Previous Article | Next Article 
Journal of Virology, January 2000, p. 710-720, Vol. 74, No. 2
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Histone Acetylation and Reactivation of
Epstein-Barr Virus from Latency
Peter J.
Jenkins,1
Ulrich K.
Binné,1 and
Paul J.
Farrell1,2,*
Ludwig Institute for Cancer
Research1 and Virology and Cell Biology
Section,2 Imperial College School of
Medicine, St. Mary's Campus, London W2 1PG, United Kingdom
Received 22 June 1999/Accepted 7 October 1999
 |
ABSTRACT |
Induction of the viral BZLF1 gene has previously been shown to be
one of the first steps in the reactivation of Epstein-Barr virus (EBV).
Using an EBV oriP episomal vector system, we have reconstituted the
regulation of the promoter for BZLF1 on stably transfected episomes,
mapped promoter elements required for that regulation, and investigated
mechanisms that may control the switch between latency and the lytic
cycle. Changes in histone acetylation at the promoter for the BZLF1
gene appear to be a key part of the reactivation mechanism of this herpesvirus.
 |
INTRODUCTION |
Herpesviruses characteristically
display latent persistence in their hosts and intermittent reactivation
of replication; the reactivation of some human herpesviruses is
associated with specific human diseases. The mechanism by which the
viral genome is retained in the latent state is thus a key determinant
of the pathogenesis of herpesviruses (30). Epstein-Barr
virus (EBV; human herpesvirus 4) is thought to persist in a resting B
lymphoid cell population since the viral genome can be detected
selectively in these cells by using PCR on DNA extracted from normal
virus carriers (2, 24). Reverse transcriptase PCR analysis
of EBV gene expression in peripheral blood suggests that the viral gene
expression is limited to EBNA-1, LMP-2, BamHI-A rightward
transcripts, and the EBER RNAs (5, 29, 43); the humoral
immune response is also consistent with this pattern of gene expression
in persistence since antibodies to EBNA-1 are always present in the
normal virus carrier state (30). It is difficult to study
the mechanism of EBV reactivation in vivo because of the low abundance
of the cells carrying latent virus, but a broadly similar pattern of
EBV gene expression is observed in group I Burkitt's lymphoma (BL)
cell lines in culture (32). These cell lines provide the
best model available to study the switch between latency and the lytic
replication of EBV. Cross-linking the surface immunoglobulin on BL
cells so as to mimic the binding of cognate antigen (41, 42)
or treatment of the BL cells with transforming growth factor
both
activate the lytic cycle of EBV efficiently in some BL cell lines. Both of these systems are likely to reflect physiologically relevant mechanisms of reactivation from latency in vivo.
The key step in the switch from latency to the productive replicative
cycle of EBV (6) is the expression of the viral
immediate-early gene BZLF1 (also known as ZEBRA, EB1, and Zta). This
b-zip transcription factor (9) binds a specific target
sequence in the promoters of the early genes of the virus and
cooperates with the EBV BRLF1 protein to activate early genes. The
promoters for BRLF1 and BZLF1 are also targets for activation by BZLF1,
and this autoactivation of expression of BZLF1 appears to be the basis
for the efficient switch into the lytic cycle once it begins to be
activated (reviewed in reference 39). The kinetics
of these processes have previously been studied in detail in the BL
cell line Akata treated with anti-immunoglobulin (anti-Ig)
(37). Transcription promoter elements have been mapped in
the promoter for BZLF1 (Zp) by using transient-transfection assays with
induction of Zp expression either by tetradecanoyl phorbol acetate
(TPA) in the presence of theophylline (11) or by anti-Ig
treatment of the cells (35). The current model involves promoter elements designated ZIA, ZIB, ZIC, ZID, ZII, ZIIIA, and ZIIIB;
mutation of either ZIIIA or ZIIIB results in a loss of activation of Zp
by BZLF1 (11, 21, 39), and both sites can bind BZLF1 in
footprinting assays (11, 18). The ZIIIB element has the
higher affinity in footprinting and has therefore been proposed as the
major target for BZLF1 autoactivation of the Zp promoter
(11). Factors that are candidates for binding to the other
sites have also been identified (39). However, it is
difficult in the transient assays to relate the efficiency of gene
expression to that of the intact EBV genome and thus to know whether
the assays quantitatively reflect the true regulation. The
physiological relevance of activation of Zp by TPA is also open to
question (19).
There is a further important difference between the transient assays
and the bona fide latent EBV genome regulation; transfection of an
expression vector for BZLF1 into cells containing latent EBV activates
the EBV lytic cycle but does not activate the endogenous BZLF1 promoter
(17, 20). In contrast, transfected BZLF1 promoter reporter
plasmids are transactivated by a cotransfected BZLF1 expression vector
(11). This has led to the concept that latency is maintained
in the EBV genome in latently infected cells by an unknown mechanism
that keeps the Zp promoter switched off until the proper activation
signal arrives, for example from anti-Ig signal transduction. This
arrangement would prevent accidental activation of the virus
replication and thus be a key determinant of latency. A variety of
mechanisms have been proposed for negative regulation of EBV
transcription in latency, including antisense transcription
(28), repression by a viral gene product, and methylation of
the EBV genome (31).
In EBV-immortalized lymphoblastoid cell lines (LCLs), the viral LMP-2
proteins can block activation of the promoter for BZLF1 but in BL cell
lines such as Akata LMP-2 proteins are either absent or only expressed
at a very low level, a finding consistent with the efficient activation
of the lytic cycle in these cells. We have previously made recombinant
EBV strains with site-directed mutations of regulatory elements to
study the control of other aspects of viral gene expression
(8), but the conventional genetic approaches for EBV result
in recombinant virus in LCLs which express LMP-2. We have therefore
sought an alternative (and more rapid) way to mimic accurately the
regulation of the BZLF1 promoter by using BL cells as the host. In this
study we reconstitute the regulation of the promoter for BZLF1 on
stably transfected episomes, map promoter elements required for that
regulation, and correlate the changes in histone acetylation at the Zp
promoter with activation. The results are consistent with a model in
which a repressive chromatin structure at the Zp promoter that can be overcome by histone acetylation is a key part of the mechanism by which
the latency of EBV is maintained.
 |
MATERIALS AND METHODS |
Plasmid construction.
Plasmid p294 (also named CMVpEBNA-1 in
reference 40) was a gift from Bill Sugden. The BZLF1
sequences were derived initially from pUCIE, which contains the EBV
sequence of the B95-8 strain from 102114 to 106435. It was made by
cloning the NcoI-NruI fragment of B95-8 EBV
derived from the E23 cosmid (13) into the SmaI site of pUC12 (having filled the NcoI overhang with Klenow
DNA polymerase), with the insert oriented so that the former
NcoI end is close to the BamHI and
SalI sites in the pUC12 polylinker.
p294:Zp-3241 was made by excising the EBV content of pUCIE by using
XbaI and EcoRI sites in the polylinker of pUC,
filling the overhangs with Klenow DNA polymerase, and then cloning into the SalI site of p294, which had been similarly blunted with
Klenow DNA polymerase. Inserts were obtained in both orientations
(p294:Zp-3241 and p294:Zp-3241rev).
p294:Zp-4263 was constructed by first cloning the BamHI R
fragment of B95-8 EBV (sequence 103816 to 107402) into the
BamHI site of p294, choosing a clone with the insert
orientated similarly to p294:Zp-3241. This plasmid was then cut with
SalI, and the larger fragment was ligated to the
SalI fragment from pUCIE that contained the BZLF1 gene. This
resulted in reconstruction of the EBV region from positions 102114 to
107402 in an orientation similar to that of Zp-3241.
p294:Zp-552 was prepared by cloning the BamHI fragment from
pUCIE (containing B95-8 EBV sequence 102114 to 103746) into the BamHI site of p294, choosing the orientation similar to that
of Zp-3241.
p294:Zp-226 was constructed by cloning the small SphI
fragment from p294:Zp-552 into the SphI site of p294,
choosing the orientation similar to that of Zp-3241.
In p294:Zp-552X, a XhoI linker was introduced to facilitate
cloning of further site directed mutants of the Zp region. The equivalent of the BamHI Z fragment of EBV was subcloned from
pUCIE into the BamHI site of pGEM4Z. This construct was cut
at the unique NaeI site, an XhoI linker
(CCTCGAGG) was inserted, and the plasmid was recircularized.
The modified BamHI Z equivalent fragment was then excised
and cloned into the BamHI-digested vector segment of
p294:Zp-4263. This is thus analogous to p294:Zp-552 but contains the
XhoI linker and has only one SphI site.
Wild-type and site-directed mutant sequences of Zp were then
transferred into p294:Zp-552X from plasmids (kindly supplied by S. Speck) containing the mutated sites. The Zp region from the wild-type
promoter and each site-directed mutant was PCR amplified by using
primers W9668 (CCGCTCGAGTGCAATGTTTAGTGAGTT) and W9669 (ACATGCATGCCATGCATATTTCAACTGG). The PCR products were cut
with XhoI and SphI and cloned between the
XhoI and SphI sites of p294:Zp-552X. Plasmids in
this series were called p294:Zp-552Xwt, p294:Zp-552XMIA/B, p294:Zp-552XMIC, p294:Zp-552XMID, p294:Zp-552XMII,
p294:Zp-552XMIIIA, and p294:Zp-552XMIIIB, according to the mutation
they carried. These plasmids were all sequenced through the Zp region
to confirm their identity and to ensure that no mutations had been
introduced during the PCR amplification. The PCR primers were designed
so that the extra sequence of the linker was eliminated but six
nucleotides were substituted to create the XhoI site with
all the promoter elements in their normal spacing relative to the BZLF1
coding sequence.
Cell culture, transfection, and induction of BZLF1.
The
Akata cell line was maintained in RPMI 1640 medium supplemented with
penicillin, streptomycin, and 10% heat-inactivated fetal calf serum.
Single-cell cloning of the parental Akata stock was performed according
to the method reported by Shimizu et al. (36). Cells were
transfected by electroporation at 250 V and 960 µF by using a Bio-Rad
GenePulser as described previously (38). Stable
transfectants were selected by the addition of 0.2 to 0.3 mg of
hygromycin B per ml. Transfected cell lines were named systematically with the Akata cell clone number followed by the plasmid name; for
example, AK31/p294:Zp-552Xwt would be Akata clone 31 cells containing
plasmid p294:Zp-552Xwt. For each cell line, multiple independent pools
were analyzed from two to four transfections so that reproducibility of
the BZLF1 response could be ensured. In all cases, results from
representative lines are shown.
Induction of the BZLF1 gene was performed by treating exponentially
growing cultures with rabbit anti-human IgG 0.5% (vol/vol) (Dako).
Unless otherwise indicated, cells were harvested 48 h after this
treatment. To prevent spontaneous lytic viral replication prior to
micrococcal nuclease digestion, cultures were pretreated with
phosphonoacetic acid (0.2 to 0.4 mM for 10 days). Where indicated, cells were pretreated with trichostatin A (50 ng/ml) for 12 h prior to the addition of anti-Ig. B95-8 cells induced into the lytic
cycle with the phorbol ester TPA (50 ng/ml for 3 days) were used as a
positive control in Western blots.
RNA isolation and RPA.
To prepare cytoplasmic RNA, cells
were washed three times with cold phosphate-buffered saline (PBS) and
lysed in 150 mM NaCl-10 mM Tris-Cl (pH 7.5)-1 mM
MgCl2-0.1% Triton X-100, and the nuclei were removed by
centrifugation. The cytoplasmic extract was adjusted to 2% sodium
dodecyl sulfate (SDS) and 20 mM EDTA, and proteinase K was added to 0.5 mg/ml. After 5 min at room temperature, the mixture was extracted twice
with phenol-chloroform and once with chloroform. RNA was ethanol
precipitated and redissolved in water.
An RNase protection assay (RPA) was performed with a probe synthesized
from plasmid SP64-Z44, which contains the B95-8 EBV sequence from
102984 to 103650 cloned between the BamHI and
EcoRI sites of SP64 (37). Prior to transcription,
the plasmid was linearized by digestion with SphI. The
plasmid was transcribed by using SP6 polymerase in the presence of
[32P]UTP to yield a 477-nucleotide antisense probe
containing EBV sequences 102984 to 103419. Overnight hybridization of
the riboprobe with 30 µg of cytoplasmic RNA was performed at 42°C
by using reagents supplied in the RPA II kit (Ambion). After RNase
digestion, protected fragments were analyzed by electrophoresis on a
6% polyacrylamide gel containing 8 M urea. Hybridization of the
riboprobe to correctly initiated BZLF1 mRNA generated a protected
species of 219 nucleotides.
Western blotting.
Cells were collected by centrifugation,
lysed in SDS-gel sample buffer, and sonicated to disperse the DNA
(8). The equivalent of 106 cells was loaded into
each lane of SDS-10 or 12.5% polyacrylamide gels. After
electrophoresis, proteins were transferred to nitrocellulose membranes
by electroblotting. After being blocked with milk (8), membranes were incubated either with the anti-BZLF1 monoclonal BZ1
(44) or the anti-LMP1 monoclonal S12 (23). Rabbit
anti-mouse horseradish peroxidase conjugate (Amersham) was used at a
dilution of 1:2,000 as a secondary antibody, and complexes were
visualized by using enhanced chemiluminescence (Amersham).
DNA preparation and Southern blotting.
To prepare genomic
DNA, cells were collected by centrifugation and washed in cold PBS.
Cells were then resuspended in 100 mM NaCl-5 mM EDTA-10 mM Tris-Cl
(pH 7.5) and lysed by bringing the solution to 1% SDS. Proteinase K
was added to a concentration of 0.3 mg/ml, and the mixture was allowed
to digest at room temperature for 12 h. DNA was extracted twice
with phenol-chloroform and once with chloroform prior to ethanol
precipitation. The resulting pellet was washed briefly with 70%
ethanol and then redissolved in 10 mM Tris-Cl (pH 7.5)-1 mM EDTA.
Genomic DNA from 1.6 × 106 cells (10 µg) was
digested with the restriction enzymes indicated, fractionated by
electrophoresis on agarose gels, and Southern blotted to nitrocellulose
filters (22). Filters were prehybridized in 65°C for
3 h, hybridized with probe overnight at 65°C, and then washed
successively with 1× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate) and then 0.1× SSC at 65°C. The probes for hybridization
were pBamWLd (B95-8 EBV BamHI fragments W, L, and d, all
ligated into the BamHI site of pBR322) and the
JH region probe M13 C76R51B (10). All the other
probes used were generated by PCR from B95-8 EBV plasmids, and their
corresponding positions on the viral genetic map (3) are
indicated in the figure legends. Probes were labelled with [32P]dCTP (Amersham) by a random priming reaction.
Bisulfite sequencing.
Methylation of cytosine residues was
assayed by the bisulfite sequencing method, in which unmethylated
cytosine residues are converted to uracil, which is then fixed as
thymidine in a PCR (12). Briefly, DNA from AK31/p294:Zp-3241
cells was denatured with alkali, neutralized, and then treated
overnight with 3.1 M sodium bisulfite. After recovery of the DNA and
PCR, clones of the PCR product were analyzed by nucleotide sequencing.
The oligonucleotides used for PCR were D8097 (CCTCCTCCTCTTTTA)
and D8098 (CTAACATCTCCCCTT) with an annealing
temperature of 37°C.
Microccocal nuclease digestion.
The protocol used to prepare
cell nuclei and micrococcal nuclease digestion was a modification of
that described by Dyson and Farrell (7). First, 2 × 107 cells were collected by centrifugation, resuspended in
1.3 ml of 10 mM NaCl-5 mM MgCl2-10 mM Tris-Cl (pH 7.5),
and left on ice for 30 min. Cells were then lysed by the addition of
0.7 ml of 5% NP-40 and disrupted with 20 strokes of a Dounce
homogenizer (B pestle). Nuclei were purified by sedimentation through
0.8 M sucrose in the same buffer at 700 × g for 5 min
and then resuspended in 60 mM KCl-15 mM NaCl-3 mM
MgCl2-15 mM Tris-Cl (pH 7.5)-0.25 M sucrose-0.5 mM
dithiothreitol-50 µM CaCl2. For digestion, the CaCl2 was supplemented to 2.2 mM, and 11.4 U of micrococcal
nuclease (Pharmacia) was added in a final volume of 250 µl. Aliquots
of 50 µl were removed at the specified time points into 200 µl of 0.4 M Tris-Cl (pH 7.5)-0.1 M EDTA-1% SDS to terminate the reaction. DNA was purified by digestion with proteinase K-phenol-chloroform extraction and ethanol precipitation.
Chromatin immunoprecipitation.
The method of Braunstein et
al. (4) as modified by Alberts et al. (1) was
used for chromatin immunoprecipitation. Briefly, aliquots of
106 cells were left untreated or were treated with 0.5%
anti-Ig for 3 h. Cells were then fixed by the addition of
formaldehyde to a final concentration of 1% for a further 10 min.
After the cells were washed, crude nuclei were prepared (4)
and resuspended in 1% SDS-10 mM EDTA-50 mM Tris-Cl (pH 8.0). The
resulting solution was sonicated such that the modal DNA fragment
length was reduced to under 1 kb. This solution was diluted 10-fold
with immunoprecipitation buffer (4) and precleared for
2 h with protein A-Sepharose beads preabsorbed with sonicated
single-stranded DNA. Immunoprecipitation was performed by incubation
for 12 h at 4°C with polyclonal antibody to acetylated histone
H4 (Upstate Biotechnology; catalog number 06-598) or a control rabbit
serum. Immune complexes were collected by a further incubation with
protein A-Sepharose beads and washed extensively prior to elution from
the beads. Histone DNA cross-links were reversed by heating to 65°C
for 4 h. DNA fragments were purified by phenol-chloroform
extraction, ethanol precipitated, and dissolved in 50 µl of water.
Next, 2 µl of the solution of immunoprecipitated DNA fragments was
used for each 50-µl PCR. The progress of the reaction was monitored
such that the amplification remained in the exponential phase. The
primers used were AK1A and AK1B (26), which span the Zp
region (B95-8 EBV positions 103180 to 103751); 257V
(AGGGCAGTGATAGCGAC) and 982T (TTTCCATCATGTGTTTA,
positions 111360 to 111737) in the BKRF4 early gene; 543V
(ATTTTATTCTGGGGGCG) and 641M (GGGAAACACTGTTTCGG, positions 8748 to 9560), which span the promoter of the late gene BCRF1; and 018R (TACTTTGGCTTGCCGGG) and 019R
(ACGCAGAGGCCTGCACC, positions 149061 to 149637) in the BdRF1
late gene.
 |
RESULTS |
Isolation and characterization of Akata cell clones.
To
determine whether BZLF1 EBV gene expression can be properly
reconstituted on transfected oriP plasmids, it would be necessary to
have comparable human cell lines either containing or lacking EBV so
that expression of genes transfected into the EBV-negative cell line
could be compared with that of genes in the virus in the EBV-positive
cell line. A convenient system became available when it was found
(36) that the EBV genome could be lost spontaneously at a
low rate from the Akata BL cell line so that EBV-negative variants of
this line could be isolated by single-cell cloning. We repeated the
cloning of Akata cells and isolated several EBV-negative Akata cell
lines, some of which were used in the work described here. Several
EBV-positive Akata clones were also isolated during this
procedure. The EBV status of the clones was determined by Southern blotting with a probe that could detect EBV DNA
(Fig. 1A); overexposures of this
autoradiograph in which the single-copy plasmid control was strongly
detectable also gave no signal in the EBV-negative Akata clone DNA, and
the multiple copies of BamHI-W in EBV gave a sensitivity of
0.1 copies of EBV per cell (not shown). Western blotting for the
EBV EBNA-1 (Fig. 1B) protein was also consistent with the presence of
EBV in clones 3, 6, 11, and 34. The EBV-positive clones retained
the characteristic pattern of expression of EBNA-1 but no
expression of LMP-1 (Fig. 1C). Clones 1, 13, 23, and 31 were EBV
negative by all criteria. One of the EBV-negative Akata clones (AK31)
was particularly appropriate for the subsequent experiments since it
grew well in culture and sustained transfection and drug selection
reliably. All of the clones retained the appearance of Akata cells
under the microscope, and Southern blotting the DNA with a
probe for the rearranged JH region (Fig. 1D)
showed that all of the Akata clones had the same, unique Ig
heavy-chain rearrangement, confirming their common origin.




View larger version (74635553K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Southern blot for EBV DNA in Akata cell clones.
Genomic DNA extracted from Akata cell clones 1, 3, 6, 11, 13, 23, 31, and 34 was digested with BamHI and electrophoresed on an
agarose gel. A Southern blot of the gel was probed with EBV
BamHI L, W, and d fragments. Dilutions of a plasmid
containing EBV BamHI L, W, and d fragments cut with
BamHI were coelectrophoresed to give hybridization signals
equivalent to 10 and 1 copies per cell. The positions of the
BamHI L, W, and d fragments are indicated. The extra band in
the Akata tracks between BamHI-d and -W is presumed to
result from an extra BamHI restriction site in Akata, which
reduces the size of the BamHI L fragment relative to the
B95-8 standard. (B) Western blot for EBNA-1. Extracts of Akata cell
clones 1, 3, 6, 11, 13, 23, 31, and 34 in an SDS-gel sample buffer were
electrophoresed on a polyacrylamide gel and analyzed by Western
immunoblotting by using a human serum to detect the EBNA-1 protein
(arrowhead). (C) Western blot for LMP-1. Extracts were analyzed as in
panel B but with the S12 monoclonal antibody for LMP-1. The LMP-1
signal in the positive control (B95-8 cell extract) is marked with an
arrowhead. (D) Southern blot for JH rearrangement. DNA from
the Akata cell clones was digested with EcoRI and analyzed
by Southern blotting by using a fragment of the JH region
clone M13 C76R51B (10) as a probe. Markers were a
HindIII digest of phage lambda DNA; the sizes are
indicated in kilobases.
|
|
Reconstitution of anti-Ig induction of BZLF1.
The BZLF1 gene
is induced as the first part of the switch from EBV latency into the
lytic cycle. This switch can be induced efficiently by treating the
Akata cells with antibodies (anti-Ig) that cross-link the surface Ig
present on the cells (41, 42). Various oriP/EBNA-1 plasmids
containing the BZLF1 gene region were transfected into AK31 cells, and
cells maintaining the plasmids were selected by using hygromycin. The
structures of the plasmids used are shown in Fig.
2A. When AK31 cells
containing the p294:Zp-3241 BZLF1 plasmid (AK31/p294:Zp-3241) were
treated with anti-Ig, BZLF1 expression (measured by Western blotting)
was induced to a level similar to that of the endogenous viral gene in
EBV-positive AK6 cells (Fig. 2B). The induction worked equally well in
transfected cells in which the orientation of the BZLF1 gene region was
reversed relative to the plasmid vector sequences (plasmid
AK31/p294:Zp-3241rev [Fig. 2B]). Inducibility was also not confined
to the AK31 cell line as host since line AK1/p294:Zp-3241 contains the
same BZLF1 plasmid in EBV-negative AK1 cells and also induced well
(Fig. 2B). The kinetics of the induction of BZLF1 were very similar (Fig. 2C) for the transfected BZLF1 gene (AK31/p294:Zp-3241 and AK31/p294:Zp-3241rev) compared with EBV-positive AK6 and AK11 cells.
Furthermore, when the p294:Zp-3241 plasmid was transfected into
EBV-positive Akata 6 cells, both the endogenous and plasmid BZLF1
proteins were induced (Fig. 2D); the Akata and B95-8 BZLF1 proteins
differ in a few amino acids (26) and can be distinguished by
SDS-gel electrophoresis.




View larger version (16383127K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Structures of p294 BZLF1 plasmids. The structures of
the plasmids used here are illustrated beneath a kilobase scale. (B to
D) Cell lines were cultured with (+) or without ( ) anti-Ig, and
extracts were analyzed by Western immunoblotting for BZLF1 expression
by using the BZ-1 antibody. The BZLF1 signal is indicated with an
arrowhead in each panel. (B) Western blot of BZLF1 induction in
AK31/p294:Zp-3241rev (line H4), AK31/p294:Zp-3241 (line L4), and
AK1/p294:Zp-3241 (line K1) cells after 48 h of anti-Ig treatment.
An extract of B95-8 cells treated with TPA was used as a marker for
B95-8 BZLF1 (track B), EBV-negative AK23 cells were the negative
control, and AK6 cells were the positive control for anti-Ig induction.
Two irrelevant tracks have been excised from the center of this blot
during photography, but the samples shown were all electrophoresed and
blotted together on the same filter and come from the same photographic
print. (C) Time course of BZLF1 induction 0, 3, 6, 12, and 24 h
after addition of anti-Ig in EBV-positive AK6 and AK11 cells and in
transfected AK31/p294:Zp-3241 (line L4) and AK31/p294:Zp-3241rev (line
H4) cells. (D) Induction of plasmids and endogenous BZLF1 in two
isolates of AK6/p294:Zp-3241 cells (lines D11.1 and D10.1) after
48 h of anti-Ig treatment.
|
|
To ensure that the induction of BZLF1 expression was a result of
transcription of correctly initiated BZLF1 mRNA from the plasmid, RNA
was extracted from some of the cell lines and analyzed by using an RPA.
The results (Fig. 3) with AK31/p294:Zp-3241 and AK31/p294:Zp-4263 cells
demonstrate a strong induction in response to anti-Ig of RNA
corresponding to transcription initiated at the point mapped previously
for BZLF1 RNA in the B95-8 EBV genome and subsequently confirmed in
Akata cells (26). The copy number of the episomes in the
EBV-negative cell lines transfected with the BZLF1 plasmid was shown by
Southern blotting Hirt supernatant extracts (15) of the
transfected cell lines to be about 30, similar to that of EBV (data not shown).
Regulation of Zp promoter.
Many transient-transfection and
footprinting experiments have resulted in the current model of
regulation of Zp, the promoter for BZLF1. In this model
(39), most of the sequences governing Zp activity are
located within 200 bp upstream of the transcription start with some
evidence for further negative elements in the region 200 to 550 bp
upstream of the transcription start. The BZLF1 plasmids shown in Fig. 2
and 3 contained at least 3,241 bp of EBV
DNA upstream of the Zp transcription start, so plasmids were made
containing shorter regions upstream of Zp (Fig.
4A). These were transfected into AK31
cells and lines containing the plasmids were established. The BZLF1
response to anti-Ig was retained in constructs containing only 226 bp
upstream of the transcription start (Fig. 4B), but the response of
p294:Zp-226 was a little stronger than that of p294:Zp
552, supporting
the previous data from transient assays that weak negative elements may
lie in the region between positions
226 and
552 (25,
33). These elements have not yet been investigated further since
they did not appear to determine the anti-Ig response, but subsequent
experiments were performed in the context of the
552 construct so
that their effect would be included in the analysis. Several elements
have been identified within the
226 region as being crucial for Zp regulation in transient assays and have also been shown to bind specific cell and viral proteins (Fig. 4A). A series of plasmids was
therefore produced in which these elements were mutated in the context
of the whole
552 promoter (Fig. 4A). Up to this point in the
analysis, the sequences of the transfected plasmids were exactly the
same as those for B95-8 EBV but, to clone the site-directed mutant
constructs, it was necessary to introduce a restriction site which
substituted six nucleotides downstream of the transcription start (Fig.
4A). This change made no difference to the anti-Ig response of the
wild-type
552 sequence (Fig. 4B). However, disruption of the ZIA/B,
ZIC, ZID, or ZIIIA elements in this context resulted in a substantial
reduction in anti-Ig responsiveness (Fig. 4C), demonstrating the
importance of all of these elements for Zp function. Mutation of ZII
caused a partial reduction in anti-Ig responsiveness, which was
variable between clones. Mutation of the ZIIIB element made
surprisingly little difference to the anti-Ig response in this system
(Fig. 4C). The ZIIIB element had the higher affinity of the two BZLF1
binding sites in footprinting assays and was found to be important in
transient assays by using induction of the promoter with TPA and BZLF1,
although it was less important in the response to TPA alone
(11). Although the ZID site has been reported to bind
proteins in footprinting analyses (11), its mutagenesis has
not been reported in the transient system. To confirm the correct
identity of all of these mutant plasmids in the cell lines, at the end
of the experiments the Zp region was reisolated from the cell line DNA
by PCR and characterized by nucleotide sequencing and restriction
enzyme digestion by using EcoRI and BamHI, which
produce characteristic cleavage patterns in the various mutants (data
not shown).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
RPA of transcription at Zp promoter in plasmids. RNA was
extracted from cell lines AK31/p294:Zp-3241 (line L4) and
AK31/p294:Zp-4263 (line C10.1) with (+) or without ( ) 6 h of
anti-Ig treatment and then analyzed by RPA by using probe
SP64-Z44/SphI. The protected fragment of 210 nucleotides
(arrowhead) indicates the correct initiation at position 103194 in the
EBV sequence (3). RNA from AK6 cells served as a positive
control, and AK31 cells treated with anti-Ig and yeast tRNA (Y) were
the negative controls. The undigested probe (1/100 of the amount used
in the RPA) is shown in lane P. The second, larger band in the AK6 lane
corresponds to a sequence difference between Akata EBV and B95-8 EBV,
which was used for the probe and oriP plasmids, and is not another
transcription start in Akata EBV. It represents the upstream
transcription of, for example, the RNA encoding BRLF1.
|
|

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Sequence of B95-8 Zp region showing relevant
restriction sites, boundaries of 552 and 226 truncations, and ZIA,
ZIB, ZIC, ZIIIA, ZIIIB, and ZII promoter elements mapped in
footprinting and transient-transfection experiments (39).
Sequences altered in site-directed mutants (MIA, etc.) including the
nucleotides substituted for the introduction of the XhoI
site used in the cloning done in this study are also shown. The DNA
sequence is reversed from the direction of the standard B95-8 map and
numbered from the transcription start of the BZLF1 mRNA, shown as
position 0 (position 103194 in the B95-8 sequence). The sequence of the
start of the protein sequence of BZLF1 is shown in the one-letter amino
acid code. The TATA box sequence TTTAAA is also marked. (B)
Western blots of BZLF1 expression in cell lines treated with anti-Ig
for 48 h (+) or left untreated ( ). Lanes: 552,
AK31/p294:Zp-552; 226, AK31/p294:Zp-226; Xwt, AK31/p294:Zp-552Xwt; 6, AK6. The BZLF1 protein is marked with an arrowhead. (C) Western blots
of BZLF1 expression in cell lines containing Zp mutations treated with
anti-Ig for 48 h (+) or left untreated ( ). Lanes: MIA/B,
AK31/p294:Zp-552XMIA/B; MIC, AK31/p294:Zp-552XMIC; MID,
AK31/p294:Zp-552XMID; MIIIA, AK31/p294:Zp-552XMIIIA; MIIIB,
AK31/p294:Zp-552XMIIIB; MII, AK31/p294:Zp-552XMII; Xwt,
AK31/p294:Zp-552Xwt. The BZLF1 protein from the plasmids is marked with
an arrowhead.
|
|
It has been suggested that latency of EBV might be maintained by
antisense transcription of the EBNA-1 gene, interference by a latent
viral gene product, or DNA methylation. Although they may play a role,
these proposed mechanisms seem to be unnecessary at the level of Zp in
our system, in which the Zp response to anti-Ig was apparently
reconstituted on the stably maintained plasmids. Antisense RNA seems
unlikely to be the controlling mechanism, since the regulation worked
equally well for either orientation of Zp in the plasmids (Fig. 2B).
There seems to be no requirement for another viral gene product apart
from EBNA-1 in the maintenance of Zp latency since there are no other
EBV genes in the cell lines shown in Fig. 2C and since Zp in these
plasmids behaved similarly to EBV. The possibility of DNA methylation
of the Zp promoter being required for latency was investigated directly
by measuring CpG methylation on the plasmids and on the endogenous EBV
in AK6 cells by using comparative sensitivity to restriction digestion by MspI and HpaII (Fig.
5). DNA is cleaved to completion by
MspI, but cleavage by HpaII is prevented at CpG
methylated restriction sites, resulting in slower-migrating bands in
the HpaII tracks on the Southern blot that differ from the
MspI bands, if there is methylation. Although there was some
methylation of the EBV DNA, no methylation was detected by this method
in the Zp promoter region of the plasmid, which regulated Zp properly.
There is one CpG dinucleotide within the
226-bp promoter that is not
within an MspI restriction site and thus cannot be monitored
by restriction digestion. Methylation at this site (position
79 in
Fig. 4A) was tested by using sequencing of bisulfite-modified DNA from the AK31/p294:Zp-3241 cells. This showed no methylation in the Zp
plasmid at this position (six bisulfite-modified clones sequenced; data
not shown), although the
226 deletion regulates properly (Fig. 4B).
So, while there is likely to be a role for methylation in the control
of gene expression in EBV latency, methylation of Zp is not required to
keep Zp inactive prior to induction by anti-Ig in the plasmids, which
seem to accurately mimic the induction of Zp in the whole virus. There
was also no change in the DNA methylation revealed in the restriction
digestion assays in response to anti-Ig treatment (Fig. 5).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 5.
DNA methylation analysis of Zp region. DNA from cell
lines AK6 or AK31/p294:Zp-3241 treated for 48 h with anti-Ig (+)
or left untreated ( ) was digested with BamHI (B),
HpaII (H), or MspI (M). After electrophoresis and
Southern blotting, the filters were probed with a Zp PCR fragment
(nucleotides 103180 to 103751 of B95-8 EBV). The 498-bp MspI
restriction fragment from Zp is marked with an arrowhead; the EBV
BamHI Z fragment detected by the probe is 1,794 bp in
length.
|
|
Our results are consistent with the model in which a primary signal
from anti-Ig leads to some expression of BZLF1 which can then bind to
its own promoter and strongly activate further transcription, this autoactivation being responsible for most of the measurable BZLF1
(11, 26, 39). Transfection of the BZLF1 gene under the
control of a strong promoter is itself able to activate the lytic cycle
but, interestingly, does not activate the endogenous BZLF1 gene through
the Zp promoter (17, 20). The stably maintained plasmids in
our system were tested for this level of regulation by comparing the
response to anti-Ig of the wild-type Zp plasmid to the MIC mutant in
EBV-positive AK6 cells (Fig. 6). The MIC mutant promoter only responded very weakly to direct anti-Ig activation (Fig. 4C), but in a transient-transfection assay it retains 70% of the
wild-type inducibility in response to a cotransfected BZLF1 expression
vector (11). We thus tested whether the BZLF1 produced from
the endogenous Akata genome is able to activate the MIC mutant promoter
in trans (Fig. 6). The Zp wild-type plasmid and another mutant (MID) responded directly to anti-Ig induction, but the MIC
mutant again responded very weakly, even though BZLF1 was produced from
the endogenous EBV (Fig. 6a). The lack of response with the MIC mutant
was not due to a lack of template DNA in the cell line; a Southern blot
showed a similar level of plasmid DNA in all three cell lines tested
(Fig. 6b). The data suggest that the mechanism for protecting the
promoter in latently infected cells from activation by BZLF1 in the
absence of anti-Ig induction is present in our system. These results
and our conclusions that antisense transcription, interference by a
latent viral gene product, and DNA methylation of the Zp promoter are
not required for correct regulation of Zp lead us to the notion that
some form of chromatin structure at the Zp might be preventing Zp
activation until the signal from anti-Ig released that repression so
that BZLF1 autoactivation of transcription could occur.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
(a) Western blot of BZLF1 protein expression in
extracts from AK6/p294:Zp-552Xwt (wt), AK6/p294:Zp-552XMIC (MIC),
and AK6/p294:Zp-552XMID (MID) cells either with (+) or without
( ) anti-Ig treatment for 24 h. The two BZLF1 bands are shown by
arrows (upper, Akata; lower, B95-8 plasmid). (b) DNA was extracted from
the cell lines in panel a without anti-Ig treatment, digested with
EcoRI, and analyzed by Southern blotting by using
p294:Zp-552Xwt as a probe (sizes shown in kilobases). The 9.4-kb
plasmid band hybridizes disproportionately strongly because it contains
the oriP and EBNA-1 repeat sequences, so its intensity should not
be compared with the larger cross-hybridizing 30-kb EcoRI B
fragment derived from the endogenous EBV in the AK6 cells.
|
|
Chromatin structure of EBV and regulation of Zp.
EBV DNA has
been shown previously to be organized in nucleosomes in latently
infected cells (7, 34). The standard nucleosome pattern was
found in EBV by using a probe across the Zp region (Fig.
7). Nucleosome-associated chromatin
structure was also detected in the stably maintained Zp plasmids with a
Zp probe (Fig. 7), although this appeared to be less extensive than
with the corresponding probe on EBV, perhaps because of technical
aspects of the assay in view of the much smaller size of the plasmid or
relative proximity of Zp in the plasmids to oriP. No difference in
nucleosome pattern could be detected in response to anti-Ig induction,
but only about 20% of the Akata cells induce into the lytic cycle in
response to anti-Ig treatment, so it would be surprising if changes
could be detected by examining the bulk DNA.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 7.
Nucleosome structure of Akata EBV in AK6 cells and BZLF1
plasmid in AK31/p294:Zp-3241 cells (with [+] or without [ ]
anti-Ig treatment) in the Zp region. Nuclei were treated with
micrococcal nuclease, and the resulting DNA was analyzed by Southern
blotting. Filters were probed with a Zp PCR fragment (nucleotides
103180 to 103751 of B95-8 EBV). Track B is a BamHI digest of
the DNA without nuclease treatment and lanes 0 to 20 (min) are a time
course of micrococcal nuclease treatment.
|
|
The presence of chromatin structure in the Zp promoter region of the
plasmids (Fig. 7) encouraged us to investigate the possibility that
some of the Zp elements might be related to recruitment of chromatin
remodelling agents such as histone acetyltransferases. Histone
acetylation is one mechanism by which chromatin conformation that
regulates gene expression is maintained in cells (14, 16, 27). Trichostatin A is a specific inhibitor of histone
deacetylases, so treatment of cells with trichostatin A results in an
increase in histone acetylation and activation of genes that have been repressed by histone deacetylation. Treatment of AK6 cells with trichostatin A did not induce BZLF1 expression, and there was little
evidence for synergy between trichostatin A and anti-Ig treatment on Zp
in the wild-type Zp plasmid p294:Zp-552Xwt (Fig. 8). However,
trichostatin A treatment rescued the anti-Ig inducibility of certain Zp
mutant constructs, particularly the MIA/B and MIC mutants. These
results suggest that Zp activation that results from signal
transduction from anti-Ig through these elements involves histone
acetylation. Factors binding to the ZIA/B and ZIC elements would be
involved in the recruitment of histone acetylase activity to the
promoter so that activation can proceed. When these elements were
mutated, the promoter could not be activated unless it was artificially
acetylated by trichostatin A treatment of the cells. There may also be
additional steps involving histone acetylation or deacetylation in the
regulation of Zp since with the MIIIB and MII mutants trichostatin
reduced the inducibility by anti-Ig (Fig.
8).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 8.
Trichostatin A treatment of Akata cell clones.
Western blots of BZLF1 expression in cell lines containing Zp mutations
treated (+) or untreated ( ) with anti-Ig and/or
trichostatin A. Lanes: MIA/B, AK31/p294:Zp-552XMIA/B; MIC,
AK31/p294:Zp-552XMIC; MID, AK31/p294:Zp-552XMID; MIIIA,
AK31/p294:Zp-552XMIIIA; MIIIB, AK31/p294:Zp-552XMIIIB; MII,
AK31/p294:Zp-552XMII; Xwt, AK31/p294:Zp-552Xwt. The BZLF1 protein is
marked with an arrowhead.
|
|
Although the immediate-early nature of Zp indicates that its activation
does not require induction of intermediate gene expression, the data in
Fig. 8 do not exclude the possibility of trichostatin A acting by
inducing expression of other transcription factors that might
transregulate Zp. To confirm that histone acetylation at Zp is involved
in the activation of the Zp promoter, we directly studied the histone
acetylation of the Zp region in response to anti-Ig treatment of the
cells in the more physiologically relevant situation of induction of
the endogenous Akata virus BZLF1 gene in Akata cells. After treatment
with anti-Ig, the chromatin was temporarily stabilized by cross-linking
with formaldehyde. The cross-linked chromatin was sonicated to reduce
it to the size of a few nucleosomes and then immunoprecipitated with an
antibody specific for acetylated histone H4. The precipitated fraction was isolated by using protein A-Sepharose beads, the
cross-linking was reversed, and the presence of Zp DNA sequences
in the acetylated fraction was determined by PCR with primers
that amplify part of the Zp sequence. The amount of DNA template in the
PCRs and the number of cycles were adjusted so that the amplification
product was detected but not saturated. Anti-Ig treatment of the cells resulted in an increase in Zp sequences in the chromatin fraction that
bound to the antibody specific for acetylated histone H4 (Fig.
9). In contrast, this short period of
anti-Ig treatment made no difference to the level of DNA from various
other regions of the EBV genome in the chromatin fraction that bound to
the antibody specific for acetylated histone H4 (Fig. 9). The control regions tested were the promoter of a late gene (BCRF1) and sequences in the BKRF4 or BdRF1 genes. These data confirm that histone
acetylation of the chromatin around Zp occurs during Zp activation in
the EBV genome.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 9.
Immunoprecipitation of chromatin containing acetylated
histone H4. Duplicate aliquots of Akata (AK6) cells were treated with
anti-Ig (+) or were left untreated ( ) for 3 h. Sonicated,
cross-linked chromatin fragments were immunoprecipitated with antibody
to acetylated histone H4 or a control rabbit serum containing an
equivalent level of IgG. The immunoprecipitated DNA was analyzed by PCR
for Zp promoter region sequences (nucleotides 103180 to 103751) (a) or,
as controls, for sequences in the BKRF4 gene (nucleotides 111360 to
111737) (b), the promoter sequence of the EBV late gene BCRF1
(nucleotides 8748 to 9560) (c), and sequences in the BdRF1 gene
(nucleotides 149061 to 149637) (d). Negative (N) and positive (P)
controls for the PCR reactions, lacking template or with an Akata or
B95-8 DNA template, respectively, were coelectrophoresed with the
experimental samples. Size markers (M) were a HindIII
digest of phage DNA (a and c) or a HaeIII digest of X174
DNA (b and d), and PCR products were detected by staining with ethidium
bromide. The specific products of the PCR reactions are indicated by
arrows.
|
|
 |
DISCUSSION |
Although much of the understanding of gene expression and
regulation has come from transient-transfection assays with promoters linked to reporter genes, it is impossible to relate those results quantitatively to the real gene. The very low efficiency of transient transfection in lymphoid cells also complicates the interpretation of
the results. We first addressed this problem in the analysis of EBV
gene regulation by making recombinant viruses to study the Cp promoter
for the EBNA genes (8). The site-directed mutants of Cp in
EBV yielded valuable insight into the regulation of Cp but also
illustrated several difficulties with the recombinant virus approach.
Most approaches to EBV recombination require that the mutant progeny be
competent in transformation of B lymphocytes, imposing considerable
selection on the phenotypes of the progeny virus. Standard methods are
also very lengthy and difficult to apply to large numbers of
recombinant constructs and yield recombinant virus in LCLs, which
express LMP-2 that suppresses activation of the lytic cycle, hindering
the study of Zp. We have therefore developed an alternative
strategy in which autonomously replicating episomes with oriP and
EBNA-1 encoded within the plasmid are used as very small
analogues of the EBV genome to reconstitute expression and regulation
of the BZLF1 gene.
The regulation of the Zp promoter in response to anti-Ig was similar in
the oriP plasmids described here to that observed in the EBV genome
(Fig. 2). There appeared to be no requirement for sequences more than
226 bp upstream of the transcription start for the positive regulation
by anti-Ig, but there was evidence for a weak negative regulatory
effect on anti-Ig induction by the sequences between positions
226
and
552. Negative regulatory elements in this region have been
investigated by using transient-transfection assays, focusing on YY1
sites (25) and sequences referred to as H1 elements
(33), but it is not yet clear how that mapping, which was
based on TPA induction or constitutive activity, relates to the
regulation studied in our experiments. The activity of the negative
elements between positions
226 and
552 thus deserves further
investigation. All of our experiments so far have been performed in the
context of the intact BZLF1 gene, permitting autoactivation of the Zp
promoter by the BZLF1 protein, which is the normal biological
situation. We cannot tell on the basis of our current results whether
there might be regulatory elements downstream of the transcription
start, within the BZLF1 coding sequence or introns that might be
involved in the gene regulation, but this could also be investigated in
future experiments.
The detailed footprinting and analysis of the effects of mutating Zp
promoter elements in the response to TPA and theophylline in
transient-transfection reporter assays (11, 18) formed a
basis for our investigation. The anti-Ig response of the Zp promoter
has also been studied directly by using Zp-CAT reporter plasmids
(35); the induction by anti-Ig in those studies was lower
than the induction of BZLF1 observed in EBV in Akata cells but
nevertheless clearly directed attention to the ZIA/B element in the
anti-Ig regulation of Zp (35). We were unable to obtain satisfactory anti-Ig regulation of Zp reporter constructs in
transient-transfection experiments (G. Packham, P. Jenkins, and P. J. Farrell, unpublished results), and this led us to pursue the system
described here. The effects of some of the site-directed mutants on
BZLF1 expression in our system were similar to the transient assays,
but there were some important differences.
One notable difference was that in the transient assay experiments,
both of the ZIIIA and ZIIIB elements had been found to be essential for
efficient autoactivation of the promoter by BZLF1 (11);
since ZIIIB was found to have a slightly higher affinity for BZLF1
binding in a footprinting analysis, it was assumed that ZIIIB was the
more important BZLF1 binding site (11). In our experiments
with the stably transformed cells, which accurately mimic the response
of the whole viral genome, ZIIIB can be mutated with only a modest
reduction in the activation of BZLF1 expression. In contrast, mutation
of the more canonical ZIIIA site greatly reduced activation of the
promoter. The degree of inactivation in MIIIA suggests that this mutant
may affect the direct response to anti-Ig as well as the autoactivation
by BZLF1, perhaps consistent with a slight reduction in inducibility of
MIIIA in response to TPA noted in an earlier transient assay
(11). There was some variation in the reduction of activity
caused by mutation of the ZII element between cell lines, but the
result shown in Fig. 8 is typical of the reduction observed. Mutation
of the ZIA/B or ZIC elements greatly reduced BZLF1 inducibility by
anti-Ig. It is important to remember that we have not tested all
promoter sequences within the
221 region systematically, so there may be further essential genetic elements that have not been investigated here. However, the site-directed mutants (devised originally by Flemington and Speck [11]) covered the regions of the
promoter found to be protected in a footprinting assay, so they are
likely to represent the major elements of importance.
The insensitivity of endogenous Zp in latent EBV in response to
activation by BZLF1 compared to Zp in a transfected plasmid (17,
20) indicated that it was likely that Zp is protected from
activation by BZLF1 protein in the EBV genomes in latently infected
cells. We have argued against antisense transcription as a mechanism
for the maintenance of EBV latency because the activation of Zp on the
oriP plasmids in our experiments was equally effective when the
orientation of the Zp sequences was reversed in the plasmid. There was
a certain amount of readthrough transcription in the oriP plasmids
(Fig. 3 and data not shown), particularly from the EBNA-1 gene in the
plasmids, but there was no evidence that this was relevant to the
control of Zp expression. DNA methylation within the minimal Zp region
that we have tested also seemed to be unnecessary in the plasmids for
apparently normal regulation of Zp. There is clearly DNA methylation of
latent EBV in vivo, at least in the parts of the genome that have been
examined (31), and the general underrepresentation of CpG
residues is consistent with methylation of EBV DNA during evolution of
the viral sequence. DNA methylation is likely to provide an additional
level of repression of the viral genome in latency, or it might be that
methylation outside the Zp promoter is important for the maintenance of
latency, but our experiments suggest that the primary mechanism by
which Zp is regulated between latency and lytic activation does not require DNA methylation of Zp DNA. We had anticipated that DNA methylation might be an explanation for why only a proportion of the
cells in an Akata population (10 to 30% in our experiments) responds
to anti-Ig, but the fraction of cells containing the transfected
plasmids that responds is similar, indicating that DNA methylation of
Zp is not the limiting factor.
Recently it has become clear that modification of histones in
chromatin, particularly through acetylation, is a very widespread mechanism by which the activity of genes is regulated (14, 16, 27). The acetylation of the histones most likely results in the
more open chromatin conformation which has long been known to be
associated with transcriptionally active genes. Histone acetyltransferases associated with gene activation have been
identified, and there are now several examples of transcriptional
repressors which have been shown to act by recruiting histone
deacetylase activity to the promoter. Based on the earlier
transcription results (17, 20) and the data presented here,
we suggest that a repressive chromatin conformation is present on the
Zp DNA in latency that prevents activation of the promoter until the
structure is released in response to signal transduction from anti-Ig.
The MIA/B and MIC mutants of Zp showed the greatest restoration of
anti-Ig inducibility in response to trichostatin A (Fig. 8), indicating
that the contribution to promoter activity mediated by signal
transduction through these elements in the wild-type Zp promoter
results in changes to the promoter that are functionally equivalent to
histone acetylation. Whether the factors that bind to these elements in
fact contain histone acetylase or recruit a histone acetylase to the
promoter remains to be determined, but it is clear that the acetylation of histone H4 occurs in the Zp region in response to anti-Ig signal transduction (Fig. 9). The reductions in anti-Ig-induced BZLF1 expression observed with the trichostatin treatment of MIIIB and MII
(Fig. 8) imply that there may be multiple (possibly compensating) steps
involving histone acetylation, but the simplest model that would
explain the data so far would be that a transcriptionally repressive
chromatin structure involving deacetylated histones at the Zp region
causes the inactivity of Zp during latency. This repression would be
overcome (so that virus reactivation can occur) in response to the
signal transduction resulting from cross-linking surface Ig, a
procedure designed to mimic the binding of antigen to the surface Ig.
Multiple signals are involved in Zp activation (39), but the
histone acetylation reported here appears to be a key early step in the process.
 |
ACKNOWLEDGMENTS |
We thank Sam Speck for supplying Zp mutant plasmids, Richard
Ambinder for advice on bisulphite sequencing, Martine Hollyoake and
Claudio Elgueta for excellent technical assistance, and Martin Allday
and Graham Packham for critically reading the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Ludwig Institute
for Cancer Research, Imperial College School of Medicine, St. Mary's Campus, Norfolk Pl., London W2 1PG, United Kingdom. Phone:
44-171-724-5522. Fax: 44-171-724-8586. E-mail:
p.farrell{at}ic.ac.uk.
 |
REFERENCES |
| 1.
|
Alberts, A.,
O. Geneste, and R. Treisman.
1998.
Activation of SRF-regulated chromosomal templates by Rho-family GTPases requires a signal that also induces H4 hyperacetylation.
Cell
92:475-487[CrossRef][Medline].
|
| 2.
|
Babcock, G. J.,
L. L. Decker,
M. Volk, and D. A. Thorley-Lawson.
1998.
EBV persistence in memory B cells in vivo.
Immunity
9:395-404[CrossRef][Medline].
|
| 3.
|
Baer, R.,
A. T. Bankier,
M. D. Biggin,
P. L. Deininger,
P. J. Farrell,
T. J. Gibson,
G. Hatfull,
G. S. Hudson,
S. C. Satchwell,
C. Seguin,
P. Tuffnell, and B. Barrell.
1984.
DNA sequence and expression of the B95-8 Epstein-Barr virus genome.
Nature
310:207-211[CrossRef][Medline].
|
| 4.
|
Braunstein, M.,
A. Rose,
S. Holmes,
C. Allis, and J. Broach.
1993.
Transcriptional silencing in yeast is associated with reduced nucleosome acetylation.
Genes Dev.
7:592-604[Abstract/Free Full Text].
|
| 5.
|
Chen, H.,
P. Smith,
R. F. Ambinder, and S. D. Hayward.
1999.
Expression of Epstein-Barr virus BamHI-A rightward transcripts in latently infected B cells from peripheral blood.
Blood
93:3026-3032[Abstract/Free Full Text].
|
| 6.
|
Countryman, J., and G. Miller.
1985.
Activation of expression of latent Epstein-Barr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA.
Proc. Natl. Acad. Sci. USA
82:4085-4089[Abstract/Free Full Text].
|
| 7.
|
Dyson, P. J., and P. J. Farrell.
1985.
Chromatin structure of Epstein-Barr virus.
J. Gen. Virol.
66:1931-1940[Abstract/Free Full Text].
|
| 8.
|
Evans, T. J.,
P. J. Farrell, and S. Swaminathan.
1996.
Molecular genetic analysis of Epstein-Barr virus Cp promoter function.
J. Virol.
70:1695-1705[Abstract].
|
| 9.
|
Farrell, P. J.,
D. T. Rowe,
C. M. Rooney, and T. Kouzarides.
1989.
Epstein-Barr virus BZLF1 trans-activator specifically binds to a consensus AP-1 site and is related to c-fos.
EMBO J.
8:127-132[Medline].
|
| 10.
|
Flanagan, J. G., and T. H. Rabbitts.
1982.
The sequence of a human immunoglobulin epsilon heavy chain constant region gene, and evidence for three non-allelic genes.
EMBO J.
1:655-660[Medline].
|
| 11.
|
Flemington, E., and S. H. Speck.
1990.
Autoregulation of Epstein-Barr virus putative lytic switch gene BZLF1.
J. Virol.
64:1227-1232[Abstract/Free Full Text].
|
| 12.
|
Frommer, M.,
L. McDonald,
D. Millar,
C. Collis,
F. Watt,
G. Grigg,
P. Molloy, and C. Paul.
1992.
A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands.
Proc. Natl. Acad. Sci. USA
89:1827-1831[Abstract/Free Full Text].
|
| 13.
|
Griffin, B. E., and L. Karran.
1984.
Immortalization of monkey epithelial cells by specific fragments of Epstein-Barr virus DNA.
Nature
309:78-82[CrossRef][Medline].
|
| 14.
|
Grunstein, M.
1997.
Histone acetylation in chromatin structure and transcription.
Nature
389:349-352[CrossRef][Medline].
|
| 15.
|
Hirt, B.
1967.
Selective extraction of polyoma DNA from infected mouse cell cultures.
J. Mol. Biol.
26:365-369[CrossRef][Medline].
|
| 16.
|
Kadonaga, J.
1998.
Eukaryotic transcription: an interlaced network of transcription factors and chromatin-modifying machines.
Cell
92:307-313[CrossRef][Medline].
|
| 17.
|
Kolman, J. L.,
N. Taylor,
L. Gradoville,
J. Countryman, and G. Miller.
1996.
Comparing transcriptional activation and autostimulation by ZEBRA and ZEBRA/c-Fos chimeras.
J. Virol.
70:1493-1504[Abstract].
|
| 18.
|
Kouzarides, T.,
G. Packham,
A. Cook, and P. J. Farrell.
1991.
The BZLF1 protein of EBV has a coiled coil dimerisation domain without a heptad leucine repeat but with homology to the C/EBP leucine zipper.
Oncogene
6:195-204[Medline].
|
| 19.
|
Laux, G.,
U. K. Freese,
R. Fischer,
A. Polack,
E. Kofler, and G. W. Bornkamm.
1988.
TPA-inducible Epstein-Barr virus genes in Raji cells and their regulation.
Virology
162:503-507[CrossRef][Medline].
|
| 20.
|
Le Roux, F.,
A. Sergeant, and L. Corbo.
1996.
Epstein-Barr virus (EBV) EB1/Zta protein provided in trans and competent for the activation of productive cycle genes does not activate the BZLF1 gene in the EBV genome.
J. Gen. Virol.
77:501-509[Abstract/Free Full Text].
|
| 21.
|
Liu, P.,
S. Liu, and S. Speck.
1998.
Identification of a negative cis element within the ZII domain of the Epstein-Barr virus lytic switch BZLF1 gene.
J. Virol.
72:8230-8239[Abstract/Free Full Text].
|
| 22.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 23.
|
Mann, K. P.,
D. Staunton, and D. A. Thorley-Lawson.
1985.
Epstein-Barr virus-encoded protein found in plasma membranes of transformed cells.
J. Virol.
55:710-720[Abstract/Free Full Text].
|
| 24.
|
Miyashita, E. M.,
B. Yang,
K. M. Lam,
D. H. Crawford, and D. A. Thorley-Lawson.
1995.
A novel form of Epstein-Barr virus latency in normal B cells in vivo.
Cell
80:593-601[CrossRef][Medline].
|
| 25.
|
Montalvo, E. A.,
M. Cottam,
S. Hill, and Y. J. Wang.
1995.
YY1 binds to and regulates cis-acting negative elements in the Epstein-Barr virus BZLF1 promoter.
J. Virol.
69:4158-4165[Abstract].
|
| 26.
|
Packham, G.,
M. Brimmell,
D. Cook,
A. Sinclair, and P. Farrell.
1993.
Strain variation in Epstein-Barr virus immediate early genes.
Virology
192:541-550[CrossRef][Medline].
|
| 27.
|
Pazin, M., and J. Kadonaga.
1997.
What's up and down with histone deacetylation and transcription?
Cell
89:325-328[CrossRef][Medline].
|
| 28.
|
Prang, N.,
H. Wolf, and F. Schwarzmann.
1995.
Epstein-Barr virus lytic replication is controlled by posttranscriptional negative regulation of BZLF1.
J. Virol.
69:2644-2648[Abstract].
|
| 29.
|
Qu, L., and D. T. Rowe.
1992.
Epstein-Barr virus latent gene expression in uncultured peripheral blood lymphocytes.
J. Virol.
66:3715-3724[Abstract/Free Full Text].
|
| 30.
|
Rickinson, A. B., and E. Kieff.
1996.
Epstein-Barr virus, p. 2397-2446.
In
B. N. Fields, P. M. Knipe, and P. M. Howley (ed.), Fields virology. Lippincott-Raven, Philadelphia, Pa.
|
| 31.
|
Robertson, K., and R. Ambinder.
1997.
Methylation of the Epstein-Barr virus genome in normal lymphocytes.
Blood
90:4480-4484[Abstract/Free Full Text].
|
| 32.
|
Rowe, M.,
D. T. Rowe,
C. D. Gregory,
L. S. Young,
P. J. Farrell,
H. Rupani, and A. B. Rickinson.
1987.
Differences in B cell growth phenotype reflect novel patterns of Epstein-Barr virus latent gene expression in Burkitt's lymphoma cells.
EMBO J.
6:2743-2751[Medline].
|
| 33.
|
Schwarzmann, F.,
N. Prang,
B. Reichelt,
B. Rinkes,
S. Haist,
M. Marschall, and H. Wolf.
1994.
Negatively cis-acting elements in the distal part of the promoter of Epstein-Barr virus trans-activator gene BZLF1.
J. Gen. Virol.
75:1999-2006[Abstract/Free Full Text].
|
| 34.
|
Shaw, J. E.,
L. F. Levinger, and C. Carter, Jr.
1979.
Nucleosomal structure of Epstein-Barr virus DNA in transformed cell lines.
J. Virol.
29:657-665[Abstract/Free Full Text].
|
| 35.
|
Shimizu, N., and K. Takada.
1993.
Analysis of the BZLF1 promoter of Epstein-Barr virus: identification of an anti-immunoglobulin response sequence.
J. Virol.
67:3240-3245[Abstract/Free Full Text].
|
| 36.
|
Shimizu, N.,
A. Tanabe-Tochikura,
Y. Kuroiwa, and K. Takada.
1994.
Isolation of Epstein-Barr virus (EBV)-negative cell clones from the EBV-positive Burkitt's lymphoma (BL) line Akata: malignant phenotypes of BL cells are dependent on EBV.
J. Virol.
68:6069-6073[Abstract/Free Full Text].
|
| 37.
|
Sinclair, A. J.,
M. Brimmell,
F. Shanahan, and P. J. Farrell.
1991.
Pathways of activation of the Epstein-Barr virus productive cycle.
J. Virol.
65:2237-2244[Abstract/Free Full Text].
|
| 38.
|
Sinclair, A. J.,
M. G. Jacquemin,
L. Brooks,
F. Shanahan,
M. Brimmell,
M. Rowe, and P. J. Farrell.
1994.
Reduced signal transduction through glucocorticoid receptor in Burkitt's lymphoma cell lines.
Virology
199:339-353[CrossRef][Medline].
|
| 39.
|
Speck, S.,
T. Chatila, and E. Flemington.
1997.
Reactivation of Epstein-Barr virus: regulation and function of the BZLF1 gene.
Trends Microbiol.
5:399-405[CrossRef][Medline].
|
| 40.
|
Sugden, B., and N. Warren.
1989.
A promoter of Epstein-Barr virus that can function during latent infection can be transactivated by EBNA-1, a viral protein required for viral DNA replication during latent infection.
J. Virol.
63:2644-2649[Abstract/Free Full Text].
|
| 41.
|
Takada, K.
1984.
Cross-linking of cell surface immunoglobulins induces Epstein-Barr virus in Burkitt lymphoma lines.
Int. J. Cancer
33:27-32[Medline].
|
| 42.
|
Takada, K., and Y. Ono.
1989.
Synchronous and sequential activation of latently infected Epstein-Barr virus genomes.
J. Virol.
63:445-449[Abstract/Free Full Text].
|
| 43.
|
Tierney, R. J.,
N. Steven,
L. S. Young, and A. B. Rickinson.
1994.
Epstein-Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state.
J. Virol.
68:7374-7385[Abstract/Free Full Text].
|
| 44.
|
Young, L. S.,
R. Lau,
M. Rowe,
G. Niedobitek,
G. Packham,
F. Shanahan,
D. T. Rowe,
D. Greenspan,
J. S. Greenspan,
A. B. Rickinson, and P. Farrell.
1991.
Differentiation-associated expression of the Epstein-Barr virus BZLF1 transactivator protein in oral hairy leukoplakia.
J. Virol.
65:2868-2874[Abstract/Free Full Text].
|
Journal of Virology, January 2000, p. 710-720, Vol. 74, No. 2
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lucchesi, W., Brady, G., Dittrich-Breiholz, O., Kracht, M., Russ, R., Farrell, P. J.
(2008). Differential Gene Regulation by Epstein-Barr Virus Type 1 and Type 2 EBNA2. J. Virol.
82: 7456-7466
[Abstract]
[Full Text]
-
Chang, S.-S., Lo, Y.-C., Chua, H.-H., Chiu, H.-Y., Tsai, S.-C., Chen, J.-Y., Lo, K.-W., Tsai, C.-H.
(2008). Critical Role of p53 in Histone Deacetylase Inhibitor-Induced Epstein-Barr Virus Zta Expression. J. Virol.
82: 7745-7751
[Abstract]
[Full Text]
-
Countryman, J. K., Gradoville, L., Miller, G.
(2008). Histone Hyperacetylation Occurs on Promoters of Lytic Cycle Regulatory Genes in Epstein-Barr Virus-Infected Cell Lines Which Are Refractory to Disruption of Latency by Histone Deacetylase Inhibitors. J. Virol.
82: 4706-4719
[Abstract]
[Full Text]
-
Chia, M. C., Leung, A., Krushel, T., Alajez, N. M., Lo, K. W., Busson, P., Klamut, H. J., Bastianutto, C., Liu, F.-F.
(2008). Nuclear Factor-Y and Epstein Barr Virus in Nasopharyngeal Cancer. Clin. Cancer Res.
14: 984-994
[Abstract]
[Full Text]
-
Sun, C. C., Thorley-Lawson, D. A.
(2007). Plasma Cell-Specific Transcription Factor XBP-1s Binds to and Transactivates the Epstein-Barr Virus BZLF1 Promoter. J. Virol.
81: 13566-13577
[Abstract]
[Full Text]
-
Palmeri, D., Spadavecchia, S., Carroll, K. D., Lukac, D. M.
(2007). Promoter- and Cell-Specific Transcriptional Transactivation by the Kaposi's Sarcoma-Associated Herpesvirus ORF57/Mta Protein. J. Virol.
81: 13299-13314
[Abstract]
[Full Text]
-
Ye, J., Gradoville, L., Daigle, D., Miller, G.
(2007). De Novo Protein Synthesis Is Required for Lytic Cycle Reactivation of Epstein-Barr Virus, but Not Kaposi's Sarcoma-Associated Herpesvirus, in Response to Histone Deacetylase Inhibitors and Protein Kinase C Agonists. J. Virol.
81: 9279-9291
[Abstract]
[Full Text]
-
Carroll, K. D., Khadim, F., Spadavecchia, S., Palmeri,