Previous Article | Next Article 
Journal of Virology, January 2000, p. 934-943, Vol. 74, No. 2
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Potential Role for Luman, the Cellular Homologue of
Herpes Simplex Virus VP16 (
Gene trans-Inducing
Factor), in Herpesvirus Latency
Rui
Lu
and
Vikram
Misra*
Department of Veterinary Microbiology,
Western College of Veterinary Medicine, University of Saskatchewan,
Saskatoon, Saskatchewan S7N 5B4, Canada
Received 26 July 1999/Accepted 7 October 1999
 |
ABSTRACT |
The cascade of herpes simplex virus (HSV) gene expression that
results in viral replication begins with the activation of viral
immediate-early (IE) genes by the virion-associated protein VP16. VP16
on its own is inefficient at associating with complexes formed on IE
gene promoters and depends upon the cellular factor HCF for its
activity. In this respect VP16 mimics the host basic leucine zipper
(bZIP) protein Luman, which also requires HCF for activating
transcription. Our objective is to explore interactions between Luman
and HCF and to determine if they play a role in the biology of
herpesviruses. In this report we show that in cultured cells
ectopically expressed Luman was retained in the cytoplasm, where it
colocalized with Calnexin, a protein normally associated with the
endoplasmic reticulum (ER). Retention of Luman in the ER depends on a
hydrophobic segment of the protein that probably serves as a
transmembrane domain. Deletion of this domain changed the intracellular
location of Luman so that most of the mutant protein was in the nucleus
of cells. While HCF was present in the nucleus of most cells, in cells
expressing Luman it was retained in the cytoplasm where the two
proteins colocalized. This cytoplasmic association of Luman and HCF
could also be demonstrated in neurons in trigeminal ganglia removed
from cattle soon after death. Cells in tissue culture that expressed
Luman, but not a mutant form of the protein that fails to bind HCF,
were resistant to a productive infection with HSV type 1 (HSV-1). We
hypothesize that similar Luman-HCF interactions in sensory neurons in
trigeminal ganglia result in the suppression of viral replication and
the establishment of latency. Interestingly, Luman could activate the
promoters of IE110 and LAT, two genes that are critical for
reactivation of HSV-1 from latency. This suggests a role for Luman in
the reactivation process as well.
 |
INTRODUCTION |
Infection for the first time with an
alphaherpesvirus leads to active replication of the virus in epithelial
cells at the portal of entry. The virus spreads to adjoining cells but
also enters the termini of sensory nerves, innervating the site of replication. It is then transported along axons to neuronal cell bodies
in sensory ganglia, where it establishes a latent infection. The virus
is relatively quiescent during the latent state but is reactivated
periodically to replicate and move back down the axons to reinfect
epithelial surfaces (reviewed in reference 42).
Herpes simplex virus type 1 (HSV-1) and Bovine
herpesvirus type 1 (BHV-1) are alphaherpesviruses that usually
cause primary infections in epithelia of the oropharynx and face. The
main sites of latency for these viruses are neurons in the trigeminal
ganglia (recently reviewed by Jones [18]). During
latent infections by HSV-1 and BHV-1, transcripts arising from only a
small portion of the viral genomes (LAT or LRG, respectively) can be
detected in neurons. The exact role of these transcripts in the
establishment of the latent infection and in reactivation from it is
unclear. However, evidence suggests that the transcripts themselves or products derived from them are required for the efficient establishment and maintenance of the latent state (7, 9, 12, 45). Paradoxically, these transcripts also appear to play a role in reactivation from latency (3, 4, 10, 17, 38, 39).
In contrast to the latent state, productive infection in epithelial
cells by HSV-1 (reviewed in reference 43) and BHV-1 (31) leads to the expression of large number of viral
regulatory, enzymatic, and structural proteins. The genes for these
proteins are expressed in a regulated cascade, and most genes can be
categorized as immediate-early (IE or
), early (E or
), or late
(L or
), depending on the order of their expression during
infection. This cascade is initiated when the expression of IE genes is
activated by a viral protein brought into the cell as a component of
the infecting virion. This protein, VP16 or
gene
trans-inducing factor (
TIF), recognizes
cis-acting response elements, the octamer-GARAT and
TAATGARAT (R is a purine) sequences, in promoters of IE
genes (32, 35, 40, 51). Unlike other transcription
activators, VP16 does not directly contact its response element but
binds to the cellular protein Oct-1 attached to the octamer or TAAT portion of the element (1, 13, 23, 29, 30, 35, 41, 47).
Another host protein, HCF, is required for this interaction (13,
19, 56). It is not known why the viruses have evolved to rely on
these cellular factors for the initiation of their replicative cycles.
Several studies (16, 21, 50) indicate that the ordered
cascade of gene expression seen in infected cultured cells does not
accompany the reactivation of latent virus. However, the HSV-1 IE
protein IE110 (ICP0) may have a specialized role in the reactivation from latent infections. Viruses containing deletions in the gene are
impaired in their ability to reactivate from latent infections (25, 48). In addition, in a tissue culture model of latency exogenously supplied IE110 but not another IE protein could induce latent virus to reactivate (44). Since VP16 is not detected in latently infected neurons and is not required for reactivation (46), it is assumed that the expression of IE110 is induced during reactivation by neuronal factors.
The human HCF proteins are derived by the posttranslational processing
of a single large precursor (22, 53). The gene for HCF is
conserved in a wide variety of metazoan species and, although HCF was
initially defined by its role in VP16-Oct1-TAATGARAT complex
formation, its ubiquitous nature suggests that it plays a fundamental
role in the cellular biology of the metazoa. When cells with a
temperature-sensitive mutation in HCF are grown at elevated
temperatures, they arrest in the G1/G0 phase of
the cell cycle (15). HCF is therefore thought to regulate
some aspect of cell replication. However, its role in this process, or
other cellular processes, is not known.
Recently, Kristie and coworkers reported that while HCF is located in
the nucleus of most cells, it is sequestered in the cytoplasm of
neurons of trigeminal ganglia (24). Death of the animal or
stimuli that trigger the reactivation of latent herpesviruses leads to
the movement of the protein to the neuronal nuclei. These observations
suggest that the regulated translocation of HCF to the nucleus may
trigger the reactivation of alphaherpesviruses from their latent state.
To determine the role of HCF in normal cellular physiology and in
herpesvirus gene expression, we and others have identified a cellular
protein which, like VP16, interacts with HCF. This protein, called
Luman (27) or L-ZIP (11), is a basic leucine zipper (bZIP) containing transcription activator. In
transient-expression assays Luman can activate expression of genes
linked to cyclic AMP response elements (CRE). It can also bind these
elements in vitro. Luman shares with VP16 the HCF binding motif
D/EHXYS/A and activation of CRE-containing promoters by Luman requires
binding to HCF through this motif (11, 28).
This report describes interactions between HCF and Luman. We show that
in cultured cells ectopically expressed Luman is retained in the
cytoplasm, where it colocalizes with Calnexin, a protein normally
associated with the endoplasmic reticulum (ER) (37, 52).
Retention of Luman in the ER depends on a hydrophobic segment of the
protein that probably serves as a transmembrane domain. Deletion of
this domain changed the intracellular location of Luman so that most of
the mutant protein was in the nuclei of cells. While HCF was present in
the nuclei of most cells, in cells expressing Luman it was retained in
the cytoplasm. This cytoplasmic association of Luman and HCF could also
be demonstrated in neurons in trigeminal ganglia removed from cattle
soon after death. Cells in tissue culture that expressed Luman were
resistant to a productive infection with HSV-1, presumably because of
insufficient HCF in the nucleus to allow for efficient IE gene
expression. We hypothesize that similar Luman-HCF interactions in
sensory neurons in trigeminal ganglia result in the suppression of
viral replication and the establishment of latency. Interestingly,
Luman could activate the promoters of the IE110 and LAT genes,
suggesting a role for Luman in the reactivation process as well.
 |
MATERIALS AND METHODS |
Materials.
All restriction endonucleases, other
DNA-modifying enzymes, media for tissue culture, and other reagents
(unless stated otherwise) were purchased from Canadian Life Technologies.
Plasmids.
The construction of pcLuman and pGEXLuman
(27), pcLuman(1-220) and pcLuman(Y81A) (28),
pAB2 (36), and pAB-167 (33), as well as that of
pBB8 and pBB15 (2), have been described. pcLuman contains
the coding sequence of Luman, as well as an amino-terminal FLAG epitope
cloned into the mammalian expression vector pcDNA3 (Invitrogen).
pcLuman(1-220) and pcLuman(Y81A) are similar to pcLuman except that
pcLuman(1-220) contains only the first 220 amino acids of Luman
followed by a termination codon. In pcLuman(Y81A) tyrosine 81, a
critical residue in the HCF binding domain of Luman, has been changed
to alanine. pGEXLuman contains the coding sequences of Luman linked to
the sequences for glutathione S-transferase (GST). Plasmid
AB2 contains the promoter sequences of the HSV IE110 gene that lie
downstream from the last octamer-GARAT motif linked to the coding
sequences of chloramphenicol acetyltransferase (CAT). In pAB2-167 the
octamer-GARAT at position
167 in the IE110 promoter has been added to
the minimal IE110 promoter of pAB2. The plasmids BB8 and BB15 were
obtained from Peter O'Hare. Plasmid BB8 contains 608 bp of DNA
upstream from the start of transcription of the HSV-1
latency-associated transcript (LAT), while pBB15 contains 143 bp of
this sequence.
In pAB2-CRE1 we changed the putative CRE, AATCGTCA, to
AATCGaCt (lowercase letters represent differences from the
wild-type sequence) by using the QuickChange site-directed mutagenesis
kit (Stratagene). The two complementary oligonucleotides used for the
mutagenesis were ATTGGGGGAATCGaCtCTGCCGCCCTT and
AAGGGGCGGCAGaGtCGATTCCCCCAAT. Similarly, the complementary
oligonucleotides ACCAGCAGCAGCAGCATGTACTCCTCTGAC and
GTCAGAGGAGTACATGCTGCTGCTGCTGGT were used to delete the
putative transmembrane domain of Luman in pcLuman. The resulting
plasmid was called pcLuman
Tm.
Antibodies.
The fusion protein GST-Luman was produced in
Escherichia coli BL21(DE3) (Novagen) and purified by using
glutathione-Sepharose beads (Pharmacia) as described previously
(32). Antibodies were produced at the University of
Saskatchewan Animal Resources Centre by immunizing rabbits with about
150 µg of protein in Freund's complete adjuvant. Two weeks after
primary immunization the rabbits were given booster injections of 150 µg of protein in Freund's incomplete adjuvant. They were bled for
serum 2 weeks later. Control serum samples were obtained from the
rabbits before immunization. The animals were treated in accordance
with protocols approved by the University of Saskatchewan Animal Care
Committee. The anti-Luman serum specifically detects Luman in Western
blots of in vitro-synthesized Luman (TnT; Promega) and lysates of
transfected mammalian cells.
Rabbit polyclonal antibodies against HCF were obtained from Winship
Herr (Cold Spring Harbor Laboratories), and monoclonal
antibodies
against HSV-1 gC were from Lenore Pereira (University
of California,
San Francisco). Mouse monoclonal antibodies against
the FLAG epitope
were purchased from the Sigma Chemical Co., and
rabbit antibody against
the carboxyl terminus of canine Calnexin
was purchased from StressGen
Biotechnologies
Corp.
Transfection and immunofluorescence.
HeLa or COS7 cells were
grown and transfected as described before (6). For
immunofluorescence, cells were grown on circular 18-mm-diameter
micro-cover glasses (VWR Scientific) in six-well Falcon tissue culture
plates (Becton Dickinson). At 40 h after transfection the cover
glasses were rinsed once with phosphate-buffered saline (PBS), and the
cells were fixed for 20 min in methanol kept at
20°C. The cells
were then kept for 20 min in blocking solution (PBS containing 10%
newborn calf serum). The cells were incubated for 20 min with primary
antibodies appropriately diluted in blocking solution, washed three
times in PBS and once in blocking solution, and then incubated with
diluted goat anti-rabbit or anti-mouse antibodies tagged with either
Alexa488 or Alexa546 (Molecular Probes, Inc.)
for 20 min. After being washed as described above, the cover glasses
were mounted on glass slides over PBS containing 20% glycerol and
sealed with clear nail polish.
The slides were observed by using a Zeiss Axioskop microscope equipped
for epifluorescence and the appropriate filters. Images
were captured
by using Northern Eclipse image analysis software
(Empix Imaging,
Inc.). Figures for this report were prepared by
using Adobe Illustrator
7.0 and Adobe Photoshop 4.0 (Adobe Systems,
Inc.).
Assays for CAT were performed by using an enzyme-linked immunosorbent
assay kit (Boehringer Manneheim) as recommended by the
manufacturer.
Trigeminal ganglia.
Trigeminal ganglia were scavenged from
cattle euthanized because of terminal illness at the Veterinary
Teaching Hospital, Western College of Veterinary Medicine, or at the
Veterinary Infectious Diseases Organization. Ganglia were removed,
trimmed, embedded in O.C.T. Compound (Tissue-Tek), and frozen
immediately in liquid nitrogen. Sections (6 µm) were cut on a Micron
cryostat and fixed in methanol. The sections were either stained with
hematoxylin and eosin by using routine procedures or were processed for
immunofluorescence as outlined above for cells grown on cover glasses.
 |
RESULTS |
Location of Luman in cells transiently expressing the protein.
To determine the location of Luman in cells, we transfected HeLa cells
with pcLuman, a mammalian expression vector containing the coding
sequences for Luman, linked to the FLAG epitope. Transfected cells were
then probed with mouse anti-FLAG antibodies, rabbit anti-Luman
antibodies, or a combination of the two antibodies. Bound antibodies
were visualized with the appropriate fluorescence (Alexa)-labelled
anti-mouse or anti-rabbit antibodies. In a transfected culture ca. 5 to
10% of the cells showed bright fluorescence with either antibody.
Cells transfected with a control plasmid or Luman expressing cells
stained with control serum showed no fluorescence (not shown).
Transfected cultures contained cells that displayed a range of
fluorescence intensity presumably reflecting differences in
the amount
of Luman expressed. In all cells in which Luman was
visible, most of
the fluorescence was located in the cytoplasm
in a "feathery"
pattern (Fig.
1A). Occasionally, we saw
more-intense
staining in small structures located just outside the
nucleus.
The pattern of staining was the same when either anti-Luman or
anti-FLAG antibodies were used. When the antibodies were used
simultaneously, with anti-mouse Alexa
488 and anti-rabbit
Alexa
546,
the pattern of red and green fluorescence was
completely superimposed
(not shown). This established that the
anti-Luman antibody was
specific for Luman. It also suggested that
although Luman had
originally been obtained from a HeLa cDNA library
(
27), these
cells contain little endogenous Luman protein.

View larger version (82K):
[in this window]
[in a new window]
|
FIG. 1.
Location of Luman and Calnexin in transfected cells.
HeLa cells were transfected with either pcLuman (A and B) or
pcLuman Tm (C and D). Cells were stained 48 h later with a
mixture of anti-FLAG monoclonal antibodies which recognize FLAG-tagged
Luman and rabbit anti-Calnexin antibodies, followed by a mixture of
Alexa488-tagged anti-rabbit and Alexa546-tagged
anti-mouse antibodies. The cells were visualized in a fluorescent
microscope by using either a 546-nm (A and C) or a 450- to 490-nm (B
and D) filter.
|
|
The pattern of staining for Luman suggested that the protein was
located in the endoplasmic reticulum (ER) and Golgi apparatus.
To
confirm this, transfected cells were probed simultaneously
with mouse
monoclonal anti-FLAG antibodies and rabbit polyclonal
antibodies
against Calnexin, an ER transmembrane protein (
37).
The
anti-Calnexin bound to cytoplasmic structures in all cells
(Fig.
1B and
D) and in some cells we also saw intense staining
of structures which
are probably the Golgi apparatus. In cells
expressing Luman the pattern
of anti-Luman and anti-Calnexin staining
could be superimposed (Fig.
1A
and B). These results suggest that
Luman is posttranslationally trapped
in the ER and
Golgi.
To determine if Luman contains potential transmembrane domains that may
anchor it in the ER, we analyzed the primary structure
of Luman by
using TmPRED (K. Hofmann and W. Stoffel,
http://www.ch.embnet.org/software/TmPRED-form.html)
and PSORTII
(K. Nakai and P. Horton,
http://cookie.imcb.osaka-u.ac.jp/nakai/psort.html).
Both programs
detected a stretch of 15 hydrophobic amino acids
that could serve as a
transmembrane domain (Fig.
2). This
putative
transmembrane (Tm) domain lies downstream from all of the
characterized
functional domains of Luman, including those responsible
for transcription
activation, HCF binding, DNA binding, and protein
dimerization
(
27,
28). To determine if deletion of the
domain would change
the location of Luman, we transfected cells with a
plasmid coding
for Luman in which amino acids 229 to 243, which make up
the putative
domain, had been deleted (Luman

Tm, Fig.
2). The cells
were then
stained for Luman (Fig.
1C) as well as for Calnexin (Fig.
1D).
In contrast to cells expressing full-length Luman (Fig.
1A), where
most of the protein was associated with cytoplasmic structures,
in
cells expressing Luman

Tm the protein was present largely
in the
nucleus (Fig.
1C). In these cells Luman and Calnexin did
not colocalize
(Fig.
1C and D). The latter was located only in
the cytoplasm. In cells
transfected with a plasmid expressing
a mutant of Luman truncated just
before the putative Tm domain
(Luman 1-220), the protein was also
located in the nucleus (not
shown). However, in these cells relatively
little Luman was present,
suggesting that the truncated protein was
unstable.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Putative transmembrane domain of Luman. The top figure
shows the results of TmPRED analysis of the amino acid sequence of
Luman. Portions of the protein with positive values (above the dotted
line) have the potential of forming transmembrane domains. The portion
of the Luman protein, residues 229 to 245, that display a high
probability of forming a Tm domain are shown. The bottom figure is a
schematic diagram of Luman and the Tm and 1-220 mutants showing
their functional domains. Domains: a, activation; h, HCF binding; l,
DNA binding; l, dimerization (leucine zipper); t, putative
transmembrane.
|
|
Luman retains HCF in the cytoplasm.
We have shown that like
HSV-1 VP16, Luman binds strongly to HCF (28). Both proteins,
as well as their other viral and cellular homologues, have a common
motif, D/EHXYS/A, for binding HCF. Mutations in the conserved residues
of this motif reduce HCF binding both in vitro and in vivo.
HCF is normally located in the nucleus of cells. To see if Luman
anchored in the ER could alter the location of HCF, we simultaneously
probed cells transfected with pcLuman with antibodies against
HCF and
the FLAG epitope. As expected, in cells not expressing
Luman, HCF was
located almost exclusively in the nucleus (Fig.
3B). However, in cells expressing Luman,
HCF appeared to be retained
in the cytoplasm with Luman (Fig.
3A and
B). This retention of
HCF by Luman was dependent on a functional HCF
binding domain
since Luman with a mutation in its HCF binding domain
(Y81A) could
not alter the nuclear localization of HCF (Fig.
3C and D).
In
these cells the mutant Luman remained in the cytoplasm but most
of
the HCF was nuclear.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 3.
Location of Luman and HCF in transfected cells. HeLa
cells were transfected with either pcLuman (A and B) or pcLuman(Y81A)
(C and D). Cells were stained 48 h later with a mixture of
anti-FLAG monoclonal antibodies which recognize FLAG-tagged Luman and
rabbit anti-HCF, followed by a mixture of Alexa488-tagged
anti-rabbit and Alexa546-tagged anti-mouse antibodies. The
cells were visualized in a fluorescent microscope by using either a
546-nm (A and C) or a 450- to 490-nm (B and D) filter.
|
|
Recently, Kristie et al. reported that while HCF is detected in the
nucleus of most cells, it is located in the cytoplasm
of neurons in the
trigeminal ganglia of mice (
24). Stimuli that
reactivate
latent HSV in the mouse model or postmortem changes
caused the protein
to move to the nucleus. To determine if Luman
might be responsible for
retaining HCF in the cytoplasm of neurons,
we examined bovine
trigeminal ganglia for the two proteins. Ganglia
were scavenged from
cattle submitted for postmortem examination
after euthanasia. The
ganglia were removed as soon as possible
after death and frozen in
liquid
nitrogen.
Since antibodies against both Luman and HCF had been produced in
rabbits, we were unable to probe individual sections of ganglia
for
both proteins. We did, however, examine consecutive 6-µm sections
and
were able to find the corresponding field in the sections
(Fig.
4).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Location of Luman and HCF in trigeminal ganglia.
Trigeminal ganglia were removed from a cow within 30 min of death,
embedded, and frozen in liquid nitrogen. Consecutive 6-µm sections
were either stained with hematoxylin-eosin (A) or for Luman (B) or HCF
(C). Rabbit anti-Luman antibodies and Alexa546-tagged
anti-rabbit antibodies were used to visualize Luman, while rabbit
anti-HCF and Alexa488-tagged anti-rabbit antibodies were
used to visualize HCF. Corresponding fields from the three sections
were located and photographed by using the appropriate filters.
|
|
In the ganglia removed from adult animals within 30 min of death, we
found that about a third to half of the neuronal cell
bodies showed
bright cytoplasmic fluorescence when stained for
Luman. The pattern of
staining was punctate and ranged from the
entire visible cytoplasm
(large arrow, Fig.
4B) to just the periphery
of the cell (small arrow,
Fig.
4B). When the adjacent section
was probed for HCF, we saw that in
every cell that stained for
Luman, HCF could be detected in the
cytoplasm as well (Fig.
4C).
In these cells the pattern of cytoplasmic
staining for Luman and
HCF was the same. In addition, HCF could also be
seen in neuronal
nuclei, as well as the nuclei of accessory cells. When
the removal
of ganglia was delayed beyond 30 min, fewer cells were
found to
stain for Luman, and in almost all cases the staining was
restricted
to the periphery of the cell body. However, in all cells
staining
for Luman, HCF showed a similar cytoplasmic pattern of
staining.
The entire cytoplasm of all neuronal cell bodies stained for
Calnexin
(not shown). Like the cytoplasmic staining for Luman and HCF,
the pattern of Calnexin staining was also
punctate.
Luman protects cells from a productive infection by HSV-1.
The
VP16-HCF-mediated activation of IE gene expression is thought to
substantially increase the efficiency with which the virus can initiate
infection. Since our results suggested that in cells expressing Luman
most of the HCF was sequestered in the cytoplasm, we hypothesized that
these cells would be relatively insensitive to HSV-1 replication. To
test this hypothesis, we transfected cells with pcLuman or
pcLuman(Y81A). At 48 h after transfection the cells were infected
with HSV-1. Another 20 h later the cells were fixed and probed
with both polyclonal antibodies against Luman and monoclonal antibodies
against HSV-1 gC. Every cell (5 to 10% of cells in the culture) that
stained for Luman was devoid of any staining for gC (Fig. 5A and
B) and did not show "cell rounding,"
a characteristic sign of HSV cytopathic effect (CPE). Every cell that
did not contain Luman showed strong staining for gC and HSV CPE. In
contrast to cells expressing Luman, cells expressing Luman(Y81A), a
mutant with a greatly reduced ability to bind HCF (28) and
retain it in the cytoplasm (see Fig. 3B and C), showed brilliant
staining for gC (Fig. 5C and D) and HSV CPE.

View larger version (98K):
[in this window]
[in a new window]
|
FIG. 5.
Luman protects cells from HSV in an HCF-dependent
manner. HeLa cells were transfected with either pcLuman (A and B) or
pcLuman(Y81A) (C and D). At 48 h after transfection cells were
infected with HSV-1 (KOS) at a multiplicity of about 10 PFU/cell. Then,
20 h later, cells were fixed and stained with a mixture of
anti-HSVgC monoclonal antibodies and rabbit anti-Luman antibodies,
followed by a mixture of Alexa488-tagged anti-mouse and
Alexa546-tagged anti-rabbit antibodies. The cells were
visualized in a fluorescent microscope by using either a 546-nm (A and
C) or a 450- to 490-nm (B and D) filter.
|
|
Luman activates the IE110 promoter.
The IE110 protein is
thought to be important for efficient reactivation of HSV from the
latent state (25, 44, 48). To determine if Luman had the
potential to initiate the replicative cascade by stimulating the
synthesis of IE110, we determined if Luman could activate the IE110
promoter. Cells were transfected with pAB2-167, in which the basal
IE110 promoter containing one octamer-GARAT element is linked
to the reporter gene for CAT. We found that Luman could activate this
promoter as efficiently as could VP16 (Fig.
6A). Also like VP16, reactivation of the
IE110 promoter by Luman depended on the ability of the protein to bind HCF, as Luman (Y81A) was unable to stimulate the expression of CAT. We
next examined the ability of VP16 and Luman to activate pAB2, which
contains the minimal IE110 promoter from which all octamer-GARATs have
been deleted. As expected, VP16 failed to activate this promoter,
although Luman activated it to levels comparable to VP16 activation of
the octamer-GARAT containing promoter (Fig. 6B). Incidently, pAB2 is
almost completely inactive in HeLa cells. This suggests that these
cells contain little Luman protein and is consistent with our inability
to detect the protein in untransfected HeLa cells by
immunofluorescence.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
Luman activates the HSV IE110 promoter in an
HCF-dependent and octamer-GARAT-independent manner. HeLa cells were
transfected with target plasmid pAB2, which has the minimal IE110
promoter linked to coding sequences for CAT, or pAB2-167, which in
addition has an IE110 octamer-GARAT motif. The cells were also
transfected with pcDNA3-0 or pcDNA3 expressing Luman-Lu,
Luman(Y81A)-Lu(Y81A), or VP16-VP16. At 48 h after transfection
cells were lysed and assayed for CAT.
|
|
Luman activates the IE110 promoter through a CRE element.
The
IE110 promoter contains a putative CRE at position
68 relative to the
start of transcription. In this site, AATCGTCA, the last five nucleotides (underlined) agree with the canonical CRE motif, TGACGTCA. Since Luman binds oligonucleotides
containing the canonical CRE motif in vitro and activates promoters
containing the sequence in vivo (27), we determined if Luman
activated the IE110 promoter through its CRE element. We changed the
GTCA in the motif in pAB2 to GaCt. Figure
7 shows that although Luman activated
pAB2 in an HCF-dependent manner (Luman Y81A was unable to activate the
promoter), it was unable to activate the promoter if two nucleotides in
the putative CRE motif were changed.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 7.
Activation of the HSV IE110 promoter requires the
putative CRE element. HeLa cells were transfected with target plasmid
pAB2, which has the minimal IE110 promoter linked to coding sequences
for CAT, or pAB2 in which two nucleotides of the CRE site have been
altered (indicated). The cells were also transfected with pcLuman. At
48 h after transfection cells were lysed and assayed for CAT.
|
|
Luman activates the LAT promoter.
The HSV-1 LAT promoter also
contains two putative CREs, CRE1 (26) and CRE2
(20). A mutation in CRE1 in the context of the viral genome
reduces reactivation of virus by epinephrine iontophoresis
(4), and in a rat pheochromocytoma cell line it confers
cyclic AMP responsiveness to the LAT promoter (26). We
examined the ability of Luman to activate either the entire LAT
promoter represented by about 600 bp of DNA upstream from the start of
transcription of LAT (pBB8) or a DNA fragment with just the proximal
143 bp (pBB15) which contains CRE1 and CRE2. Luman could activate both
promoters about 20- to 30-fold. The results obtained with pBB15, which
is inactive in HeLa cells in the absence of Luman, are shown in Fig.
8.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 8.
Luman activates the HSV LAT promoter. HeLa cells were
transfected with the target plasmid pBB15, which contains 138 bp
upstream from the start of transcription of LAT and either pcDNA-0 or
pcLuman-Lu. At 48 h after transfection cells were lysed and
assayed for CAT.
|
|
 |
DISCUSSION |
The cascade of herpesvirus gene expression that results in viral
replication begins with the activation of IE genes by the virion-associated protein VP16. VP16 on its own is inefficient at
associating with complexes formed on IE promoters and depends upon the
cellular factor HCF for its activity. In this respect VP16 mimics the
host bZIP protein Luman, which also requires HCF for activating
transcription. Our objective is to explore interactions between Luman
and HCF and to determine if they play a role in the biology of
herpesviruses. The results presented here suggest that Luman may be
involved in both the establishment of latent infections and the
reactivation of latent virus. By sequestering HCF in the cytoplasm of
sensory neurons, Luman may prevent the initiation of the replicative
cascade leading to latent infection. Subsequent release of the
Luman-HCF complex from the cytoplasm in response to external signals
and its translocation to the nucleus may activate IE110 and LAT, key
viral genes required for reactivation of the latent virus.
We found that ectopically expressed Luman in cultured epithelial cells,
and possibly also in sensory neurons of the trigeminal ganglia, is
retained in the ER. This is reminiscent of the sterol enhancer binding
proteins (SREBPs) (5). These leucine-zipper-containing transcription activators are also sequestered in the ER and are released by proteolysis in response to reduced levels of cholesterol and sterols in the cellular environment. Subsequently, SREBPs are
translocated to the nucleus, where they coordinately activate the
expression of several genes involved in cholesterol and fatty acid
biosynthesis. This strategy has probably evolved to allow a rapid
response to low levels of substances that are critical for cellular survival.
Like the SREBPs, Luman is anchored to the ER by a hydrophobic domain.
We found that deletion of this domain dramatically altered the location
of Luman in the cell. Mutants of Luman that either lacked the
transmembrane domain (Luman
Tm) or lacked the domain as well as
sequences downstream from it (Luman 1-220) accumulated in the nucleus.
SREBP has two hydrophobic Tm domains that allow both the amino and
carboxyl portions of the protein to protrude into the cytoplasm. The
amino portion of the protein contains the activation domain, basic DNA
binding domain, and leucine zipper, while the carboxyl terminus is
thought to play a regulatory role. Luman appears to have a single
transmembrane domain, suggesting that its proline-rich carboxyl
terminus remains in the lumen of the ER. We speculate that as with the
SREBPs the amino-terminal portion of Luman, which contains its domains
for transcription activation dimerization and interactions with HCF and
DNA, is released by proteolysis. The released product is probably
unstable since mutants lacking the carboxyl portion of the protein
accumulated in the cell at much lower levels than the wild-type protein
(results not shown). The instability of the truncated protein may
explain why, while we could visualize HCF in the nucleus of neurons of trigeminal ganglia, we were unable to follow the possible translocation of Luman from the cytoplasm to the nucleus in these cells. Instability of the truncated, and presumably active, form of Luman may be a way of
ensuring that the activation of the genes that it regulates is transient.
We had previously shown that Luman strongly binds HCF both in vitro and
in vivo. Here we demonstrate that Luman retained in the ER sequesters
HCF. Since HCF is required for cell cycle progression, one consequence
of this might be that cells expressing Luman are arrested in the
G0 phase. This may explain why, despite several attempts,
we have been unable to obtain cell lines expressing Luman, even when we
have used tetracycline (14)- and Ecdysone (34)-inducible systems. It is possible that in the absence
of inducers these systems allow the synthesis of small amounts of Luman
which are enough to cause cell cycle arrest.
We observed that Luman-expressing cells were resistant to productive
infection by HSV, at least as assessed by the lack of gC in these cells
after infection. Since gC is made late in infection, we do not know at
which stage of the replicative cycle the infection was interrupted or
the mechanism by which Luman blocked HSV replication. Interaction
between Luman and HCF was required for protection against HSV since the
Luman (Y81A) mutant that does not bind HCF and does not retain it in
the cytoplasm, failed to protect cells. This suggests that cells
expressing Luman were protected from HSV replication by a mechanism
that relied on retention of HCF in the cytoplasm. A simple explanation
for how Luman might protect cells could be that Luman prevents HCF from
entering the nucleus, thereby blocking VP16-mediated IE gene
expression. However, our observations suggest that the mechanism might
be more complex. In transfected cells enough Luman-HCF makes it to the
nucleus to activate the IE110-ICP0 promoter in a VP16-independent
manner. In addition, our preliminary results (unpublished) suggest that although Luman-expressing HSV-infected cells fail to make detectable levels of the structural proteins gC, gB, and gD, they do synthesize the IE proteins ICP0, ICP4, and ICP27.
Kristie and others found that, in contrast to other cell types, in
neurons of the trigeminal ganglia HCF is located largely in the
cytoplasm. It is translocated to the nucleus after death of the animal
and in response to other stimuli that lead to reactivation of HSV in
the mouse model (24). These authors suggested that translocation of HCF to the nucleus may lead to the activation of IE
gene expression and reactivation. Since latently infected neurons would
not be expected to contain VP16, activation of IE genes by HCF would
likely be by a VP16-independent mechanism. Kristie et al. suggest that
this may involve GA binding protein (GABP). The IE110 promoter has
binding sites for GABP, and T. M. Kristie (unpublished
observations) has indicated that activation by GABP may require HCF.
Our observations of sections of bovine trigeminal ganglia support the
results of our experiments with transfected cells in culture and may
explain two of Kristie's observations. First, these results provide a
mechanism for the sequestering of HCF in the neuronal cytoplasm. We
found Luman and HCF in neuronal cytoplasm in a pattern similar to that
observed by Kristie for HCF. In addition, in sections of ganglia the ER
marker Calnexin had the same punctate pattern, suggesting that as in
transfected cells Luman and HCF were associated with the ER. In
transfected cells we showed that the sequestering of HCF by Luman in
the ER correlated with resistance to HSV replication. Similar
association of the two proteins in neurons could also suppress
replication and lead to latency, if the initiation of viral replication
at this site relied on an HCF-dependent process. Second, our
observations suggest a mechanism for the initiation of the replicative
cascade once both HCF and Luman are translocated to the nucleus. We
showed that Luman could efficiently activate the promoters of IE110 and LAT, two genes that appear to be critical for reactivation. Our observations do not rule out the possibility that other neuronal factors, such as GABP (24), also mediate activation. They
simply suggest that Luman may also play a role in reactivation from
latency. Recently, however, Davido and Leib (8) showed that
the region of the IE110 promoter that lies between
420 and
70 and
includes the GABP-responsive sites is dispensable for reactivation from latency. The Luman-responsive CREs lie downstream from this dispensable region. Those authors discounted the role of the CRE because it did not
bind CREB and was nonfunctional in undifferentiated neuroblastoma and
pheochromocytoma cells (PC12). However, our preliminary data suggest
that the IE110 CRE is relatively specific for Luman, and we have been
unable to find Luman in undifferentiated PC12 cells. It is possible
that Luman is expressed only after differentiation of these cells into
neurons, and we are exploring this possibility. Interestingly, Su et
al. (49) have shown that HSV causes a long-term "quiescent" infection in differentiated PC12 cells. We have not examined differentiated PC12 cells for Luman expression, but it is
tempting to speculate that Luman synthesis in response to
differentiation causes these cells to become resistant to virus infection.
We hypothesize that, as with SREBP, the retention of Luman in the ER
provides a means of responding rapidly to conditions that might be
detrimental to neurons. Release of the complex from the ER and
translocation to the nucleus leads to the coordinate expression of
genes that can correct these conditions. Furthermore, rapid degradation
of Luman released from the ER ensures that its activation of downstream
genes was transient. By requiring HCF for the initiation of its
replicative cascade, HSV exploits this pathway both for the
establishment of latency and reactivation from it. In the absence of
free nuclear HCF in differentiated neurons of the trigeminal ganglia,
the virus is unable to replicate and becomes latent. Release of
Luman-HCF and translocation to the nucleus activates IE expression in
the absence of viral proteins and leads to reactivation.
 |
ACKNOWLEDGMENTS |
We are grateful to Peter O'Hare and Sylvie LaBoissiere of the
Marie Curie Institute for discussions, reagents, and advice on
immunofluorescence; to Ian Shirley and Leah Heasman for assistance with
the bovine ganglia; and to Kevin Snyder for technical assistance.
R.L. is a postdoctoral fellow of the Saskatchewan Health Services
Utilization and Research Commission, and this work was funded by an
operating grant to V.M. from the Natural Sciences and Engineering Research Council of Canada.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Veterinary Microbiology, Western College of Veterinary Medicine,
University of Saskatchewan, 52 Campus Dr., Saskatoon, Saskatchewan S7N
5B4, Canada. Phone: (306) 966-7218. Fax: (306) 966-7244. E-mail:
misra{at}duke.usask.ca.
Present address: Laboratory of Viral Diseases, NIAID, National
Institutes of Health, Bethesda, MD 20892.
 |
REFERENCES |
| 1.
|
apRhys, C. M.,
D. M. Ciufo,
E. A. O'Neill,
T. J. Kelly, and G. S. Hayward.
1989.
Overlapping octamer and TAATGARAT motifs in the VF65-response elements in herpes simplex virus immediate-early promoters represent independent binding sites for cellular nuclear factor III.
J. Virol.
63:2798-2812[Abstract/Free Full Text].
|
| 2.
|
Batchelor, A. H., and P. O'Hare.
1992.
Localization of cis-acting sequence requirements in the promoter of the latency-associated transcript of herpes simplex virus type 1 required for cell-type-specific activity.
J. Virol.
66:3573-3582[Abstract/Free Full Text].
|
| 3.
|
Bloom, D. C.,
J. M. Hill,
G. Devi-Rao,
E. K. Wagner,
L. T. Feldman, and J. G. Stevens.
1996.
A 348-base-pair region in the latency-associated transcript facilitates herpes simplex virus type 1 reactivation.
J. Virol.
70:2449-2459[Abstract].
|
| 4.
|
Bloom, D. C.,
J. G. Stevens,
J. M. Hill, and R. K. Tran.
1997.
Mutagenesis of a cAMP response element within the latency-associated transcript promoter of HSV-1 reduces adrenergic reactivation.
Virology
236:202-207[CrossRef][Medline].
|
| 5.
|
Brown, M. S., and J. L. Goldstein.
1997.
The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor.
Cell
89:331-340[CrossRef][Medline].
|
| 6.
|
Chen, C. A., and H. Okayama.
1988.
Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA.
BioTechniques
6:632-638[Medline].
|
| 7.
|
Chen, S. H.,
M. K. Kramer,
P. S. Schaffer, and D. M. Coen.
1997.
A viral function represses accumulation of transcripts from productive-cycle genes in mouse ganglia latently infected with herpes simplex virus.
J. Virol.
71:5878-5884[Abstract].
|
| 8.
|
Davido, D. J., and D. A. Leib.
1998.
Analysis of the basal and inducible activities of the ICP0 promoter of herpes simplex virus type 1.
J. Gen. Virol.
79:2093-2098[Abstract].
|
| 9.
|
Devi-rao, G. B.,
D. C. Bloom,
J. G. Stevens, and E. K. Wagner.
1994.
Herpes simplex virus type 1 DNA replication and gene expression during explant-induced reactivation of latently infected murine sensory ganglia.
J. Virol.
68:1271-1282[Abstract/Free Full Text].
|
| 10.
|
Drolet, B. S.,
G. C. Perng,
R. J. Villosis,
S. M. Slanina,
A. B. Nesburn, and S. L. Wechsler.
1999.
Expression of the first 811 nucleotides of the herpes simplex virus type 1 latency-associated transcript (LAT) partially restores wild-type spontaneous reactivation to a LAT-null mutant.
Virology
253:96-106[CrossRef][Medline].
|
| 11.
|
Freiman, R. N., and W. Herr.
1997.
Viral mimicry: common mode of association with HCF by VP16 and the cellular protein LZIP.
Genes Dev.
11:3122-3127[Abstract/Free Full Text].
|
| 12.
|
Garber, D. A.,
P. A. Schaffer, and D. M. Knipe.
1997.
The LAT-associated function reduces productive cycle gene expression during acute infection of murine sensory neurons with herpes simplex virus type 1.
J. Virol.
71:5885-5893[Abstract].
|
| 13.
|
Gerster, T., and R. G. Roeder.
1988.
A herpesvirus trans-activating protein interacts with transcription factor OTF-1 and other cellular proteins.
Proc. Natl. Acad. Sci. USA
85:6347-6351[Abstract/Free Full Text].
|
| 14.
|
Gossen, M., and H. Bujard.
1992.
Tight control of gene expression in mammalian cells by tetracycline responsive promoters.
Proc. Natl. Acad. Sci. USA
89:5547-5551[Abstract/Free Full Text].
|
| 15.
|
Goto, H.,
S. Motomura,
A. C. Wilson,
R. N. Freiman,
Y. Nakabeppu,
K. Fukushima,
M. Fujishima,
W. Herr, and T. Nishimoto.
1997.
A single-point mutation in HCF causes temperature-sensitive cell-cycle arrest and disrupts VP16 function.
Genes Dev.
11:726-737[Abstract/Free Full Text].
|
| 16.
|
Halford, W. P.,
B. M. Gebhardt, and D. J. Carr.
1996.
Mechanisms of herpes simplex virus type 1 reactivation.
J. Virol.
70:5051-5060[Abstract/Free Full Text].
|
| 17.
|
Hill, J. M.,
H. H. J. Garza,
Y. H. Su,
R. Meegalla,
L. A. Hanna,
J. M. Loutsch,
H. W. Thompson,
E. D. Varnell,
D. C. Bloom, and T. M. Block.
1997.
A 437-base-pair deletion at the beginning of the latency-associated transcript promoter significantly reduced adrenergically induced herpes simplex virus type 1 ocular reactivation in latently infected rabbits.
J. Virol.
71:6555-6559[Abstract].
|
| 18.
|
Jones, C.
1998.
Alphaherpesvirus latency: its role in disease and survival of the virus in nature.
Adv. Virus Res.
51:81-133[Medline].
|
| 19.
|
Katan, M.,
A. Haigh,
C. P. Verrijzer,
P. C. van der Vliet, and P. O'Hare.
1990.
Characterization of a cellular factor which interacts functionally with Oct-1 in the assembly of a multicomponent transcription complex.
Nucleic Acids Res.
18:6871-6880[Abstract/Free Full Text].
|
| 20.
|
Kenny, J. J.,
F. C. Krebs,
H. T. Hartle,
A. E. Gartner,
C. B., J. M. Leiden,
J. P. Hoeffler,
P. C. Weber, and B. Wigdahl.
1994.
Identification of a second ATF/CREB like element in the herpes simplex virus type 1 (HSV-1) latency associated transcript (LAT) promoter.
Virology
171:607-610.
|
| 21.
|
Kosz-Vnenchak, M.,
J. Jacobson,
D. M. Coen, and D. M. Knipe.
1993.
Evidence for a novel regulatory pathway for herpes simplex virus gene expression in trigeminal ganglion neurons.
J. Virol.
67:5383-5393[Abstract/Free Full Text].
|
| 22.
|
Kristie, T. M.,
J. L. Pomerantz,
T. C. Twomey,
S. A. Parent, and P. A. Sharp.
1995.
The cellular C1 factor of the herpes simplex virus enhancer complex is a family of polypeptides.
J. Biol. Chem.
270:4387-4394[Abstract/Free Full Text].
|
| 23.
|
Kristie, T. M., and B. Roizman.
1987.
Host cell proteins bind to the cis-acting site required for virion-mediated induction of herpes simplex virus 1 alpha genes.
Proc. Natl. Acad. Sci. USA
84:71-75[Abstract/Free Full Text].
|
| 24.
|
Kristie, T. M.,
J. L. Vogel, and A. E. Sears.
1999.
Nuclear localization of the C1 factor (host cell factor) in sensory neurons correlates with reactivation of herpes simplex virus from latency.
Proc. Natl. Acad. Sci. USA
96:1229-1233[Abstract/Free Full Text].
|
| 25.
|
Leib, D. A.,
D. M. Coen,
C. L. Bogard,
K. A. Hicks,
D. R. Yager,
D. M. Knipe,
K. L. Tyler, and P. A. Schaffer.
1989.
Immediate-early regulatory gene mutants define different stages in the establishment and reactivation of herpes simplex virus latency.
J. Virol.
63:759-768[Abstract/Free Full Text].
|
| 26.
|
Leib, D. A.,
K. C. Nadeau,
S. A. Rundle, and P. A. Schaffer.
1991.
The promoter of the latency associated transcripts of herpes simplex virus type 1 contain a functional cAMP response element: role of the latency associated transcripts and cAMP in reactivation of viral latency.
Proc. Natl. Acad. Sci. USA
88:48-52[Abstract/Free Full Text].
|
| 27.
|
Lu, R.,
P. Yang,
P. O'Hare, and V. Misra.
1997.
Luman, a new member of the CREB/ATF family, binds to herpes simplex virus VP16-associated host cellular factor.
Mol. Cell. Biol.
17:5117-5126[Abstract].
|
| 28.
|
Lu, R.,
P. Yang,
S. Padmakumar, and V. Misra.
1998.
The herpesvirus transactivator VP16 mimics a human basic domain leucine zipper protein, Luman, in its interaction with HCF.
J. Virol.
72:6291-6297[Abstract/Free Full Text].
|
| 29.
|
Marsden, H. S.,
M. E. Campbell,
L. Haarr,
M. C. Frame,
D. S. Parris,
M. Murphy,
R. G. Hope,
M. T. Muller, and C. M. Preston.
1987.
The 65,000-Mr DNA-binding and virion trans-inducing proteins of herpes simplex virus type 1.
J. Virol.
61:2428-2437[Abstract/Free Full Text].
|
| 30.
|
McKnight, J. L.,
T. M. Kristie, and B. Roizman.
1987.
Binding of the virion protein mediating alpha gene induction in herpes simplex virus 1-infected cells to its cis site requires cellular proteins.
Proc. Natl. Acad. Sci. USA
84:7061-7065[Abstract/Free Full Text].
|
| 31.
|
Misra, V.,
R. M. Blumenthal, and L. A. Babiuk.
1981.
Proteins specified by bovine herpesvirus-1 (infectious rhinotracheitis virus).
J. Virol.
40:367-378[Abstract/Free Full Text].
|
| 32.
|
Misra, V.,
A. C. Bratanich,
D. Carpenter, and P. O'Hare.
1994.
Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.
J. Virol.
68:4898-4909[Abstract/Free Full Text].
|
| 33.
|
Misra, V.,
S. Walker,
P. Yang,
S. Hayes, and P. Ohare.
1996.
Conformational alteration of Oct 1 upon DNA binding dictates selectivity in differential interactions with related transcriptional coactivators.
Mol. Cell. Biol.
16:4404-4413[Abstract].
|
| 34.
|
No, D.,
T. P. Yao, and R. M. Evans.
1996.
Ecdysone-inducible gene expression in mammalian cells and transgenic mice.
Proc. Natl. Acad. Sci. USA
93:3346-3351[Abstract/Free Full Text].
|
| 35.
|
O'Hare, P., and C. R. Goding.
1988.
Herpes simplex virus regulatory elements and the immunoglobulin octamer domain bind a common factor and are both targets for virion transactivation.
Cell
52:435-445[CrossRef][Medline].
|
| 36.
|
O'Rourke, D., and P. O'Hare.
1993.
Mutually exclusive binding of two cellular factors within a critical promoter region of the gene for the IE110k protein of herpes simplex virus.
J. Virol.
67:7201-7214[Abstract/Free Full Text].
|
| 37.
|
Ou, W. J.,
P. H. Cameron,
D. Y. Thomas, and J. J. Bergeron.
1993.
Association of folding intermediates of glycoproteins with calnexin during protein maturation.
Nature
364:771-776[CrossRef][Medline].
|
| 38.
|
Perng, G. C.,
E. C. Dunkel,
P. A. Geary,
S. M. Slanina,
H. Ghiasi,
R. Kaiwar,
A. B. Nesburn, and S. L. Wechsler.
1994.
The latency-associated transcript gene of herpes simplex virus type 1 (HSV-1) is required for efficient in vivo spontaneous reactivation of HSV-1 from latency.
J. Virol.
68:8045-8055[Abstract/Free Full Text].
|
| 39.
|
Perng, G. C.,
S. M. Slanina,
A. Yukht,
B. S. Drolet,
W. J. Keleher,
H. Ghiasi,
A. B. Nesburn, and S. L. Wechsler.
1999.
A herpes simplex virus type 1 latency-associated transcript mutant with increased virulence and reduced spontaneous reactivation.
J. Virol.
73:920-929[Abstract/Free Full Text].
|
| 40.
|
Preston, C. M.,
M. G. Cordingley, and N. D. Stow.
1984.
Analysis of DNA sequences which regulate the transcription of a herpes simplex virus immediate early gene.
J. Virol.
50:708-716[Abstract/Free Full Text].
|
| 41.
|
Preston, C. M.,
M. C. Frame, and M. E. Campbell.
1988.
A complex formed between cell components and a HSV structural polypeptide binds to a viral immediate early gene regulatory DNA sequence.
Cell
52:425-434[CrossRef][Medline].
|
| 42.
|
Roizman, B.
1995.
Herpesviridae, p. 2221-2230.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Field's virology, 3rd ed., vol. 2. Lippincott-Raven, Philadelphia, Pa.
|
| 43.
|
Roizman, B., and A. E. Sears.
1995.
Herpes simplex viruses and their replication, p. 2231-2296.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Field's virology, 3rd ed., vol. 2. Lippincott-Raven, Philadelphia, Pa.
|
| 44.
|
Russell, J.,
E. C. Stow,
N. D. Stow, and C. M. Preston.
1987.
Herpes simplex virus genes involved in latency in vitro.
J. Gen. Virol.
68:3009-3019[Abstract/Free Full Text].
|
| 45.
|
Sawtell, N. M., and R. L. Thompson.
1992.
Herpes simplex virus type 1 latency-associated transcription unit promotes anatomical site-dependent establishment and reactivation from latency.
J. Virol.
66:2157-2169[Abstract/Free Full Text].
|
| 46.
|
Steiner, I.,
J. G. Spivack,
S. L. Deshmane,
C. I. Ace,
C. M. Preston, and N. W. Fraser.
1990.
A herpes simplex virus type 1 mutant containing a nontransinducing Vmw65 protein establishes latent infection in vivo in the absence of viral replication and reactivates efficiently from explanted trigeminal ganglia.
J. Virol.
64:1630-1638[Abstract/Free Full Text].
|
| 47.
|
Stern, S.,
M. Tanaka, and W. Herr.
1989.
The Oct-1 homoeodomain directs formation of a multiprotein-DNA complex with the HSV transactivator VP16.
Nature
341:624-630[CrossRef][Medline].
|
| 48.
|
Stow, N. D., and E. C. Stow.
1986.
Isolation and characterization of a herpes simplex virus type 1 mutant containing a deletion within the gene encoding the immediate early polypeptide Vmw110.
J. Gen. Virol.
67:2571-2585[Abstract/Free Full Text].
|
| 49.
|
Su, Y. H.,
R. L. Meegalla,
R. Chowhan,
C. Cubitt,
J. E. Oakes,
R. N. Lausch,
N. W. Fraser, and T. M. Block.
1999.
Human corneal cells and other fibroblasts can stimulate the appearance of herpes simplex virus from quiescently infected PC12 cells.
J. Virol.
73:4171-4180[Abstract/Free Full Text].
|
| 50.
|
Tal-Singer, R.,
T. M. Lasner,
W. Podrzucki,
A. Skokotas,
J. J. Leary,
S. L. Berger, and N. W. Fraser.
1997.
Gene expression during reactivation of herpes simplex virus type 1 from latency in the peripheral nervous system is different from that during lytic infection of tissue cultures.
J. Virol.
71:5268-5276[Abstract].
|
| 51.
|
Triezenberg, S. J.,
K. L. LaMarco, and S. L. McKnight.
1988.
Evidence of DNA:protein interactions that mediate HSV-1 immediate early gene activation by VP16.
Genes Dev.
2:730-742[Abstract/Free Full Text].
|
| 52.
|
Wada, I.,
D. Rindress,
P. H. Cameron,
W. J. Ou,
J. J. D. Doherty,
D. Louvard,
A. W. Bell,
D. Dignard,
D. Y. Thomas, and J. J. Bergeron.
1991.
SSR alpha and associated calnexin are major calcium binding proteins of the endoplasmic reticulum membrane.
J. Biol. Chem.
266:19599-19610[Abstract/Free Full Text].
|
| 53.
|
Wilson, A. C.,
K. LaMarco,
M. G. Peterson, and W. Herr.
1993.
The VP16 accessory protein HCF is a family of polypeptides processed from a large precursor protein.
Cell
74:115-125[CrossRef][Medline].
|
| 54.
|
Xiao, P., and J. P. Capone.
1990.
A cellular factor binds to the herpes simplex virus type 1 transactivator Vmw65 and is required for Vmw65-dependent protein-DNA complex assembly with Oct-1.
Mol. Cell. Biol.
10:4974-4977[Abstract/Free Full Text].
|
Journal of Virology, January 2000, p. 934-943, Vol. 74, No. 2
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kang, H., Kim, Y. S., Ko, J.
(2009). A Novel Isoform of Human LZIP Negatively Regulates the Transactivation of the Glucocorticoid Receptor. Mol. Endocrinol.
23: 1746-1757
[Abstract]
[Full Text]
-
Whitlow, Z. W., Kristie, T. M.
(2009). Recruitment of the Transcriptional Coactivator HCF-1 to Viral Immediate-Early Promoters during Initiation of Reactivation from Latency of Herpes Simplex Virus Type 1. J. Virol.
83: 9591-9595
[Abstract]
[Full Text]
-
Kolb, G., Kristie, T. M.
(2008). Association of the Cellular Coactivator HCF-1 with the Golgi Apparatus in Sensory Neurons. J. Virol.
82: 9555-9563
[Abstract]
[Full Text]
-
Audas, T. E., Li, Y., Liang, G., Lu, R.
(2008). A Novel Protein, Luman/CREB3 Reruitment Factor, Inhibits Luman Activation of the Unfolded Protein Response. Mol. Cell. Biol.
28: 3952-3966
[Abstract]
[Full Text]
-
Liang, G., Audas, T. E., Li, Y., Cockram, G. P., Dean, J. D., Martyn, A. C., Kokame, K., Lu, R.
(2006). Luman/CREB3 Induces Transcription of the Endoplasmic Reticulum (ER) Stress Response Protein Herp through an ER Stress Response Element. Mol. Cell. Biol.
26: 7999-8010
[Abstract]
[Full Text]
-
Marciniak, S. J., Ron, D.
(2006). Endoplasmic reticulum stress signaling in disease.. Physiol. Rev.
86: 1133-1149
[Abstract]
[Full Text]
-
Akhova, O., Bainbridge, M., Misra, V.
(2005). The Neuronal Host Cell Factor-Binding Protein Zhangfei Inhibits Herpes Simplex Virus Replication. J. Virol.
79: 14708-14718
[Abstract]
[Full Text]
-
Misra, V., Rapin, N., Akhova, O., Bainbridge, M., Korchinski, P.
(2005). Zhangfei Is a Potent and Specific Inhibitor of the Host Cell Factor-binding Transcription Factor Luman. J. Biol. Chem.
280: 15257-15266
[Abstract]
[Full Text]
-
Chin, K.-T., Zhou, H.-J., Wong, C.-M., Lee, J. M.-F., Chan, C.-P., Qiang, B.-Q., Yuan, J.-G., Ng, I. O.-l., Jin, D.-Y.
(2005). The liver-enriched transcription factor CREB-H is a growth suppressor protein underexpressed in hepatocellular carcinoma. Nucleic Acids Res
33: 1859-1873
[Abstract]
[Full Text]
-
Jones, C.
(2003). Herpes Simplex Virus Type 1 and Bovine Herpesvirus 1 Latency. Clin. Microbiol. Rev.
16: 79-95
[Abstract]
[Full Text]
-
Mahajan, S. S., Little, M. M., Vazquez, R., Wilson, A. C.
(2002). Interaction of HCF-1 with a Cellular Nuclear Export Factor. J. Biol. Chem.
277: 44292-44299
[Abstract]
[Full Text]
-
Raggo, C., Rapin, N., Stirling, J., Gobeil, P., Smith-Windsor, E., O'Hare, P., Misra, V.
(2002). Luman, the Cellular Counterpart of Herpes Simplex Virus VP16, Is Processed by Regulated Intramembrane Proteolysis. Mol. Cell. Biol.
22: 5639-5649
[Abstract]
[Full Text]
-
Higaki, S., Gebhardt, B. M., Lukiw, W. J., Thompson, H. W., Hill, J. M.
(2002). Effect of Immunosuppression on Gene Expression in the HSV-1 Latently Infected Mouse Trigeminal Ganglion. IOVS
43: 1862-1869
[Abstract]
[Full Text]
-
Chen, X., Shen, J., Prywes, R.
(2002). The Luminal Domain of ATF6 Senses Endoplasmic Reticulum (ER) Stress and Causes Translocation of ATF6 from the ER to the Golgi. J. Biol. Chem.
277: 13045-13052
[Abstract]
[Full Text]
-
Qi, H., Fillion, C., Labrie, Y., Grenier, J., Fournier, A., Berger, L., El-Alfy, M., Labrie, C.
(2002). AIbZIP, a Novel bZIP Gene Located on Chromosome 1q21.3 That Is Highly Expressed in Prostate Tumors and of Which the Expression Is Up-Regulated by Androgens in LNCaP Human Prostate Cancer Cells. Cancer Res.
62: 721-733
[Abstract]
[Full Text]
-
Lee, S., Herr, W.
(2001). Stabilization but Not the Transcriptional Activity of Herpes Simplex Virus VP16-Induced Complexes Is Evolutionarily Conserved among HCF Family Members. J. Virol.
75: 12402-12411
[Abstract]
[Full Text]
-
Tsavachidou, D., Podrzucki, W., Seykora, J., Berger, S. L.
(2001). Gene Array Analysis Reveals Changes in Peripheral Nervous System Gene Expression following Stimuli That Result in Reactivation of Latent Herpes Simplex Virus Type 1: Induction of Transcription Factor Bcl-3. J. Virol.
75: 9909-9917
[Abstract]
[Full Text]
-
Wysocka, J., Reilly, P. T., Herr, W.
(2001). Loss of HCF-1-Chromatin Association Precedes Temperature-Induced Growth Arrest of tsBN67 Cells. Mol. Cell. Biol.
21: 3820-3829
[Abstract]
[Full Text]
-
Omori, Y., Imai, J.-i., Watanabe, M., Komatsu, T., Suzuki, Y., Kataoka, K., Watanabe, S., Tanigami, A., Sugano, S.
(2001). CREB-H: a novel mammalian transcription factor belonging to the CREB/ATF family and functioning via the box-B element with a liver-specific expression. Nucleic Acids Res
29: 2154-2162
[Abstract]
[Full Text]
-
Luciano, R. L., Wilson, A. C.
(2000). N-terminal transcriptional activation domain of LZIP comprises two LxxLL motifs and the Host Cell Factor-1 binding motif. Proc. Natl. Acad. Sci. USA
10.1073/pnas.190062797v1
[Abstract]
[Full Text]
-
Lu, R., Misra, V.
(2000). Zhangfei: a second cellular protein interacts with herpes simplex virus accessory factor HCF in a manner similar to Luman and VP16. Nucleic Acids Res
28: 2446-2454
[Abstract]
[Full Text]
-
Luciano, R. L., Wilson, A. C.
(2000). N-terminal transcriptional activation domain of LZIP comprises two LxxLL motifs and the Host Cell Factor-1 binding motif. Proc. Natl. Acad. Sci. USA
97: 10757-10762
[Abstract]
[Full Text]