Previous Article | Next Article 
Journal of Virology, October 2000, p. 9586-9593, Vol. 74, No. 20
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Biochemical Characterization of the Equine Arteritis Virus
Helicase Suggests a Close Functional Relationship between
Arterivirus and Coronavirus Helicases
Anja
Seybert,1
Leonie C.
van Dinten,2,
Eric J.
Snijder,2 and
John
Ziebuhr1,*
Institute of Virology and Immunology,
University of Würzburg, Würzburg,
Germany,1 and Department of Virology,
Center of Infectious Diseases, Leiden University Medical Center,
Leiden, The Netherlands2
Received 15 June 2000/Accepted 18 July 2000
 |
ABSTRACT |
The arterivirus equine arteritis virus nonstructural protein 10 (nsp10) has previously been predicted to contain a Zn finger structure
linked to a superfamily 1 (SF1) helicase domain. A recombinant form of
nsp10, MBP-nsp10, was produced in Escherichia coli as a
fusion protein with the maltose-binding protein. The protein was
partially purified by affinity chromatography and shown to have ATPase
activity that was strongly stimulated by poly(dT), poly(U), and
poly(dA) but not by poly(G). The protein also had both RNA and DNA
duplex-unwinding activities that required the presence of 5'
single-stranded regions on the partial-duplex substrates, indicating a 5'-to-3' polarity in the unwinding reaction. Results of
this study suggest a close functional relationship between the
arterivirus nsp10 and the coronavirus helicase, for which NTPase and
duplex-unwinding activities were recently demonstrated. In a number
of biochemical properties, both arterivirus and coronavirus SF1
helicases differ significantly from the previously characterized RNA
virus SF1 and SF2 enzymes. Thus, the combined data strongly support the idea that nidovirus helicases may represent a separate group of RNA virus-encoded helicases with distinct properties.
 |
INTRODUCTION |
Equine arteritis virus
(EAV) is the prototype of the Arteriviridae, a family of
positive-stranded, enveloped RNA viruses which also includes
Lactate dehydrogenase-elevating virus, Porcine reproductive and
respiratory syndrome virus, and Simian haemorrhagic fever virus (for a review, see 47). A common ancestry of the
Arteriviridae and Coronaviridae seems probable
(6), and, consequently, the two families have been united in
the order Nidovirales (3). The phylogenetic
relationship between arteri- and coronaviruses is most evident from the
organization and expression of their replicase genes. Thus, for
example, both arteri- and coronaviruses (i) encode a very similar
array of functional domains in their replicase genes, (ii) use
ribosomal frameshifting to express key replicative functions, (iii)
control the activity of the individual subunits of the viral
replication and transcription machinery by extensive proteolytic
processing of large protein precursors, and (iv) use a discontinuous
transcription mechanism to produce a nested set of subgenomic
(sg) mRNAs for structural gene expression (3, 8).
The EAV replicase gene comprises the 5'-terminal three-
fourths of the 12.7-kb genome and is composed of two open reading frames (ORFs), ORF1a and ORF1b (6). The upstream ORF1a
encodes the ORF1a protein (187 kDa), and ORF1a and ORF1b together
encode the ORF1ab protein (345 kDa). Expression of the
ORF1b-encoded part of the ORFlab protein involves a ribosomal
frameshift in the ORF1a-1b overlap region during translation of the
genomic RNA (6). The primary translation products,
which are also called replicase polyproteins, are extensively processed
by three virus-encoded proteinases to produce 12 mature proteins
(nonstructural protein 1 [nsp1] to nsp12), as well as multiple
processing intermediates (for a recent review, see 63). To date,
specific functions have been assigned to only a few of these proteins.
Thus, for example, nsp1, nsp2, and nsp4 harbor proteolytic activities
(48-50), and the hydrophobic domains present in nsp2, nsp3,
and nsp5 have been found to direct the viral replication and
transcription complexes to intracellular membranes of the endoplasmic
reticulum and intermediate compartment (40, 52). The
ORF1b-encoded part of the ORF1ab protein is believed to contain
functions essential for viral RNA replication and sg mRNA transcription
(6). Its processing by the nsp4 serine proteinase yields
four end products (nsp9 through nsp12), including those that carry the
putative RNA-dependent RNA polymerase (nsp9) and nucleoside
triphosphatase (NTPase)- helicase (nsp10) activities (54,
56).
Besides the RNA-dependent RNA polymerase domain, the helicase is the
most conserved component of the nidovirus RNA synthesis machinery
(12-14, 16, 29) and has therefore attracted much attention
(53-57). The arterivirus helicase is amino terminally linked to a putative Zn finger structure (6). This
combination of a Zn finger structure with a helicase domain is also
found in the related coronavirus helicases (7, 17, 23) and a number of cellular and viral helicases (9, 25, 34, 39, 58).
Recently, genetic evidence was obtained to show that both the Zn finger
itself and the region connecting the Zn finger to the carboxyl proximal
part of nsp10 ("hinge spacer") are critically involved in different
processes of the EAV life cycle, including genome replication, mRNA
transcription, and possibly also virion biogenesis (53, 55,
57).
The arterivirus helicase domain has been classified as belonging to
helicase superfamily 1 (SF1) (27). Putative SF1 helicases are extremely widespread among positive-stranded RNA viruses. Based on
sequence comparisons, they have also been identified in a variety of
plant virus families, as well as alpha-, rubi-, hepatitis E, and
coronaviruses (13, 14, 16). Similarly to EAV nsp10, a number
of these viral enzymes have been implicated in diverse aspects of
transcription and replication but also in RNA stability and
cell-to-cell movement (5, 24, 30, 36-38, 41, 44). However,
despite their importance, there is very little detailed information on
the enzymatic properties of RNA virus SF1 helicases. Only a few
proteins have been shown to have NTPase activity, but, in striking
contrast to other helicases, the activity of these proteins was not
significantly stimulated by homopolynucleotides (18, 23, 26,
42). Furthermore, numerous attempts to detect the predicted RNA
duplex-unwinding activity of these proteins have failed. Therefore, the
functional assignment of these proteins as true helicases, that is,
nucleic acid duplex-unwinding enzymes, has been questioned
(27). Only very recently has experimental evidence for
duplex-unwinding activity been obtained for two viral proteins of this
superfamily (11, 46). The biochemical characterization of
one of these proteins, the human coronavirus 229E (HCoV) helicase,
revealed that this protein has both RNA and DNA duplex-unwinding
activities with a preference for oligopyrimidine-tailed substrates.
Furthermore and in obvious contrast to the previously characterized RNA
virus SF2 helicases, a 5'-to-3' polarity of the unwinding reaction has been demonstrated (46).
The helicase domains of the three nidovirus genera, that is,
coronaviruses, toroviruses, and arteriviruses, were previously proposed
to represent a separate phylogenetic lineage of the RNA virus SF1
helicases (14, 29). It was thus tempting to believe that, despite the differences in their primary structures, the arterivirus nsp10 and coronavirus helicases may have similar functional properties. To test this hypothesis, we expressed and purified EAV
nsp10. The subsequent biochemical characterization revealed that the
recombinant nsp10 has polynucleotide-stimulated ATPase and both RNA and
DNA duplex-unwinding activities. The DNA duplex-unwinding activity was
used to show that 5' single-stranded tails on the partial-duplex
substrates were required for unwinding, indicating a 5'-to-3' polarity
of the helicase activity. Taken together, the data are fully consistent
with the recently reported coronavirus helicase data but stand in clear
contrast to the biochemical properties of RNA virus SF2 helicases.
 |
MATERIALS AND METHODS |
Construction of bacterial expression plasmids pMal-nsp10 and
pMal-nsp10-KQ.
The coding sequence of amino acids 2371 through
2837 of the EAV ORF1ab protein followed by a translation stop codon was
amplified by PCR from pL(2371-2837) plasmid DNA (54) and
cloned into the XmnI-SalI restriction sites of
the bacterial expression vector pMal-c2 (New England Biolabs,
Schwalbach, Germany). The upstream PCR primer contained an
EagI restriction site that was introduced by replacing the
wild-type Ser-2371 codon AGT with TCG, which also encodes Ser. The
resulting plasmid, pMal-nsp10, encodes a fusion protein consisting of
the maltose-binding protein (MBP) of Escherichia coli and
full-length EAV nsp10. The plasmid pMal-nsp10-KQ is identical to
pMal-nsp10, except for a single-base exchange resulting in the
substitution of Gln for Lys-2534 in nsp10.
Protein expression and purification.
E. coli TB1
bacteria (New England Biolabs) containing either plasmid pMal-nsp10 or
pMal-nsp10-KQ were grown at 37°C in Luria-Bertani medium containing
100 µg of ampicillin per ml until they reached a culture density
(absorbency at 595 nm ([A595]) of 0.6. The
expression of the recombinant proteins was induced by addition of 0.5 mM isopropyl-
-D-thiogalactopyranoside (IPTG). Upon
induction, the temperature was shifted to 24°C. The cells were
harvested after growing for another 4 h and 30 min, and the cell
paste was suspended in column buffer (20 mM Tris-Cl [pH 8.0], 1 M
NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 10% glycerol) and
disrupted by sonication as described previously (22). Tween
20 (0.1%) was added, and the solution was centrifuged (20,000 × g, 30 min) to produce a clear supernatant that was then
loaded onto a column packed with amylose resin (New England Biolabs).
After extensive washing with column buffer containing 0.1% Tween 20, the proteins were eluted in the same buffer containing 10 mM maltose.
Aliquots of the purified proteins were frozen on dry ice and stored at
80°C until needed.
Nucleoside triphosphatase assay.
In the ATPase assay, 250 fmol to 4 pmol of the MBP-nsp10 or MBP-nsp10-KQ fusion proteins was
incubated in 40 µl of buffer N containing 20 mM HEPES-KOH (pH 7.4),
300 µM ATP, 5 mM magnesium acetate, 2 mM dithiothreitol, 25 µg of bovine serum albumin per ml, and 250 nCi of
[
-32P]ATP (3,000 Ci/mmol). In the GTPase assay, ATP
and [
-32P]ATP were replaced by 300 µM GTP and 250 nCi [
-32P]GTP (3,000 Ci/mmol), respectively. When
included, polynucleotides and polyribonucleotides (5.4 to 8.3 Svedberg
units) were at the indicated concentrations of 1, 50, or 150 µg/ml.
The reactions were incubated at 30°C for 30 min and stopped by adding
EDTA to a final concentration of 100 mM. The samples were analyzed
by polyethyleneimine-cellulose thin-layer chromatography with
0.15 M formic acid-0.15 M LiCl (pH 3.0) as the liquid phase. The
reaction products were quantified by phosphorimaging of the dried
chromatographic plates (ImageQuant software; Molecular Dynamics,
Sunnyvale, Calif.).
Preparation of duplex RNA and DNA substrates.
For 5'-RNA2,
two oligonucleotides, 5'-R2a
(5'-CGTTGGCGCGCTAATACGACTCACTATAGGGATCCCTTTAGTGAGGGTTAATTGCGCGCGTTGC-3')
and 5'-R2b (5'-GCAAC GCGCGCAATTAACCCTCACTAAAGGGATCCCTATAGTGAGTCGTAT TAGCGCGCCAACG-3'), were annealed, digested with BssHII, and ligated with the
large fragment of BssHII-digested pBluescript II KS(+) DNA.
The resultant plasmid was designated pBS-65/66. Next, two
oligonucleotides, 5'-R2c
[5'-GATC-d(pT)15-CTAGAACCGCTGCGGCTGGATCCCG-3']
and 5'-R2d [5'-CGGGATCCAGCCGCAGCGGTTCTAG-d(pA)15-GATC-3'],
were annealed, digested with BamHI, and ligated with
BamHI-digested pBS-65/66. The resultant plasmid was
linearized with either BamHI or XbaI and used as
a template for run-off transcription with either T7 RNA polymerase or
T3 RNA polymerase. The T3 transcript was synthesized in the presence of
2 µCi of [
-32P]CTP per µl (800 Ci/mmol).
For 3'-RNA2, two synthetic oligonucleotides, 3'-R2a
[5'-CACTCCC-d(pT)15-AAA-3'] and 3'-R2b
[5'-TTT-d(pA)15-GGGAGTGAGCT-3'], were
annealed, phosphorylated with T4 polynucleotide kinase, and ligated
with the larger fragment of SacI-EcoRV-digested
pBluescript II KS(+) DNA. The resultant plasmid was linearized with
DraI and used as the template for run-off transcription with
T7 RNA polymerase. For the preparation of the partially complementary
RNA strand, two oligonucleotides, 3'-R2c
(5'-CGCGCGTAATACGACTCACTATAGGGAGTGAGCTCCAATTCGCCCGGG-3') and
3'-R2d
(5'-CGCGCCCGGGCGAATTGGAGCTCACTCCCTATAGTGAGTCGTATTACG-3'), were annealed, phosphorylated, and ligated with the larger fragment of
BssHII-digested pBluescript II KS(+) DNA. The resultant
plasmid was linearized with SmaI and used as the template
for run-off transcription with T7 RNA polymerase in the presence of 2 µCi of [
-32P]CTP per µl (800 Ci/mmol).
In vitro-transcribed RNA was purified by phenol-chloroform extraction
and gel filtration chromatography using Micro Bio-Spin
6 columns
(Bio-Rad Laboratories, Munich, Germany). The RNA duplex
was produced by
annealing a mixture of two RNAs with a 10-fold
excess of unlabeled RNA
over [

-
32P]CTP-labeled RNA in buffer E (25 mM
HEPES-KOH[pH 7.4], 500 mM
NaCl, 1 mM EDTA, 0.1% [wt/vol] sodium
dodecyl sulfate [SDS]).
The reaction mixture was denatured for 5 min
at 95°C and slowly
cooled to room
temperature.
To produce duplex DNA substrates, two synthetic oligonucleotides (HPSF
quality; MWG-Biotech, Munich, Germany) were annealed
as described
above. Oligonucleotides were labeled with [

-
32P]ATP
(3,000 Ci/mmol) using T4 polynucleotide kinase. The labeled
DNA was
purified by phenol-chloroform extraction and gel filtration
chromatography using Micro Bio-Spin 6
columns.
For DNA-0, the radioactively labeled oligonucleotide DR
(5'-GGTGCAGCCGCAGCGGTGCTCG-3') and oligonucleotide D1
(5'-CGAGCACCGCTGCGGCTGCACC-3')
were annealed. This substrate
contained no single-stranded regions.
For 5'-3'-DNA-T30, the
radioactively labeled oligonucleotide D2
[5'-GGTGCAGCCGCAGCGGTGCTCG-d(pT)
30-3']
and oligonucleotide D3
[5'-d(pT)
30-CGAGCACCGCTGCGGCTGCACC-3']
were annealed. This twin-tailed
("forked") substrate
contained 5' and 3' single-stranded regions
on one end of the partial
duplex DNA. For 5'-DNA-3'-T30, the radioactively
labeled
oligonucleotide DR and oligonucleotide D4
[5'-d(pT)
30-CGAGCACCGCTGCGGCTGCACC-d(pT)
30-3']
were annealed. This substrate contained 5' and 3'
single-stranded
regions at opposite ends of the partial duplex DNA. For
3'-DNA-T30,
the oligonucleotide D1 and the radioactively labeled
oligonucleotide
D2 were annealed. For 5'-DNA-T30, the radioactively
labeled oligonucleotide
DR and oligonucleotide D3 were
annealed.
Duplex-unwinding assay.
MBP-nsp10 or MBP-nsp10-KQ was
incubated in a volume of 40 µl with 90 fmol of partial-duplex-RNA or
25 fmol of partial-duplex-DNA substrates for 30 min at 30°C in a
buffer containing 20 mM HEPES-KOH (pH 7.4), 5 mM ATP, 10% glycerol, 5 mM magnesium acetate, 2 mM dithiothreitol, and 0.1 mg of bovine serum
albumin per ml. The NaCl concentration in the reactions, resulting from
substrate and protein storage buffers, was 25 mM. The reactions were
stopped by the addition of 10 µl of 5% SDS-15% Ficoll-100 mM
EDTA-0.25% bromphenol blue dye. The reaction products were separated
on 10 to 20% gradient polyacrylamide-1× TBE gels
(acrylamide/bisacrylamide ratio, 19 to 1) at 4 W until the bromophenol
blue dye approached the bottom of the gel. The gels were exposed to
X-ray film at
70°C.
 |
RESULTS |
Bacterial expression and purification of recombinant nsp10
proteins.
We have chosen a bacterial expression system to
synthesize the EAV nsp10 protein in sufficient amounts for enzymatic
studies. The nsp10 sequence was amino terminally fused to the MBP of
E. coli, which allowed for the purification of the MBP-nsp10
fusion protein by amylose affinity chromatography. Also, a mutant
protein of MBP-nsp10 was produced in which Gln was substituted for the Walker A box (59) Lys-2534 residue of the EAV ORF1ab
protein. This control protein was called MBP-nsp10-KQ. It should be
noted that, in the context of the infectious EAV cDNA clone
(53), this Lys-to-Gln substitution in nsp10 has proven to
completely abolish viral RNA synthesis (L. C. van Dinten and
E. J. Snijder, unpublished data). The expression of the
recombinant proteins was analyzed by SDS-polyacrylamide gel
electrophoresis and Western blotting. After induction of recombinant
protein expression with IPTG, lysates from both TB1(pMal-nsp10) and
TB1(pMal-nsp10-KQ) cells contained an abundant protein that was
absent in lysates from noninduced cells (Fig.
1, lanes 1, 2, 4, and 5). The migration of the IPTG-induced proteins in SDS gels corresponded well to the
calculated molecular masses of the MBP-nsp10 and MBP-nsp10-KQ fusion
proteins (93 kDa). The identity of the recombinant fusion proteins was
unequivocally confirmed by Western blotting using the nsp10-specific
rabbit antiserum
B2 (data not shown), which recognizes the amino
acids 2812 through 2827 of the EAV ORF1ab protein (56). The
Western blot data also revealed a slight intracellular degradation of
both MBP-nsp10 and MBP-nsp10-KQ (data not shown). Obviously, some
degradation products have been copurified by the amylose affinity
purification procedure used in this study (Fig. 1, lanes 3 and 6).
Protein expression at 24°C provided sufficient amounts of
soluble protein and thus allowed the use of a
nondenaturing-purification protocol (Fig. 1, lanes 3 and 6). Routinely,
about 6 mg of partially purified protein was obtained from a 400-ml
culture volume. Attempts to release the authentic EAV nsp10 domain from
MBP by endoproteinase Xa treatment failed; even after prolonged
incubation, only minor portions of the fusion proteins were cleaved.
Nevertheless, since a number of helicases have proven to be
enzymatically active as MBP fusion proteins (4, 23, 43), we
decided to use the intact fusion proteins for further biochemical
analysis.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 1.
Purification of MBP-nsp10 and MBP-nsp10-KQ from E. coli lysates. The MBP fusion proteins were purified by affinity
chromatography as described in Materials and Methods. An SDS-10%
polyacrylamide gel stained with Coomassie brilliant blue dye is shown,
and the position of the recombinant 93-kDa proteins is indicated by an
arrowhead. Lanes: M, protein molecular mass markers (with masses, in
kilodaltons, indicated on the left); 1, total lysate from E. coli cells transformed with pMal-nsp10; 2, total lysate from
IPTG-induced E. coli cells transformed with pMal-nsp10; 3, 3 µg of amylose affinity-purified MBP-nsp10 protein; 4, total lysate
from E. coli cells transformed with pMal-nsp10-KQ; 5, total
lysate from IPTG-induced E. coli cells transformed with
pMal-nsp10-KQ; 6, 3 µg of amylose affinity-purified MBP-nsp10-KQ
protein.
|
|
MBP-nsp10 has ATPase and GTPase activities that are strongly
stimulated by specific types of polynucleotides.
We first used the
MBP-nsp10 protein to examine its predicted ATPase activity. In the
experiment shown in Fig. 2, we were able to demonstrate that ATP is hydrolyzed by MBP-nsp10, albeit with low
efficacy. However, if the assay was done in the presence of 1 or 150 µg of poly(U) per ml (Fig. 2, lanes 4 and 5, respectively), a
strong stimulation of the ATPase activity of MBP-nsp10 was
observed. In contrast, if either the MBP-nsp10-KQ protein or no
protein at all was used, nearly no ATP hydrolysis was detectable. These data clearly support the presumed but never demonstrated ATPase activity of nsp10. The apparent lack of ATPase activity in the MBP-nsp10-KQ protein suggests an indispensability of Lys-2534 for nsp10
activity. This result is consistent with previous mutagenesis studies
that have implicated equivalent Lys residues of the Walker A motif in
the function of numerous helicase-associated NTPase activities
(reviewed in 20). Furthermore, it strongly suggests that the observed
ATPase activity is mediated by MBP-nsp10 rather than any impurity
of the preparations and that MBP-nsp10-KQ would be an appropriate
control in subsequent experiments.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
ATPase activity of MBP-nsp10. The ATPase
activity was analyzed by thin-layer chromatography using
[ -32P]ATP as a substrate as described in Materials and
Methods. The positions of ATP and inorganic phosphate (Pi)
are indicated. Lanes: 1, reaction without protein; 2, reaction
containing 600 fmol of MBP-nsp10; 3, reaction containing 600 fmol
of MBP-nsp10-KQ; 4, reaction containing 600 fmol of MBP-nsp10 and 1 µg of poly(U) per ml; 5, reaction containing 600 fmol of
MBP-nsp10 and 150 µg of poly(U) per ml; 6, reaction containing 600 fmol of MBP-nsp10-KQ and 150 µg of poly(U) per ml.
|
|
An additional set of experiments revealed that MBP-nsp10 hydrolyzed ATP
and GTP with comparable efficacies (data not shown)
and that the nsp10
NTPase activity depends on the presence of
divalent cations. Thus, no
NTPase activity was detected if the
reaction lacked magnesium ions or
if EDTA was added in millimolar
amounts (data not shown). Divalent
cations have also been shown
to be required in many other
helicase-associated NTPase activities
(
32).
Stimulation of NTPase activity by nucleic acids is an intrinsic
property of most helicases (
32), and our initial poly(U)
stimulation data (see above) suggested that this may also be the
case for the nsp10 NTPase activity. We therefore examined
the
effect of different DNA and RNA polynucleotides on the
ATPase
activity of MBP-nsp10 in more detail (Table
1). The assays were
done in buffer N
containing 600 fmol of MBP-nsp10. The reactions
also contained 2 mM
sodium chloride that originated from the protein
storage buffer. ATP
hydrolysis was measured by phosphorimaging
of the reaction products
following thin-layer chromatography.
The ATPase activity in the
absence of polynucleotides was taken
to be 1.0, and all other
activities were normalized to this value.
Also, the data were collected
prior to 20% substrate depletion
to obtain initial hydrolysis
velocities. The data summarized in
Table
1 show that poly(dA), poly(U),
and poly(dT) were the strongest
stimulators of the MBP-nsp10-associated
ATPase activity with a
15- to 20-fold increase of the basal
activity (Table
1). Poly(A),
poly(C) and tRNA stimulated the ATPase
activity to a lesser extent,
and poly(G) was inactive. The calculation
of the specific activity
of MBP-nsp10 in the presence of the strongest
stimulator, poly(dT),
revealed that 1 pmol of MBP-nsp10 hydrolyzed 0.5 nmol of ATP per
min. The extent of ATPase stimulation by specific
polynucleotides
is similar to that reported for RNA virus SF2 helicases
(
27)
but stands in sharp contrast to most other RNA virus
SF1 helicases,
in which stimulatory effects of not more than twofold
have been
reported (
18,
26,
42). The only RNA virus SF1
helicase for
which comparably high stimulatory effects of
polynucleotides on
the ATPase activity have been found is the human
coronavirus helicase
(
46).
Effects of increasing salt concentrations on MBP-nsp10
ATPase activity.
Variations of the salt concentration
are known to strongly influence the stability and kinetics of
protein-nucleic acid interactions (33). Probably an increase
in cation concentration decreases the gain of entropy that normally
occurs upon cation release during complex formation. To study the
effects of varying the salt concentration on both the basal and the
poly(U)-stimulated MBP-nsp10 ATPase activity, the extent of ATP
hydrolysis at increasing potassium chloride concentrations was
determined. In these experiments, the maximal extent of substrate
hydrolysis (in the absence of salt) was set to be 50%, which still
allowed the reliable detection of strongly reduced ATPase
activities at high salt concentrations. Because of the low
ATPase activity in the absence of polynucleotides, the reactions
without poly(U) were incubated with 4 pmol of MBP-nsp10, whereas the
reactions containing poly(U) were incubated with 250 fmol of MBP-nsp10.
Due to the transfer of sodium chloride from the protein storage buffer,
the reactions contained different amounts of sodium chloride [16 mM
NaCl versus 1 mM NaCl in the reactions without and with poly(U),
respectively]. The ATPase activity in the absence of potassium
chloride was taken to be 100%, and all other activities were
normalized to this value. The basal ATPase activity of
MBP-nsp10 in the absence of poly(U) was not significantly affected by
up to 250 mM potassium chloride concentrations and still retained 80%
activity at 500 mM potassium chloride (data not shown). In contrast,
the poly(U)-stimulated ATPase activity of MBP-nsp10 proved to be
extremely sensitive to increasing salt concentrations. The data
summarized in Fig. 3 clearly indicate
that monovalent-cation concentrations above 20 to 25 mM significantly
inhibited the enzymatic activity.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of increasing monovalent-cation
concentration on the poly(U)-stimulated ATPase activity
of MBP-nsp10. The ATPase activity was analyzed by thin-layer
chromatography using [ -32P]ATP as a substrate as
described in Materials and Methods and quantified by phosphorimaging.
The poly(U)-stimulated ATPase activity in the absence of potassium
chloride was taken to be 100%, and all other activities were
normalized to this value (see text for details).
|
|
RNA duplex-unwinding activity of MBP-nsp10.
A standard in
vitro assay (35) was used to analyze the RNA helicase
activity of MBP-nsp10. The test substrates consisted of two partially
complementary RNA strands of which one was radiolabeled. The substrates
were incubated with MBP-nsp10 and the ATPase-deficient MBP-nsp10-KQ protein, respectively, in a buffer containing ATP and magnesium. The separation of the partial-duplex substrate into
single-stranded reaction products was examined by nondenaturing gel electrophoresis.
Helicases bind to the single-stranded tail of their partial-duplex
substrates with a specific orientation with respect to
the polarity of
the sugar-phosphate backbone. This property determines
the
directionality (or polarity) of the duplex-unwinding reaction
and
allows for the classification into 3'-to-5' helicases and
5'-to-3'
helicases (
32). In a first set of experiments, we used
partial-duplex RNA substrates carrying different single-stranded
regions. The first substrate, 5'-RNA2, consisted of a 22-nucleotide
(nt) duplex and two 5' single-stranded regions of 21 and 7 nt
at
opposite ends of the substrate. The 21-nt tail essentially
consisted of
oligo(U). The second substrate, 3'-RNA2, also contained
a 22-nt
duplex region, but had a 3'-single-stranded region, consisting
of
oligo(U)
15. Substrates incubated with buffer (Fig.
4, lanes
1 and 6) as well as
heat-denatured substrates (Fig.
4, lanes 2
and 7) were used as size
markers to localize the duplex RNA substrates
and the displaced,
radiolabeled single-stranded RNA products.
As Fig.
4 shows, MBP-nsp10
was able to unwind the 5'-tailed 5'-RNA2
(lane 4) but not the 3'-tailed
3'-RNA2 (lane 9). The helicase
activity required the presence of ATP
(Fig.
4, cf. lanes 3 and
4) or GTP (data not shown), which is
consistent with previous
results showing that helicase-catalyzed
unwinding of nucleic acids
is an energy-dependent process (
31,
35). Accordingly, the
NTPase-deficient control protein
MBP-nsp10-KQ completely lacked
helicase activity (Fig.
4, lanes 5 and
10). The combined data
led us to conclude that the MBP-nsp10 protein
has RNA duplex-unwinding
activity and operates with 5'-to-3' polarity.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 4.
MBP-nsp10 5'-to-3' RNA duplex-unwinding activity.
Reaction conditions were as described in Materials and Methods with
approximately 90 fmol of RNA substrate per reaction. The structures of
the substrates are shown schematically with the radiolabeled strands
marked by asterisks. The reaction products were separated on
nondenaturing, 10 to 20% gradient polyacrylamide gels. The positions
of the partially double-stranded substrates (dsRNA) and the displaced
monomeric products (ssRNA) are indicated. Lanes: 1, incubation of
5'-RNA2 without protein; 2, heat-denatured 5'RNA2; 3, incubation of
5'-RNA2 with 3 pmol of MBP-nsp10 in the absence of ATP; 4, incubation
of 5'-RNA2 with 3 pmol of MBP-nsp10 in the presence of 5 mM ATP; 5, incubation of 5'-RNA2 with 3 pmol of MBP-nsp10-KQ in the presence of 5 mM ATP; 6, incubation of 3'-RNA2 without protein; 7, heat-denatured
3'-RNA2; 8, incubation of 3'-RNA2 with 3 pmol of MBP-nsp10 in the
absence of ATP; 9, incubation of 3'-RNA2 with 3 pmol of MBP-nsp10 in
the presence of 5 mM ATP; 10, incubation of 3'-RNA2 with 3 pmol of
MBP-nsp10-KQ in the presence of 5 mM ATP.
|
|
DNA duplex-unwinding activity of MBP-nsp10.
As shown in Table
1, the ATPase activity of MBP-nsp10 was strongly stimulated by the
DNA homopolymers poly(dT) and poly(dA). These data prompted us to
analyze the unwinding activity of MBP-nsp10 on duplex DNA substrates.
The DNA substrates we used had identical 22-bp duplex regions to which
(except for the completely double-stranded substrate DNA-0) 30-nt-long,
single-stranded oligo(dT) tails were attached at different positions.
The data presented in Fig.
5 show that
MBP-nsp10 was able to unwind substrates containing 5' single-stranded
tails alone or
in combination with 3' single-stranded tails,
irrespective of
whether they were present on the same end or on
opposite ends
of the substrate (Fig.
5, lanes 7, 11, and 19). In
contrast, if
the DNA substrates contained only a 3' tail or no
single-stranded
tail, they were not unwound by MBP-nsp10 (Fig.
5, lanes
3 and
15). As expected, the ATPase-deficient MBP-nsp10-KQ protein
was
not able to unwind any of the substrates (Fig.
5, lanes 4, 8,
12, 16, and 20).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 5.
MBP-nsp10 5'-to-3' DNA duplex-unwinding activity.
Reaction conditions were as described in Materials and Methods with
approximately 25 fmol of DNA substrates per reaction. The structures of
the substrates are shown schematically with the radiolabeled strands
marked by asterisks. With the exception of DNA-0, which was entirely
double-stranded, the substrates consisted of identical 22-bp duplexes
to which 30-nt-long, single-stranded oligo(dT) tails were attached at
different positions. The reaction products were separated on
nondenaturing, 10 to 20% gradient polyacrylamide gels. Lanes: 1, 5, 9, 13, and 17, reactions without protein; 2, 6, 10, 14, and 18, heat-denatured DNA substrates; 3, 7, 11, 15, and 19, reactions
containing 2 pmol of MBP-nsp10; 4, 8, 12, 16, and 20, reactions
containing 2 pmol of MBP-nsp10-KQ.
|
|
The forked substrate 5'-3'-DNA-T30, which carries 5' and 3'
single-stranded tails on the same end of the duplex, appeared
to be
more readily unwound by MBP-nsp10 than the substrates 5'-DNA-3'-T30
and
5'-DNA-T30 (Fig.
5, cf. lanes 7, 11, and 19). To determine
whether this
substrate is indeed more readily unwound by MBP-nsp10
or,
alternatively, whether different reannealing kinetics are
responsible
for the observed difference, we analyzed the reannealing
kinetics of
the DNA substrates 5'-3'-DNA-T30 and 5'-DNA-T30 after
strand
separation. To this end, both DNA substrates were denatured
(95°C, 5 min) and subsequently placed on ice for 10 min. The denatured
substrates were then subjected to a standard helicase assay without
MBP-nsp10, and the reaction products were analyzed by nondenaturing
gel
electrophoresis. Quantitation of the double-stranded and
single-stranded
forms of the two substrates by phosphorimaging revealed
that 90%
of the DNA substrate 5'-3'-DNA-T30 but only 75% of DNA
substrate
5'-DNA-T30 had remained single stranded (data not shown). We
concluded
from this experiment that substrate 5'-DNA-T30 reanneals more
rapidly than the twin-tailed 5'-3'-DNA-T30. We therefore consider
it
likely that the apparently incomplete unwinding of the 5'-DNA-3'-T30
and 5'-DNA-T30 substrates reflects a rapid reannealing of the
separated
strands rather than a low activity of MBP-nsp10 on these
substrates.
In summary, the data suggest that the DNA duplex-unwinding activity
strictly depends on the presence of 5' single-stranded
tails, which
again supports the conclusion that EAV nsp10 is a
helicase with
5'-to-3'
polarity.
 |
DISCUSSION |
Although more than a decade ago a large number of RNA virus
families were predicted to encode SF1 helicases (13, 16), no
convincing evidence for duplex-unwinding activity has been obtained for
most of these proteins. Therefore, their functional assignment as true
helicases has been questioned, and alternative functions have been
considered for these proteins (27). The identification of
duplex-unwinding activities for three of these proteins, the Semliki
Forest virus nsp2 protein (11), the HCoV helicase
(46), and the EAV nsp10 (this study), provides clear biochemical evidence for the early sequence-based predictions and
strongly suggests that other RNA virus helicases of SF1 may also
represent duplex-unwinding enzymes. The recently observed preference of
the HCoV helicase for pyrimidine-tailed substrates (46),
however, supports the idea that at least some of these proteins may
require specific substrates to display their helicase activities.
The characterization of its ATPase and helicase activities revealed
that nsp10 shares a number of biochemical properties with the HCoV
helicase. First, and probably most importantly, nsp10 and the HCoV
helicase share a 5'-to-3' polarity in their unwinding reactions,
whereas all RNA virus SF2 enzymes analyzed to date operate in 3'-to-5'
direction (reviewed in 27). This finding implies that nidovirus
helicases bind to the 5' single-stranded region of a partial duplex RNA
and unwind this duplex in a 5'-to-3' direction with respect to the RNA
strand used for entry. Even though the 5'-to-3' polarity has now been
demonstrated for two RNA viral enzymes of SF1, it is certainly
premature to propose a 5'-to-3' polarity for all RNA virus SF1
helicases. In this respect, it should be kept in mind that there are
many cellular and DNA virus SF1 helicases with proven 3'-to-5'
directionality (15). Also, recent studies on molecular
motors of the kinesin superfamily have shown that the specific
arrangement of a motor domain and its associated accessory domain(s)
(rather than the intrinsic properties of the motor domain itself)
determines the polarity of translocation (21), and it has
been speculated that this model may also apply to the function of
helicases (2).
Second, both proteins were strongly stimulated by a nearly identical
range of polynucleotides, with poly(U), poly(dT), and poly(dA) being
the most active cofactors. In contrast, none of the enzymes was
stimulated by poly(G). The levels of stimulation were surprisingly high
in both enzymes (up to 50-fold in the HCoV helicase and up to 20-fold
in nsp10). Thus, the values substantially surpassed the stimulatory
effects reported for the ATPase activities of other RNA virus SF1
helicases (18, 26, 42). The stimulation of the ATPase
activity upon binding to single-stranded nucleic acid most likely
reflects a conformational change in nsp10, stabilizing the bound ATP
molecule in a conformation that is required for rapid hydrolysis. This
conformational change has long been proposed to occur in most NTPases,
and recently it was indeed verified by structural data (51).
The poly(U)-stimulated ATPase activity of nsp10 proved to be
extremely sensitive to increasing salt concentrations. Similar results
have also been obtained for other virus-encoded, helicase-associated
NTPase activities (10, 60, 61). At least in some cases,
direct evidence was obtained to show that, even in the presence of very
low concentrations of monovalent cations, the binding of a given enzyme
to nucleic acid was significantly reduced (10). The fact
that the basal NTPase activity of nsp10 was not significantly affected
by moderate salt concentrations (up to 250 mM) suggests that the
overall conformation of nsp10 was maintained at this ionic strength. We
therefore interpret the data to show that monovalent cations interfere
with the binding of nsp10 to its nucleic acid cofactor, which, in turn,
prevents the enzyme from assuming the specific conformation required
for effective ATP hydrolysis. Since the physiological ionic strength in
the cytoplasm is about 150 mM, it is likely that the functionality of
nsp10 in vivo is maintained by a specific microenvironment. Nsp10 has
been shown to be part of the viral replication complex (56),
and it is conceivable that specific protein-protein interactions in
conjunction with membranes may exclude salt from the immediate environment of the helicase or change the salt sensitivity of the enzyme.
Third, it appears that the substrate-binding pockets of both nsp10 and
the HCoV helicase do not significantly discriminate between RNA and
DNA. This conclusion is supported by the observation that both RNA and
DNA homopolymers were able to stimulate the ATPase activities of
nsp10 and the HCoV helicase. Similarly, both RNA and DNA duplexes are
readily unwound by the two enzymes. The nidovirus enzymes share this
lack of specificity with only a few other helicases (1, 19, 28,
45, 62), whereas the majority of helicases act very specifically
on either DNA or RNA.
It should be noted here that the similarity between the EAV and HCoV
helicases is not restricted to their common biochemical properties.
There are additional peculiarities that support a close phylogenetic
and functional relationship between these enzymes. First, both the
arterivirus and the coronavirus helicases are localized downstream of
the polymerase domain in the viral polyprotein, an arrangement that is
extremely unusual among positive-strand RNA viruses, where the helicase
generally precedes the polymerase domain (29). Second, both
the arterivirus and the coronavirus helicases are combined with
supergroup 1 polymerases, whereas all other RNA viral SF1 helicases are
combined with polymerases of supergroup 3 (29). And third,
both enzymes use a combination of an amino-terminal Zn finger domain
and a downstream SF1 helicase domain (6, 7, 17, 23, 56).
Taken together, these observations lead us to suggest that the two
nidovirus proteins are closely related and can be expected to have
similar functions in the virus life cycle. Also, the data provide
additional support for a common ancestry of the nidovirus replicase
genes as previously postulated on the basis of sequence
comparison data (6). Obviously, the conserved 5'-to-3'
polarity of the arteri- and coronavirus helicases stands in contrast to
the 3'-to-5' polarity of RNA virus SF2 helicases, suggesting that the
nidovirus enzymes may have functions that fundamentally differ from the
distantly related SF2 helicases of the poty-, flavi- and pestilike viruses.
In the EAV reverse genetic system (53), it has recently been
demonstrated that the nsp10-associated Zn finger domain is a
multifunctional protein that is specifically involved in such different processes as genome replication, sg mRNA transcription, and virion biogenesis (55). The bacterial expression
system described in this study can be expected to provide a
valuable tool in the functional and, possibly, structural
characterization of nsp10. Furthermore, the in vitro DNA helicase
activity of nsp10 allows for the use of DNA substrates and will thus
greatly facilitate the detailed analysis of the substrate specificity
of nsp10. Obviously, one of our primary goals will be to examine the
functional relevance of the Zn finger structure and the hinge spacer
region, which connects the Zn finger and the helicase domain, to the
enzymatic activities of nsp10. As a first step towards this goal,
mutant forms of nsp10 will be characterized, and we hope that, in
combination with the in vivo data reported recently (55),
these studies will provide clues to the understanding of the physical
interactions between the individual subdomains of nsp10.
 |
ACKNOWLEDGMENTS |
The work of Anja Seybert was supported by grants from the
Deutsche Forschungsgemeinschaft (SI 357/4-1) and the Fonds der
Chemischen Industrie (FCI).
We thank Jessika Dobbe for technical support and gratefully acknowledge
Alexander E. Gorbalenya for helpful discussions during the course of
these studies.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Virology and Immunology, University of Würzburg, Versbacher Str.
7, 97078 Würzburg, Germany. Phone: 49-931-2013966. Fax:
49-931-2013934. E-mail: ziebuhr{at}vim.uni-wuerzburg.de.
Present address: Department of Molecular Virology, Institut
Jacques-Monod, 75251 Paris Cedex 05, France.
 |
REFERENCES |
| 1.
|
Bayliss, C. D., and G. L. Smith.
1996.
Vaccinia virion protein I8R has both DNA and RNA helicase activities: implications for vaccinia virus transcription.
J. Virol.
70:794-800[Abstract].
|
| 2.
|
Bird, L. E.,
H. S. Subramanya, and D. B. Wigley.
1998.
Helicases: a unifying structural theme?
Curr. Opin. Struct. Biol.
8:14-18[CrossRef][Medline].
|
| 3.
|
Cavanagh, D.
1997.
Nidovirales: a new order comprising Coronaviridae and Arteriviridae.
Arch. Virol.
142:629-633[Medline].
|
| 4.
|
Chiorini, J. A.,
M. D. Weitzman,
R. A. Owens,
E. Urcelay,
B. Safer, and R. M. Kotin.
1994.
Biologically active Rep proteins of adeno-associated virus type 2 produced as fusion proteins in Escherichia coli.
J. Virol.
68:797-804[Abstract/Free Full Text].
|
| 5.
|
Dé, I.,
S. G. Sawicki, and D. L. Sawicki.
1996.
Sindbis virus RNA-negative mutants that fail to convert from minus-strand to plus-strand synthesis: role of the nsP2 protein.
J. Virol.
70:2706-2719[Abstract].
|
| 6.
|
den Boon, J. A.,
E. J. Snijder,
E. D. Chirnside,
A. A. de Vries,
M. C. Horzinek, and W. J. Spaan.
1991.
Equine arteritis virus is not a togavirus but belongs to the coronaviruslike superfamily.
J. Virol.
65:2910-2920[Abstract/Free Full Text].
|
| 7.
|
Denison, M. R.,
W. J. Spaan,
Y. van der Meer,
C. A. Gibson,
A. C. Sims,
E. Prentice, and X. T. Lu.
1999.
The putative helicase of the coronavirus mouse hepatitis virus is processed from the replicase gene polyprotein and localizes in complexes that are active in viral RNA synthesis.
J. Virol.
73:6862-6871[Abstract/Free Full Text].
|
| 8.
|
de Vries, A. A. F.,
M. C. Horzinek,
P. J. M. Rottier, and R. J. de Groot.
1997.
The genome organization of the Nidovirales: similarities and differences between arteri, toro-, and coronaviruses.
Semin. Virol.
8:33-47[CrossRef].
|
| 9.
|
Dracheva, S.,
E. V. Koonin, and J. J. Crute.
1995.
Identification of the primase active site of the herpes simplex virus type 1 helicase-primase.
J. Biol. Chem.
270:14148-14153[Abstract/Free Full Text].
|
| 10.
|
Eagles, R. M.,
E. Balmori-Melian,
D. L. Beck,
R. C. Gardner, and R. L. Forster.
1994.
Characterization of NTPase, RNA-binding and RNA-helicase activities of the cytoplasmic inclusion protein of tamarillo mosaic potyvirus.
Eur. J. Biochem.
224:677-684[Medline].
|
| 11.
|
Gomez de Cedrón, M.,
N. Ehsani,
M. L. Mikkola,
J. A. García, and L. Kääriäinen.
1999.
RNA helicase activity of Semliki Forest virus replicase protein NSP2.
FEBS Lett.
448:19-22[CrossRef][Medline].
|
| 12.
|
Gorbalenya, A. E.,
V. M. Blinov,
A. P. Donchenko, and E. V. Koonin.
1989.
An NTP-binding motif is the most conserved sequence in a highly diverged monophyletic group of proteins involved in positive strand RNA viral replication.
J. Mol. Evol.
28:256-268[CrossRef][Medline].
|
| 13.
|
Gorbalenya, A. E., and E. V. Koonin.
1989.
Viral proteins containing the purine NTP-binding sequence pattern.
Nucleic Acids Res.
17:8413-8440[Abstract/Free Full Text].
|
| 14.
|
Gorbalenya, A. E., and E. V. Koonin.
1993.
Comparative analysis of amino-acid sequences of key enzymes of replication and expression of positive-strand RNA viruses. Validity of approach and functional and evolutionary implications.
Sov. Sci. Rev. D. Physicochem. Biol.
11:1-84.
|
| 15.
|
Gorbalenya, A. E., and E. V. Koonin.
1993.
Helicases: amino acid sequence comparisons and structure-function relationships.
Curr. Opin. Struct. Biol.
3:419-429.
|
| 16.
|
Gorbalenya, A. E.,
E. V. Koonin,
A. P. Donchenko, and V. M. Blinov.
1988.
A novel superfamily of nucleoside triphosphate-binding motif containing proteins which are probably involved in duplex unwinding in DNA and RNA replication and recombination.
FEBS Lett.
235:16-24[CrossRef][Medline].
|
| 17.
|
Gorbalenya, A. E.,
E. V. Koonin,
A. P. Donchenko, and V. M. Blinov.
1989.
Coronavirus genome: prediction of putative functional domains in the non-structural polyprotein by comparative amino acid sequence analysis.
Nucleic Acids Res.
17:4847-4861[Abstract/Free Full Text].
|
| 18.
|
Gros, C., and G. Wengler.
1996.
Identification of an RNA-stimulated NTPase in the predicted helicase sequence of the Rubella virus nonstructural polyprotein.
Virology
217:367-372[CrossRef][Medline].
|
| 19.
|
Gwack, Y.,
D. W. Kim,
J. H. Han, and J. Choe.
1997.
DNA helicase activity of the hepatitis C virus nonstructural protein 3.
Eur. J. Biochem.
250:47-54[Medline].
|
| 20.
|
Hall, M. C., and S. W. Matson.
1999.
Helicase motifs: the engine that powers DNA unwinding.
Mol. Microbiol.
34:867-877[CrossRef][Medline].
|
| 21.
|
Henningsen, U., and M. Schliwa.
1997.
Reversal in the direction of movement of a molecular motor.
Nature
389:93-96[CrossRef][Medline].
|
| 22.
|
Herold, J.,
S. Siddell, and J. Ziebuhr.
1996.
Characterization of coronavirus RNA polymerase gene products.
Methods Enzymol.
275:68-89[Medline].
|
| 23.
|
Heusipp, G.,
U. Harms,
S. G. Siddell, and J. Ziebuhr.
1997.
Identification of an ATPase activity associated with a 71-kilodalton polypeptide encoded in gene 1 of the human coronavirus 229E.
J. Virol.
71:5631-5634[Abstract].
|
| 24.
|
Janda, M., and P. Ahlquist.
1998.
Brome mosaic virus RNA replication protein 1a dramatically increases in vivo stability but not translation of viral genomic RNA3.
Proc. Natl. Acad. Sci. USA
95:2227-2232[Abstract/Free Full Text].
|
| 25.
|
Johnson, R. E.,
S. T. Henderson,
T. D. Petes,
S. Prakash,
M. Bankmann, and L. Prakash.
1992.
Saccharomyces cerevisiae RAD5-encoded DNA repair protein contains DNA helicase and zinc-binding sequence motifs and affects the stability of simple repetitive sequences in the genome.
Mol. Cell. Biol.
12:3807-3818[Abstract/Free Full Text].
|
| 26.
|
Kadaré, G.,
C. David, and A. L. Haenni.
1996.
ATPase, GTPase, and RNA binding activities associated with the 206-kilodalton protein of turnip yellow mosaic virus.
J. Virol.
70:8169-8174[Abstract].
|
| 27.
|
Kadaré, G., and A. L. Haenni.
1997.
Virus-encoded RNA helicases.
J. Virol.
71:2583-2590[Medline].
|
| 28.
|
Kim, H. D.,
J. Choe, and Y. S. Seo.
1999.
The sen1(+) gene of Schizosaccharomyces pombe, a homologue of budding yeast SEN1, encodes an RNA and DNA helicase.
Biochemistry
38:14697-14710[CrossRef][Medline].
|
| 29.
|
Koonin, E. V., and V. V. Dolja.
1993.
Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences.
Crit. Rev. Biochem. Mol. Biol.
28:375-430[Medline].
|
| 30.
|
Kroner, P. A.,
B. M. Young, and P. Ahlquist.
1990.
Analysis of the role of brome mosaic virus 1a protein domains in RNA replication, using linker insertion mutagenesis.
J. Virol.
64:6110-6120[Abstract/Free Full Text].
|
| 31.
|
Lohman, T. M.
1993.
Helicase-catalyzed DNA unwinding.
J. Biol. Chem.
268:2269-2272[Abstract/Free Full Text].
|
| 32.
|
Lohman, T. M., and K. P. Bjornson.
1996.
Mechanisms of helicase-catalyzed DNA unwinding.
Annu. Rev. Biochem.
65:169-214[CrossRef][Medline].
|
| 33.
|
Lohman, T. M., and D. P. Mascotti.
1992.
Thermodynamics of ligand-nucleic acid interactions.
Methods Enzymol.
212:400-424[Medline].
|
| 34.
|
Mannhaupt, G.,
R. Stucka,
S. Ehnle,
I. Vetter, and H. Feldmann.
1992.
Molecular analysis of yeast chromosome II between CMD1 and LYS2: the excision repair gene RAD16 located in this region belongs to a novel group of double-finger proteins.
Yeast
8:397-408[CrossRef][Medline].
|
| 35.
|
Matson, S. W., and K. A. Kaiser-Rogers.
1990.
DNA helicases.
Annu. Rev. Biochem.
59:289-329[CrossRef][Medline].
|
| 36.
|
O'Reilly, E. K.,
N. Tang,
P. Ahlquist, and C. C. Kao.
1995.
Biochemical and genetic analyses of the interaction between the helicase-like and polymerase-like proteins of the brome mosaic virus.
Virology
214:59-71[CrossRef][Medline].
|
| 37.
|
O'Reilly, E. K.,
Z. Wang,
R. French, and C. C. Kao.
1998.
Interactions between the structural domains of the RNA replication proteins of plant-infecting RNA viruses.
J. Virol.
72:7160-7169[Abstract/Free Full Text].
|
| 38.
|
Osman, T. A., and K. W. Buck.
1996.
Complete replication in vitro of tobacco mosaic virus RNA by a template-dependent, membrane-bound RNA polymerase.
J. Virol.
70:6227-6234[Abstract].
|
| 39.
|
Ouzounis, C. A., and B. J. Blencowe.
1991.
Bacterial DNA replication initiation factor priA is related to proteins belonging to the 'DEAD-box' family.
Nucleic Acids Res.
19:6953[Free Full Text].
|
| 40.
|
Pedersen, K. W.,
Y. van der Meer,
N. Roos, and E. J. Snijder.
1999.
Open reading frame 1a-encoded subunits of the arterivirus replicase induce endoplasmic reticulum-derived double-membrane vesicles which carry the viral replication complex.
J. Virol.
73:2016-2026[Abstract/Free Full Text].
|
| 41.
|
Petty, I. T.,
R. French,
R. W. Jones, and A. O. Jackson.
1990.
Identification of barley stripe mosaic virus genes involved in viral RNA replication and systemic movement.
EMBO J.
9:3453-3457[Medline].
|
| 42.
|
Rikkonen, M.,
J. Peränen, and L. Kääriäinen.
1994.
ATPase and GTPase activities associated with Semliki Forest virus nonstructural protein nsP2.
J. Virol.
68:5804-5810[Abstract/Free Full Text].
|
| 43.
|
Rodriguez, P. L., and L. Carrasco.
1993.
Poliovirus protein 2C has ATPase and GTPase activities.
J. Biol. Chem.
268:8105-8110[Abstract/Free Full Text].
|
| 44.
|
Rouleau, M.,
R. J. Smith,
J. B. Bancroft, and G. A. Mackie.
1994.
Purification, properties, and subcellular localization of foxtail mosaic potexvirus 26-kDa protein.
Virology
204:254-265[CrossRef][Medline].
|
| 45.
|
Scheffner, M.,
R. Knippers, and H. Stahl.
1989.
RNA unwinding activity of SV40 large T antigen.
Cell
57:955-963[CrossRef][Medline].
|
| 46.
|
Seybert, A.,
A. Hegyi,
S. G. Siddell, and J. Ziebuhr.
2000.
The human coronavirus 229E superfamily 1 helicase has RNA and DNA duplex-unwinding activities with 5'-to-3' polarity.
RNA
6:1056-1068[Abstract].
|
| 47.
|
Snijder, E. J., and J. J. Meulenberg.
1998.
The molecular biology of arteriviruses.
J. Gen. Virol.
79:961-979[Medline].
|
| 48.
|
Snijder, E. J.,
A. L. Wassenaar, and W. J. Spaan.
1992.
The 5' end of the equine arteritis virus replicase gene encodes a papainlike cysteine protease.
J. Virol.
66:7040-7048[Abstract/Free Full Text].
|
| 49.
|
Snijder, E. J.,
A. L. Wassenaar,
W. J. Spaan, and A. E. Gorbalenya.
1995.
The arterivirus nsp2 protease: an unusual cysteine protease with primary structure similarities to both papain-like and chymotrypsin-like proteases.
J. Biol. Chem.
270:16671-16676[Abstract/Free Full Text].
|
| 50.
|
Snijder, E. J.,
A. L. Wassenaar,
L. C. van Dinten,
W. J. Spaan, and A. E. Gorbalenya.
1996.
The arterivirus nsp4 protease is the prototype of a novel group of chymotrypsin-like enzymes, the 3C-like serine proteases.
J. Biol. Chem.
271:4864-4871[Abstract/Free Full Text].
|
| 51.
|
Soultanas, P.,
M. S. Dillingham,
S. S. Velankar, and D. B. Wigley.
1999.
DNA binding mediates conformational changes and metal ion coordination in the active site of PcrA helicase.
J. Mol. Biol.
290:137-148[CrossRef][Medline].
|
| 52.
|
van der Meer, Y.,
H. van Tol,
J. Krijnse Locker, and E. J. Snijder.
1998.
ORF1a-encoded replicase subunits are involved in the membrane association of the arterivirus replication complex.
J. Virol.
72:6689-6698[Abstract/Free Full Text].
|
| 53.
|
van Dinten, L. C.,
J. A. den Boon,
A. L. Wassenaar,
W. J. Spaan, and E. J. Snijder.
1997.
An infectious arterivirus cDNA clone: identification of a replicase point mutation that abolishes discontinuous mRNA transcription.
Proc. Natl. Acad. Sci. USA
94:991-996[Abstract/Free Full Text].
|
| 54.
|
van Dinten, L. C.,
S. Rensen,
A. E. Gorbalenya, and E. J. Snijder.
1999.
Proteolytic processing of the open reading frame 1b-encoded part of arterivirus replicase is mediated by nsp4 serine protease and is essential for virus replication.
J. Virol.
73:2027-2037[Abstract/Free Full Text].
|
| 55.
|
van Dinten, L. C.,
H. van Tol,
A. E. Gorbalenya, and E. J. Snijder.
2000.
The predicted metal-binding region of the arterivirus helicase protein is involved in subgenomic mRNA synthesis, genome replication, and virion biogenesis.
J. Virol.
74:5213-5223[Abstract/Free Full Text].
|
| 56.
|
van Dinten, L. C.,
A. L. Wassenaar,
A. E. Gorbalenya,
W. J. Spaan, and E. J. Snijder.
1996.
Processing of the equine arteritis virus replicase ORF1b protein: identification of cleavage products containing the putative viral polymerase and helicase domains.
J. Virol.
70:6625-6633[Abstract/Free Full Text].
|
| 57.
|
van Marle, G.,
L. C. van Dinten,
W. J. Spaan,
W. Luytjes, and E. J. Snijder.
1999.
Characterization of an equine arteritis virus replicase mutant defective in subgenomic mRNA synthesis.
J. Virol.
73:5274-5281[Abstract/Free Full Text].
|
| 58.
|
Visse, R.,
M. de Ruijter,
M. Ubbink,
J. A. Brandsma, and P. van de Putte.
1993.
The first zinc-binding domain of UvrA is not essential for UvrABC-mediated DNA excision repair.
Mutat. Res.
294:263-274[Medline].
|
| 59.
|
Walker, J. E.,
M. Saraste,
M. J. Runswick, and N. J. Gay.
1982.
Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold.
EMBO J.
1:945-951[Medline].
|
| 60.
|
Wardell, A. D.,
W. Errington,
G. Ciaramella,
J. Merson, and M. J. McGarvey.
1999.
Characterization and mutational analysis of the helicase and NTPase activities of hepatitis C virus full-length NS3 protein.
J. Gen. Virol.
80:701-709[Abstract].
|
| 61.
|
Warrener, P.,
J. K. Tamura, and M. S. Collett.
1993.
RNA-stimulated NTPase activity associated with yellow fever virus NS3 protein expressed in bacteria.
J. Virol.
67:989-996[Abstract/Free Full Text].
|
| 62.
|
Zhang, S., and F. Grosse.
1994.
Nuclear DNA helicase II unwinds both DNA and RNA.
Biochemistry
33:3906-3912[CrossRef][Medline].
|
| 63.
|
Ziebuhr, J.,
E. J. Snijder, and A. E. Gorbalenya.
2000.
Virus-encoded proteinases and proteolytic processing in the Nidovirales.
J. Gen. Virol.
81:853-879[Free Full Text].
|
Journal of Virology, October 2000, p. 9586-9593, Vol. 74, No. 20
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
van Hemert, M. J., de Wilde, A. H., Gorbalenya, A. E., Snijder, E. J.
(2008). The in Vitro RNA Synthesizing Activity of the Isolated Arterivirus Replication/Transcription Complex Is Dependent on a Host Factor. J. Biol. Chem.
283: 16525-16536
[Abstract]
[Full Text]
-
Beerens, N., Selisko, B., Ricagno, S., Imbert, I., van der Zanden, L., Snijder, E. J., Canard, B.
(2007). De Novo Initiation of RNA Synthesis by the Arterivirus RNA-Dependent RNA Polymerase. J. Virol.
81: 8384-8395
[Abstract]
[Full Text]
-
Pasternak, A. O., Spaan, W. J. M., Snijder, E. J.
(2006). Nidovirus transcription: how to make sense...?. J. Gen. Virol.
87: 1403-1421
[Abstract]
[Full Text]
-
van Aken, D., Snijder, E. J., Gorbalenya, A. E.
(2006). Mutagenesis Analysis of the nsp4 Main Proteinase Reveals Determinants of Arterivirus Replicase Polyprotein Autoprocessing.. J. Virol.
80: 3428-3437
[Abstract]
[Full Text]
-
Posthuma, C. C., Nedialkova, D. D., Zevenhoven-Dobbe, J. C., Blokhuis, J. H., Gorbalenya, A. E., Snijder, E. J.
(2006). Site-Directed Mutagenesis of the Nidovirus Replicative Endoribonuclease NendoU Exerts Pleiotropic Effects on the Arterivirus Life Cycle. J. Virol.
80: 1653-1661
[Abstract]
[Full Text]
-
Seybert, A., Posthuma, C. C., van Dinten, L. C., Snijder, E. J., Gorbalenya, A. E., Ziebuhr, J.
(2005). A Complex Zinc Finger Controls the Enzymatic Activities of Nidovirus Helicases. J. Virol.
79: 696-704
[Abstract]
[Full Text]
-
Pasternak, A. O., Spaan, W. J. M., Snijder, E. J.
(2004). Regulation of Relative Abundance of Arterivirus Subgenomic mRNAs. J. Virol.
78: 8102-8113
[Abstract]
[Full Text]
-
Ivanov, K. A., Ziebuhr, J.
(2004). Human Coronavirus 229E Nonstructural Protein 13: Characterization of Duplex-Unwinding, Nucleoside Triphosphatase, and RNA 5'-Triphosphatase Activities. J. Virol.
78: 7833-7838
[Abstract]
[Full Text]
-
Ivanov, K. A., Thiel, V., Dobbe, J. C., van der Meer, Y., Snijder, E. J., Ziebuhr, J.
(2004). Multiple Enzymatic Activities Associated with Severe Acute Respiratory Syndrome Coronavirus Helicase. J. Virol.
78: 5619-5632
[Abstract]
[Full Text]
-
Vlot, A. C., Laros, S. M., Bol, J. F.
(2003). Coordinate Replication of Alfalfa Mosaic Virus RNAs 1 and 2 Involves cis- and trans-Acting Functions of the Encoded Helicase-Like and Polymerase-Like Domains. J. Virol.
77: 10790-10798
[Abstract]
[Full Text]
-
Tanner, J. A., Watt, R. M., Chai, Y.-B., Lu, L.-Y., Lin, M. C., Peiris, J. S. M., Poon, L. L. M., Kung, H.-F., Huang, J.-D.
(2003). The Severe Acute Respiratory Syndrome (SARS) Coronavirus NTPase/Helicase Belongs to a Distinct Class of 5' to 3' Viral Helicases. J. Biol. Chem.
278: 39578-39582
[Abstract]
[Full Text]
-
Thiel, V., Ivanov, K. A., Putics, A., Hertzig, T., Schelle, B., Bayer, S., Weissbrich, B., Snijder, E. J., Rabenau, H., Doerr, H. W., Gorbalenya, A. E., Ziebuhr, J.
(2003). Mechanisms and enzymes involved in SARS coronavirus genome expression. J. Gen. Virol.
84: 2305-2315
[Abstract]
[Full Text]
-
Hegyi, A., Friebe, A., Gorbalenya, A. E., Ziebuhr, J.
(2002). Mutational analysis of the active centre of coronavirus 3C-like proteases. J. Gen. Virol.
83: 581-593
[Abstract]
[Full Text]
-
Snijder, E. J., van Tol, H., Roos, N., Pedersen, K. W.
(2001). Non-structural proteins 2 and 3 interact to modify host cell membranes during the formation of the arterivirus replication complex. J. Gen. Virol.
82: 985-994
[Abstract]
[Full Text]
-
Ziebuhr, J., Thiel, V., Gorbalenya, A. E.
(2001). The Autocatalytic Release of a Putative RNA Virus Transcription Factor from Its Polyprotein Precursor Involves Two Paralogous Papain-like Proteases That Cleave the Same Peptide Bond. J. Biol. Chem.
276: 33220-33232
[Abstract]
[Full Text]