Previous Article | Next Article 
Journal of Virology, January 2000, p. 944-955, Vol. 74, No. 2
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
In Situ Distribution of Hepatitis C Virus
Replicative-Intermediate RNA in Hepatic Tissue and Its Correlation with
Liver Disease
Ming
Chang,1
Anthony P.
Marquardt,1
Brent L.
Wood,1
Ocean
Williams,1
Scott J.
Cotler,2,
Shari L.
Taylor,3
Robert L.
Carithers Jr.,2 and
David R.
Gretch1,2,*
Departments of Laboratory
Medicine,1 and
Medicine,2 and
Pathology,3 University of Washington
Medical Center, Seattle, Washington 98195
Received 28 May 1999/Accepted 21 September 1999
 |
ABSTRACT |
Liver failure from chronic hepatitis C is the leading indication
for liver transplantation in the United States. However, the
pathogenesis of liver injury resulting from chronic hepatitis C virus
(HCV) infection is not well understood. To examine the relationship
between HCV replication in liver tissue and hepatocellular injury, a
strand-specific in situ hybridization procedure was developed. The
sensitivity and specificity of digoxigenin-labeled riboprobes were
optimized by analyzing Northern blots and cell lines expressing HCV
RNAs. For the current study, both genomic (sense) and
replicative-intermediate (antisense) HCV RNAs were detected and
quantified in 8 of 8 liver tissue specimens from infected patients
versus 0 of 11 liver tissue specimens from noninfected controls. The
distribution pattern for HCV replicative-intermediate RNA in liver was
different from that for HCV genomic RNA. HCV genomic RNA was variably
distributed throughout infected livers and was located primarily in the
cytoplasm of hepatocytes, with some signal in fibroblasts and/or
macrophages in the surrounding fibroconnective tissue. However, HCV
replicative-intermediate RNA showed a more focal pattern of
distribution and was exclusively localized in the cytoplasm of
hepatocytes. There was no significant relationship between the
distribution pattern for HCV genomic RNA and any indices of
hepatocellular injury. However, a highly significant correlation was
observed between the percentage of cells staining positive for
replicative-intermediate RNA and the degree of hepatic inflammatory
activity (P, < 0.0001). Furthermore, the ratio of cells
staining positive for HCV replicative-intermediate versus genomic RNA
correlated with the histological severity of liver injury
(P, 0.0065), supporting the hypothesis that active replication of HCV in liver tissue may be a significant determinant of
hepatocellular injury.
 |
INTRODUCTION |
Hepatitis C virus (HCV) is an
important cause of chronic liver disease leading to cirrhosis and
end-stage liver disease in humans. Chronic hepatitis C is now
recognized as a leading indication for orthotopic liver transplantation
in the United States. HCV is a positive-strand RNA virus of
approximately 9.4 kb with a single open reading frame encoding a
polyprotein of 3,011 amino acids. HCV has been classified as a
Hepacivirus within the family Flaviviridae, based
on its genomic organization and genetic homology with pestiviruses and
flaviviruses. By analogy with other members of the
Flaviviridae, it is assumed that HCV replication requires the production of an antisense or replicative-intermediate RNA, from
which progeny genomic strands are transcribed.
The diagnosis of HCV infection is established by detection of
HCV-specific antibodies in patient serum by serological assays and by
detection of HCV genomic (positive-strand) RNA in serum by molecular
assays, such as reverse transcriptase (RT) PCR (RT-PCR) (10,
12). Detection of HCV replicative-intermediate RNA by RT-PCR has
been controversial due to inherent limitations in achieving strand
specificity (19). Recent studies with improved methods, however, appear to confirm the hypothesis that HCV replicates in human
liver (20, 24). Several reports have described the detection
of HCV RNA in liver tissue by the techniques of in situ hybridization
and in situ PCR (2, 7-9, 13, 17, 18, 21, 22, 26, 28, 29,
31-34). However, several issues remain unresolved due to
conflicting data. In some studies, only a subset of biopsies from
patients with hepatitis C stained positive for HCV RNA, and only a
small percentage of hepatocytes appeared to be infected (2,
23). In other studies, HCV genomes were found in over 90% of
biopsies from infected patients (8, 9, 25, 34), suggesting
that HCV infection may be more widely disseminated in human liver than
previously thought. Previous studies have reported a wide range in the
percentages of hepatocytes positive for HCV RNA in positive livers; the
reports have also presented conflicting data on the correlations among
hepatic RNA, serum RNA, and hepatocellular injury. Reports suggesting
no relationship between the level of HCV RNA in the liver and the
degree of hepatocellular injury have led to the hypothesis that HCV may
not be a cytopathic virus (24, 25, 28). However, other
reports have suggested a correlation between HCV RNA and/or HCV
antigens in the liver and the degree of liver injury (1, 11, 13,
32).
To help resolve these important issues, the current report describes
the development and optimization of a new quantitative and highly
sensitive strand-specific in situ hybridization assay for detecting HCV
RNAs in liver tissue. With this assay, different and distinct
intrahepatic distribution patterns were observed for HCV genomic and
replicative-intermediate RNAs, in terms of tissue distribution patterns
and percentages of positive cells. The examination of HCV RNAs in
infected tissues has led to the novel finding that the percentage of
hepatocytes positive for replicative-intermediate RNA is significantly
correlated with the index of liver injury, while the pattern of
positivity for HCV genomic RNA shows no such correlation.
 |
MATERIALS AND METHODS |
Collection and processing of liver tissue.
Liver needle
biopsy specimens were obtained from patients seen at the Hepatology
Service of the University of Washington Medical Center under informed
consent. Immediately after being released from the needle, the core
biopsies were divided into three portions; the largest piece was
processed by formalin fixation and paraffin embedding for histologic
examination, the second piece was placed in guanidinium thiocyanate
solution for HCV RNA testing by reverse transcription (RT)-PCR, and the
remaining piece was snap-frozen in OCT medium (0.2% [wt/wt]
polyvinyl alcohol, 4.3% [wt/wt] polyethylene glycol, 85.5%
[wt/wt] nonreactive ingredients) and stored in a
70°C freezer for
in situ hybridization.
Larger portions of explanted cirrhotic livers were collected from
HCV-infected patients at the time of liver transplantation and
processed in the manner described above. A human liver which was found
to be unsuitable for organ transplantation due to excessive fat and
which tested negative for HCV RNA by RT-PCR (12) was processed for use as negative control tissue. Ten HCV-negative needle
biopsies examined in this study were obtained from HCV antibody-negative patients diagnosed with autoimmune cirrhosis, cryptogenic cirrhosis, or primary sclerosing cholangitis.
All liver biopsies and explants were evaluated by use of routine
hematoxylin- and eosin-stained sections by pathologists who
had no
knowledge of the serum HCV infectivity status. Specific
liver biopsies
or explants were chosen for evaluation based upon
the degree of
inflammatory activity in the native livers or histologic
evidence of
recurrent hepatitis C infection in posttransplant
biopsies. The degree
of liver injury due to hepatitis C infection
was assessed with the
histologic activity index described by Knodell
et al. (
16).
Components of liver injury that were assessed included
portal
inflammation, lobular degeneration and necrosis, piecemeal
necrosis,
and fibrosis. The hepatitis activity was deemed mild
if the piecemeal
necrosis and the lobular degeneration and necrosis
were given scores of
1, moderate if they were given scores of
3, and severe if they received
scores of 4. When there was a discrepancy
between the scores for
piecemeal necrosis and for lobular degeneration
and necrosis, the
higher score
prevailed.
Generation of cDNA clones and riboprobes.
Portions of cDNAs
of the human housekeeping genes for beta-actin and hypoxanthine-guanine
phosphoribosyltransferase (HPRT) and HCV 5' untranslated region (5'UTR)
core and envelope 1 (E1) genes were amplified by RT-PCR with the primer
pairs described in Table 1. E1 genes of
both HCV genotypes 1a and 1b were incorporated because of the high
genetic variability in this region (4). PCR products were
purified with a PCR purification kit from QIAGEN Inc. (Chatsworth,
Calif.) and cloned into plasmid pCRII (Invitrogen, San Diego, Calif.)
according to the manufacturer's protocol to generate the recombinant
plasmids illustrated in Fig. 1. Positive clones were selected by amplification with native primers to identify the correct inserts, and the orientation of the inserts was determined by examination of plasmid restriction enzyme digestion patterns.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Characterization of Dig-labeled riboprobes specific for
HCV sense and antisense RNAs. (A) Map location of riboprobes within the
HCV genome (see Table 1 for nucleotide positions). Abbreviations: 1a,
HCV genotype 1a; 1b, HCV genotype 1b; nt, nucleotide. (B) Recombinant
plasmids containing subgenomic fragments of HCV genotype 1a or 1b were
constructed for generation of riboprobes by in vitro transcription from
bacteriophage T7 or Sp6 promoters. (C) Dot blot assay for assessing the
strand specificity of HCV riboprobes. Unlabeled HCV genomic (sense
[S]) and replicative-intermediate (antisense [AS]) target RNAs were
synthesized by in vitro transcription from recombinant plasmid pE1-1a,
pCORE, or pCU (B), treated with DNase I, and blotted onto nylon
membranes. Unlabeled target RNAs were hybridized with Dig-labeled
riboprobes synthesized from the genomic (S) or antigenomic (AS) strands
of the corresponding recombinant DNA templates. For example, rE1-1a
(AS), indicates the antigenomic riboprobe corresponding to the HCV
genotype 1a E1 gene. (D) Specificity of positive control riboprobes
specific for human beta-actin and HPRT sense RNAs. (E) Specificity of
negative control riboprobe for Neo. Unlabeled sense (S) RNA probes and
Dig-labeled antisense (AS) RNA probes were generated from recombinant
DNA templates containing human and bacterial genes and were hybridized
in the dot blot assay.
|
|
To generate riboprobes, cDNA inserts plus flanking bacteriophage
promoter sequences (T7 or Sp6) were amplified by PCR with
primers Csj7
(GACCATGATTACGCCAAAGC) and m13fII (GTAAAACGACGGCCAGTG).
Digoxigenin-11-UTP (Dig)-labeled riboprobes were synthesized from
purified PCR product templates by runoff transcription with T7
or Sp6
polymerase and with incorporation of Dig according to the
manufacturer's protocol (Boehringer Mannheim Biochemicals,
Indianapolis,
Ind.). The production of RNA and the subsequent removal
of the
DNA template were monitored by agarose gel electrophoresis and
RNA denaturing gel electrophoresis. Briefly, 20 µl of in vitro
transcription reaction mixture was incubated with 1 µl of DNase
I
(amplification grade) (Life Technologies, Gaithersburg, Md.)
for 1 h or until the DNA template was invisible on agarose gels
while a
strong RNA band remained. DNase I was inactivated by incubation
at
65°C for 10 min in the presence of 2.5 mM EDTA. Dig-labeled
riboprobes were further broken down to an average size of 100
nucleotides by alkaline hydrolysis (
6). The final riboprobe
was precipitated and resuspended in 0.1% sodium dodecyl
sulfate.
The pSTP18-neo plasmid containing the bacterial neomycin transferase
gene (Neo) was purchased from Boehringer for use in generating
negative
control riboprobes. Plasmid DNA was cleaved with
PvuII
in
preparation for in vitro transcription with T7 polymerase.
The
antisense transcript was processed by DNase digestion and
alkaline
hydrolysis.
Each newly made Dig-labeled riboprobe was evaluated against a known,
standard Dig-labeled RNA according to the manufacturer's
protocol
(Boehringer). Typically, serial 10-fold dilutions of
the Dig-labeled
riboprobes were applied to nylon membranes along
with serial 10-fold
dilutions of standard Dig-labeled RNA. The
concentrations of
experimental riboprobes were estimated by comparing
spot intensities of
the standard control and the experimental
dilutions. Probe
concentrations were further optimized by Northern
dot blot
hybridization (see Results), and probe concentrations
were adjusted to
equivalent reactivity for all in situ hybridization
experiments.
Generation of positive control cell lines.
To generate
control cell lines expressing either HCV positive-strand (genomic) or
HCV replicative-intermediate (antigenomic) RNA, DNA containing the HCV
genotype 1a core plus E1 was amplified by PCR with primers Ish1
(CGACCGGTCCTTTTTGGA) and x(e2)19j (4). The Ish1
sequence is located 159 bp upstream of the start codon of the core
gene, and the x(e2)19j sequence is located near the 3' end of the
hypervariable region of the E2 gene. The purified PCR product was
subcloned into plasmid pCR2.1 (Invitrogen), and the colony PCR method
was used to select a single clone containing the correct insert. HCV
DNA inserts were subcloned into the eukaryotic expression vector pcDNA3
in both sense (pCE-S) and antisense (pCE-AS) orientations relative to
the promoter-enhancer of human cytomegalovirus.
Huh7 cells (
38), which are human hepatocellular carcinoma
cells, were cultured in Dulbecco's modified Eagle medium containing
high levels of glucose (0.45%) and supplemented with 10% fetal
bovine
serum, 50 U of penicillin per ml, and 50 µg of streptomycin
per ml.
Ten micrograms of purified pcDNA3, pCE-S, or pCE-AS DNA
was transfected
into 3 × 10
6 Huh7 cells by electroporation
(electroporation system; BTX, San
Diego, Calif.). Subsequently,
transfected cell lines were selected
by culturing in the presence of
600 µg of G418, a neomycin analog
(Calbiochem, La Jolla, Calif.), per
ml.
To prepare the cell lines for in situ hybridization analysis,
approximately 8 × 10
4 cells were suspended in 50 µl
of 1% bovine serum albumin (nuclease-free
grade; Calbiochem) after
being washed twice with 1× phosphate-buffered
saline (PBS). Positively
charged slides were precoated with 50
µl of 1% bovine serum albumin
and centrifuged for 5 min at 800
rpm (Shandon Lipshaw, Pittsburgh,
Pa.). Cells were air dried before
fixation with formalin for 5 min at
room temperature, after which
they were washed and stored in 3× PBS at
4°C until in situ hybridization
analysis.
In situ hybridization.
Frozen sections (6 µm) were
initially placed on 50°C heating blocks for 2 min to improve
adherence, fixed in 10% neutral buffered formalin for 5 min at room
temperature, and sequentially washed in 3× PBS and 1× PBS for 5 min
each. The tissue sections were treated with 0.2 N HCl for 2 min and
proteinase K (1 µg/ml) for 2 to 3 min and rinsed with diethyl
pyrocarbonate-treated deionized water. Slides were soaked in
equilibration solution (50% formamide, 0.6 M NaCl, 10 mM Tris-HCl [pH
7.5], 1 mM EDTA, 50 µg of heparin per ml, 10 mM dithiothreitol
[DTT]) for 10 min at room temperature followed by prehybridization
solution (50% formamide, 0.6 M NaCl, 10 mM Tris-HCl [pH 7.5], 1 mM
EDTA, 50 µg of heparin per ml, 10 mM DTT, 10% polyethylene glycol
8000, 1× Denhardt's solution) at 50°C for 1 h. The reagents
were obtained from Novagen (Madison, Wis.).
Approximately 15 µl of Dig-labeled riboprobes was applied to each
slide at a final concentration of 2 to 4 ng/µl in hybridization
buffer (50% formamide, 0.6 M NaCl, 10 mM Tris-HCl [pH 7.5], 1
mM
EDTA, 50 µg of heparin per ml, 10 mM DTT, 0.5 mg of carrier
DNA per
ml, 0.5 mg of tRNA per ml, 10% polyethylene glycol 8000,
1×
Denhardt's solution). For analysis of HCV RNA, mixtures of
core and
genotype-specific E1 riboprobes (Fig.
1A) were used as
HCV antisense or
sense riboprobes. In all experiments, a mixture
of HPRT and beta-actin
antisense riboprobes was used as a positive
control, and the antisense
riboprobe of Neo served as a negative
control. During the hybridization
steps, tissue sections were
covered with siliconized coverslips, sealed
with rubber cement,
and incubated at 50°C in a humidified chamber for
18
h.
After hybridization, sections were soaked in 2× SSC (1× SSC is 0.15 M
NaCl plus 0.015 M sodium citrate) to remove the coverslips,
washed in
2× SSC at 50°C for 30 min, and treated with RNase (20
µg/ml in 2×
SSC) at 37°C for 30 min to reduce nonspecific background.
Subsequently, sections were washed once in 50% formamide-2× SSC
for
30 min at 50 to 65°C and two times in 1× SSC at 50 to 65°C
for 30 min. The wash temperature was optimized by titration for
each
probe.
Immunological detection.
Tissue sections were soaked in 2%
blocking reagent in 100 mM Tris (pH 7.5)-150 mM NaCl for 30 min at
room temperature, followed by incubation with anti-Dig-alkaline
phosphatase conjugate (1:250 dilution) at 4°C overnight in a
humidified chamber. Sections were washed twice with buffer 1 (100 mM
Tris [pH 7.5], 150 mM NaCl) and once with 100 mM Tris buffer (pH 8.2)
at room temperature. Vector red substrate (Vector Laboratories,
Burlingame, Calif.) supplemented with 1.25 mM levamisole (Sigma, St.
Louis, Mo.) was added for 30 minutes before the reaction was terminated
by soaking the slides in buffer IV (10 mM Tris-HCl [pH 8.0], 1 mM
EDTA). Slides were counterstained with 2% methyl green and dehydrated by successive washings with 95% ethanol, 100% ethanol, and xylene before permanent mounting. Slides were examined and photographed with
bright-field microscopy.
For in situ experiments, the specificity of the positive signal was
evaluated with the following controls. (i) Cells were
stained with
riboprobes against endogenous RNAs (HPRT and beta-actin)
to evaluate
the integrity of RNA in frozen sections, including
specimens which were
negative for HCV riboprobes, to confirm their
RNA preservation. (ii)
Cells were stained with the Neo riboprobe
to establish the level of
nonspecific background staining. (iii)
All probes were omitted from the
hybridization solution, allowing
evaluation of any potential endogenous
alkaline phosphatase activity
in liver tissue. No endogenous alkaline
phosphatase was detected
by the in situ hybridization procedure as
described (data not
shown).
Statistical analysis.
To estimate the percentage of cells
positive for either HCV genomic or replicative-intermediate RNA, we
counted 50 to 120 cells per slide, distinguished by nuclear
counterstaining, depending on the size of the liver tissue sample. The
Pearson chi-square test was used to test the significance of
differences between the percentages of positive cells in two
inflammatory grades. Linearity was assessed for the percentage of cells
positive for the HCV RNA signal and the severity of liver damage in
three histopathologic classifications by use of the Mantel-Haenszel
chi-square test. The statistical analyses were carried out by use of
SPSS for Macintosh, version 6.1.1 (SPSS Inc., Chicago, Ill.).
 |
RESULTS |
Characterization of Dig-labeled riboprobes.
In order to
develop an in situ hybridization system for the specific detection of
HCV genomic and replicative-intermediate RNAs in human tissues, a
series of control experiments were designed to optimize and
characterize HCV riboprobes. Figure 1 presents a summary of such
optimization experiments. A summary of HCV cDNA clones and their
genetic locations, sizes of inserts, and primers used for amplification
is listed in Table 1 and illustrated in Fig. 1A and B. Riboprobe
synthesis is described in Materials and Methods.
For each riboprobe, Northern dot blot experiments were performed to
determine positive reactivity as well as strand and genotype
specificity. Representative Northern dot blot experiments are
shown in
Fig.
1C, D, and E. Unlabeled RNAs were synthesized from
both strands of
each clone and dotted to nylon membranes to serve
as target RNA. The
targets were probed with either sense or antisense
Dig-labeled
riboprobes synthesized from the same or different
HCV genes or cellular
control
genes.
Three sets of sense and antisense Dig-labeled riboprobes were
hybridized against the corresponding sense and antisense unlabeled
RNA
transcripts as described in the legend to Fig.
1C. Strong,
highly
specific reactivity was evident in each case. Positive
control
antisense riboprobes derived from beta-actin and HPRT
cDNAs and the
negative control riboprobe were hybridized against
unlabeled
transcripts from the same genes in Fig.
1D and E. Strong
hybridization
signals with high specificity were observed with
these positive and
negative control riboprobes. The weak reactivity
between the Neo
riboprobe and the HCV core antisense target was
due to small amounts of
homologous vector sequences present in
both RNA
constructs.
Establishment of cell lines expressing HCV sense and antisense
RNAs.
To further evaluate the sensitivity and specificity of our
in situ hybridization protocol, permanent cell lines expressing subgenomic regions of HCV sense and antisense RNAs were established. DNA containing the HCV 5'UTR, core, and E1 genes was amplified by PCR
from plasmid pTET/HCV5"T73'AFL, obtained from Charles Rice (Washington
University, St. Louis, Mo.), and subcloned into expression vector
pcDNA3 as shown in Fig. 2A. Plasmid
pcDNA3 contains enhancer-promoter sequences from the major
immediate-early gene of human cytomegalovirus, which drives high-level
transcription in human cell lines (3). Two plasmids, pCE-S
and pCE-AS, were constructed to allow HCV RNA expression from either
the positive (genomic) strand or the negative (antigenomic) strand of
the HCV genome. Plasmids pCE-S and pCE-AS were transfected into Huh7
cell lines, and permanent transfectants (Huh7-hcvS and Huh7-hcvAS) were
isolated after 3 weeks of selection in the presence of the neomycin
analog G418.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
Generation and analysis of human cell lines expressing
HCV genomic and antigenomic RNAs. (A) Construction of expression
plasmids pCE-AS and pCE-S. The entire core and E1 genes of HCV genotype
1a were aligned in either the sense orientation (pCE-S) or the
antisense orientation (pCE-AS) relative to the human cytomegalovirus
major immediate-early promoter regulatory region (PCMV).
Huh7 cells were transfected with plasmid pCE-S or pCE-AS, and stable
transformants, designated Huh7-hcvS and Huh7-hcvAS, were selected as
described in Materials and Methods. (B) Analysis of HCV RNA expression
in cell lines Huh7-hcvS and Huh7-hcvAS by RT-PCR. Total RNA was
extracted from cells, digested with DNase I prior to reverse
transcription in the presence of a mixture of hexamer
(pdN6) oligonucleotides (lanes 3 and 5), and then amplified
with primers c256 and c186 (30). The arrow on the right
denotes the appropriate expected band of 240 bp. In lanes 4 and 6, the
reverse transcription step was eliminated prior to PCR amplification
under conditions identical to those used for lanes 3 and 5, respectively. In lanes 1 and 2, RNA from negative control cell lines
Huh7 and Huh7-PC3 was analyzed by the same method as in lanes 3 and 5. Lane M contains size markers. (C) Northern dot blot analysis of RNA
from transfected or control cell lines with strand-specific HCV
riboprobes. CU (S) designates a genomic-strand synthetic HCV RNA which
was derived from the pCU clone and which served as a positive control
for the antisense riboprobes. See the legend to Fig. 1 for an
explanation of other designations.
|
|
To verify the expression of HCV RNA, total RNAs were extracted from
Huh7, Huh7-PC3 (permanent pcDNA3-transfected cells), Huh7-hcvAS,
and
Huh7-hcvS cells and treated with DNase I prior to RT-PCR with
primers
c186 and c256 (
30). The results of RT-PCR and control
DNA
PCR experiments are shown in Fig.
2B, indicating that subgenomic
HCV
RNAs were expressed in Huh7-hcvAS and Huh7-hcvS cell lines.
Trace
amounts of residual HCV DNA were detected in DNase I-treated
Huh7-hcvAS
RNA, as indicated by a weak positive signal (Fig.
2B,
lane
4).
Northern dot blot analysis was performed to examine the expression of
the positive- and negative-strand RNAs. Ten micrograms
of RNA was
isolated from Huh7-hcvAS and Huh7-hcvS cells, treated
with DNase I,
blotted to nylon membranes, and probed with strand-specific
HCV
riboprobes as described in the legend to Fig.
2C. Following
hybridization with HCV sense riboprobes (Fig.
2C), total RNA from
the
Huh7-hcvAS cell line gave a positive hybridization signal,
while RNA
from the Huh7-hcvS cell line was negative. These results
were
consistent with the expectation that Huh7-hcvAS cells would
produce
only the antisense RNA of HCV genes. In a parallel experiment
(Fig.
2C,
right panel), HCV sense RNA was not detected in the
Huh7-hcvS cell line
by Northern dot blotting with antisense probes,
although HCV sense RNA
was detected in the cell line by strand-specific
RT-PCR (Fig.
2B).
Thus, Huh7-hcvS cells expressed small amounts
of sense RNA detectable
by RT-PCR but not by Northern dot blotting.
The most likely explanation
for this result is that the Huh7-hcvS
cell line is not a clonal
population, as was originally expected.
In Fig.
2C, the positive
control HCV sense RNA was efficiently
detected by the HCV antisense
riboprobes.
The expression of HCV RNAs in the cell lines was further examined by in
situ hybridization. Huh7-hcvAS, Huh7-hcvS, and control
Huh7 cells were
harvested and each loaded on positively charged
slides by cytospinning.
Figure
3 shows in situ hybridization
results
obtained with HCV antisense riboprobes (Fig.
3A and B) and HCV
sense riboprobes (Fig.
3C and D). The positive strand of HCV RNA
was
detected at low levels by antisense riboprobes in a subset
of Huh7-hcvS
cells (Fig.
3A) but not in Huh7 cells (Fig.
3B).
Similarly, the
negative strand of HCV RNA was appropriately detected
by sense
riboprobes in Huh7-hcvAS cells (Fig.
3C) but not in Huh7
cells (Fig.
3D). Importantly, sense and antisense riboprobes did
not detect signals
in Huh7-hcvS and Huh7-hcvAS cell lines, respectively
(data not shown).
The positive signals in Fig.
3A and C were located
outside the nuclei,
confirming that the signals resulted from
in situ detection of
cytoplasmic RNAs and not plasmid DNA. The
results in Fig.
3 demonstrate
(i) the establishment of positive
control cell lines for in situ
hybridization experiments, (ii)
the specificity of the riboprobes for
in situ experiments, and
(iii) higher sensitivity of the in situ
hybridization method than
of Northern dot blot analysis for detecting
HCV RNA transcripts.

View larger version (118K):
[in this window]
[in a new window]
|
FIG. 3.
In situ analysis of HCV genomic and
replicative-intermediate RNAs in cell lines with Dig-labeled
riboprobes. Cells in panels A and B were probed with HCV antisense
riboprobes, while cells in panels C and D were probed with HCV sense
riboprobes. (A) Huh7-hcvS cell lines, which express positive-strand
(i.e., genomic polarity) HCV RNA. (C) Huh7-hcvAS cell lines, which
express negative-strand (i.e. replicative-intermediate) HCV RNA. (B and
D) Control Huh7 cell lines. Nuclear methyl green stain was used;
magnifications, ×250 (A) and ×100 (B, C, and D). Arrows indicate the
positive signal for HCV RNA.
|
|
The cells expressing HCV antisense RNA (Huh7-hcvAS) appeared to be a
particularly homogeneous population, since approximately
90% (95 of
107, 92 of 102, and 82 of 92 cells) of HCV-hcvAS cells
showed a
positive signal by in situ hybridization. The variance
of signal
intensity among cells was negligible. Therefore, experiments
were
performed to determine the sensitivity of our in situ hybridization
assay. Total RNA was extracted from a known quantity of Huh7-hcvAS
cells, converted to cDNA, and analyzed by serial dilution end-point
PCR
as described previously (
12). The last specimen giving a
positive RT-PCR result was used to calculate the HCV RNA titer.
As a
control, human serum containing known quantities of HCV RNA
was spiked
into solubilized Huh7 cells; the viral RNA was extracted
and analyzed
by RT-PCR in a parallel experiment (Fig.
4). Using
this approach, we estimated
that Huh7-hcvAS cells contained, on
average, seven equivalent copies of
HCV RNA per cell.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Determination of the level of HCV RNA expressed in
Huh7-hcvAS cells. Total RNA was extracted from cells and a clinical
serum sample and then digested with DNase I prior to reverse
transcription in the presence of a mixture of hexamer
(pdN6) oligonucleotides. Serial 10-fold dilution of cDNA
was done before amplification with primers c256 and c186
(30). In the last four lanes, the reverse transcription step
was eliminated prior to PCR amplification under conditions identical to
those used for the first four lanes. PCR products were denatured and
hybridized with 32P-labeled internal primer c104 before
being applied to a 6% polyacrylamide gel.
|
|
In situ analysis of HCV genomic RNA in human liver tissue.
Given the high sensitivity of our current assay, the next objective was
to qualitatively assess HCV genomic RNAs in a panel of human liver
tissues obtained from patients with active HCV infections and explanted
liver tissues obtained from patients who had end-stage liver disease
and who underwent liver transplantation at the University of Washington
Medical Center (Table 2). Adjacent pieces
of biopsies or explanted liver were submitted for histological analysis
by hospital pathologists and also were tested for the presence of HCV
genomic RNA by a highly sensitive RT-PCR assay (12).
Altogether, 10 HCV RNA-negative biopsies, 6 HCV RNA-positive biopsies,
one HCV RNA-negative explanted liver, and two HCV RNA-positive explanted livers were tested by in situ hybridization for genomic HCV
RNA with antisense riboprobes and control riboprobes.
In all 19 cases, the qualitative results obtained for HCV genomic RNA
by in situ hybridization were in perfect concordance
with the RT-PCR
results. Each HCV-infected tissue (
n = 8) showed
a
positive signal with HCV antisense riboprobes, while each noninfected
tissue (
n = 11) was found negative by in situ
hybridization. Among
the HCV RNA-positive tissues, the percentage of
cells containing
genomic RNA ranged from 28 to 86%. Figure
5A illustrates the detection
of HCV
genomic RNA in a field of hepatocytes within cirrhotic
nodules after
staining with Vector red. Granular signals representing
HCV genomic RNA
showed a cytoplasmic localization. Overall, the
abundance of the signal
appeared to vary widely among cells, suggesting
that different cells
may harbor different quantities of viral
genomic RNA. Within cirrhotic
livers, the HCV genomic RNA signal
varied from one nodule to another.

View larger version (147K):
[in this window]
[in a new window]
|
FIG. 5.
In situ analysis of HCV-infected, explanted cirrhotic
liver tissue. (A, C, and E) HCV-infected liver tissue. (B, D, and F)
Noninfected (normal) liver tissue. (A and B) Hybridization with
antisense riboprobes. (C and D) Hybridization with sense riboprobes.
(E) Hybridization with hybridization solution free of riboprobes. (F)
Hybridization with human endogenous HPRT and beta-actin riboprobes.
Nuclear methyl green stain was used; magnification, ×250.
|
|
The fluorescent nature of the Vector red reaction product provides
increased sensitivity when fluorescence microscopes are
used. Figure
6A illustrates the detection of HCV
genomic RNA in
a cirrhotic liver viewed with a conventional Leitz
fluorescence
microscope with a rhodamine filter. The liver cells
produced dark
red autofluorescence, while the positive signal
produced bright
yellow fluorescence. As noted above, the HCV
genomic signal was
located primarily in the cytoplasm of hepatocytes,
and the signal
abundance varied from one nodule to another. However, no
clear
preferential localization within the hepatic lobule could be
discerned.
Most of the HCV genomic signal was located inside cirrhotic
nodules,
with some signal in fibroblasts and/or macrophages in the
surrounding
fibroconnective tissue. No convincing evidence for signal
in the
sinusoidal lining cells was identified, but this possibility
cannot
be excluded.

View larger version (140K):
[in this window]
[in a new window]
|
FIG. 6.
Fluorescent HCV genomic (A) and replicative-intermediate
(B) signals in cirrhotic nodules of one explanted cirrhotic liver.
Magnification, ~×62.
|
|
In situ analysis of HCV replicative-intermediate RNA in human liver
tissue.
The same 19 cases were analyzed for qualitative detection
of HCV replicative-intermediate RNA with sense riboprobes. Again, in
all 19 cases, the qualitative results obtained by in situ hybridization were in perfect concordance with the RT-PCR results. Figure 5C illustrates the detection of HCV replicative-intermediate RNA in a
cirrhotic liver by in situ hybridization. The percentage of cells
positive for replicative-intermediate RNA was uniformly lower than that
observed for genomic RNA (4 to 25% versus 28 to 86%, respectively).
Figure 6B shows the localization of the replicative-intermediate RNA
signal exclusively inside cirrhotic nodules, a pattern observed among
other cirrhotic nodules and other biopsies.
Relationship between HCV RNAs in serum and liver.
The
virological characteristics of HCV in serum and liver specimens
obtained during the same clinic visit are summarized in Table
3. In the five instances when serum
specimens were available, HCV RNA titers ranged from 8,000 equivalents
per ml to 500 million equivalents per ml. There was no relationship
between levels of viral RNA in serum and the percentage of hepatocytes
staining positive for either HCV genomic or HCV
replicative-intermediate RNA. Specimen A-1, for example, was obtained 3 months after liver transplantation for end-stage hepatitis C; the liver
specimen showed no specific pathological abnormality on examination
(Table 2). The patient serum contained an unusually low titer of HCV RNA (8,000 copies/ml), considering that the patient was
immunosuppressed. However, 73% of hepatocytes stained positive for HCV
genomic RNA by in situ hybridization. In contrast, only 6% of
hepatocytes stained positive for HCV replicative-intermediate RNA in
this case. Specimen A-2, obtained from the same patient 21 months
later, showed also no histological evidence of disease. However, the patient's serum contained an exceptionally high HCV load, 500 million
equivalents per ml. On in situ examination, 86 and 11% of hepatocytes
stained positive for HCV genomic and replicative-intermediate RNAs,
respectively. It is noteworthy that there was no association between
either the level of HCV genomic RNA in serum or the percentage of
hepatocytes staining positive for HCV genomic RNA and histopathologic indices of liver disease, although the sample size was too small to
allow us to make definite conclusions.
Specimens B-1 and B-2 were obtained from a second patient at 5 and 24 weeks after liver transplantation, respectively. Both
serum specimens
had high HCV RNA titers (100 million and 288 million
equivalents per
ml, respectively), and 28 to 31% of hepatocytes
stained positive for
HCV genomic RNA by in situ hybridization
(Table
3). The B-1 liver
biopsy specimen showed no histological
evidence of hepatitis, while the
B-2 specimen showed mild to moderate
hepatitis (Table
2). Of interest,
the percentage of cells staining
positive for HCV
replicative-intermediate RNA was increased threefold
in specimen B-2
compared to specimen B-1, and the serum HCV RNA
titer was increased to
the same degree. However, the percentage
of hepatocytes staining
positive for HCV genomic RNA did not change
appreciably in these
specimens.
Specimen C was obtained from a nontransplant patient with chronic
hepatitis C. The patient's serum HCV RNA titer was relatively
high for
a nontransplant patient (37 million equivalents per ml).
The liver
specimen from patient C showed a higher percentage of
cells staining
positive for HCV replicative-intermediate RNA than
any of the
posttransplant specimens (21 versus 4 to 12%, respectively),
a result
which may reflect a longer duration of disease in this
case. Similarly
high percentages of cells staining positive for
HCV
replicative-intermediate RNA were seen in specimens D and
E (21 and
25% of cells, respectively), both of which came from
cirrhotic livers
of patients with end-stage hepatitis
C.
The percentage of cells positive for HCV replicative-intermediate
RNA correlates with liver injury.
The relationship between the
percentage of hepatocytes staining positive for HCV RNA and indices of
liver disease is summarized in Fig. 7 and
8. Figure 7 illustrates a highly
significant correlation between the percentage of cells staining
positive for replicative-intermediate RNA and hepatic inflammatory
activity (
2, 26.82; P, < 0.0001). Specimens
with higher inflammation scores had a significantly higher percentage
of cells staining positive for HCV replicative-intermediate RNA than
specimens with lower inflammation scores (one-tailed P, < 0.0001). On the other hand, the percentage of cells staining positive
for HCV genomic RNA did not correlate with liver inflammation
(
2, 1.54; P, 0.21). The percentage of cells
staining positive for HCV replicative-intermediate RNA was also
significantly correlated with the histopathologic classification of
liver injury (Fig. 8A) (
2, 24.97; P, < 0.0001). Specimens from patients with cirrhosis had higher percentages
of positivity for replicative-intermediate RNA than specimens from
patients with minimal lesions. However, the percentage of cells
staining positive for HCV genomic RNA did not correlate with liver
injury (
2, 2.54; P, 0.111). Figure 8B
illustrates linear regression analysis of the significant relationship
between the ratio of percent positivity for replicative-intermediate
RNA/genomic RNA and liver injury (R2, 0.80;
P, 0.0065). In summary, the percentage of hepatocytes staining positive for HCV replicative-intermediate RNA but not HCV
genomic RNA showed significant correlation with indices of liver
disease.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 7.
Association between percentage of hepatocytes positive
for HCV genomic RNA or replicative-intermediate (RI) RNA and
inflammatory activity in seven liver specimens. The data were analyzed
by a chi-square test.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 8.
Percentage of hepatocytes positive for HCV RNA in
seven liver specimens and correlation with the status of liver injury.
(A) Correlation between percentage of cells positive for genomic or
replicative-intermediate (RI) RNA and the histopathologic assessment of
liver injury. (B) Linear regression model expressing the ratio of
percentage of replicative-intermediate RNA-positive cells to that of
genomic RNA-positive cells. Rsq, squared multiple correlation
coefficient.
|
|
 |
DISCUSSION |
Since the discovery of HCV over a decade ago, major progress has
been made in understanding this important viral infection. However, the
basic mechanisms of HCV pathogenesis remain to be elucidated, and two
schools of thought predominate. The "immunopathogenic" model argues
that the disease is largely mediated by host immune responses, while
the "pathogenic virus" model argues that HCV is capable of
cytopathic replication, in at least some instances. Studies which
assess HCV RNA in liver specimens have attempted to provide insight
into these two models; however, results to date have been conflicting,
possibly due to technical limitations and also because of variability
in the quality of liver biopsy specimens. The present study addressed
many limitations of in situ technology in the following manner. (i)
Sensitivity and specificity of riboprobes were well characterized, and
genotype-specific probes were used in all cases. To maximize
sensitivity, riboprobes incorporating the core and the E1 regions of
the HCV genome were used. The 5'UTR was not used for riboprobe
production because, although mostly conserved, it has been shown to
form a complex secondary structure such that some portions of the RNA
sequence hybridize with both positive- and negative-strand RNAs
(15, 35). (ii) Liver cell lines expressing HCV subgenomic
RNAs were used as controls. (iii) All tissues were snap-frozen at the
time of biopsy and were systematically evaluated for integrity of
endogenous mRNAs (beta-actin plus HPRT). Only high-quality tissues were
accepted for study. (iv) Negative control riboprobes were used in all
cases to evaluate and control for background staining. Rigorous
optimization of probe and hybridization parameters resulted in an assay
with exquisite sensitivity, calculated to be less than 10 HCV RNA
copies per cell, without any evidence of nonspecific staining in
negative control cell lines or noninfected human liver.
With the optimized in situ hybridization assay, HCV genomic and
replicative-intermediate RNAs were detected in 100% of liver tissue
specimens from infected patients versus 0% of specimens from
noninfected controls. A granular nature of the positive signal was seen
for either HCV RNA or endogenous cellular mRNAs (beta-actin and HPRT)
in both cell lines and native liver tissue. For HCV genomic RNA in
infected liver tissue, we noticed that some cells had a few dots of
signal while other cells had multiple dots aggregating to form complex
shapes. On the other hand, endogenous HPRT and beta-actin mRNAs
generated more consistent and diffuse patterns of positive signal and
varied less in abundance among the same types of cells. HCV genomic RNA
signal granules were located mostly in the cytoplasm of hepatocytes;
the abundance of the signal varied widely among different cells, in
agreement with previous reports (7-9). In the current
report, the percentage of hepatocytes positive for genomic RNA ranged
from 28 to 86%, while the percentage of hepatocytes positive for
replicative-intermediate RNA ranged from 4 to 25%. The range of
replicative-intermediate RNA signal abundance was more limited than
that of genomic RNA; however, the focal intensity of
replicative-intermediate RNA granules was equal to or even greater than
that of the genomic signal (data not shown). The signal distribution
patterns were quite distinct: HCV genomic RNA was distributed
throughout the entire tissue, including nonhepatic fibroconnective
tissue, while the HCV replicative-intermediate RNA was arranged in a
more restricted pattern resembling foci and was found only in
hepatocytes. To explain this phenomenon, we propose that HCV
replication occurs in a limited number of infected hepatocytes,
possibly due to local interference by endogenous antiviral mediators at
the molecular level.
Previous studies have provided conflicting results on the relationship
between HCV RNA in liver and indices of hepatocellular injury (1,
5, 9, 10, 18, 27, 36). In a recent study with a
well-characterized in situ hybridization assay, Agnello and colleagues
convincingly demonstrated that HCV RNA molecules are more widespread in
human liver than previously appreciated (1). In their study,
levels of HCV genomes and antigenomes were lowest in biopsies with
minimal disease activity. In this study, we also found low levels of
HCV antigenomes in biopsies with minimal lesions but found widespread
distribution of HCV genomes in the same biopsies. The cases with
minimal liver lesions differed from those in the study of Agnello et
al. in at least two ways: in our study, HCV infection of the liver was
relatively recent (during the first year posttransplant), and the
patients were immunosuppressed. However, it is noteworthy that in both studies, low levels of HCV antigenomes were associated with minimal histological lesions.
In this study, the finding that the percentage of cells staining
positive for HCV replicative-intermediate RNA (but not HCV genomic RNA)
correlated with hepatic inflammation and histopathologic assessment of
liver disease is novel, as it has not been previously reported. Using
strand-specific semiquantitative RT-PCR, Negro et al. concluded that
the amount of HCV replicative-intermediate RNA in infected liver is not
correlated with the degree of liver damage (24, 25). Our
study differs in that we used in situ hybridization to examine the
distribution of HCV RNAs in tissue. Preliminary results obtained with
computerized image analysis show that there is no significant
difference in the absolute amount of replicative-intermediate RNA per
100 hepatocytes analyzed among biopsies with various degrees of damage
(M. Chang et al., unpublished data). This information seems to agree
with the observation of Negro et al. that the measurement of
replicative-intermediate RNA is not a good predictor of liver injury.
However, our quantitative in situ method allows evaluation of the
percentage of positive cells as well as viral RNA signal abundance per
positive cell. In this study, we found that two parameters increased in
direct proportion to the degree of inflammatory activity: (i) the
percentage of hepatocytes harboring replicative-intermediate RNA and
(ii) the ratio of replicative-intermediate to genomic HCV RNA. These observations suggest that HCV-associated cytopathic damage and immune
system-mediated inflammatory activity in hepatocytes may be induced not
simply by the presence of virions but rather by the process of viral replication.
For the disease-free cases, in which we observed high levels of HCV
genomes but low levels of HCV antigenomes, it is reasonable to
speculate that the accumulation of nonreplicating HCV genomes may
represent some form of viral latency or inactivity in the infected
host. Such a model would help explain earlier reports that HCV genomic
RNA levels in liver do not correlate with liver injury (24, 25,
28). We and others have previously reported that the levels of
HCV nonstructural antigen in liver correlate with the degree of liver
injury (11, 14, 32, 36); such reports seem consistent with
our present findings and the hypothesis that active HCV replication in
the liver is important in the pathogenesis of hepatocellular injury.
In conclusion, the present study describes a reliable method for
high-sensitivity in situ detection of HCV genomic and
replicative-intermediate RNAs in liver tissue specimens. This method
provides a useful tool for investigating viral replicative functions in
the host liver and in model systems and has potential diagnostic value. We found a significant correlation between HCV replication and liver
injury which needs to be verified with a larger number of liver biopsy
specimens from diseased and nondiseased patients.
 |
ACKNOWLEDGMENTS |
We deeply appreciate Vaughn Fierke (Histology Laboratory,
University of Washington Medical Center) for preparing frozen sections of clinical samples and the advice of Shu-Kuang Lee (Department of
Biostatistics) on statistical analysis. We thank members of the Viral
Hepatitis Laboratory, Department of Laboratory Medicine, University of
Washington Medical Center, including Jean-Baptiste Nousbaum, for
critical review of the manuscript; Steve Polyak for assistance with
transfected cell lines; Dan Sullivan for providing the pCORE clone;
Minjun Chung, Maureen Guajardo, and Ka Wing Ng for technical
assistance; and Jane Ninh for assistance in manuscript preparation.
The work was supported in part by NIH grants AI 39049-03 and AI/OK
41320-02.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Viral Hepatitis
Laboratory, Department of Laboratory Medicine, University of Washington Medical Center, Annex Building, 1124 Columbia St., Room #B133, Seattle,
WA 98104. Phone: (206) 667-1635. Fax: (206) 667-1118. E-mail:
gretch{at}u.washington.edu.
Present address: Section of Hepatology, Rush-Presbyterian-St.
Luke's Medical Center, Chicago, IL 60612.
 |
REFERENCES |
| 1.
|
Agnello, V.,
G. Abel,
G. B. Knight, and E. Muchmore.
1998.
Detection of widespread hepatocyte infection in chronic hepatitis C.
Hepatology
28:573-584[CrossRef][Medline].
|
| 2.
|
Blight, K.,
R. Trowbridge,
R. Rowland, and E. Gowans.
1992.
Detection of hepatitis C virus RNA by in situ hybridization.
Liver
12:286-289[Medline].
|
| 3.
|
Boshart, M.,
F. Weber,
G. Jahn,
K. Dorsch Hasler,
B. Fleckenstein, and W. Schaffner.
1985.
A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus.
Cell
41:521-530[CrossRef][Medline].
|
| 4.
|
Bukh, J.,
R. H. Purcell, and R. H. Miller.
1993.
At least 12 genotypes of hepatitis C virus predicted by sequence analysis of the putative E1 gene of isolates collected worldwide.
Proc. Natl. Acad. Sci. USA
90:8234-8238[Abstract/Free Full Text].
|
| 5.
|
Choo, Q. L.,
K. H. Richman,
J. H. Han,
K. Berger,
C. Lee,
C. Dong,
C. Gallegos,
D. Coit,
R. Medina Selby,
P. J. Barr, et al.
1991.
Genetic organization and diversity of the hepatitis C virus.
Proc. Natl. Acad. Sci. USA
88:2451-2455[Abstract/Free Full Text].
|
| 6.
|
Cox, K. H.,
D. V. DeLeon,
L. M. Angerer, and R. C. Angerer.
1984.
Detection of mRNAs in sea urchin embryos by in situ hybridization using asymmetric RNA probes.
Dev. Biol.
101:485-502[CrossRef][Medline].
|
| 7.
|
Felgar, R. E.,
K. T. Montone, and E. E. Furth.
1996.
A rapid method for the detection of hepatitis C virus RNA by in situ hybridization.
Modern Pathol.
9:696-702[Medline].
|
| 8.
|
Gastaldi, M.,
A. Massacrier,
R. Planells,
A. Robaglia Schlupp,
I. Portal Bartolomei,
M. Bourliere,
F. Quilici,
J. Fiteni,
E. Mazzella, and P. Cau.
1995.
Detection by in situ hybridization of hepatitis C virus positive and negative RNA strands using digoxigenin-labeled cRNA probes in human liver cells.
J. Hepatol.
23:509-518[CrossRef][Medline].
|
| 9.
|
Gosalvez, J.,
E. Rodriguez Inigo,
J. L. Ramiro Diaz,
J. Bartolome,
J. F. Tomas,
H. Oliva, and V. Carreno.
1998.
Relative quantification and mapping of hepatitis C virus by in situ hybridization and digital image analysis.
Hepatology
27:1428-1434[CrossRef][Medline].
|
| 10.
|
Gretch, D. R.
1997.
Diagnostic tests for hepatitis C.
Hepatology
26:S43-S47[CrossRef].
|
| 11.
|
Gretch, D. R.,
C. E. Bacchi,
L. Corey,
C. dela Rosa,
R. R. Lesniewski,
K. Kowdley,
A. Gown,
I. Frank,
J. D. Perkins, and R. L. Carithers, Jr.
1995.
Persistent hepatitis C virus infection after liver transplantation: clinical and virological features.
Hepatology
22:1-9[CrossRef][Medline].
|
| 12.
|
Gretch, D. R.,
J. J. Wilson,
R. L. Carithers, Jr.,
C. de la Rosa,
J. H. Han, and L. Corey.
1993.
Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.
J. Clin. Microbiol.
31:289-291[Abstract/Free Full Text].
|
| 13.
|
Haruna, Y.,
N. Hayashi,
N. Hiramatsu,
T. Takehara,
H. Hagiwara,
Y. Sasaki,
A. Kasahara,
H. Fusamoto, and T. Kamada.
1993.
Detection of hepatitis C virus RNA in liver tissues by an in situ hybridization technique.
J. Hepatol.
18:96-100[CrossRef][Medline].
|
| 14.
|
Hiramatsu, N.,
N. Hayashi,
Y. Haruna,
A. Kasahara,
H. Fusamoto,
C. Mori,
I. Fuke,
H. Okayama, and T. Kamada.
1992.
Immunohistochemical detection of hepatitis C virus-infected hepatocytes in chronic liver disease with monoclonal antibodies to core, envelope and NS3 regions of the hepatitis C virus genome.
Hepatology
16:306-311[Medline].
|
| 15.
|
Honda, M.,
M. R. Beard,
L. H. Ping, and S. M. Lemon.
1999.
A phylogenetically conserved stem-loop structure at the 5' border of the internal ribosome entry site of hepatitis C virus is required for cap-independent viral translation.
J. Virol.
73:1165-1174[Abstract/Free Full Text].
|
| 16.
|
Knodell, R. G.,
K. G. Ishak,
W. C. Black,
T. S. Chen,
R. Craig,
N. Kaplowitz,
T. W. Kiernan, and J. Wollman.
1981.
Formulation and application of a numerical scoring system for assessing histological activity in asymptomatic chronic active hepatitis.
Hepatology
1:431-435[Medline].
|
| 17.
|
Komminoth, P.,
V. Adams,
A. A. Long,
J. Roth,
P. Saremaslani,
R. Flury,
M. Schmid, and P. U. Heitz.
1994.
Evaluation of methods for hepatitis C virus detection in archival liver biopsies. Comparison of histology, immunohistochemistry, in-situ hybridization, reverse transcriptase polymerase chain reaction (RT-PCR) and in-situ RT-PCR.
Pathol. Res. Pract.
190:1017-1025[Medline].
|
| 18.
|
Lamas, E.,
P. Baccarini,
C. Housset,
D. Kremsdorf, and C. Bréchot.
1992.
Detection of hepatitis C virus (HCV) RNA sequences in liver tissue by in situ hybridization.
J. Hepatol.
16:219-223[CrossRef][Medline].
|
| 19.
|
Lanford, R. E.,
D. Chavez,
F. V. Chisari, and C. Sureau.
1995.
Lack of detection of negative-strand hepatitis C virus RNA in peripheral blood mononuclear cells and other extrahepatic tissues by the highly strand-specific rTth reverse transcriptase PCR.
J. Virol.
69:8079-8083[Abstract].
|
| 20.
|
Lanford, R. E.,
C. Sureau,
J. R. Jacob,
R. White, and T. R. Fuerst.
1994.
Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR.
Virology
202:606-614[CrossRef][Medline].
|
| 21.
|
Lau, G. K.,
J. W. Fang,
P. C. Wu,
G. L. Davis, and J. Y. Lau.
1994.
Detection of hepatitis C virus genome in formalin-fixed paraffin-embedded liver tissue by in situ reverse transcription polymerase chain reaction.
J. Med. Virol.
44:406-409[Medline].
|
| 22.
|
Lau, J. Y., and G. L. Davis.
1994.
Detection of hepatitis C virus RNA genome in liver tissue by nonisotopic in situ hybridization.
J. Med. Virol.
42:268-271[Medline].
|
| 23.
|
Lau, J. Y.,
K. Krawczynski,
F. Negro, and R. P. González Peralta.
1996.
In situ detection of hepatitis C virus a critical appraisal.
J. Hepatol.
24:43-51[CrossRef][Medline].
|
| 24.
|
Negro, F.,
E. Giostra,
K. Krawczynski,
R. Quadri,
L. Rubbia-Brandt,
G. Mentha,
G. Colucci,
L. Perrin, and A. Hadengue.
1998.
Detection of intrahepatic hepatitis C virus replication by strand-specific semiquantitative RT-PCR: preliminary application to the liver transplantation model.
J. Hepatol.
29:1-11[CrossRef][Medline].
|
| 25.
|
Negro, F.,
K. Krawczynski,
R. Quadri,
L. Rubbia-Brandt,
M. Mondelli,
J. P. Zarski, and A. Hadengue.
1999.
Detection of genomic- and minus-strand of hepatitis C virus RNA in the liver of chronic hepatitis C patients by strand-specific semiquantitative reverse-transcriptase polymerase chain reaction.
Hepatology
29:536-542[CrossRef][Medline].
|
| 26.
|
Negro, F.,
D. Pacchioni,
Y. Shimizu,
R. H. Miller,
G. Bussolati,
R. H. Purcell, and F. Bonino.
1992.
Detection of intrahepatic replication of hepatitis C virus RNA by in situ hybridization and comparison with histopathology.
Proc. Natl. Acad. Sci. USA
89:2247-2251[Abstract/Free Full Text].
|
| 27.
|
Ng, S. Y.,
P. Gunning,
R. Eddy,
P. Ponte,
J. Leavitt,
T. Shows, and L. Kedes.
1985.
Evolution of the functional human beta-actin gene and its multipseudogene family: conservation of noncoding regions and chromosomal dispersion of pseudogenes.
Mol. Cell. Biol.
5:2720-2732[Abstract/Free Full Text].
|
| 28.
|
Nouri Aria, K. T.,
R. Sallie,
D. Sangar,
G. J. Alexander,
H. Smith,
J. Byrne,
B. Portmann,
A. L. Eddleston, and R. Williams.
1993.
Detection of genomic and intermediate replicative strands of hepatitis C virus in liver tissue by in situ hybridization.
J. Clin. Investig.
91:2226-2234.
|
| 29.
|
Nuovo, G. J.,
K. Lidonnici,
P. MacConnell, and B. Lane.
1993.
Intracellular localization of polymerase chain reaction (PCR)-amplified hepatitis C cDNA.
Am. J. Surg. Pathol.
17:683-690[CrossRef][Medline].
|
| 30.
|
Okamoto, H.,
Y. Sugiyama,
S. Okada,
K. Kurai,
Y. Akahane,
Y. Sugai,
T. Tanaka,
K. Sato,
F. Tsuda,
Y. Miyakawa, et al.
1992.
Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources.
J. Gen. Virol.
73:673-679[Abstract/Free Full Text].
|
| 31.
|
Saito, K.,
D. Sullivan,
Y. Haruna,
N. D. Theise,
S. N. Thung, and M. A. Gerber.
1997.
Detection of hepatitis C virus RNA sequences in hepatocellular carcinoma and its precursors by microdissection polymerase chain reaction.
Arch. Pathol. Lab. Med.
121:400-403[Medline].
|
| 32.
|
Sansonno, D.,
V. Cornacchiulo,
A. R. Iacobelli,
P. Gatti,
M. Di Stasi, and F. Dammacco.
1995.
Demonstration and distribution of HCV RNA sequences by in situ hybridization and HCV-related proteins by immunohistochemistry in the liver tissue of patients with chronic HCV infection.
Pathobiology
63:239-248[Medline].
|
| 33.
|
Sansonno, D.,
V. Cornacchiulo,
V. Racanelli, and F. Dammacco.
1997.
In situ simultaneous detection of hepatitis C virus RNA and hepatitis C virus-related antigens in hepatocellular carcinoma.
Cancer
80:22-33[CrossRef][Medline].
|
| 34.
|
Tanaka, Y.,
N. Enomoto,
S. Kojima,
L. Tang,
M. Goto,
F. Marumo, and C. Sato.
1993.
Detection of hepatitis C virus RNA in the liver by in situ hybridization.
Liver
13:203-208[Medline].
|
| 35.
|
Tang, S.,
A. J. Collier, and R. M. Elliott.
1999.
Alterations to both the primary and predicted secondary structure of stem-loop IIIc of the hepatitis C virus 1b 5' untranslated region (5'UTR) lead to mutants severely defective in translation which cannot be complemented in trans by the wild-type 5'UTR sequence.
J. Virol.
73:2359-2364[Abstract/Free Full Text].
|
| 36.
|
Tsutsumi, M.,
S. Urashima,
A. Takada,
T. Date, and Y. Tanaka.
1994.
Detection of antigens related to hepatitis C virus RNA encoding the NS5 region in the livers of patients with chronic type C hepatitis.
Hepatology
19:265-272[CrossRef][Medline].
|
| 37.
|
Van Voorhis, W. C.,
L. K. Barrett,
Y. T. Sweeney,
C. C. Kuo, and D. L. Patton.
1997.
Repeated Chlamydia trachomatis infection of Macaca nemestrina fallopian tubes produces a Th1-like cytokine response associated with fibrosis and scarring.
Infect. Immun.
65:2175-2182[Abstract].
|
| 38.
|
Yoo, B. J.,
M. J. Selby,
J. Choe,
B. S. Suh,
S. H. Choi,
J. S. Joh,
G. J. Nuovo,
H. S. Lee,
M. Houghton, and J. H. Han.
1995.
Transfection of a differentiated human hepatoma cell line (Huh7) with in vitro-transcribed hepatitis C virus (HCV) RNA and establishment of a long-term culture persistently infected with HCV.
J. Virol.
69:32-38[Abstract].
|
Journal of Virology, January 2000, p. 944-955, Vol. 74, No. 2
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lazaro, C. A., Chang, M., Tang, W., Campbell, J., Sullivan, D. G., Gretch, D. R., Corey, L., Coombs, R. W., Fausto, N.
(2007). Hepatitis C Virus Replication in Transfected and Serum-Infected Cultured Human Fetal Hepatocytes. Am. J. Pathol.
170: 478-489
[Abstract]
[Full Text]
-
Pal, S., Shuhart, M. C., Thomassen, L., Emerson, S. S., Su, T., Feuerborn, N., Kae, J., Gretch, D. R.
(2006). Intrahepatic Hepatitis C Virus Replication Correlates with Chronic Hepatitis C Disease Severity In Vivo. J. Virol.
80: 2280-2290
[Abstract]
[Full Text]
-
Moneke, E., Groman, D. B., Wright, G. M., Stryhn, H., Johnson, G. R., Ikede, B. O., Kibenge, F. S. B.
(2005). Correlation of Virus Replication in Tissues with Histologic Lesions in Atlantic Salmon Experimentally Infected with Infectious Salmon Anemia Virus. Vet Pathol
42: 338-349
[Abstract]
[Full Text]
-
Chang, M., Williams, O., Mittler, J., Quintanilla, A., Carithers, R. L. Jr., Perkins, J., Corey, L., Gretch, D. R.
(2003). Dynamics of Hepatitis C Virus Replication in Human Liver. Am. J. Pathol.
163: 433-444
[Abstract]
[Full Text]
-
Authier, F.-J., Bassez, G., Payan, C., Guillevin, L., Pawlotsky, J.-M., Degos, J.-D., Gherardi, R. K., Belec, L.
(2003). Detection of genomic viral RNA in nerve and muscle of patients with HCV neuropathy. Neurology
60: 808-812
[Abstract]
[Full Text]