40).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 1.
MVV is associated with large cells in afferent lymph.
(A) Sheep with afferent lymph cannulations were infected with MVV; at
variable times postinfection, afferent lymph cells were purified by
metrizamide gradient centrifugation. Whole afferent lymph cells and
large cells from the metrizamide gradient fraction were analyzed for
the presence of infectious virus by cocultivation with indicator skin
cells. The frequency of infected cells is shown versus time
postinfection. Open histogram, whole afferent lymph cells; closed
histogram, metrizamide gradient cells; *, no detectable virus, but
bar indicates sensitivity of assay, i.e., maximum level of infectivity
which theoretically could have been present but undetected; nd, not
determined; Pre, samples analyzed preinfection. (B) Forward and side
scatter (FSC and SSC) flow cytometry profile of metrizamide gradient
afferent lymph cells, with the lymphocyte (LO) and large, granular cell
(DC) analysis gates indicated.
|
|
The afferent lymph cell populations were analyzed by flow cytometry.
Small lymphocytes and larger granular dendritic cells
and macrophages
were separated using electronic gates, allowing
the proportion of each
major lymphoid and myeloid population within
samples to be determined.
A representative flow cytometry plot
is shown in Fig.
1B, with the
electronic gating indicated. The
proportions of large granular cells in
unfractionated afferent
lymph (6.8% ± 2.8%) and in the low-density
fraction of cells from
a metrizamide gradient (35.2% ± 16.0%) varied
among sheep and
samples (data from three sheep). When the frequency of
infected
cells is adjusted for the percentage of large granular cells
in
any given sample and plotted for both unfractionated and
fractionated
afferent lymph, there is good correlation between
frequency of
infection and proportions of large granular cells
(analyzed by
linear least squares regression,
P < 0.001). The titer of infectious
virus in subsets of any one sample
was therefore directly related
to the proportion of large granular
cells in those subsets and
suggests that virus in afferent lymph was
associated exclusively
with large granular
cells.
Free infectious virus was never detected in afferent lymph plasma even
at times when cell-associated virus was present (data
not
shown).
Afferent lymph dendritic cells carry infectious MVV.
To
investigate whether MVV was associated with the dendritic cells in
afferent lymph and/or the small population of macrophages which
coenrich on a metrizamide gradient, further phenotypic characterization was required. Afferent lymph cells from MVV-seronegative sheep, purified and electronically gated for large granular cells as in Fig.
1B, were analyzed by flow cytometry for expression of a variety of cell
surface antigens found on dendritic cells, macrophages, and B and T
lymphocytes. Table 1 shows that the
majority of cells in the analysis region expressed the cell surface
repertoire characteristic of dendritic and macrophage cells (CD1b,
CD11c, MHC class I and II, and WC6; some expressed mannose receptor and
CD14), with little expression of T or B lymphocyte markers. It is known
that dendritic cells and macrophages share many cell surface antigens
such as MHC class II, CD11c, and mannose receptor (26, 27,
62). However, ovine afferent lymph dendritic cells express CD1b
but very little CD14 (32, 34), while ovine macrophages
express little or no CD1b but low to high levels of CD14 (25, 44, 60).
Metrizamide gradient cells were double stained for CD14 and CD1b
expression, and the large granular cells were analyzed (Fig.
2A). Four populations were identified:
CD14

CD1b

, CD14

CD1b
lo, CD14
lo CD1b
hi, and
CD14
hi CD1b
/lo. These varied slightly in
proportion and staining intensity from
sheep to sheep, but the mean
percentages of large granular metrizamide
gradient cells in the four
populations were 16.4 ± 6.0, 15.4 ±
4.0, 54.3 ± 11.2, 4.1 ± 4.0, respectively (values from six sheep).
We considered
the CD1b
lo and CD1b
hi populations to be
dendritic cells and the CD14
hi population to be
macrophages. This left an unknown population
of large granular cells
which was both CD1b

and CD14

.

View larger version (82K):
[in this window]
[in a new window]
|
FIG. 2.
Phenotype of dendritic cells and macrophages. (A)
Metrizamide gradient afferent lymph cells stained for CD14 and CD1b
were analyzed in the large, granular cell gate (Fig. 1) for expression
of these markers. CD14 CD1b cells (box 1;
26.7% of cells), CD14 CD1blo cells (box 2;
7.5% of cells), and CD14lo CD1bhi (box 3;
36.2% of cells) were considered dendritic cells, and
CD14hi CD1b ve cells box 4 (12.8% of cells)
were considered to be macrophages. (B) Afferent lymph cell populations
were separated by FACS using the electronic gates indicated by the
quadrant and box markers in panel A. Cytospins of (i) CD14+
(quadrants c and d), (ii) CD14 (quadrants a and b), (iii)
CD14lo CD1bhi (box 3), and (iv)
CD14 CD1blo (box 2) FACS-sorted cells were
stained for nonspecific esterase activity.
|
|
Cells from afferent lymph considered to be dendritic cells are
heterogeneous with respect to nonspecific esterase activity,
being
negative or displaying a reticular or punctate pattern of
staining
(
20). In contrast, afferent lymph macrophages display
a high
level of nonspecific esterase activity throughout the cytoplasm.
Metrizamide gradient cells from afferent lymph were separated
by FACS
into CD14
+ and CD14

populations. Cytospin
preparations of these cells were stained
for nonspecific esterase
activity. Macrophages were found only
in the CD14
+ fraction
[Fig.
2B(i)], while dendritic cells were found in both
the
CD14
+ and CD14

populations [Fig.
2B(ii)].
FACS separated CD14

CD1b
lo and
CD14
lo CD1b
hi populations from afferent lymph
both had exclusively dendritic
cell patterns of nonspecific esterase
activity [Fig.
2B(iii) and
(iv)].
The phenotypic analysis of metrizamide gradient ovine afferent lymph
cells shown in Table
1, together with assessment of
the morphology of
cells stained as cytospin preparations (Fig.
2B), supports the
dendritic cell and macrophage classification
with CD1b and CD14 (Table
2) and suggests that the unknown CD14

CD1b

population is also dendritic cells. In conclusion, the data demonstrate
that ovine afferent lymph dendritic cells can be categorized as
three
subpopulations: CD14

CD1b

,
CD14

CD1b
lo, and CD14
lo
CD1b
hi. Furthermore, they are distinguishable from afferent
lymph macrophages,
which are CD14
hi CD1b
/lo.
Table
2 summarizes the phenotypic
criteria established to distinguish
dendritic cells from macrophages in
afferent lymph.
During an in vivo infection, the ability of dendritic cells to carry
MVV from tissue to the draining lymph node was assessed
by FACS sorting
of afferent lymph cells using CD1b and CD14 expression.
No functional
assay was used to define these cells. CD14

CD1b
lo and CD14
lo CD1b
hi dendritic
cells were analyzed for infectious virus. Both populations
were
associated with virus. The highest frequencies of infected
cells were
detected in the CD1b
hi population, and more samples of
CD1b
hi than of CD1b
lo cells were positive for
virus in this animal (Fig.
3). Infected
cells were never detected in
cocultures performed using any cell
populations from seronegative
animals prior to inoculation with
MVV (e.g., preinfection or day 0 samples in Fig.
1A and
3). Dendritic
cells were therefore involved in the transport of MVV from the
periphery to the lymph node.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
MVV is associated with dendritic cells in afferent
lymph. Afferent lymph dendritic cells from a sheep infected with MVV
subsequent to cannulation were purified by metrizamide gradient
centrifugation followed by FACS sorting. CD14
CD1blo and CD14lo CD1bhi dendritic
cells were analyzed for the presence of infectious virus by
cocultivation with indicator skin cells. The frequency of infected
cells is shown versus time postinfection. Open histogram,
CD14 CD1blo dendritic cells; closed
histogram, CD14lo CD1bhi dendritic cells; *,
no detectable virus, but bar indicates sensitivity of assay, i.e.,
maximum level of infectivity which theoretically could have been
present but undetected. Day 0 samples were taken before infection. Mean
purity of FACS-separated cells was 91% (range of 67.1 to 97%) after
adjustments for autofluorescence and spectral overlap.
|
|
To determine whether dendritic cells were infected with as opposed to
carrying virus, we chose to analyze cells for viral
mRNA expression by
in situ hybridization. This individual cell
analysis was preferred due
to the low frequency of infectious
cells, e.g., 10 to 15 TCID
50/10
6 cells seen in the in vivo infection.
Initially we looked at FACS-separated
CD14

dendritic
cells for both
tat and
gag RNA expression. Both
riboprobes
used will detect genomic RNA as well as viral mRNA; however,
tat may be expressed earlier in the replication cycle than
gag (
64)
and therefore was considered appropriate
for this acute infection
model. Cells which were strongly positive for
gag (Fig.
4A) or
tat (data not shown) RNA were seen. In a total of 3 × 10
6 cells analyzed during the course of an infection, viral
RNA was
detected at a rate of approximately 0.3 positive cells per
10
5 CD14

dendritic cells. This was consistent
with the mean virus titer
measured by cocultivation assays from the
same samples of 0.11
TCID
50/10
5 cells. Due the
limited number of samples tested, we are unable
to say whether there
were more
tat than
gag RNA-positive cells
and
therefore whether the
tat probe was more sensitive in this
infection model. Preinfection samples were always negative with
either
antisense probe used. Cells were double stained by immunocytochemistry
for CD1b to define dendritic cells in unsorted populations used
in the
in situ hybridizations. The double-staining technique was
verified
using in vitro MVV-infected macrophages and an antibody
detecting MHC
class I. The sense
tat riboprobe did not produce
any signal
on heavily infected macrophages (Fig.
4B), while clear
signal was seen
with the antisense probe at the same time as MHC
class I expression
(Fig.
4C). The infrequent
tat RNA-positive
cells detected in
afferent lymph from in vivo-infected sheep were
shown to be
CD1b-positive dendritic cells (Fig.
4D).

View larger version (148K):
[in this window]
[in a new window]
|
FIG. 4.
MVV RNA expression in afferent lymph cells. (A)
Cytospins of CD14 FACS-separated afferent lymph dendritic
cells from MVV-infected sheep were probed for gag mRNA by in
situ hybridization using a digoxigenin-labeled gag
riboprobe. Positive controls were skin fibroblasts heavily infected in
vitro with MVV; as negative controls, all samples were hybridized with
a sense gag riboprobe (data not shown). (B to D) Cytospins
of metrizamide gradient cells from MVV-infected sheep were
immunostained for CD1b and probed for tat RNA by in situ
hybridization using a digoxigenin-labeled riboprobe. MVV-infected
monocyte-derived macrophages, used as controls, were immunostained
for MHC class I and for tat RNA. Specificity was verified
using an isotype control antibody for the immunostaining (data not
shown); for the in situ reaction, all samples were hybridized with a
sense tat riboprobe. Red staining indicates positive signal
for CD1b or MHC class I, and black staining indicates a positive signal
from the in situ hybridization reaction. (B) MVV-infected macrophages
stained for MHC class I expression and hybridized with sense
tat control riboprobe. (C) MVV-infected macrophages stained
for MHC class I expression and hybridized with antisense tat
riboprobe. (D) Metrizamide gradient afferent lymph cells stained for
CD1b expression and hybridized with antisense tat riboprobe.
Arrows indicate double-stained cells.
|
|
Infection of afferent lymph dendritic cells in vitro.
Theoretically both the gag and the tat riboprobe
could have detected genomic viral RNA or DNA. Although unlikely, it
remained a possibility that the dendritic cells were not infected but
were passively carrying virions. As the time at which virus was
detected in afferent lymph cells was variable and the virus titers were low, an in vitro infection system was chosen to assay for late reverse
transcription products. During lentivirus replication these are
produced only by virions which have started replication inside a host
cell, unlike some of the intermediate DNA products of viral
replication, which may be detected in extracellular HIV virions
(71). Nested PCR was used to amplify a 203-bp sequence of
MVV proviral DNA from the 5' long terminal repeat region. Since the
first-round primers span the primer binding site, PCR amplification can
occur only when proviral synthesis is almost complete. The presence of
a 203-bp product after PCR therefore indicates that virus has uncoated
and initiated replication.
CD14
lo CD1b
hi dendritic cells separated by FACS
from the afferent lymph of uninfected sheep were infected in vitro with
a low
multiplicity of infectious virus (DNase treated) and incubated
for 24 or 48 h. Cells were harvested, and the DNA was extracted
for use in the nested PCR described above to detect late reverse
transcription products. The assay was quantitated by using serial
dilutions of template cellular DNA. Ovine skin cell fibroblasts
which
are permissive for MVV infection and nonpermissive Chinese
hamster
ovary (CHO) cells were used as controls for the infection
and PCR. CHO
cells do not express detectable MVV receptor, as
determined by fusion
assay with cells expressing MVV
env (L. Tiley,
personal
communication). At 24 h postinfection, skin cells showed
detectable viral DNA at 70 pg of input cellular DNA (Fig.
5A).
Dendritic cells had detectable viral
DNA at 700 pg of input cellular
DNA (Fig.
5A). CHO cells did show
consistently a viral DNA band
at 7 ng of template DNA after 24 h
(Fig.
5A), which disappeared
by 48 h postinfection (Fig.
5B). This
viral DNA band is considered
to be genomic viral DNA from high template
input. At 48 h, both
the skin cells and the dendritic cells showed
increased levels
of viral DNA per cell equivalent (Fig.
5B). These
results were
consistent both within and between sheep (two different
days'
samples from two individual sheep analyzed). Therefore, the
level
of reverse transcription increased with time postinfection in
afferent lymph dendritic cells.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
In vitro infection of afferent lymph dendritic cells by
MVV. CD14lo CD1bhi dendritic cells were
separated by FACS from afferent lymph, and skin and CHO cells were
harvested from stocks in culture. Cells were infected with
DNase-treated MVV (0.06 TCID50/cell) for 2 h, and then
additional medium was added for overnight (A) or 48-h (B) incubation.
DNA was extracted from the cells, quantified with a PicoGreen dsDNA
quantitation reagent kit, and used as template at the given amounts (7 ng to 7 pg) in a nested PCR. Heat-inactivated virus was noninfectious,
as determined by cocultivation, and was used at preinactivation titers
as above. For these controls, 7 ng of template DNA was used. The
expected size for the PCR-amplified early reverse transcription product
of EV1 MVV is 203 bp. These results are representative of four
experiments using two different sheep. The percentage purity of
FACS-separated dendritic cells was 93.1% after the deduction of
backgrounds due to autofluorescence and spectral overlap.
|
|
To determine if macrophages behaved in a similar manner, both
monocyte-derived and afferent lymph macrophages (CD14
hi
CD1b

) were infected in vitro and analyzed using the same
PCR. Monocyte-derived
macrophages had increased levels of viral DNA per
cell equivalent
with time (Fig.
6).
Afferent lymph macrophages were always a minor
population, and very low
numbers were recovered from FACS separation.
The starting input
cellular DNA was therefore 0.7 ng rather than
7 ng. At 0.7 ng of input
cellular DNA, viral DNA was not detectable
at 24 h postinfection
but was present by 48 h postinfection (Fig.
6), again showing
increased levels of viral reverse transcription
with time in the
macrophage population. Analysis of the FACS-separated
dendritic cell
populations for purity indicated that the proportion
of macrophages
which could have contaminated them (Fig.
5) was
less than 5% (data not
shown). Therefore, as the dendritic cells
showed viral DNA in up to 7 pg of input cellular DNA while the
afferent lymph macrophages showed
viral DNA only at 700 pg of
input cellular DNA, the dendritic cells
must be one of the infected
cell populations: the macrophages could not
account for all the
signal seen in dendritic cell samples.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
In vitro infection of afferent lymph and monocyte
derived macrophages. CD14hi CD1b /lo
macrophages were separated by FACS from afferent lymph (AL
macrophages), and macrophages were derived in culture from ovine
peripheral blood monocytes (MD macrophages). Skin and CHO cells were
harvested from stocks in culture. Cells were infected with
DNase-treated MVV (0.06 TCID50/cell) for 2 h, and then
additional medium was added for overnight (A) incubation or a 48-h (B)
incubation. DNA was extracted from the cells, quantified with a
PicoGreen dsDNA quantitation reagent kit, and used as template at the
given amounts (7 ng to 7 pg) in a nested PCR. Heat-inactivated virus
was noninfectious, as determined by cocultivation, and was used at
preinactivation titers as above. For these controls, 7 ng (skin cells
and CHO cells) or 0.7 ng (AL macrophages and MD macrophages) of
template DNA was used. The expected size for the PCR-amplified early
reverse transcription product of EV1 MVV is 203 bp. This experiment is
representative of four experiments using two different sheep.
FACS-separated afferent lymph macrophages were 95.8% pure after
deduction of backgrounds for autofluorescence and spectral overlap. nd,
not done.
|
|
 |
DISCUSSION |
The results presented above show that dendritic cells form an
important route for transfer of MVV from the site of infection to
lymphoid tissue. The dendritic cells not only carry virus but are
infected with replicating virus. This was shown by in situ hybridization of in vivo-infected dendritic cells and by PCR
amplification of proviral DNA from ex vivo-infected dendritic cells.
This is a novel finding within the MVV field, where isolation and
analysis of dendritic cells has been hampered by the lack of markers
for ovine dendritic cells. Other investigators characterizing ovine
afferent lymph dendritic cells by FACS have not definitively separated
these cells from contaminating tissue macrophages. Functional studies
have used the low-density large granular cells from afferent lymph as
dendritic cell populations, ignoring macrophage contamination (10,
30, 33). As MVV has a known tropism for macrophages, it was
necessary in our studies to definitively separate and identify dendritic cells. We have characterized afferent lymph dendritic cells
into three distinct populations and distinguished these from
macrophages. Ovine macrophages have been characterized by their
expression of CD14 (25) and CD11b (27). Here we
have used CD14 to differentiate monocytes/macrophages from dendritic cells. Using CD1b and CD14 cell staining, we have managed to sort to
high purity afferent lymph dendritic cells. These cells are always
large granular cells with high autofluorescence. This means that
estimates of purity used 5% background gates, and therefore purity of
>95% will never be achieved. However, both double staining by in situ
hybridization for viral products and marker expression and infection of
purified afferent lymph macrophages show that in the population
studied, dendritic cells constituted a major source of virus.
There has been one report suggesting that blood dendritic cells may be
infected with MVV (23). These investigators took peripheral blood mononuclear cells (PBMCs) from MVV-infected
sheep, depleted them of specific cell subsets using adherence,
nylon wool, and panning, and measured cell-associated infectivity in infectious center assays. Depletion of nonadherent MHC class II CD45RA+ cells had the greatest effect in reducing the
infectivity of nonadherent PBMCs more than 100-fold (23).
The conclusion that the dendritic cell and not the monocyte is the
predominant MVV-infected cell type in blood assumed that ovine
dendritic cells are CD45RA+ by analogy with human blood
dendritic cells (70). The authors used negative selection
and an assay based on a reduction in infectivity to identify dendritic
cells. The infectivity data for most sheep tested were incomplete, and
the infectivities of nonadherent PBMCs and nonadherent PBMCs depleted
of MHC class II and CD45RA+ cells were compared in only one animal.
The phenotypic heterogeneity of ruminant afferent lymph dendritic
cells has been reported by other investigators (15, 20, 30,
36). Previously, four subpopulations of ovine afferent lymph
dendritic cells were defined by CD1 and Fc receptor expression (30); therefore, our finding of three dendritic cell
populations by CD1b and CD14 staining is not surprising. Subsets of
bovine afferent lymph dendritic cells defined by CD11a and the
novel bovine antigen MyD-1, which is a member of the SIRP family of signal regulatory binding proteins and mediates binding to
CD4+ T cells, differ in the ability to stimulate T cells
(9, 38). Subsets of ovine afferent lymph dendritic cells
have not been functionally subdivided, and so it is not known what
significance to attribute to the more consistent infection of
CD14lo CD1bhi dendritic cells than of
CD14
CD1blo cells (Fig. 3).
The highest level of infection in purified macrophage or dendritic cell
populations from in vivo-infected animals was <0.1%. This is
consistent with the results of other workers using a range of tissue
samples and suggests that factors which confine infection to a small
minority of cells are also acting in afferent lymph (3, 46,
55). The quantitative and qualitative aspects of HIV infection of
dendritic cells in vivo has been the subject of many opposing opinions
(11). However, it seems likely that dendritic cells not only
act as a reservoir of infection, passing virus to the T cells which
they activate, but also stimulate the protective CD4 and CD8 immune
responses which characterize asymptomatic infection (41).
The low percentage of dendritic cells infected by MVV in vivo in this
study precluded functional studies. As gross immunodeficiency is not a
feature of MVV infection, any functional defects in infected dendritic
cells would probably relate specifically only to MVV.
Afferent lymph plasma from three sheep was assayed for infectious virus
by cocultivation and was negative at all time points, including those
where cell-associated infectious virus was demonstrated (data not
shown). Diluting stock virus to a known titer with autologous serum or
lymph plasma for 30 min at room temperature completely abrogated
infectivity (data not shown). This effect was not seen in the controls
where tissue culture medium was used as a diluent. These results are
consistent with the established fact that MVV is predominantly a
cell-associated virus and free virus has not been detected in the
efferent lymph of experimentally infected animals (3) or in
the serum of naturally infected sheep (8), although there
are reports of free MVV in cerebrospinal fluid and synovial fluid
(8, 55). The antiviral elements of serum and lymph plasma
have not been identified for MVV. Possible candidates include
collectins such as mannose binding protein and bovine conglutinin,
which can both bind to HIV gp120 and inhibit virus infection of T cells
(1, 19). Activation of the alternative complement pathway is
thought to occur with vesicular stomatitis virus, measles virus, and
respiratory syncytial virus and may occur with MVV.
The absence of infectious free virus in fluids from inoculated tissue
emphasizes the importance of dendritic cell infection in the initial
spread of MVV. As ubiquitous patrollers of the periphery, dendritic
cells in lungs would probably perform the same function when sheep
become infected through the intranasal route. Afferent lymph dendritic
cells migrate to the lymph nodes, where they become short-lived
interdigitating dendritic cells in the T-cell paracortex, sited to
engage and sample the large number of naive and memory T cells
circulating through the node. Evidence from our previous studies
indicates that these CD4 T lymphocytes are necessary for transfer of
virus from dendritic cells to the macrophages which leave the node in
the efferent lymph (18). The mechanism for this is not
known, but T cell-dendritic cell interactions are two way: just as
dendritic cell activation of T cells is required for productive T-cell
infection with HIV (56, 57), so perhaps T-cell enhancement
of dendritic cell activation status (2, 13, 61, 65) is
necessary to stimulate complete MVV replication in dendritic cells and
enable transfer of infection to macrophages. Our in vitro PCR assays
have established that MVV can commence replication in afferent lymph
dendritic cells, and the cocultivation assays confirmed that in
vivo-infected dendritic cells can transfer infection to skin cell lines
in vitro. In the absence of CD4 T cells, in vitro culture is known to
greatly enhance the levels of infection in macrophages (21),
and therefore there remains the possibility that full production of
virions in vivo in dendritic cells requires CD4 T cells. In mature
dendritic cells, HIV reverse transcription is commenced but not
completed and viral transfer is dependent on T-cell interaction
(24, 69). Our preliminary evidence suggests that in vitro,
MVV replication in dendritic cells is faster in metrizamide gradient
cell preparations than in purified dendritic cell populations. The two
differ mainly by the presence of memory lymphocytes (data not shown).
It has previously been observed that MVV-infected sheep fail to mount
an IgG2 response to the virus (4) and also that such animals
show a reduced cutaneous delayed-type hypersensitivity response
(58). The definitive identification of MVV-infected afferent
lymph dendritic cells presented here could provide an explanation for
these observations if the interaction between dendritic cells harboring
MVV and CD4 helper T cells was defective in stimulating a Th1 response.
It has been shown that infection with a related virus, caprine
arthritis encephalitis virus, dysregulates cytokine expression in
macrophages (42). The absence of antibody-dependent cellular
cytotoxicity to MVV-infected cells (59) may reflect the lack
of MVV-specific IgG2 antibodies (Inderpal Singh, personal communication) and represent a mechanism for viral persistence. Dendritic cells could further contribute to viral persistence and
spread if the reservoir of infected bone marrow cells which have been
described by expression of an undefined macrophage antigen (22) are in fact hematopoietic precursors of both monocytes and dendritic cells (54).
The ability to cannulate sheep and study fresh afferent lymph
dendritic cells draining the site of an experimental MVV
infection has enabled us to identify these cells as targets for the
virus in vivo. This approach maximizes the immunological and
pathological relevance of the findings, both in minimizing phenotypic
changes induced by culture of dendritic cells and in studying the
acquisition of infection in the context of the whole-animal model.
 |
ACKNOWLEDGMENTS |
This work was supported by Wellcome Trust program grant 035157. Susanna Ryan was funded by a veterinary fellowship from the BBSRC.
We thank Kristina Eriksson, Elizabeth McInnes, and Paul Tonks for
invaluable assistance. We also thank Ray Hicks and Nigel Miller for
FACS sorting.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Wellcome Trust
Immunology Unit, School of Clinical Medicine, Hills Road, Cambridge CB2
2SP, United Kingdom. Phone: 44 1223 330526. Fax: 44 1223 336815. E-mail: srr20{at}cam.ac.uk.
 |
REFERENCES |
| 1.
|
Anderson, O.,
A.-M. Sorensen,
U. Holmskov,
P. Friischristiansen,
S. Thiel,
S.-E. Svehag,
E. Bahraoui,
J. C. Gluckman, and E. Fenouillet.
1990.
Bovine conglutinin binds the HIV envelope glycoprotein gp160 and inhibits its binding to cell-membrane CD4.
Scand. J. Immunol.
32:382.
|
| 2.
|
Bennett, S. R. M.,
F. R. Carbone,
F. Karamalls,
R. A. Flavells,
J. F. A. P. Miller, and W. R. Heath.
1998.
Help for cytotoxic-T-cell responses is mediated by CD40 signalling.
Nature (London)
393:478-480[CrossRef][Medline].
|
| 3.
|
Bird, P.,
B. Blacklaws,
H. T. Reyburn,
D. Allen,
J. Hopkins,
D. Sargan, and I. McConnell.
1993.
Early events in immune evasion by the lentivirus maedi-visna occurring within infected lymphoid tissue.
J. Virol.
67:5187-5197[Abstract/Free Full Text].
|
| 4.
|
Bird, P.,
H. T. Reyburn,
B. A. Blacklaws,
D. Allen,
P. Nettleton,
D. L. Yirrell,
N. Watt,
D. Sargan, and I. McConnell.
1995.
The restricted IgG1 antibody response to maedi visna virus is seen following infection but not following immunization with recombinant gag protein.
Clin. Exp. Immunol.
102:274-280[Medline].
|
| 5.
|
Blacklaws, B.,
P. Bird, and I. McConnell.
1995.
Early events in infection of lymphoid tissue by a lentivirus, maedi-visna.
Trends Microbiol.
3:434-440[CrossRef][Medline].
|
| 6.
|
Blacklaws, B. A.,
P. Bird,
D. Allen,
D. J. Roy,
I. C. M. MacLennan,
J. Hopkins,
D. R. Sargan, and I. McConnell.
1995.
Initial lentivirus-host interactions within lymph nodes: a study of maedi-visna virus infection in sheep.
J. Virol.
69:1400-1407[Abstract/Free Full Text].
|
| 7.
|
Blacklaws, B. A.,
P. Bird, and I. McConnell.
1994.
Pathogenesis and immunity in lentivirus infections of small ruminants, p. 199-212.
In
B. M. L. Goddeeris, and W. I. Morrison (ed.), Cell-mediated immunity in ruminants. CRC Press, Boca Raton, Fla.
|
| 8.
|
Brodie, S. J.,
L. D. Pearson,
M. C. Zink,
H. M. Bickle,
B. C. Anderson,
K. A. Marcom, and J. C. Demartini.
1995.
Ovine lentivirus expression and disease. Virus replication, but not entry, is restricted to macrophages of specific tissues.
Am. J. Pathol.
146:250-263[Abstract].
|
| 9.
|
Brooke, G. P.,
K. R. Parsons, and C. J. Howard.
1998.
Cloning of two members of the SIRP alpha family of protein tyrosine phosphatase binding proteins in cattle that are expressed on monocytes and a subpopulation of dendritic cells and which mediate binding to CD4 T cells.
Eur. J. Immunol.
28:1-11[CrossRef][Medline].
|
| 10.
|
Bujdoso, R.,
J. Hopkins,
P. Young,
B. M. Dutia, and I. McConnell.
1989.
Characterisation of sheep afferent lymph dendritic cells and their role in antigen carriage.
J. Exp. Med.
170:1285-1302[Abstract/Free Full Text].
|
| 11.
|
Cameron, P.,
M. Pope,
A. Granelli-Piperno, and R. M. Steinman.
1996.
Dendritic cells and the replication of HIV-1.
J. Leukoc. Biol.
59:158-171[Abstract].
|
| 12.
|
Carey, N., and R. G. Dalziel.
1993.
The biology of maedi-visna virus an overview.
Br. Vet. J.
149:437-454[Medline].
|
| 13.
|
Cella, M.,
D. Scheidegger,
K. Palmer Lehmann,
P. Lane,
A. Lanzavecchia, and G. Alber.
1996.
Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation.
J. Exp. Med.
184:747-752[Abstract/Free Full Text].
|
| 14.
|
Coffin, J. M.
1996.
Retroviridae: the viruses and their replication, p. 1767-1847.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 15.
|
Dutia, B. M., and J. Hopkins.
1991.
Analysis of the CD1 cluster in sheep.
Vet. Immunol. Immunopathol.
27:189-194[CrossRef][Medline].
|
| 16.
|
Dutia, B. M., and J. Hopkins.
1993.
Analysis of the monoclonal antibodies comprising WC6.
Vet. Immunol. Immunopathol.
39:193-199[CrossRef][Medline].
|
| 17.
|
Dutia, B. M.,
J. Hopkins,
M. P. Allington,
R. Bujdoso, and I. McConnell.
1990.
Characterisation of monoclonal-antibodies specific for alpha-chains and beta-chains of sheep MHC class-II.
Immunology
70:27-32[Medline].
|
| 18.
|
Eriksson, K.,
E. McInnes,
S. Ryan,
P. Tonks,
I. McConnell, and B. Blacklaws.
1999.
CD4 T cells are required for the establishment of maedi-visna virus infection in macrophages but not dendritic cells.
Virology
258:355-364[CrossRef][Medline].
|
| 19.
|
Ezekowitz, R. A. B.,
M. Kuhlman,
J. E. Groopman, and R. A. Byrn.
1989.
A human-serum mannose-binding protein inhibits in vitro infection by the human immunodeficiency virus.
J. Exp. Med.
169:185-196[Abstract/Free Full Text].
|
| 20.
|
Fiskerstrand, C. E.
1993.
Ph.D. thesis.
University of Edinburgh, Edinburgh, United Kingdom.
|
| 21.
|
Gendelman, H. E.,
O. Narayan,
S. Kennedy-Stoskopf,
P. G. E. Kennedy,
Z. Ghotbi,
J. E. Clements,
J. Stanley, and G. Pezeshkpour.
1986.
Tropism of sheep lentiviruses for monocytes: susceptibility to infection and virus gene expression increase during maturation of monocytes to macrophages.
J. Virol.
58:67-74[Abstract/Free Full Text].
|
| 22.
|
Gendelman, H. E.,
O. Narayan,
S. Molineaux,
J. E. Clements, and Z. Ghotbi.
1985.
Slow, persistent replication of lentiviruses: role of tissue macrophages and macrophage precursors in bone marrow.
Proc. Natl. Acad. Sci. USA
82:7086-7090[Abstract/Free Full Text].
|
| 23.
|
Gorrell, M. D.,
M. R. Brandon,
D. Sheffer,
R. J. Adams, and O. Narayan.
1992.
Ovine lentivirus is macrophagetropic and does not replicate productively in T lymphocytes.
J. Virol.
66:2679-2688[Abstract/Free Full Text].
|
| 24.
|
Granelli-Piperno, A.,
B. Moser,
M. Pope,
D. Chen,
Y. Wei,
F. Isdell,
F. O'Doherty,
W. Paxton,
R. Koup,
S. Mojsov,
N. Bhardwaj,
I. Clark-Lewis,
M. Baggiolini, and R. M. Steinman.
1996.
Efficient interaction of HIV-1 with purified dendritic cells via multiple chemokine coreceptors.
J. Exp. Med.
184:2433-2438[Abstract/Free Full Text].
|
| 25.
|
Gupta, V. K.,
I. McConnell,
R. G. Dalziel, and J. Hopkins.
1996.
Identification of the sheep homolog of the monocyte cell surface molecule CD14.
Vet. Immunol. Immunopathol.
51:89-99[CrossRef][Medline].
|
| 26.
|
Gupta, V. K.,
I. McConnell, and J. Hopkins.
1993.
Reactivity of the CD11/CD18 workshop monoclonal antibodies in the sheep.
Vet. Immunol. Immunopathol.
39:93-102[CrossRef][Medline].
|
| 27.
|
Gupta, V. K.,
I. McConnell,
M. Pepin,
W. C. Davis,
R. G. Dalziel, and J. Hopkins.
1995.
Biochemical and phenotypic characterization of the ovine beta-2 (leukocyte) integrins.
J. Comp. Pathol.
112:339-349[CrossRef][Medline].
|
| 28.
|
Haig, D. M.,
A. Percival,
J. Mitchell,
I. Green, and D. Sargan.
1995.
The survival and growth of ovine afferent lymph dendritic cells in culture depends on tumour necrosis factor-alpha and is enhanced by granulocyte-macrophage colony-stimulating factor but inhibited by interferon gamma.
Vet. Immunol. Immunopathol.
45:221-236[CrossRef][Medline].
|
| 29.
|
Hall, J. G.
1967.
A method for collecting lymph from the prefemoral lymph node of unanaesthetised sheep.
Q. J. Exp. Physiol.
52:200-205.
|
| 30.
|
Harkiss, G. D.,
J. Hopkins, and I. McConnell.
1990.
Uptake of antigen by afferent lymph dendritic cells mediated by antibody.
Eur. J. Immunol.
20:2367-2373[Medline].
|
| 31.
|
Hopkins, J., and B. M. Dutia.
1990.
Monoclonal-antibodies to the sheep analogues of human-CD45 (leukocyte common antigen), MHC class-I and CD5 differential expression after lymphocyte activation in vivo.
Vet. Immunol. Immunopathol.
24:331-346[CrossRef][Medline].
|
| 32.
|
Hopkins, J., and B. M. Dutia.
1991.
Workshop studies on the ovine CD1 homolog.
Vet. Immunol. Immunopathol.
27:97-99[CrossRef][Medline].
|
| 33.
|
Hopkins, J.,
B. M. Dutia,
R. Bujdoso, and I. McConnell.
1989.
In vivo modulation of CD1 and MHC class II expression by sheep afferent lymph dendritic cells.
J. Exp. Med.
170:1303-1318[Abstract/Free Full Text].
|
| 34.
|
Hopkins, J., and V. K. Gupta.
1996.
Identification of three myeloid-specific differentiation antigens in sheep.
Vet. Immunol. Immunopathol.
52:329-339[CrossRef][Medline].
|
| 35.
|
Hopkins, J.,
I. McConnell,
R. Bujdoso, and A. J. Munroe.
1985.
Studies of MHC class II products on sheep peripheral and efferent lymph cells, p. 441-459.
In
B. Morris, and M. Miyasaka (ed.), Immunology of the sheep. F. Hoffmann-La Roche & Co., Basel, Switzerland.
|
| 36.
|
Howard, C. J.,
G. P. Brooke,
D. Werling,
P. Sopp,
J. C. Hope,
K. R. Parsons, and R. A. Collins.
1999.
Dendritic cells in cattle: phenotype and function.
Vet. Immunol. Immunopathol.
72:119-124[CrossRef][Medline].
|
| 37.
|
Howard, C. J., and J. Naessens.
1993.
Summary of workshop findings for cattle.
Vet. Immunol. Immunopathol.
39:25-48[CrossRef][Medline].
|
| 38.
|
Howard, C. J.,
P. Sopp,
J. Brownlie,
L. S. Kwong,
K. R. Parsons, and G. Taylor.
1997.
Identification of two distinct populations of dendritic cells in afferent lymph that vary in their ability to stimulate T cells.
J. Immunol.
159:5372-5382[Abstract].
|
| 39.
|
Hudson, L., and F. C. Hay.
1989.
Practical immunology, 3rd ed.
Blackwell Scientific, Oxford, United Kingdom.
|
| 40.
|
Knight, S. C.,
J. Farrant,
A. Bryant,
A. J. Edwards,
S. Burman,
A. Lever,
J. Clarke, and D. B. Webster.
1986.
Non-adherent, low-density cells from human peripheral blood contain dendritic cells and monocytes both with veiled morphology.
Immunology
57:595-603[Medline].
|
| 41.
|
Knight, S. C., and S. Patterson.
1997.
Bone marrow-derived dendritic cells, infection with human immunodeficiency virus, and immunopathology.
Annu. Rev. Immunol.
15:593-615[CrossRef][Medline].
|
| 42.
|
Lechner, F.,
J. Machado,
G. Bertoni,
H. F. Seow,
D. A. E. Dobbelaere, and E. Peterhans.
1997.
Caprine arthritis encephalitis virus dysregulates the expression of cytokines in macrophages.
J. Virol.
71:7488-7497[Abstract/Free Full Text].
|
| 43.
|
Lechner, F.,
H. R. Vogt,
H. F. Seow,
U. vonBodungen,
G. Bertoni,
A. Zurbriggen, and E. Peterhans.
1996.
Expression of TNF alpha in arthritis caused by caprine arthritis encephalitis virus.
Vet. Immunol. Immunopathol.
54:281-289[CrossRef][Medline].
|
| 44.
|
Lee, W. C.
1994.
Ph.D. thesis.
University of Edinburgh, Edinburgh, United Kingdom.
|
| 45.
|
Lee, W. C.,
P. Bird,
I. McConnell,
N. J. Watt, and B. A. Blacklaws.
1996.
The phenotype and phagocytic activity of macrophages during maedi-visna virus infection.
Vet. Immunol. Immunopathol.
51:113-126[CrossRef][Medline].
|
| 46.
|
Lujan, L.,
I. Begara,
D. D. S. Collie, and N. J. Watt.
1994.
Ovine lentivirus (maedi-visna virus) protein expression in sheep alveolar macrophages.
Vet. Pathol.
31:695-703[Abstract].
|
| 47.
|
Mackay, C. R.,
W. R. Hein,
M. R. Brown, and P. Matzinger.
1988.
Unusual expression of CD2 in sheep: implications for T cell interactions.
Eur. J. Immunol.
18:1681-1685[Medline].
|
| 48.
|
Mackay, C. R.,
W. L. Marston, and L. Dudler.
1990.
Naive and memory T-cells show distinct pathways of lymphocyte recirculation.
J. Exp. Med.
171:801-817[Abstract/Free Full Text].
|
| 49.
|
Mackay, C. R.,
W. L. Marston,
L. Dudler,
O. Spertini,
T. F. Tedder, and W. R. Hein.
1992.
Tissue-specific migration pathways by phenotypically distinct subpopulations of memory T-cells.
Eur. J. Immunol.
22:887-895[Medline].
|
| 50.
|
Maddox, J. F.,
C. R. Mackay, and M. R. Brandon.
1985.
Surface antigens, SBU-T4 and SBU-T8, of sheep T lymphocyte subsets defined by monoclonal antibodies.
Immunology
55:739-748[Medline].
|
| 51.
|
Mohanty, S. G., and S. K. Dutta.
1981.
Veterinary virology, p. 43.
Lea & Febiger, Philadelphia, Pa.
|
| 52.
|
Narayan, O.,
J. S. Wolinsky,
J. E. Clements,
J. D. Strandberg,
D. E. Griffin, and L. C. Cork.
1982.
Slow virus replication: the role of macrophages in the persistence and expression of visna viruses of sheep and goats.
J. Gen. Virol.
59:345-356[Abstract/Free Full Text].
|
| 53.
|
Pepin, M.,
D. Cannella,
J. J. Fontaine,
J. C. Pittet, and A. Le Pape.
1992.
Ovine mononuclear phagocytes in situ: identification by monoclonal antibodies and involvement in experimental pyogranuloma.
J. Leukoc. Biol.
51:188-198[Abstract].
|
| 54.
|
Peters, J. H.,
R. Gieseler,
B. Thiele, and F. Steinbach.
1996.
Dendritic cells: from ontogenetic orphans to myelomonocytic descendants.
Immunol. Today
17:273-278[CrossRef][Medline].
|
| 55.
|
Petursson, G.,
N. Nathanson,
G. Georgsson,
H. Panitch, and P. A. Palsson.
1976.
Pathogenesis of visna. I. Sequential virologic, serologic, and pathologic studies.
Lab. Investig.
35:402-412[Medline].
|
| 56.
|
Pope, M.,
M. G. H. Betjes,
N. Romani,
H. Hirmand,
P. U. Cameron,
L. Hoffman,
S. Gezelter,
G. Schuler, and R. M. Steinman.
1994.
Conjugates of dendritic cells and memory T lymphocytes from skin facilitate productive infection with HIV-1.
Cell
78:389-398[CrossRef][Medline].
|
| 57.
|
Pope, M.,
S. Gezelter,
N. Gallo,
L. Hoffman, and R. M. Steinman.
1995.
Low levels of HIV-1 infection in cutaneous dendritic cells promote extensive viral replication upon binding to memory CD4+ T cells.
J. Exp. Med.
182:2045-2056[Abstract/Free Full Text].
|
| 58.
|
Pyrah, I. T. G., and N. J. Watt.
1996.
Immunohistological study of the depressed cutaneous DTH response in sheep naturally infected with an ovine lentivirus (maedi-visna virus).
Clin. Exp. Immunol.
104:32-36[CrossRef][Medline].
|
| 59.
|
Reyburn, H. T.
1992.
Ph.D. thesis.
University of Edinburgh, Edinburgh, United Kingdom.
|
| 60.
|
Rhind, S. M.,
B. M. Dutia,
C. J. Howard, and J. Hopkins.
1996.
Discrimination of two subsets of CD1 molecules in the sheep.
Vet. Immunol. Immunopathol.
52:265-270[CrossRef][Medline].
|
| 61.
|
Ridge, J. P.,
D. F. Rosa, and P. Matzinger.
1998.
A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell.
Nature (London)
393:474-478[CrossRef][Medline].
|
| 62.
|
Sallusto, F.,
M. Cella,
C. Danieli, and A. Lanzavecchia.
1995.
Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products.
J. Exp. Med.
182:389-400[Abstract/Free Full Text].
|
| 63.
|
Sargan, D. R.,
I. D. Bennet,
C. Cousens,
D. J. Roy,
B. A. Blacklaws,
R. G. Dalziel,
N. J. Watt, and I. McConnell.
1991.
Nucleotide sequence of EV1, a British isolate of maedi-visna virus.
J. Gen. Virol.
72:1893-1903[Abstract/Free Full Text].
|
| 64.
|
Sargan, D. R.,
D. J. Roy,
R. G. Dalziel,
N. J. Watt, and I. McConnell.
1994.
A temporal study of RNAs produced in maedi-visna virus infection of choroid-plexus cells.
Vet. Microbiol.
39:369-378[CrossRef][Medline].
|
| 65.
|
Schoenberger, S. P.,
R. E. M. Toes,
E. I. H. Van der Voort,
R. Offringa, and C. J. M. Melief.
1998.
T-cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions.
Nature (London)
393:480-483[CrossRef][Medline].
|
| 66.
|
Sonigo, P.,
M. Alizon,
K. Staskus,
D. Klatzmann,
S. Cole,
O. Danos,
E. Retzel,
P. Tiollais,
A. Haase, and S. Wainhobson.
1985.
Nucleotide-sequence of the visna lentivirus relationship to the AIDS virus.
Cell
42:369-382[CrossRef][Medline].
|
| 67.
|
Spira, A. I.,
P. A. Marx,
B. K. Patterson,
J. Mahoney,
R. A. Koup,
S. M. Wolinsky, and D. D. Ho.
1995.
Cellular targets of infection and route of viral dissemination after an intravaginal inoculation of simian immunodeficiency virus into rhesus macaques.
J. Exp. Med.
183:215-225[Abstract/Free Full Text].
|
| 68.
|
Staskus, K. A.,
L. Couch,
P. Bitterman,
E. F. Retzel,
M. Zupancic,
J. List, and A. T. Haase.
1991.
In situ amplification of visna virus DNA in tissue sections reveals a reservoir of latently infected cells.
Microb. Pathog.
11:67-76[CrossRef][Medline].
|
| 69.
|
Steinman, R. M.,
A. Granelli-Piperno,
K. Tenner-Racz,
P. Racz,
S. Frankel,
E. Delgado,
R. Ignatius, and M. Pope.
1999.
Dendritic cells during infection with HIV-1 and SIV, p. 421-434.
In
M. T. Lotze, and A. W. Thomson (ed.), Dendritic cells, 1st ed. Academic Press, London, United Kingdom.
|
| 70.
|
Wood, G. S.,
P. S. Freudenthal,
A. Edinger,
R. M. Steinman, and R. A. Warnke.
1991.
CD45 epitope mapping of human CD1a+ dendritic cells and peripheral blood dendritic cells.
Am. J. Pathol.
138:1451-1459[Abstract].
|
| 71.
|
Zhang, H.,
Y. Zhang,
T. P. Spicer,
L. Z. Abbott,
M. Abbott, and B. J. Poiesz.
1993.
Reverse transcription takes place within extracellular HIV-1 virions: potential biological significance.
AIDS Res. Hum. Retroviruses
9:1287-1296[Medline].
|
Journal of Virology, November 2000, p. 10096-10103, Vol. 74, No. 21
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Stanton, J. B., Knowles, D. P., O'Rourke, K. I., Herrmann-Hoesing, L. M., Mathison, B. A., Baszler, T. V.
(2008). Small-Ruminant Lentivirus Enhances PrPSc Accumulation in Cultured Sheep Microglial Cells. J. Virol.
82: 9839-9847
[Abstract]
[Full Text]
-
Wu, C., Barbezange, C., McConnell, I., Blacklaws, B. A.
(2008). Mapping and characterization of visna/maedi virus cytotoxic T-lymphocyte epitopes. J. Gen. Virol.
89: 2586-2596
[Abstract]
[Full Text]
-
Niesalla, H., McNeilly, T. N., Ross, M., Rhind, S. M., Harkiss, G. D.
(2008). Experimental infection of sheep with visna/maedi virus via the conjunctival space. J. Gen. Virol.
89: 1329-1337
[Abstract]
[Full Text]
-
McNeilly, T. N., Baker, A., Brown, J. K., Collie, D., MacLachlan, G., Rhind, S. M., Harkiss, G. D.
(2008). Role of Alveolar Macrophages in Respiratory Transmission of Visna/Maedi Virus. J. Virol.
82: 1526-1536
[Abstract]
[Full Text]
-
Chan, S. S. M., Mastroeni, P., McConnell, I., Blacklaws, B. A.
(2008). Salmonella infection of afferent lymph dendritic cells. J. Leukoc. Biol.
83: 272-279
[Abstract]
[Full Text]
-
McNeilly, T. N., Tennant, P., Lujan, L., Perez, M., Harkiss, G. D.
(2007). Differential infection efficiencies of peripheral lung and tracheal tissues in sheep infected with Visna/maedi virus via the respiratory tract. J. Gen. Virol.
88: 670-679
[Abstract]
[Full Text]
-
McNeilly, T. N., Brown, J. K., Harkiss, G.
(2006). Differential Expression of Cell Surface Markers by Ovine Respiratory Tract Dendritic Cells. J. Histochem. Cytochem.
54: 1021-1030
[Abstract]
[Full Text]
-
Heeney, J. L., Dalgleish, A. G., Weiss, R. A.
(2006). Origins of HIV and the evolution of resistance to AIDS.. Science
313: 462-466
[Abstract]
[Full Text]
-
Singh, I., McConnell, I., Blacklaws, B.
(2006). Immune Response to Individual Maedi-Visna Virus gag Antigens. J. Virol.
80: 912-919
[Abstract]
[Full Text]
-
Pernthaner, A., Cole, S.-A., Morrison, L., Hein, W. R.
(2005). Increased Expression of Interleukin-5 (IL-5), IL-13, and Tumor Necrosis Factor Alpha Genes in Intestinal Lymph Cells of Sheep Selected for Enhanced Resistance to Nematodes during Infection with Trichostrongylus colubriformis. Infect. Immun.
73: 2175-2183
[Abstract]
[Full Text]
-
Mohan, J., Bruce, M. E., Mabbott, N. A.
(2005). Neuroinvasion by Scrapie following Inoculation via the Skin Is Independent of Migratory Langerhans Cells. J. Virol.
79: 1888-1897
[Abstract]
[Full Text]
-
Epardaud, M., Bonneau, M., Payot, F., Cordier, C., Megret, J., Howard, C., Schwartz-Cornil, I.
(2004). Enrichment for a CD26hi SIRP- subset in lymph dendritic cells from the upper aero-digestive tract. J. Leukoc. Biol.
76: 553-561
[Abstract]
[Full Text]
-
Hotzel, I., Cheevers, W. P.
(2002). A maedi-visna virus strain K1514 receptor gene is located in sheep chromosome 3p and the syntenic region of human chromosome 2. J. Gen. Virol.
83: 1759-1764
[Abstract]
[Full Text]
-
Vacheron, S., Luther, S. A., Acha-Orbea, H.
(2002). Preferential Infection of Immature Dendritic Cells and B Cells by Mouse Mammary Tumor Virus. J. Immunol.
168: 3470-3476
[Abstract]
[Full Text]
-
Hotzel, I., Cheevers, W. P.
(2001). Host Range of Small-Ruminant Lentivirus Cytopathic Variants Determined with a Selectable Caprine Arthritis- Encephalitis Virus Pseudotype System. J. Virol.
75: 7384-7391
[Abstract]
[Full Text]