Previous Article | Next Article 
Journal of Virology, January 2000, p. 721-734, Vol. 74, No. 2
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Nuclear Import of Moloney Murine Leukemia Virus DNA
Mediated by Adenovirus Preterminal Protein Is Not Sufficient for
Efficient Retroviral Transduction in Nondividing Cells
André
Lieber,1,*
Mark A.
Kay,2 and
Zong-Yi
Li1
Division of Medical Genetics, University of
Washington, Seattle, Washington 98195,1 and
Departments of Pediatrics and Genetics, Stanford University,
Stanford, California 94305-52082
Received 28 July 1999/Accepted 7 October 1999
 |
ABSTRACT |
Moloney murine leukemia virus (MoMLV)-derived vectors require cell
division for efficient transduction, which may be related to an
inability of the viral DNA-protein complex to cross the nuclear
membrane. In contrast, adenoviruses (Ad) can efficiently infect
nondividing cells. This property may be due to the presence of multiple
nuclear translocation signals in a number of Ad proteins, which are
associated with the incoming viral genomes. Of particular interest is
the Ad preterminal protein (pTP), which binds alone or in complex with
the Ad polymerase to specific sequences in the Ad inverted terminal
repeat. The goal of this study was to test whether coexpression of pTP
with retroviral DNA carrying pTP-binding sites would facilitate nuclear
import of the viral preintegration complex and transduction of
quiescent cells. In preliminary experiments, we demonstrated that the
karyophylic pTP can coimport plasmid DNA into the nuclei of
growth-arrested cells. Retroviral transduction studies were performed
with G1/S-arrested LTA cells or stationary-phase human
primary fibroblasts. These studies demonstrated that pTP or pTP-Ad
polymerase conferred nuclear import of retroviral DNA upon arrested
cells when the retrovirus vector contained the corresponding binding
motifs. However, pTP-mediated nuclear translocation of MoMLV DNA in
nondividing cells was not sufficient for stable transduction.
Additional cellular factors activated during S phase or DNA repair
synthesis were required for efficient retroviral integration.
| |
INTRODUCTION |
Integration of viral DNA into the
host chromosome is an essential step in the retrovirus life cycle. With
their remarkably efficient ability to integrate, retrovirus vectors are
an important tool in obtaining stable gene expression in vitro and in
vivo (37, 65). However, the most commonly used and as yet
best-characterized vectors based on mammalian C-type retroviruses
cannot transduce quiescent cells, which often represent the targets for
gene therapy approaches (20, 38, 43, 63).
After entry of the retroviral core into the cytoplasm, the retroviral
genome is reverse transcribed by using enzymatic activities associated
with the incoming virion. The resulting double-stranded linear viral
DNA is associated with viral proteins, forming a large nucleoprotein
complex. To complete the retroviral life cycle, this preintegration
complex must be translocated to the nucleus. The mechanisms of nuclear
transport appear to differ among different retrovirus subfamilies and
host cells (for a review, see reference 8). For
Moloney murine leukemia virus (MoMLV)-derived vectors, it is believed
that breakdown of the nuclear membrane during mitosis is necessary to
allow access of the preintegration complex to chromosomal DNA. This is
supported by two lines of evidence: (i) inhibitors, which delay the
onset of mitosis, delay integration as well (3, 33, 38); and
(ii) MoMLV proviruses segregate into only one daughter cell during the
first mitotic division after infection, implying that integration
occurs after DNA replication (19, 43). The MoMLV
preintegration complex contains linear DNA associated with the CA, IN,
and possibly RT and NC proteins (8). This complex with a
sedimentation constant of ~160S is too large to pass through the
nuclear membrane by simple diffusion. To enter the nucleus, larger
proteins (>40 to 60 kDa) require nuclear localization signals (NLS)
(for a review, see reference 55). NLS are currently
classified into several classes, including those consisting of a single
stretch of basic residues, bipartite NLS composed of two clusters of
basic amino acids separated by a spacer of 10 to 12 amino acids, and
those resembling the NLS of the yeast homeodomain protein Mat
2
(55). These NLS interact with cytoplasmic receptors
variously named importin /
, importin 58/97, or karyopherin
/, initiating an energy-dependent multistep translocation into
the nucleus. Importantly, the rate of active nuclear import of proteins
is independent of cell proliferation and is similar between arrested
and dividing cells (14). Karyophilic proteins containing NLS
can function as a nuclear import shuttle for other proteins, RNA, or
DNA (11, 39, 51).
In contrast to MoMLV-based retrovirus vectors, adenovirus type
5-derived vectors (Ad) can efficiently transduce nondividing cells in
vitro and in vivo (for a review, see reference 24). The efficiency of Ad infection relies to a large degree on efficient targeting of the Ad genome to the host cell nucleus. Ad DNA is packaged
together with viral core proteins and pTP/TP, the terminal protein,
into virions. After entry into the host cell, the virion is uncoated
and the Ad DNA is transported into the nucleus where its replication
occurs. It is generally thought that the NLS in the pTP/TP and the core
protein V play a crucial role in directing this complex to the nucleus.
Both the 80-kDa precursor to the terminal protein (pTP) and the 55-kDa
terminal protein (TP) contain an NLS (RLPVRRRRRRVP,
corresponding to residues 362 and 373 within the TP), which is well
conserved among all Ad serotypes (48). It was shown that
this motif can mediate nuclear import when transplanted into other
proteins (42). Once in the nucleus, one of the first early
viral proteins synthesized is the pTP, which binds with its N terminus
to bp 9 to 18 of the origin for Ad replication found at each end of the
linear DNA genome within the inverted terminal repeats (62,
68). During lytic infection, pTP forms a stable heterodimer with
the Ad polymerase (Pol), which is translocated to the nucleus by using
the NLS of pTP. The pTP-Pol complex binds with increased affinity and
specificity to the origin. This binding is further enhanced by
interaction of the heterodimer with the cellular factors NFI and OCT-1,
which bind at nucleotides nt 25 to 50 of the origin (60).
pTP functions as a protein primer for Ad DNA replication. After
binding, pTP is covalently linked to dCTP, providing a free 3'-hydroxyl
group to begin the synthesis of a daughter DNA strand. Furthermore, pTP
serves as the site of primary attachment of the viral DNA to a specific
protein(s) in the nuclear matrix, forming replicative complexes
(5, 17). Late in infection, pTP is proteolytically cleaved
by the viral protease, generating the 55-kDa terminal protein.
The goal of this study was to incorporate the pTP-based, Ad, nuclear
import machinery into MoMLV vectors and to test whether this would
allow retroviral transduction of nondividing cells. To approach this
hypothesis, we first analyzed whether pTP could mediate the nuclear
import of plasmid DNA carrying pTP-binding sites into arrested cells.
Based on these preliminary results, MoMLV-based vectors containing
pTP-binding sites were generated and tested for the ability to
transduce nondividing cells expressing pTP.
| |
MATERIALS AND METHODS |
Plasmids.
The pTP coding sequence (Ad5 bp 8533 to 10589),
including a small exon around Ad map unit 39, which contained the
initiation codon, was provided by Jerry Schaack, University of
Colorado, Denver, Colo. The pTP gene was cloned under the control of
different promoters into p
E1sp1A derivatives (Microbix, Toronto,
Canada). To generate pRSV-pTP or pPGK-pTP, the pTP gene was inserted as 1.2-kb HindIII-EcoRI fragment into pAd.RSV or
pAd.PGK (26). To generate pCMV-pTP, a cytomegalovirus (CMV)
promoter-pTP gene bovine growth hormone polyadenylation signal (bpA)
containing the 4.1-kb NruI-SmaI fragment
(provided by J. Schaack) was inserted into pE1aSp1. To
generate pMT-pTP, the pTP gene was first cloned into pMRENeo
(53) and then transferred as a
NotI-XbaI fragment into pE1sp1A. The Ad Pol
expression plasmid pCMVpol was also provided by J. Schaack. The Pol
cDNA (Ad bp 5187 to 8357) contains a mutation at the C terminus to
create a SphI site that does not impair enzymatic activity.
To generate the test plasmid for pTP-mediated nuclear transport
(pITR-hAAT), a 0.8-kb fragment of pFG140 from bp 
382 to +452 (Microbix) containing two head-to-head joined Ad inverted terminal repeats (provided by Jim Nelson, Stanford University) was inserted as a
pTP-binding motif into the XhoI site of pBS-RSV.hAAT
(26) in front of the human 1-antitrypsin
(hAAT) expression cassette.
Plasmid DNA was purified by ultracentrifugation in two CsCl
gradients.
Ad vectors.
All Ad vectors were generated by homologous
recombination with pJM17 (Microbix) in 293 cells. The shuttle vectors
containing pTP expression cassettes based on pE1sp1A (Microbix) were
cotransfected with pJM17 into low-passage 293 cells by calcium
phosphate coprecipitation as previously described (35). The
plaque titers of all viruses were determined on 293 cells. The presence
of replication-competent Ad and contamination with endotoxin in virus
preparations were excluded by tests described previously
(35). Viruses with a titer of 5 × 1011
PFU/ml were stored at 80°C in 10 mM Tris-Cl (pH 8.0)-1 mM
MgCl2-10% glycerol. Attempts to generate an Ad vector
expressing Ad Pol under a CMV promoter were not successful.
Retrovirus vectors.
All retrovirus vectors were based on
MSCVneoEB (21). The murine stem cell virus (MSCV)-series
vectors were derived from LN and MESV vectors. They contain the
extended packaging signal from LN vectors for high viral titers with a
mutated MoMLV gag start codon and an upstream region derived
from Moloney murine sarcoma virus. A 1.4-kb hAAT cDNA containing the
EcoRI-EcoRI fragment derived from pBS-RSV.hAAT
was inserted into the EcoRI site of pMSCVneoEB in front of
the PGKneo cassette. The hAAT cDNA is under control of a variant long
terminal repeat from the retrovirus mutant PCMV (PCC4 embryonal
carcinoma cell-passaged myeloproliferative sarcoma virus)
(21). The pTP-binding sites were synthesized as
oligonucleotides and cloned as XhoI-BglII
fragments downstream of the hAAT cDNA into pMSCVneoEB. The
18-mer pTP-binding site (Ad nt 1 to 18) used for RV.18-hAAT was
assembled by annealing oligonucleotides (60)
5'TCGAGCATCATCAATAATATACCTTAGA and
5'GATCTCTAAGGTATATTATTGATGATGC. The mutated 18-mer
pTP-binding site used for RV.18-hAAT was assembled by annealing
oligonucleotides (59) 5'TCGAGCATCATCAGCGGCGCGTTTTAGA and 5'GATCTCTAAAACGCGCCGCTGATGATGC. The 90-mer pTP
binding site (Ad nt 1 to 90) used for RV.90-hAAT was assembled by
annealing oligonucleotides (62)
5'TCGAGCATCATCAATAATATA,
5'CCTTATTTTGGATTGAAGCCAATATGATAATGAGGA, 5'GATCTCCTCATTATCATATTGGCTT, and
5'CAATCCAAAATAAGGTATATTATTGATGATGC.
The correctness of all constructs was confirmed by sequencing.
Retrovirus vectors were generated as described previously
(
34).
Ecotropic virus generated following transient
transfection of
the vectors into PE501 cells was used to infect the
amphotropic
packaging line PA317. Transduced PA317 cells were selected
with
G418 (700 µg/ml) for 4 weeks. For each retrovirus vector, 40 individual
G418-resistant clones were screened for hAAT expression. The
clone
with the highest transgene expression for each vector was
amplified
and subjected to titer determination on mouse LTA cells by
counting
the number of G418-resistant colonies. The titers of the
corresponding
amphotropic viruses were as follows: RV.hAAT, 5 × 10
5 CFU/ml; RV.18-hAAT, 4 × 10
5 CFU/ml;
RV.
18-hAAT, 8.5 × 10
5 CFU/ml; and RV.90-hAAT,
4 × 10
5 CFU/ml.
Western blot analysis.
After pTP plasmid transfection or Ad
pTP gene transfer, cell pellets were lysed on ice for 30 min in 20 mM
HEPES (pH 7.5)-2 mM EGTA-10% glycerol-1% Triton X-100-0.1 M
dithiothreitol-and protease inhibitors. After 5 min of boiling, 80 µg of total protein in 1× Laemmli buffer with 4%
-mercaptoethanol was separated on a sodium dodecyl sulfate-10%
polyacrylamide gel. After electrotransfer and blocking, the filters
were incubated with monoclonal antibodies against pTP (gift from Sarah
Jones, University of St. Andrews, St. Andrews, United Kingdom) at a
dilution of 1:40 and then incubated with peroxidase-labeled anti-mouse
immunoglobulin antibodies (1:1,000). The filters were developed with
the ECL detection kit (Amersham, Burlington, Mass.).
Cell lines.
293 cells (Microbix), LTA cells (American Type
Culture Collection, Rockville, Md.) (61), and neonatal
primary human foreskin fibroblasts (46) were grown in
Dulbecco's modified Eagle's medium (DMEM) plus 10% fetal calf serum
(FCS). Stationary-phase fibroblasts were maintained in DMEM plus 5%
FCS and 1 µM dexamethasone (46). For cell cycle arrest,
LTA cells were presynchronized by serum starvation and then incubated
with either 10 mM hydroxurea or 2 µg of aphidicolin per ml. Selection
for G418 resistance was performed by trypsinizing the cell cultures in
6-cm dishes and plating them as single-cell suspensions in 10-cm dishes
in the presence of 600 µg of active G418 per ml. For studies with the ZnSO4-inducible pMRE-pTP construct, FCS was pretreated to
eliminate potentially interfering heavy-metal traces by filtration
through Chelex 100 resin (Bio-Rad, Hercules, Calif.). A 50-ml volume of FCS was applied to a column matrix formed of 5 g of resin. The procedure was repeated 5 times. The in situ cell death detection kit
(Boehringer Mannheim) was used to quantify apoptosis in LTA cells as
specified by the manufacturer.
Plasmid transfection and virus infection.
For standard
transfections, 5 × 105 LTA cells in 6-cm dishes were
transfected by calcium phosphate coprecipitation with 10 µg of
plasmid DNA. The transfection efficiency was between 30 and 35% as
determined by X-Gal
(5-bromo-4-chloro-3-indolyl--D-galactopyranoside) staining of a parallel transfection with 10 µg of test plasmid plus 1 µg of pCMV-lacZ. If the transfection efficiency was less than 30%,
the test plasmid was reprepared and transfection was repeated with
double CsCl-banded DNA. For Ad infections, cells in 6-cm dishes or
12-well plates were incubated overnight with virus in 2 or 0.5 ml of
DMEM plus FCS, respectively. The multiplicity of infection (MOI) that
infected 100% of cells was 1,000 for LTA cells and 2,000 for human
fibroblast as determined by infection with Ad.RSVbGal (26)
and subsequent X-Gal staining. For retroviral infection, cells in 6-cm
dishes or 12-well plates were incubated for 2 h at an MOI of 1 in
a total volume of 2 or 0.5 ml, respectively. Fresh supernatant from
retroviral packaging cells was filtered though 0.45-µm-pore-size
filters, diluted with DMEM plus FCS, supplemented with 4 µg of
Polybrene per ml, and immediately used for infection. Test cells were
incubated with retrovirus for 2 h and then extensively washed.
Southern analysis.
Nuclei were isolated from transfected
cells by Nonidet P-40 cell lysis and centrifugation though a sucrose
step gradient as described by Fitzgerald et al. (15).
Extraction of genomic DNA and Southern analysis were performed as
described previously (35). Loading differences were adjusted
by rehybridization of the filters with a fragment of the mouse
metallothionein gene. The following DNA fragments were used as labeled
probes: a 1.4-kb fragment of the hAAT cDNA (EcoRI fragment
of pAd.RSVhAAT [26]), and a 2-kb fragment of the mouse
metallothionein gene (HindIII-EcoRI fragment of pmMMT [67]).
PCR.
For semiquantitative PCR, a specific competitor plasmid
was constructed by inserting a blunted 2.3-kb HindIII
-DNA fragment into the EcoRV site of the hAAT cDNA in
pRSV.hAAT (26). A 500-ng portion of genomic DNA from
isolated nuclei was spiked with competitor plasmid DNA corresponding to
0.1 copy per cell and subjected to PCR with hAAT-specific primers
(5' ATGCCGTCTTCTGTCTCGTGG and 5' GCACGGCCTTGGAGAGCTTC)
and PCR buffer containing 1.5 mM MgCl2 and 2.5 U of
Taq polymerase (Perkin-Elmer) in a total volume of 100 µl.
The PCR was run for 20 or 30 cycles (1 min at 95°C, 1 min at 60°C,
and 1 min at 72°C). Then 10 µl of the reaction product was analyzed
by electrophoresis in a 0.8% agarose gel.
BrdU labeling.
Bromodeoxyuridine (BrdU) labeling reagent
(Amersham) was added to the culture medium (1:1,000 dilution) for a
specific period (1, 4, or 24 h [see the figure legends]). After
metabolic labeling, the cells were washed twice with phosphate-buffered
saline and fixed with acetic alcohol for 30 min at room temperature.
Endogenous peroxidase activity was blocked by incubation with 0.03%
methanol for 30 min at room temperature. The cells were incubated in
1.5 N HCl for 15 min at 37°C, blocked with 10% FCS, and incubated with anti-BrdU antibodies (DAKO; 1:50 diluted in 10% FCS). Specific antibody binding was enhanced and developed with Vectastain ABC kit
(Vector Laboratories, Burlingame, Calif.). To quantify S-phase cells,
the number of BrdU-positive cells per 1,000 cells was counted from
random fields.
ELISA.
hAAT concentrations were determined by enzyme-linked
immunosorbent assay (ELISA) as previously described (26).
The detection limit of the assay was 500 pg/ml. Culture supernatants
were used undiluted for hAAT detection.
| |
RESULTS |
pTP-mediated nuclear import of transfected plasmid DNA into
arrested cells.
Transfection of plasmid DNA into cells represents
a simple model system for studying nuclear import of DNA in nondividing cells. It is generally known that the efficiency of plasmid
transfection by calcium phosphate coprecipitation depends on the
proliferative stage of target cells and is inefficient in confluent or
growth-arrested cells (18). A number of studies with
synchronized cells or regenerating tissues in vivo have demonstrated
that mitosis with nuclear membrane breakdown is a prerequisite for
efficient transfection measured by reporter gene expression (58,
66, 71). A simple diffusion of plasmid DNA through the nuclear
membrane is impossible due to the high molecular mass (1 kb = 618 kDa) and the large gyration radius (12, 45). Previously, it
was hypothesized that karyophilic, DNA-binding proteins would improve
plasmid transfection into nondividing cells (22, 29). To
test this, we investigated whether pTP can mediate nuclear transport of
plasmids carrying pTP-binding sites after transfection into nondividing cells.
To express pTP in test cells, we generated a number of constructs with
the pTP gene under the control of promoters, which
varied in their
activity. This was done because a priori it was
not clear which level
of pTP expression would allow for nuclear
import of DNA and would, at
the same time, avoid cytotoxicity.
Earlier attempts to establish
stable, pTP-expressing cell lines
indicated that at a certain
expression level, pTP can induce cell
cycle arrest or apoptotic cell
death (
28,
49). To provide
pTP expression at different
levels, the strong CMV and Rous sarcoma
virus (RSV) promoters, the
relatively weak phosphoglycerate kinase
(PGK) promoter (
26),
and a metal-inducible promoter (MRE/MT)
(
53) were used. All
constructs were assembled in p
E1sp1A, a
shuttle plasmid subsequently
used for production of first-generation,
E1-deleted Ad vectors. Ad
vectors with pTP expression cassettes
were generated to facilitate pTP
gene transfer in vitro into nondividing
cells.
In preliminary experiments, we selected the murine fibroblast cell line
LTA (
61) as an in vitro test cell system because
this cell
line can be transfected by calcium phosphate coprecipitation
with a
relatively high efficiency (>30%) and can easily be cell
cycle
arrested. pTP was expressed in mouse LTA cells after transfection
of
pTP expression plasmids or Ad gene transfer. On day 3 after
transfection or infection, the amount of expressed pTP was analyzed
by
Western blotting with pTP-specific antibodies (Fig.
1). To
correlate pTP expression levels
with cytotoxicity, the percentage
of apoptotic cells measured by a
terminal deoxynucleotidyl transferase-mediated
dUTP nick end labeling
(TUNEL) assay was determined in a parallel
set of pTP-expressing test
cells. Generally, pTP (77kDa) expression
levels were higher after Ad
gene transfer than after plasmid transfection.
About half of the pTP
expressed after Ad gene transfer was converted
into TP (55 kDa),
probably by the Ad protease expressed in transduced
LTA cells. Notably,
a low level of pTP expression was observed
in LTA cells infected with a
first-generation control Ad vector
(Ad.CMV-bGal), indicating that the
E2 promoter is active in these
cells. RSV and CMV promoters yielded
similarly high levels of
pTP expression after transfection or
infection. In comparison,
pTP levels were about threefold lower when
the PGK promoter was
used. Expression of pTP was maintained for at
least 7 days after
transfection or infection (data not shown). Basal,
noninduced
expression from the transfected pMRE-pTP construct was
barely
detectable. HAAT expression was ~15-fold induced in the
presence
of ZnSO
4 added 36 h before protein analysis.
After removal of
ZnSO
4, pTP expression returned to baseline
levels within 24 h
(data not shown). In cells infected with the
MRE promoter-containing
Ad vector (Ad.MRE-pTP), there was a high level
of basal expression,
which was comparable to that from Ad.PGK-pTP (data
not shown).
We recently reported that the MRE promoter in Ad vectors is
transactivated
by viral enhancers (D. Steinwaerder and A. Lieber,
submitted for
publication). Because of this undesirable interference,
Ad.MRE-pTP
was excluded from further experiments.
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
pTP expression and pTP-associated cytotoxicity after
plasmid transfection or Ad infection of LTA cells. pTP was expressed in
mouse LTA cells after transfection of expression plasmids (left) or Ad
gene transfer (right). On day 3 after transfection or infection, the
amount of expressed pTP was analyzed in cell lysates by Western
blotting with pTP-specific antibodies. The molecular masses of pTP and
TP are 77 and 55 kDa, respectively. pBHG10 (Microbix) contains the pTP
gene under its endogenous E2 promoter. LTA cells transfected with the
ZnSO4-inducible construct pMRE-pTP were cultured in DMEM
plus 10% pretreated FCS. At 36 h before protein analysis, 100 µM ZnSO4 was added to one set of cells (+Zn). To analyze
cytotoxic effects associated with pTP expression, the percentage of
TUNEL-positive cells was determined on day 3 after transfection or
infection by using the in situ cell death detection kit from Boehringer
Mannheim. SEM, standard error of the mean (n = 3).
|
|
High-level pTP expression in cells transfected with pCMV-pTP and
pRSV-pTP or after infection with pTP-expressing Ad was associated
with
cytotoxicity (Fig.
1, bottom). Importantly, in cells transfected
with
pMRE-pTP, noninduced pTP expression and transient induction
of pTP
expression over 36 h had no toxic effects. However, attempts
to
establish pTP-expressing, stable cell lines after cotransfection
of
pMRE-pTP, together with a selectable marker, were not successful.
Taken
together, the data show that pTP expression exerted cytotoxic
side
effects in a concentration-dependent manner, which complicated
the
experimental strategies. Therefore, all further experiments
studying
the effect of pTP on retroviral transduction were designed
by using
transiently induced pTP expression after transfection
of pMRE-pTP or
short-term assays after infection with Ad.PGK-pTP.
To generate the "target" plasmid for pTP-mediated nuclear
transport, a fragment of Ad DNA containing two head-to-head-joined
Ad
ITRs was used as a pTP-binding motif and cloned in front of
a reporter
gene (hAAT) expression cassette (pITR-hAAT) (Fig.
2A).
The full-length Ad
ITR was chosen as the pTP-binding motif because
it represented the
native structure used during the Ad life cycle.
The control plasmid
(phAAT) contained the same transgene cassette
without the Ad ITRs.
View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
pTP-mediated nuclear import of transfected plasmid DNA.
(A) Test plasmids to study pTP-mediated nuclear import of plasmid DNA.
(B) Scheme of the experiment (see Results for a detailed description).
Cells were transfected with pMRE-pTP in a proliferative stage. One set
of cells was arrested in the cell cycle by adding 10 mM hydroxyurea
(HU) to serum-starved cells 48 h before transfection of test
plasmids. Nucleus-localized plasmid DNA was analyzed by Southern
blotting 24 h after transfection. At 48 h after transfection,
the hAAT concentrations in culture supernatants were measured by ELISA. (C) After transfection, cells were lysed and
nuclei were purified by centrifugation though a sucrose step gradient.
Genomic DNA was isolated from purified nuclei and subjected to Southern
analysis with a 32P-labeled (1.4-kb) probe specific to the
hAAT cDNA. For Southern analysis, 10 µg of genomic DNA was loaded per
lane. All blots were rehybridized with a 32P-labeled
fragment of the mouse metallothionein gene (67) to adjust
for loading differences. Southern blots from three independent
experiments were quantified by PhosphorImager analysis, and adjusted
signals were expressed as arbitrary units based on plasmid
concentration standards loaded on each gel. (D) At 48 h after
transfection of the test plasmids, a separate set of transfected cells
was analyzed by ELISA for hAAT expression. + pTP, pTP expression was
induced by ZnSO4. Means and standard deviations of three
determinations are given.
|
|
pTP-mediated nuclear import of plasmid DNA was investigated in parallel
in dividing and in arrested cells (Fig.
2B). Cells
were arrested in
G
1/S phase by serum starvation and treatment
with
hydroxyurea, a nonspecific inhibitor of DNA synthesis (
6).
Cell cycle arrest was assessed by quantifying the number of cells
in S
phase based on BrdU incorporation. During the proliferative
stage, 78%
of cells were BrdU positive, whereas in arrested cells,
only 7% of all
cells passed the S phase during the 4 h of exposure
to BrdU. To
analyze pTP-mediated nuclear import of plasmid DNA,
LTA cells were
transfected with pMT-pTP and pTP expression was
induced in one set of
cells. At 36 h after induction of pTP expression,
proliferating or
arrested cells were transfected with the test
plasmid (phAAT or
pITR-hAAT). At 24 h after pITR-hAAT or phAAT
transfection, the
concentration of plasmid DNA translocated to
the nucleus was measured.
To do this, genomic DNA extracted from
isolated nuclei was analyzed by
Southern blotting with a hAAT
cDNA-specific probe (Fig.
2C). All
proliferating cells had a strong
transgene-specific signal from nuclear
DNA 24 h after transfection;
in arrested cells, efficient nuclear
localization was observed
only in pTP-expressing cells transfected with
pITR-hAAT. Transfection
with pITR-hAAT alone without pTP coexpression
and pTP expression
in combination with the control plasmid, phAAT, did
not confer
nuclear localization upon plasmid DNA in arrested cells.
Plasmid
DNA detected from isolated nuclei could result from nuclear
import
or from plasmid DNA associated with the outer surface of the
nuclear
membrane, without translocation. To distinguish between these
possibilities, hAAT expression was analyzed after transfection
(Fig.
2D). Transgene expression could occur only if the corresponding
expression plasmid had been imported into the nucleus, where the
transcriptional machinery is located. In arrested cells, high-level
hAAT expression was observed only in pTP-expressing cells transfected
with pITR-hAAT. The level of transgene expression in this case
was
comparable to that from transfected proliferating cells. Taken
together, this demonstrates that nuclear import of plasmid DNA
is
hampered in nondividing cells, confirming the reported observation
that
mitosis is a prerequisite for efficient plasmid transfection
(by
calcium phosphate coprecipitation). Importantly, transient
pTP
expression can mediate nuclear import of plasmid DNA carrying
pTP-binding
sites.
Effect of pTP-mediated nuclear import of viral DNA on transduction
of nondividing cells.
Preliminary plasmid transfection studies
supported our hypothesis that pTP may allow the nuclear import of MoMLV
viral DNA carrying pTP-binding sites in nondividing cells. In the next
step, we generated MoMLV-based retroviruses containing the hAAT cDNA expression cassette together with a neo expression unit
(RV.hAAT/neo) (Fig. 3). Attempts
to introduce the Ad ITR fragment into retrovirus vectors resulted in
viruses with very low titers (<102 CFU/ml), indicating
that these elements affected retroviral replication. In contrast,
amphotropic retrovirus vectors containing only the minimal pTP-binding
motif, an 18-mer oligonucleotide (60), could be produced at
high titers (RV.18-hAAT/neo). The pTP-binding site was placed in the
center of the recombinant vector genome between hAAT and the
neo cassette to avoid potential interference of pTP binding
with the formation and function of the retroviral preintegration complex, which is thought to be associated with the LTRs. To
differentiate between effects mediated by pTP binding and subsequent
nuclear localization and other possible nonspecific effects of pTP on retroviral transduction (e.g., increased intracellular half-life), a
control vector that contained a mutated pTP binding site
(RV18.hAAT/neo) was generated. It has been previously shown that
this sequence is not recognized by pTP or TP (59, 60). pTP
binds to the Ad origin with higher affinity in complex with Ad Pol and
NFI. DNA binding of this complex involves nt 1 to 90 of the Ad ITR. To
test whether a strengthened interaction of pTP can improve nuclear DNA
import, MoMLV vectors containing the 90-mer binding motif were
generated (62). All retrovirus vectors were produced in
amphotropic packaging cell lines with titers of ~4 × 105 to 8 × 105 CFU/ml (measured on LTA
cells based on G418-resistant colonies).
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
Retrovirus vectors carrying pTP-binding sites. All
vectors were based on MSCVneoEB (21) and contained the hAAT
cDNA under the control of the retroviral LTR and the neo
gene under the control of the PGK promoter. pTP- or pTP-Pol-NFI-binding
sites were inserted into the center of the retroviral genome to avoid
potential interference with the formation and stability of the
preintegration complex. RV.18-hAAT/neo contained a mutated
pTP-binding motif that is not recognized by pTP. The underlined
positions were mutated. The nucleotide numbers 1 to 18 and 1 to 90 refer to positions in Ad5 DNA. All viruses were produced in amphotropic
packaging cells at titers ranging from 4 × 105 to
8 × 105 CFU/ml.
|
|
In all further experiments, we used aphidicolin instead of hydroxyurea
to obtain a more complete cell cycle arrest. Aphidicolin
is a more
potent inhibitor of DNA polymerase
A 6-h treatment
with aphidicolin
arrested most of the cells (2% BrdU-positive
cells) when LTA cells
were presynchronized by serum starvation
(Fig.
4). According to a previous report, cell
cycle arrest by
aphidicolin occurs at the G
1/S border
(
43). Cell viability as
measured by plating efficiency after
trypsinization was decreased
by less than 10% when cells were treated
for 24 h with aphidicolin
prior to trypsinization (data not
shown). This is in agreement
with earlier reports demonstrating that
aphidicolin incubation
for 16 h (
43) or 24 h
(
16,
56) does not significantly affect
cell viability. For
retroviral transduction experiments, it was
important to determine the
kinetics of cell cycle progression
after removal of aphidicolin.
Therefore, after removal of aphidicolin,
the cells were pulse-labeled
with BrdU for 1 h intervals (Fig.
4). The percentage of cells
undergoing DNA synthesis peaked at
approximately 4 h and declined
by 6 h after aphidicolin removal,
indicating that most cells had
passed through S phase and had
entered the G
2/M phase by
this time.
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of cell cycle progression after arrest by
aphidicolin. LTA cells (~70% confluent) were presynchronized by
serum starvation for 2 days, resulting in 14% of cells passing the S
phase during the 4-h period of BrdU labeling. Cell cycle arrest was
completed by incubation with aphidicolin for 6 h, resulting in
only 2% of the cells replicating DNA in a 4-h interval. To monitor
cell cycle progression after removal of aphidicolin, different dishes
with cells were pulse-labeled with BrdU for 1-h intervals (hours 0 to
1, 1 to 2, 3 to 4, 5 to 6, and 7 to 8 after the removal of
aphidicolin). S-phase cells were counted for selected intervals. SEM,
standard error of the mean (n = 3).
|
|
To determine how long retroviruses that have successfully entered the
target cell retained their ability to integrate, the
intracellular
stability of retroviruses was estimated for each
test retrovirus vector
in arrested target LTA cells. The ability
to integrate and express the
transgene is a function of the time
between virus entry and the next
mitosis (
4). This period was
extended from ~6 to ~30 h
by varying the lengths of G
1/S arrest
mediated by
aphidicolin (Fig.
5). The total lengths
of these periods
include the time of aphidicolin treatment plus the
~6 h required
by LTA cells to enter the next mitosis after
aphidicolin is removed.
Retroviral transduction, as measured by
neo gene expression resulting
in G418-resistant colonies,
decreased to <1% when aphidicolin-mediated
cell cycle arrest was
extended for 4 h or more after completion
of retrovirus infection.
This implies that nearly all of the transduction-competent
virus was
inactivated or degraded when mitosis was delayed for
more than 10 h. This appears to be in agreement with the results
of an earlier study
in which, by a different method, the intracellular
half-life of
retrovirus vectors was measured to be 6.4 h (
4).
The data
shown for RV.18-hAAT/neo was representative of all four
test
retroviruses.
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 5.
Retroviral life span in arrested cells. Cells were
arrested as described for Fig. 4. Arrested cells were infected with
retrovirus (RV18.hAAT/neo) at an MOI of 1 for 2 h. After
infection, cell cycle arrest by aphidicolin was continued for different
periods, after which the cells were trypsinized and subjected to G418
selection. The number of G418-resistant colonies was determined after 3 weeks of selection. The selected periods of cell cycle arrest were
based on the consideration that the lag phase between aphidicolin
removal and next mitosis was assumed to be at least 6 h (Fig. 4).
The period between virus entry and mitosis (0 h of incubation with
aphidicolin) includes the 6 h that LTA cells require to enter the
next mitosis after aphidicolin was removed. This period was lengthened
by aphidicolin-mediated cell cycle arrest, which was extended for 0 to
24 h after virus infection. SEM, standard error of the mean
(n = 3).
|
|
A number of important parameters obtained in these studies were used in
our central experiments aimed to analyze the effect
of coexpressed pTP
on retrovirus transduction. These parameters
include the following: (i)
2 h after the removal of aphidicolin,
cells reentered the S phase
of the cell cycle, and (ii) treatment
with aphidicolin for 4 h or
more after retrovirus infection prevented
transduction, because all the
virus was inactivated or degraded
before the cells entered the next
mitosis.
To test whether pTP can mediate the nuclear import of viral DNA
carrying pTP-binding motifs and to analyze whether this effect
would be
more pronounced with pTP in complex with Ad Pol, proliferating
LTA
cells were transfected with pTP, pTP plus Pol, or control
plasmids
(Fig.
6A). After
transfection, the cells were arrested
by serum starvation and
aphidicolin treatment. Retrovirus infection
was performed at an MOI of
1 in arrested cells. Our first experimental
design was based on an
extended cell cycle arrest by incubation
with aphidicolin that was
continued for 4 h after retrovirus infection
(scheme I), which was
shown earlier to prevent transduction because
all viral preintegration
complexes were inactivated or degraded
before the infected cells could
enter the next mitosis. However,
in this scheme, transduction-competent
virus was still present
when cells entered the S phase (Fig.
6A).
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of pTP expression on retroviral nuclear import
and transduction (scheme I: treatment with aphidicolin extended for
4 h). (A) Scheme of the experiment. A total of 8 × 105 LTA cells (70% confluent) were transfected with 10 µg of pcDNA3 (Invitrogen) as control plasmid (Co), 5 µg of pMRE-pTP
plus 5 µg of pcDNA3 (pTP), or 5 µg of pMRE-pTP plus 5 µg of
pCMV-pol (pTP + Pol). After transfection, the cells were synchronized
by serum starvation and arrested in the cell cycle by aphidicolin.
Arrested cells were infected with retroviruses (RV.hAAT/neo,
RV.18-hAAT/neo, RV.18-hAAT/neo, or RV.90-hAAT/neo) at an MOI of 1 for 2 h. pTP expression was induced for the time of retrovirus
infection by addition of ZnSO4. Cell cycle arrest was
continued for 4 h after retrovirus infection. At this time point,
one set of infected cells was trypsinized and lysed, and genomic DNA
was extracted from isolated nuclei (see Materials and Methods). Another
set of dishes was analyzed for hAAT expression 3 days after infection
and then subjected to G418 selection. The number of G418-resistant
colonies was counted after 3 weeks of selection. As shown in Fig. 5, treatment with
aphidicolin for 4 h after retrovirus infection prevented
transduction, because all retroviral DNA was inactivated or degraded
before the infected cells could enter the next mitosis. However,
transduction-competent virus was still present when cells entered the S
phase. (B) Detection of nucleus-localized viral DNA by competitive PCR.
A 500-ng portion of genomic DNA isolated from purified nuclei was
spiked with ~0.1 copy per cell of competitor plasmid DNA and
subjected to PCR (20 cycles) with hAAT-specific primers. The PCR
product specific for the vector DNA is 1.1 kb. The PCR product derived
from the competitor template is 3.4 kb. PCR products were separated by
electrophoresis in 0.8% agarose gels. (C) Transgene expression after
pTP-mediated nuclear import of viral DNA in arrested cells. hAAT
expression in culture supernatants was analyzed by ELISA 3 days after
retrovirus infection. To determine the number of G418-resistant,
neo expressing clones, infected cells were trypsinized and
subjected to G418 selection for 3 weeks. Co, cells transfected with
control plasmid; pTP, cells transfected with pMRE-pTP with subsequent
induction by ZnSO4; pTP+Pol, cells transfected with
pMRE-pTP and pCMV-pol and induction with ZnSO4. Means and
standard deviations of three determinations are given.
|
|
After retroviral infection of arrested LTA cells followed by
aphidicolin treatment extended for 4 h, pTP-mediated nuclear
import of viral DNA was analyzed by competitive PCR of genomic
DNA
isolated from purified nuclei (Fig.
6B). PCR was performed
with
hAAT-specific primers. A strong vector-specific signal appeared
in
nuclear DNA from cells coexpressing pTP and viral DNA with
pTP-binding
sites. This signal was stronger in cells expressing
both pTP and Pol
and the RV.90-hAAT/neo DNA containing the extended
binding motif for
pTP, Pol, and NFI. This indicates that pTP can
mediate the nuclear
import of viral DNA carrying pTP-binding sites
into arrested cells and
that this process is enhanced by Ad Pol
(probably due to increased
pTP-binding affinity or possibly use
of the NLS present in Ad Pol).
Vector-specific background signals
were visible in all control lanes.
These signals probably originated
from the transduction of the small
percentage of nonarrested cells,
which were present at the time of
retroviral
infection.
Retroviral transduction was assessed based on transgene (hAAT and
neo) expression (Fig.
6C). hAAT expression was analyzed
3 days after infection. The number of stably transduced cells
was
determined based on the number of G418-resistant colonies
present after
3 weeks of selection. Significant hAAT expression
was observed only in
cells expressing pTP or pTP plus Pol and
containing viral DNA with the
corresponding binding motifs. Combined
expression of pTP and Pol
yielded higher transgene expression
in cells infected with
RV.90-hAAT/neo compared to cells containing
the pTP-binding motif alone
or cells infected with RV.90-hAAT/neo
without coexpressed Ad Pol. The
number of G418-resistant colonies
mirrored the transduction data
obtained based on hAAT expression,
suggesting that pTP-mediated
transduction is associated with stable
vector integration. For
comparison, transduction of proliferating
cells with the same MOI of
RV.18-hAAT/neo yielded about 50 times
more G418-resistant colonies than
in arrested cells with pTP-supported
import of retroviral DNA. Clearly,
there was a significant stimulation
of transduction supported by pTP;
however, this mechanism was
not as efficient as transduction during
cell
division.
These data indicate that pTP can mediate the nuclear import of viral
DNA and that this is sufficient for integration. However,
in
experimental scheme I, transduction-competent virus was still
present
when cells entered the S phase. To analyze whether in
addition to
pTP-mediated nuclear import, events occurring during
S phase are
critical for vector integration, treatment with aphidicolin
was
continued for 24 h (scheme II) after retrovirus infection
(Fig.
7A). During this period, all the virus
was degraded or inactivated
long before the infected cells could enter
either the S or M phase
according to data obtained earlier. Analysis of
nucleus-localized
viral DNA and retroviral transduction was performed
as described
for scheme I. No vector-specific signal was detectable by
competitive
PCR after 20 PCR cycles (data not shown). After 30 PCR
cycles,
vector-specific signals that were slightly stronger than
background
signals appeared in cells expressing pTP or pTP plus Pol
after
infection with RV.18-hAAT/neo or RV.90-hAAT/neo (Fig.
7B). This
indicates that most viral DNA had not integrated and was degraded
before analysis. It is thought that nonintegrated viral DNA is
not
protected from degradation by nucleases, which determines
the short
intracellular half-life of transduction-competent virus
(
4,
71). There was a low level of transduction (based on
hAAT
expression and formation of G418-resistant colonies) in cells
coexpressing pTP or pTP plus Pol and viral DNA with the corresponding
binding sites. However, in comparison, hAAT expression and formation
of
G418-resistant colonies was ~10-fold less efficient in scheme
II (24 h of aphidicolin) than in scheme I (4 h of aphidicolin).
View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of pTP expression on retroviral nuclear import
and transduction (scheme II: treatment with aphidicolin for 24 h).
(A) Scheme of the experiment. Cells were transfected with pTP-Pol
expression plasmids, arrested, and infected with retroviruses as
described for Fig. 6. After retrovirus infection, treatment with
aphidicolin was continued for 24 h. During this period, all virus
was degraded or inactivated long before the infected cells could enter
either the S or M phase. (B) Detection of nucleus-localized viral DNA
by competitive PCR. PCR was performed for 30 cycles under the
conditions described for Fig. 6B. (C) Transgene expression after
pTP-mediated nuclear import of viral DNA in arrested cells. hAAT and
long-term neo expression were analyzed as described for Fig.
6C.
|
|
Ad-mediated pTP gene transfer allows the expression of pTP in 100% of
test cells at a higher level than transfection with
pTP expression
plasmids. To test whether this property would change
the outcome of
retroviral transduction studies in arrested cells,
LTA cells were
infected with Ad.PGK-pTP or control virus (Ad.Co).
Subsequently,
arrested cells were infected with retrovirus, after
which incubation
with aphidicolin was continued for 4 or 24 h
according to the
experimental designs developed for Fig.
6 (scheme
I) and Fig.
7 (scheme
II). Retroviral transduction was evaluated
based on hAAT expression on
day 3 postinfection (Fig.
8). Analysis
for formation of G418-resistant colonies was not possible due
to the
cytotoxicity caused by the high level of pTP expression
after Ad gene
transfer. In agreement with the previously obtained
data, in scheme I
(4 h of aphidicolin) significant retroviral
transduction in
arrested cells was detected only in cells expressing
pTP after
Ad.PGK-pTP gene transfer, which were subsequently infected
with
vectors carrying pTP-binding sites (RV.18-hAAT/neo,
RV.90-hAAT/neo).
Transduction rates were approximately 20-fold
lower with these
retrovirus vectors in cells after infection with the
first-generation
control vector (Ad.Co), which had yielded a low level
of pTP expression
in transduced LTA cells (Fig.
1). Transgene
expression was not
detectable in cells not infected with Ad or in cells
infected
with the control retroviruses (RV.hAAT/neo or
RV.
18h-AAT/neo).
Prolonged cell cycle arrest after retrovirus
infection (24 h of
aphidicolin) resulted in ~20-fold-lower retroviral
transduction
rates in pTP-expressing cells infected with retroviruses
carrying
pTP-binding sites.
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 8.
Retroviral transduction in arrested LTA cells after
Ad-mediated pTP gene transfer. Arrested LTA cells without prior Ad
infection (no Ad), transduced with Ad.RSVbGal (34) (Ad.Co),
or transduced with Ad.PGK-pTP (Ad.pTP) were infected with retroviruses
as described for Fig. 6. One set of cells was incubated with
aphidicolin for 4 h after retrovirus infection (scheme I), and
another set was incubated for 24 h (scheme II). hAAT levels were
measured on day 3 after retrovirus infection. Means and standard
deviations of three determinations are given.
|
|
In conclusion, it appears that pTP can support the nuclear import of
viral DNA carrying pTP-binding sites. Coexpression of
Pol enhances this
process. However, pTP-mediated nuclear import
is not sufficient for
transduction in long-term-arrested cells.
Our data indicates that in
addition to nuclear localization, events
occurring during S phase are
required for MoMLV integration and
stable
transduction.
So far, for convenience, we have used artificially arrested test cells
for retroviral transduction studies. To exclude the
possibility that
aphidicolin nonspecifically affects cellular
factors necessary for
retroviral integration, another cell culture
system was used as a model
to test the pTP-mediated retroviral
transduction of nondividing cells.
Primary neonatal human foreskin
fibroblast cultures contain only 2 to
4% of cells passing through
the S phase each day when maintained as
confluent monolayers at
a reduced serum concentration (
46,
47). However, transfection
of these cells is extremely
inefficient (data not shown). Therefore,
for transduction studies, pTP
expression was provided by infection
with Ad.PGK-pTP at an MOI of
2,000, which allowed the transduction
of all cells. Retrovirus vectors
were applied to arrested cells
(at an MOI of 1) 2 days after Ad
infection, and hAAT expression
was measured on day 3 after retrovirus
infection to assess retroviral
transduction. hAAT levels after
infection of stationary human
fibroblasts were detectable only in
pTP-expressing cells after
infection with retroviruses carrying
pTP-binding sites (Fig.
9A).
However,
transgene expression was about 300-fold lower than retroviral
infection
of dividing fibroblasts (ranging from 145 to 167 ng/ml
for RV.hAAT/neo,
RV.
18-hAAT/neo, RV.18-hAAT/neo, and RV.90-hAAT/neo).
This
underscores our conclusion that pTP-supported nuclear import
is not
sufficient to allow significant transduction of nondividing
cells.
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 9.
Retroviral transduction of primary human fibroblasts
after pTP expression and induction of DNA repair synthesis. (A)
Stationary-phase human fibroblast cultures without prior Ad infection
(no Ad), transduced with Ad.RSVbGal (34) (Ad.Co), or
transduced with Ad.PGK-pTP (Ad.pTP) were infected with retroviruses at
an MOI of 1. At the time of retrovirus infection, less than 3% of the
cells were in S phase. At 48 h after retrovirus infection, hAAT
levels in culture supernatants were measured by ELISA. hAAT levels
detected in pTP-expressing cells (Ad.pTP) were statistically different
from those in Ad.Co-infected cells (P  0.002) (as
determined by the Student t test assuming a normal
distribution). (B) Stationary-phase human fibroblast cultures were
pretreated overnight with distamycin A (5 × 10 6 M),
aphidicolin (2 µg/ml), or
[methyl-3H]thymidine (10 µCi/ml). After
distamycin or aphidicolin treatment, the cells were washed and infected
with retrovirus. Incubation with
[methyl-3H]thymidine was continued during
retrovirus infection. At 48 h after retrovirus infection, hAAT
levels in culture supernatants were measured by ELISA. Means and
standard deviations of three determinations are given.
|
|
This model for nondividing cells allowed us to study whether in
addition to pTP-mediated nuclear import, pretreatment with
agents that
stimulates DNA repair synthesis would increase retroviral
transduction.
Previous studies with recombinant adeno-associated
virus vectors have
demonstrated that DNA synthesis inhibitors
or DNA-damaging agents can
induce unscheduled DNA synthesis or
DNA repair pathways, resulting in
an increased transduction of
nondividing cells by rAAV vectors (
2,
46). To test whether
this had an effect on our system, stationary
fibroblasts infected
with Ad.pTP or Ad.Co were exposed to
[
3H]thymidine (10 µCi/ml), as a DNA-damaging agent
(
2), or the
DNA synthesis inhibitors aphidicolin or
distamycin A (
72) prior
to retrovirus infection. As shown in
Fig.
9, pretreatment with
these agents, which were able to induce
cellular DNA repair enzymes,
stimulated retroviral transduction;
however, this occurred only
in combination with pTP-mediated nuclear
import of viral DNA.
Notably, transduction rates as measured based on
transient hAAT
expression were still 20 to 30 times lower than
infection of dividing
cells.
| |
DISCUSSION |
Transduction with MoMLV-based retrovirus vectors does not occur in
nondividing cells. It is thought that this phenomenon is related to an
inability of the MoMLV preintegration complex to cross the nuclear
membrane due to the absence of competent NLS in viral proteins
associated with the incoming virion. In contrast to MoMLV, Ad
efficiently infects nondividing cells, and this property is probably
due to the presence of NLS in viral proteins, in particular the
terminal protein. Furthermore, there is increasing evidence from other
viral systems that NLS within viral proteins are crucial for nuclear
translocation of viral genomes. For influenza virus, the nuclear entry
of the viral genome is mediated by an NLS in the nucleoprotein
component of the viral RNA-protein complex (10). A similar
mechanism of nuclear localization of the viral genome seems to exist
for simian virus 40, mediated by its small structural proteins Vp2 and
Vp3 (7). Importantly, for both influenza virus and simian
virus 40, quiescent cells are among their natural targets. Members of
another retrovirus subfamily, the lentiviruses, do not require mitosis
for transduction. It is thought that this property is based on active
transport of the preintegration complex into the nucleus of an infected
cell without the requirement for nuclear envelope breakdown during cell
division (23, 40, 41).
pTP mediates nuclear import of plasmid DNA with pTP-binding sites
in nondividing cells.
The hypothesis underlying this study was
that coexpression of the Ad pTP with viral MoMLV DNA carrying
pTP-binding sites would facilitate nuclear import of the preintegration
complex in nondividing cells and that this would be sufficient to allow
retroviral transduction. To support this hypothesis, we demonstrated
with arrested cells that pTP mediated the efficient nuclear import of
transfected plasmid DNA carrying pTP-binding sites. This is in
agreement with a study from 1984 demonstrating that transfection of Ad
DNA attached to pTP or TP was several orders of magnitude more
efficient than transfection of viral DNA without pTP or TP
(22). It underscores the point that nuclear transport is a
limiting step for transfection and that nuclear entry of plasmid DNA
could be improved by DNA-bound karyophilic proteins. Moreover, a recent
report noted that plasmid DNA is rapidly degraded by cytosolic
nucleases and that transfection is more efficient the faster the DNA is
translocated to the nucleus (29).
pTP mediates nuclear import of viral MoMLV DNA containing
pTP-binding sites.
In arrested cells, pTP mediated the nuclear
import of MLV DNA carrying pTP-binding sites. This allowed retroviral
transduction in arrested cells that were later released into S phase
while transduction-competent virus was still present. However,
pTP-mediated transduction rates in arrested cells were still lower than
in proliferating cells. There may be several explanations for this. For
example, the affinity of pTP binding to viral DNA may be too low, which
might limit the efficiency of nuclear translocation. This is supported
by our observation that pTP-mediated nuclear import and transduction
was increased by Ad Pol, which presumably increases the affinity of pTP
binding to DNA. On the other hand, weak pTP binding may be advantageous
by allowing rapid dissociation. Otherwise, this complex could be
tightly associated with the nuclear matrix via pTP, which may decrease
the efficiency of integration. Alternatively, pTP binding within the
central region of viral DNA may affect the composition, stability, or
activity of the preintegration complex, for example, resulting perhaps
in the loss of viral integrase. However, it is thought that the
preintegration complex, or the so-called intasome, is organized around
several hundred base pairs at each end of the viral DNA (69,
70), which makes it unlikely that pTP bound in the middle of the
viral DNA could critically affect integration. Finally, the
concentration of nucleotides available for reverse transcription of
retroviral genomes may be a limiting factor in nondividing cells.
Requirement of S phase or DNA repair for MoMLV integration.
From the data obtained in this study, we concluded that nuclear
translocation of MoMLV DNA is not sufficient for stable transduction and that additional cellular factors activated during S phase or DNA
repair are required to mediate integration and stable transduction of
nondividing cells. It is now generally accepted that cellular proteins
are required for retroviral integration, and it is speculated that the
activity of some of these accessory cellular proteins is regulated in a
cell cycle-specific manner. Although the purified integrase protein is
sufficient to carry out 3' processing and DNA strand transfer in
cell-free systems, viral integration is several orders of magnitude
more efficient in cells, indicating that cellular factors are involved
in the process of integration (70). Among the host proteins
that are potentially involved in MoMLV integration are BAF
(30), INI 1 (25), HMG 1 (1), HMGI(Y)
(13), and cellular DNA repair enzymes. During the process of
MoMLV integration, the 5' ends of the viral DNA and the 3' ends of the
target DNA remain unjoined, and cellular repair enzymes are believed to
be responsible for degradation of the unpaired nucleotides at the 5'
ends of the viral DNA, filling in the single-strand gaps, and for the
subsequent ligation to complete the integration process (8).
A recent study has demonstrated that retroviral integration
intermediates are detected as DNA damage by the host cell that and
completion of the integration process requires the DNA-dependent
protein kinase-mediated DNA repair pathway (9). Importantly,
DNA-dependent protein kinase is regulated in a cell cycle-dependent
manner, with peaks of activity during the G1 and early S
phases (31). In light of this, we speculate that viral DNA
imported to the nucleus by pTP symport is rapidly degraded when not
integrated and that integration requires cellular factors, which are
not activated in artificially arrested LTA cells or quiescent fibroblasts.
Alternatively, serum starvation or aphidicolin treatment may perturb
cellular metabolism, which may affect retrovirus integration
independently of the cell cycle requirements. Moreover, retroviral
integration may require a specific chromatin structure, which
is not
present in arrested cells. There are a number of reports
stating that
MoMLV integration depends on the methylation or heterochromatinization
state of chromosomal DNA (
27,
44,
50,
64).
At this point, the question arises of how lentiviruses integrate in
nondividing cells. It is thought that viral proteins can
mediate the
nuclear translocation of the human immunodeficiency
virus type 1 preintegration complex. Vpr appears to play a central
role in this
process (
40,
41). Interestingly, Vpr is known
to interfere
with cell cycle checkpoint control and is associated
with the induction
of chromosomal breaks and DNA repair synthesis
(
36,
54). The
potential property of lentivirus proteins to
induce cell
cycle-dependent host proteins, together with a longer
intracellular
half-life for lentivirus DNA, may be beneficial
for integration in
nondividing cells. In this context, a number
of reports noted that
although mitosis is not required for transduction
by lentiviruses or
lentivirus vectors, cell cycle progression
through G
1/S
significantly increased transduction efficiencies
(
32,
52,
57).
Our study demonstrates that in arrested cells, the karyophilic,
DNA-binding Ad protein pTP mediated the nuclear import of
plasmid or
MoMLV DNA carrying pTP-binding sites. This observation
may provide a
rationale for improving plasmid transfection techniques
or nonviral
gene transfer, particularly in nondividing cells.
Instead of pTP, which
exerts cytotoxic side effects, synthetic
proteins, which contain
strong, sequence-specific DNA-binding
domains fused to strong NLS, may
be a better alternative to include
in nonviral delivery systems.
Furthermore, our finding that nuclear
import of MoMLV viral DNA is not
sufficient for integration and
appears to require cell cycle-dependent
cellular factors contributes
to a better understanding of retroviral
transduction.
| |
ACKNOWLEDGMENTS |
We thank Chen-Yi He for technical assistance and Cheryl Carlson
for critical discussion. We are grateful to David Russell (University
of Washington) for providing human primary fibroblasts.
This work was supported by the Cystic Fibrosis Foundation (A.L.) and
NIH-DK49022 (M.A.K.).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Medical Genetics, Box 357720, University of Washington, Seattle, WA
98195. Phone: (206) 221-3973. Fax: (206) 685-8675. E-mail:
lieber00{at}u.washington.edu
| |
REFERENCES |
| 1.
|
Aiyar, A.,
P. Hindmarsh,
A. M. Skalka, and J. Leis.
1996.
Concerted integration of linear retroviral DNA by the avian sarcoma virus integrase in vitro: dependence on both long terminal repeat termini.
J. Virol.
70:3571-3580[Abstract].
|
| 2.
|
Alexander, I. E.,
D. W. Russell, and A. D. Miller.
1994.
DNA-damaging agents greatly increase the transduction of nondividing cells by adeno-associated virus vectors.
J. Virol.
68:8282-8287[Abstract/Free Full Text].
|
| 3.
|
Andreadis, S.,
A. O. Fuller, and B. O. Palsson.
1998.
Cell-cycle dependence of retroviral transduction: an issue of overlapping time scales.
Biotechnol. Bioeng.
58:272-281[CrossRef][Medline].
|
| 4.
|
Andreadis, S. T.,
D. Brott,
A. O. Fuller, and B. O. Palsson.
1997.
Moloney Murine Leukemia Virus-derived retroviral vectors decay intracellularly with a half-life in the range of 5.5 to 7.5 hours.
J. Virol.
71:7541-7538[Abstract].
|
| 5.
|
Angeletti, P. C., and J. A. Engler.
1996.
Tyrosine kinase-dependent release of an adenovirus preterminal protein complex from the nuclear matrix.
J. Virol.
70:3060-3067[Abstract].
|
| 6.
|
Brooks, R. F.
1976.
Regulation of fibroblast cell cycle by serum.
Nature
260:248-250[CrossRef][Medline].
|
| 7.
|
Clever, J., and H. Kasamatsu.
1991.
Simian virus 40 VP2/3 small structural proteins habor their own nuclear transport signal.
Virology
181:78-90[CrossRef][Medline].
|
| 8.
|
Coffin, J. M.
1996.
Retroviridae: the viruses and their replication, p. 1767-1848.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 9.
|
Daniel, R.,
R. A. Katz, and A. M. Skalka.
1999.
A role for DNA-PK in retroviral DNA integration.
Science
284:644-647[Abstract/Free Full Text].
|
| 10.
|
Davey, J.,
N. J. Dimmock, and A. Colman.
1985.
Identification of the sequence responsible for the nuclear accumulation of the influenza virus nucleoprotein in Xenopus oocytes.
Cell
40:667-675[CrossRef][Medline].
|
| 11.
|
Dean, D. A.
1997.
Import of plasmid DNA into the nucleus is sequence specific.
Exp. Cell Res.
230:293-302[CrossRef][Medline].
|
| 12.
|
Dowty, M. E.,
P. Williams,
G. Zhang,
J. E. Hagstrom, and J. A. Wolff.
1995.
Plasmid DNA entry into postmitotic nuclei of primary rat myotubes.
Proc. Natl. Acad. Sci. USA
92:4572-4576[Abstract/Free Full Text].
|
| 13.
|
Farnet, C. M., and F. D. Bushman.
1997.
HIV-1 cDNA integration: requirement for HMGI (Y) protein for function of preintegration complexes in vitro.
Cell
88:483-492[CrossRef][Medline].
|
| 14.
|
Feldherr, C. M., and D. Akin.
1994.
Variations in signal-mediated nuclear transport during the cell cycle in BALB/c 3T3 cells.
Exp. Cell Res.
215:206-210[CrossRef][Medline].
|
| 15.
|
Fitzgerald, M. E.,
E. Webber,
J. Donovan, and N. Fausto.
1995.
Rapid DNA binding by nuclear factor kappaB in hepatocytes at the start of liver regeneration.
Cell Growth Differ.
6:417-427[Abstract].
|
| 16.
|
Fox, M. H.,
R. A. Read, and J. S. Bedford.
1987.
Comparison of synchronized Chinese Hamster Ovary cells obtained by mitotic shake-off, hydroxyurea, aphidicolin, or methotrexate.
Cytometry
8:315-320[CrossRef][Medline].
|
| 17.
|
Fredman, J. N., and J. A. Engler.
1993.
Adenovirus precursor to terminal protein interacts with the nuclear matrix in vitro and in vivo.
J. Virol.
67:3384-3395[Abstract/Free Full Text].
|
| 18.
|
Graham, F. L., and A. J. van der Eb.
1973.
A new technique for the assay of infectivity of human adenovirus 5 DNA.
Virology
52:456[CrossRef][Medline].
|
| 19.
|
Hajihosseini, M.,
L. Iavachev, and J. Price.
1993.
Evidence that retroviruses integrate into post-replication DNA.
EMBO J.
12:4969-4974[Medline].
|
| 20.
|
Harel, J.,
E. Rassart, and P. Jolicoeur.
1981.
Cell cycle dependence of synthesis of unintegrated viral DNA in mouse cells newly infected with murine leukemia virus.
Virology
110:202-207[CrossRef][Medline].
|
| 21.
|
Hawley, R. G.,
F. H. L. Lieu,
A. Z. C. Fong, and T. S. Hawley.
1994.
Versatile retroviral vectors for potential use in gene therapy.
Gene Ther.
1:136-138[Medline].
|
| 22.
|
Hay, R. T.,
N. D. Stow, and I. M. McDougall.
1984.
Replication of adenovirus mini-chromosomes.
J. Mol. Biol.
175:493-510[CrossRef][Medline].
|
| 23.
|
Heinzinger, N. K.,
M. I. Bukrinsky,
S. A. Haggerty,
V. Ragland,
M. A. Kewalramani,
H. E. Lee,
L. Gendelmann,
L. Ratner,
M. Stevenson, and M. Emerman.
1994.
The Vpr protein of HIV-1 influences nuclear localization of viral nucleic acids in non-dividing host cells.
Proc. Natl. Acad. Sci. USA
91:7311-7315[Abstract/Free Full Text].
|
| 24.
|
Hitt, M. M.,
C. L. Addison, and F. L. Graham.
1997.
Human adenoviral vectors for gene transfer into mammalian cells.
Adv. Pharmacol.
40:137-205.
|
| 25.
|
Kalpana, G. V.,
S. Marmon,
W. Wang,
G. R. Crabtree, and S. P. Goff.
1994.
Binding and stimulation of HIV-1 integrase by a human homolog of yeast transcription factor SNF5.
Science
266:2002-2006[Abstract/Free Full Text].
|
| 26.
|
Kay, M. A.,
F. Graham,
F. Leland, and S. L. Woo.
1995.
Therapeutic serum concentrations of human alpha1-antitrypsin after adenoviral-mediated gene transfer into mouse hepatocytes.
Hepatology
21:815-819[CrossRef][Medline].
|
| 27.
|
Kitamura, Y.,
Y. M. H. Lee, and J. M. Coffin.
1992.
Nonrandom integration of retroviral DNA in vitro: effect of CpG methylation.
Proc. Natl. Acad. Sci. USA
89:5532-5536[Abstract/Free Full Text].
|
| 28.
|
Langer, S. J., and J. Schaak.
1996.
293 cell lines that inducibly express high levels of adenovirus type 5 precurser terminal protein.
Virology
221:172-179[CrossRef][Medline].
|
| 29.
|
Lechardeur, D.,
K.-J. Sohn,
M. Haardt,
P. B. Joshi,
M. Monck,
R. W. Graham,
B. Beatty,
J. Squire,
H. O'Brodovich, and G. L. Lukacs.
1999.
Metabolic instability of plasmid DNA in the cytosol: a potential barrier to gene transfer.
Gene Ther.
6:482-497[CrossRef][Medline].
|
| 30.
|
Lee, M. S., and R. Craigie.
1998.
A previously unidentified host protein protects retroviral DNA from autointegration.
Proc. Natl. Acad. Sci. USA
95:1528-1533[Abstract/Free Full Text].
|
| 31.
|
Lee, S. E.,
R. A. Mitchell,
A. Cheng, and E. A. Hendrickson.
1997.
Evidence for DNA-PK-dependent and -independent DNA double-strand break repair pathways in mammalian cells as a function of the cell cycle.
Mol. Cell. Biol.
17:1425-1433[Abstract].
|
| 32.
|
Lewis, P.,
M. Hensel, and M. Emerman.
1994.
Human immunodeficiency virus infection of cells arrested in cell cycle.
EMBO J.
11:3053-3058[Medline].
|
| 33.
|
Lewis, P. F., and M. Emerman.
1994.
Passage though mitosis is required for oncoviruses but not for the human immunodeficiency virus.
J. Virol.
68:510-516[Abstract/Free Full Text].
|
| 34.
|
Lieber, A.,
M. J. Vrancken Peeters, and M. Kay.
1995.
Adenovirus-mediated transfer of the amphotropic retrovirus receptor cDNA increases retroviral transduction in cultured cells.
Hum. Gene Ther.
6:5-11[Medline].
|
| 35.
|
Lieber, A.,
C.-Y. He,
I. Kirillova, and M. A. Kay.
1996.
Recombinant adenoviruses with large deletions generated by Cre-mediated excision exhibit different biological properties compared with first-generation vectors in vitro and in vivo.
J. Virol.
70:8944-8960[Abstract].
|
| 36.
|
Mahalingam, S.,
V. Ayyavoo,
M. Patel,
T. Kieber-Emmons,
G. D. Kao,
R. J. Muschel, and D. B. Weiner.
1998.
HIV-1 Vpr interacts with the human 34 kDa mov34 homologue, a factor linked to the G2/M phase transition of the mammalian cell cycle.
Proc. Natl. Acad. Sci. USA
95:3419-3424[Abstract/Free Full Text].
|
| 37.
|
Miller, A. D.
1992.
Human gene therapy comes of age.
Nature
357:455-460[CrossRef][Medline].
|
| 38.
|
Miller, D. G.,
M. A. Adam, and A. D. Miller.
1990.
Gene transfer by retrovirus vectors occurs only in cells that actively replicate at the time of infection.
Mol. Cell. Biol.
10:4239-4242[Abstract/Free Full Text].
|
| 39.
|
Pollard, W. W.,
W. M. Michael,
S. Nakielny,
M. C. Siomi,
F. Wang, and G. Dreyfuss.
1996.
A novel receptor-mediated nuclear protein import pathway.
Cell
86:985-994[CrossRef][Medline].
|
| 40.
|
Popov, S.,
M. Rexach,
L. Ratner,
G. Blobel, and M. Bukrinsky.
1998.
Viral protein R regulates docking of the HIV-1 preintegration complex to the nuclear pore complex.
J. Biol. Chem.
273:13347-13352[Abstract/Free Full Text].
|
| 41.
|
Popov, S.,
M. Rexach,
G. Zybarth,
N. Reiling,
M.-A. Lee,
L. Ratner,
C. M. Lane,
M. S. Moore,
G. Blobel, and M. Bukrinsky.
1998.
Viral protein R regulates nuclear import of the HIV-1 pre-integration complex.
EMBO J.
17:909-917[CrossRef][Medline].
|
| 42.
|
Ramachandra, M., and R. Padmanabhan.
1995.
Expression, nuclear transport, and phosphorylation of adenovirus DNA replication proteins, vol. 2.
Springer-Verlag KG, Berlin, Germany.
|
| 43.
|
Roe, T. Y.,
T. C. Reynolds,
G. Yu, and P. O. Brown.
1993.
Integration of murine leukemia virus DNA depends on mitosis.
EMBO J.
12:2099-2108[Medline].
|
| 44.
|
Rohdewohld, H.,
H. Weiher,
W. Reik,
R. Jaenisch, and M. Breindl.
1987.
Retrovirus integration and chromatin structure: Moloney murine leukemia proviral integration sites map near DNase I-hypersensitivity sites.
J. Virol.
61:336-343[Abstract/Free Full Text].
|
| 45.
|
Rosenkranz, A. A.,
S. V. Yachmenev,
D. A. Jans,
N. V. Serebryakova,
V. I. Muravev, and A. S. Sobolev.
1992.
Receptor-mediated endocytosis and nuclear transport of a transfecting DNA construct.
Exp. Cell Res.
199:323-329[CrossRef][Medline].
|
| 46.
|
Russell, D.,
I. E. Alexander, and A. D. Miller.
1995.
DNA synthesis and topoisomerase inhibitors increase transduction by adeno-associated virus vectors.
Proc. Natl. Acad. Sci. USA
92:5719-5723[Abstract/Free Full Text].
|
| 47.
|
Russell, D. W.,
A. D. Miller, and I. E. Alexander.
1994.
AAV vectors preferentially transduce cells in S phase.
Proc. Natl. Acad. Sci. USA
91:8915-8919[Abstract/Free Full Text].
|
| 48.
|
Russell, W. C., and G. D. Kemp.
1995.
Role of adenovirus structural components in the regulation of adenovirus infection, p. 81-98.
In
W. Doerfler, and P. Boehm (ed.), The molecular repertoire of adenoviruses, vol. 2. Springer-Verlag KG, Berlin, Germany.
|
| 49.
|
Schaak, J.,
X. Guo,
W. Y. Ho,
M. Karlok,
C. Chen, and D. Ornelles.
1995.
Adenovirus type 5 precursor terminal protein-expressing 293 and HeLa cell lines.
J. Virol.
69:4079-4085[Abstract].
|
| 50.
|
Scherdin, U.,
K. Rhodes, and M. Breindl.
1990.
Transcriptionally active genome regions are preferred targets for retrovirus integration.
J. Virol.
64:907-912[Abstract/Free Full Text].
|
| 51.
|
Schmidt-Zachmann, M. S.,
C. Dargemot,
L. C. Kuehn, and E. A. Nigg.
1993.
Nuclear export of proteins: the role of nuclear retention.
Cell
74:493-504[CrossRef][Medline].
|
| 52.
|
Schuitemaker, H.,
N. A. Koostra,
R. A. M. Fouchier,
B. Hooibrink, and F. Miedema.
1994.
Productive HIV-1 infection of macrophages restricted to the cell fraction with proliferative capacity.
EMBO J.
13:5929-5936[Medline].
|
| 53.
|
Searle, P. F.,
G. W. Stuart, and R. D. Palmiter.
1987.
Metal regulatory elements of the mouse metallothionein-I gene.
EXS
52:407-414.
|
| 54.
|
Shimura, M.,
Y. Onozuka,
T. Yamaguchi,
K. Hatake,
F. Takaku, and Y. Ishizaka.
1999.
Micronuclei formation with chromosomal breaks and gene amplification caused by Vpr, an accessory gene of human immunodeficiency virus.
Cancer Res.
59:2259-2264[Abstract/Free Full Text].
|
| 55.
|
Silver, P. A.
1991.
How proteins enter the nucleus.
Cell
64:489-497[CrossRef][Medline].
|
| 56.
|
Spadari, S.,
F. Focher,
F. Sala,
G. Ciarrocchi,
G. Koch,
A. Falaschi, and G. Pedrali-Noy.
1985.
Controll of cell division by aphidicolin without adverse effects upon resting cells.
Drug Res.
35:1108-1116[Medline].
|
| 57.
|
Sutton, R. E.,
M. J. Reitsma,
N. Uchida, and P. O. Brown.
1999.
Transduction of human progenitor hematopoietic stem cells by human immunodeficiency virus type-1 based vectors is cell cycle dependent.
J. Virol.
73:3649-3660[Abstract/Free Full Text].
|
| 58.
|
Takeshita, S.,
D. Gal,
G. Leclerc,
J. G. Pickering,
R. Riessen,
L. Weir, and J. M. Isner.
1994.
Increased gene expression after liposome-mediated arterial gene transfer associated with intimal smooth muscle cell proliferation.
J. Clin. Investig.
93:652-661.
|
| 59.
|
Temperley, S. M.,
C. R. Burrow,
T. J. Kelly, and R. T. Hay.
1991.
Identification of two distinct regions within the adenovirus minimal origin of replication that are required for adenovirus type 4 DNA replication in vitro.
J. Virol.
65:5037-5044[Abstract/Free Full Text].
|
| 60.
|
Temperley, S. M., and R. T. Hay.
1992.
Recognition of the adenovirus type 2 origin of DNA replication by the virally encoded DNA polymerase and preterminal proteins.
EMBO J.
11:761-768[Medline].
|
| 61.
|
Tuck, A. B.,
S. M. Wilson,
F. R. Sergovich, and A. F. Chambers.
1991.
Gene expression and metastasis of somatic cell hybrids between murine fibroblast cell lines of different malignant potential.
Somat. Cell Mol. Genet.
17:377-389[CrossRef][Medline].
|
| 62.
|
van der Vliet, P.
1995.
Adenovirus DNA replication, p. 1-31.
In
P. B. W. Doerfler (ed.), The molecular repertoire of adenoviruses, vol. 2. Springer-Verlag KG, Berlin, Germany.
|
| 63.
|
Varmus, H. E.,
T. Padgett,
S. Heasley,
G. Simon, and J. M. Bishop.
1977.
Cellular functions are required for the synthesis and integration of avian sarcoma virus-specific DNA.
Cell
11:307-319[CrossRef][Medline].
|
| 64.
|
Vijaya, S.,
D. L. Steffen, and H. L. Robinson.
1986.
Acceptor sites for retroviral integrations map near DNase I-hypersensitivity sites in chromatin.
J. Virol.
60:683-692[Abstract/Free Full Text].
|
| 65.
|
Vile, R. G., and S. J. Russell.
1995.
Retroviruses as vectors.
Br. Med. Bull.
51:12-30[Abstract/Free Full Text].
|
| 66.
|
Vitadello, M.,
M. V. Schiaffino,
A. Picard,
M. Scarpa, and S. Schiaffino.
1994.
Gene transfer in regenerating muscle.
Hum. Gene Ther.
5:11-18[Medline].
|
| 67.
|
Vrancken Peeters, M.-J.,
A. Lieber,
J. Perkins, and M. A. Kay.
1996.
Method for multiple portal vein infusions in mice: quantification of adenovirus-mediated hepatic gene transfer.
BioTechniques
20:278-285[Medline].
|
| 68.
|
Webster, A.,
I. R. Leith, and R. T. Hay.
1994.
Activation of adenovirus-coded protease and processing of preterminal protein.
J. Virol.
68:7292-7300[Abstract/Free Full Text].
|
| 69.
|
Wei, S.-Q.,
K. Mizuuchi, and R. Craigie.
1998.
Footprints on the viral DNA ends in Moloney murine leukemia virus preintegration complexes reflect a specific association with integrase.
Proc. Natl. Acad. Sci. USA
95:10535-10540[Abstract/Free Full Text].
|
| 70.
|
Wei, S.-Q.,
K. Mizuuchi, and R. Craigie.
1997.
A large nucleoprotein assembly at the ends of the viral DNA mediates retroviral DNA integration.
EMBO J.
16:7511-7520[CrossRef][Medline].
|
| 71.
|
Wilke, M.,
E. Fortunati,
M. van den Broek,
A. T. Hoogeveen, and B. J. Scholte.
1996.
Efficacy of a peptide-based gene delivery system depends on mitotic activity.
Gene Ther.
3:1133-1142[Medline].
|
| 72.
|
Zimmer, C. P.,
H. Grunicke,
P. Chandra, and H. Venner.
1971.
Influence of netropsin and distamycin A on the secondary structure and template activity of DNA.
Eur. J. Biochem.
21:269-278[Medline].
|
Journal of Virology, January 2000, p. 721-734, Vol. 74, No. 2
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yu, J. H., Schaffer, D. V.
(2006). High-throughput, library-based selection of a murine leukemia virus variant to infect nondividing cells.. J. Virol.
80: 8981-8988
[Abstract]
[Full Text]
-
Seamon, J. A., Jones, K. S., Miller, C., Roth, M. J.
(2002). Inserting a Nuclear Targeting Signal into a Replication-Competent Moloney Murine Leukemia Virus Affects Viral Export and Is Not Sufficient for Cell Cycle-Independent Infection. J. Virol.
76: 8475-8484
[Abstract]
[Full Text]
Top
Abstract
Introduction
