Previous Article | Next Article ![]()
Journal of Virology, January 2000, p. 693-701, Vol. 74, No. 2
Departments of
Neurology,1
Neurosurgery,2 and
Microbiology,3 University of
Pennsylvania Medical Center, Philadelphia, Pennsylvania
Received 24 June 1999/Accepted 22 September 1999
Microglia are the main reservoir for human immunodeficiency virus
type 1 (HIV-1) in the central nervous system (CNS), and multinucleated
giant cells, the result of fusion of HIV-1-infected microglia and
brain macrophages, are the neuropathologic hallmark of HIV
dementia. One potential explanation for the formation of syncytia is
viral adaptation for these CD4+ CNS cells.
HIV-1BORI-15, a virus adapted to growth in microglia by sequential passage in vitro, mediates high levels of fusion and replicates more efficiently in microglia and
monocyte-derived-macrophages than its unpassaged parent (J. M. Strizki, A. V. Albright, H. Sheng, M. O'Connor, L. Perrin, and F. Gonzalez-Scarano, J. Virol. 70:7654-7662, 1996). Since the
interaction between the viral envelope glycoprotein and CD4 and the
chemokine receptor mediates fusion and plays a key role in tropism, we
have analyzed the HIV-1BORI-15 env as a fusogen
and in recombinant and pseudotyped viruses. Its syncytium-forming phenotype is not the result of a switch in
coreceptor use but rather of the HIV-1BORI-15
envelope-mediated fusion of CD4+CCR5+ cells
with greater efficiency than that of its parental strain, either by
itself or in the context of a recombinant virus. Genetic analysis
indicated that the syncytium-forming phenotype was due to four discrete
amino acid differences in V1/V2, with a single-amino-acid change
between the parent and the adapted virus (E153G) responsible for the
majority of the effect. Additionally, HIV-1BORI-15
env-pseudotyped viruses were less sensitive to
decreases in the levels of CD4 on transfected 293T cells, leading to
the hypothesis that the differences in V1/V2 alter the interaction
between this envelope and CD4 or CCR5, or both. In sum, the
characterization of the envelope of HIV-1BORI-15, a highly
fusogenic glycoprotein with genetic determinants in V1/V2, may
lead to a better understanding of the relationship between HIV
replication and syncytium formation in the CNS and of
the importance of this region of gp120 in the interaction with CD4 and CCR5.
Multinucleated giant cells
(MGC) are the most specific markers of human immunodeficiency
virus (HIV) encephalitis, the pathological correlate of HIV dementia
(HIVD), a progressive central nervous system (CNS) syndrome induced by
HIV-1 infection (27, 43, 51, 68). MGC are thought to be the
result of fusion of microglia and brain macrophages mediated by the
HIV-1 glycoproteins, and in fact, the CNS is one of the few sites where
syncytia, a common in vitro cytopathological effect of HIV infection,
can be observed in vivo. Concomitantly, MGC express HIV antigens
and RNA, as well as surface markers for microglia and macrophages
(69). Microglia isolated from either adult or fetal brain
can also be infected in vitro with certain HIV-1 strains (26, 30,
34, 42, 58), primarily those previously designated as macrophage
tropic, and at least in adult microglia, this infection can be
maintained for at least several weeks in culture. Depending on the
specific HIV-1 isolate, microglia infected in vitro are also
susceptible to giant cell formation (60, 67).
HIV-1 tropism and syncytium formation are closely reflected in the use
of seven-transmembrane-domain G-protein coupled molecules, principally
CXCR4 and CCR5, as coreceptors that in conjunction with CD4 mediate
virus entry into primary cells. Microglia express both CXCR4 and CCR5,
as well as other potential coreceptors, including CCR3 (1,
25). However, CCR5 appears to be the most important coreceptor for adult microglial cells (1, 58), although
there may be some instances where CCR3 use predominates
(30). Therefore, the formation of syncytia in microglial
cells likely involves the interaction of HIV with those coreceptor
molecules that are now considered to be the most important coreceptors
in most cell types (76).
Additionally, sequence analysis of several HIV-1 genes has indicated
that HIV strains within the CNS evolve somewhat independently of
strains in other body compartments, such as the spleen (23, 37,
70), suggesting a degree of sequestration of HIV replication. Whether such sequestration has any specific effect on the development of HIVD or in syncytium formation is considerably more controversial; some investigators have suggested that specific sequence motifs are associated with CNS infection, whereas others have not found such relationships (18, 35, 49). However, it is reasonable to hypothesize that localized replication results in the adaptation of
HIV-1 isolates to CNS cell types, and specifically microglia, which
bear the brunt of the virus burden in the brain. To determine whether
the process of adaptation to microglia could be mimicked in vitro, we
sequentially passaged a primary, blood-derived isolate, HIV-1BORI (13), in microglial cultures
and derived an isolate, HIV-1BORI-15, with
greater capacity to replicate in these cells. Somewhat
independently, this virus also resulted in marked enhancement of
syncytium formation in microglia, less so in monocyte-derived macrophages (MDM), and not at all in peripheral blood mononuclear cells
(PBMCs) (60).
Since the interactions resulting in syncytium formation in primary
cells are potentially important in the development of HIVD, we have
characterized in detail the differences between
HIV-1BORI and HIV-1BORI-15.
Using recombinant viruses, we determined that the
HIV-1BORI-15 env sequences were
sufficient to mediate syncytium formation, and those amino acids
critical to fusion were identified. The results point to the importance
of the V1/V2 regions in the interaction between these CCR5-using
viruses and primary microglia. Additionally, we determined that fusion
of microglia by recombinant viruses incorporating the relevant regions
of HIV-1BORI-15 was not dependent on viral
replication, and it was induced even in the presence of antiretroviral
drugs, suggesting fusion from without (FFWO).
Cells.
Microglia were prepared from fresh adult human brain
tissue obtained from donors undergoing temporal lobectomy for
medication-resistant epilepsy (67, 75). The microglia were
cultured in Dulbecco's modified Eagle medium with 5% fetal calf
serum, 5% Giant Cell Tumor Supernatant (Fisher), gentamicin (50 µg/ml), and sodium pyruvate (1 mM). U373-MAGI-CCR5E cells
(66) and MAGI-CCR5 cells (9) (both provided by
the AIDS Research and Reference Reagent Program) express CD4 and the
chemokine receptor CCR5. These cells also contain an HIV-1-long
terminal repeat-beta-galactosidase sequence resulting in
beta-galactosidase activity following HIV infection. These cells were
cultured in selective medium. 293T and U87 cells were cultured in
Dulbecco's modified Eagle medium with 10% heat-inactivated fetal
bovine serum (58), as were the quail QT6 cells.
HIV-1 isolates and env clones.
HIV-1BORI, which was obtained from an individual
with primary HIV-1 infection, was a gift from G. Shaw (University of
Alabama). HIV-1BORI-15 resulted from 15 sequential
passages of the parental HIV-1BORI isolate in
microglia (60). The env genes were cloned by PCR
amplification and TA cloning (Invitrogen) from infected peripheral
blood lymphocytes (for HIV-1BORI) or from infected microglia (HIV-1BORI-15) (58).
Additional env clones were subsequently amplified from
HIV-1BORI for further sequence comparison.
env genes were sequenced with six primers that spanned the
entire env sequence (Nucleic Acid Core Facility, Children's
Hospital of Philadelphia).
Cell-to-cell fusion assay.
The cell-to-cell fusion assay
(46) was performed as adapted by Rucker et al.
(54). Briefly, 293T cells (effector cells) were infected
with recombinant vaccinia virus expressing T7 polymerase (vTF1.1; a
gift of B. Moss, National Institutes of Health) and transfected with
envelope-expressing constructs, 89.6 env (15) (obtained from R. Collman, University of Pennsylvania),
HIV-1BORI env (clone 11A), or
HIV-1BORI-15 env (clone 4C)
(58), by the calcium phosphate method. These cells were
incubated overnight at 30°C in medium containing rifampin (100 µg/ml) to inhibit vaccinia virus replication. Quail QT6 cells (target
cells) were transfected with plasmids expressing CD4 and/or the
chemokine receptors CCR3 and CCR5 and then incubated overnight. The
293T effector cells were lifted with versene, resuspended in cold
medium, and washed with cold phosphate-buffered saline. The cells were
then resuspended in medium containing rifampin (0.1 mg/ml) and cytosine
Cloning env sequences into a common backbone
virus.
The full-length provirus pIIIB (a derivative of HXB3) was
originally used by Hwang et al. (33). Fragments of envelope
clones from HIV-1BORI (clone 11A) and
HIV-1BORI-15 (clone 4C) were first cloned into a
shuttle vector containing the SalI-XhoI fragment of pIIIB by using KpnI and AvaI, and then a
SalI-BamHI fragment from the shuttle vector was
cloned into the full-length provirus pIIIB. The resulting chimeric
viruses VH-Bori and VH-B15 contain the HIV-1BORI
and HIV-1BORI-15 env sequences,
respectively, with the exception of the first 39 and last 131 amino
acids of env, which originate from pIIIB. The additional
chimeric viruses VH-R4 and VH-R7 were constructed by using a
BglII site which is located in the C2 region of
env. The viruses were produced by calcium phosphate
transfection of 293T cells, and the virus-containing supernatants were
centrifuged (10 min at 1,750 × g on a Beckman centrifuge) for clarification and stored at Fine mapping of amino acids involved in syncytium-forming
phenotype.
The recombinant virus constructs were altered with PCR
to include the full-length gp120 from HIV-1BORI or
HIV-1BORI-15. First a fragment of pIIIB was
amplified with the primers vpr-up and env-rev, and then a fragment of
either HIV-1BORI or
HIV-1BORI-15 env was amplified with the
primers env1 and 3'-V3out. The fragments were purified and joined by
PCR with the outer primers and cloned into VH-BORI or VH-B15 with
SalI and BglII to give the recombinants VH-rBORI
and VH-rB15. Site-directed mutants were generated by PCR with mutagenic
oligonucleotides. Briefly, a fragment of env was amplified
with env1 primer and a reverse mutagenic primer, and a second fragment
of env was amplified with a forward mutagenic primer and the
3'-V3out primer. The fragments were joined with outer primers and
cloned into VH-rBORI by using KpnI and BglII to
yield individual mutations in V1/V2 loops in the background of
VH-rBORI. VH-rV1/V2 was generated by cloning a
KpnI-StuI fragment from
HIV-1BORI-15 env into VH-rBORI to yield
a virus that differs from VH-rBORI by only four amino acids in V1/V2.
The primer sequences are as follows (with standard numbering positions
relative to HXB2CG): vpr-up,
ATGGAACAAGCCCCAGAAGACCAAGGGCCACA (5559 to 5590); env-rev, TCATTGCCACTGTCTTCTGCTCTTTCT (6228 to 6202);
env1, AGAAAGAGCAGAAGACAGTGGCAATGA (6202 to 6228);
3'-V3out, AATTTCTGGGTCCCCTCCTG (7337 to 7318); 153-forw, GGGAGAAATGAGAGGAGGAATAAAAAAATGCTC (6657 to 6697);
153-rev, GAGCATTTTTTTATTCCTCCTCTCATTTCTCCC (6697 to 6657);
162-forw, GCTCTTTCAATGTCGCCACAAGAATAAG (6694 to 6721);
162-rev, CTTATTCTTGTGGCGACATTGAAAGAGC (6721 to 6694);
190-forw, GGTAATGGTAATACTAGATATAGGTTG (6777 to 6803);
190-rev, CAACCTATATCTAGTATTACCATTACC (6803 to 6777).
Infections.
Seven- to 10-day-old microglia were
infected with 5 to 50 ng of p24gag of HIV-1 per
well of a 96-well plate. The supernatant p24gag
antigen concentrations were determined at regular intervals
(58). For infection of U373-MAGI-CCR5E cells and MAGI-CCR5
cells, the cells were infected with VH-BORI or VH-B15 in the presence
of 20 µg of DEAE dextran/ml for 2 h at 37°C (9, 29,
66).
Syncytium formation.
Microglia or MDM were cultured in
either four- or eight-chamber Permanox tissue culture slides (Nunc) and
infected as described above. Syncytium formation was assessed by
staining the cells with a nuclear stain (1:50 dilution of Hoechst 33342 [bis-benzimide] fluorochrome; Molecular Probes Inc., Eugene, Oreg.)
and with a ligand that labels microglia or MDM via their low-density
lipoprotein receptors (1:100 dilution of DiI-Ac-LDL; Biomedical
Technologies, Inc., Stoughton, Mass.). The U373-MAGI-CCR5E and
MAGI-CCR5 cell lines were infected as indicated above and stained
48 h after infection either with Diff-Quik cell staining reagents
(Baxter) or, for beta-galactosidase activity, with X-Gal
(5-bromo-4-chloro-3-indolyl- Infection of cells transfected with different amounts of CD4.
env-pseudotyped luciferase reporter viruses were prepared by
transfection of 293T cells as previously described (1, 16, 58). Basically, the cells were cotransfected with
pNL-4-3-LucR+E
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Determinants of Syncytium Formation in Microglia by
Human Immunodeficiency Virus Type 1: Role of the V1/V2
Domains
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-D-arabinofuranoside (10 µM) to inhibit vaccinia virus
replication, overlaid on the transfected QT6 target cells, and
incubated for 8 h at 37°C. The cells were then lysed in
luciferase reporter lysis buffer (Promega), and luciferase activity was
measured with a Wallac 1450 Microbeta Plus luminometer. Cell-to-cell
fusion reactions were performed in triplicate, and the averages and
standard deviations are shown.
80°C. Envelope
glycoprotein expression was assayed by Western blotting of transfected
293T cell lysates and virus-containing supernatants with a rabbit
polyclonal anti-gp120 antibody (a gift from R. Doms, University of
Pennsylvania) (32).
-D-galactopyranoside). For
the quantification of syncytia, digital photographs of random microscopic fields were obtained under a 10× objective and the nucleus/cell ratio was determined by direct counting. Approximately 400 to 800 nuclei were counted for each datum point.
(a gift of N. Landau, Aaron
Diamond AIDS Research Center) and envelope-expressing shuttle vectors
used for cloning envelopes into pIIIB, and supernatants were collected
48 h later. 293T cells were transfected in six-well plates with
various amounts of plasmid encoding CD4, CCR5-expressing plasmid, and
control pcDNA3.1(
) (Invitrogen, San Diego, Calif.) in a total of 5 µg of DNA per well and infected 24 h later with pseudotyped
viruses. The cells were lysed at 48 h postinfection, and
luciferase activity was measured by mixing the lysates with Luciferase
Assay Substrate (Promega) in a Wallac 1450 Microbeta luminometer
detector (1).
| |
RESULTS |
|---|
|
|
|---|
Cell-to-cell fusion mediated by BORI envelopes is CD4 and CCR5 dependent. In comparison with the parental HIV-1BORI isolate, the virus derived by serial passage (HIV-1BORI-15) caused extensive syncytia in microglia (60). Previous experiments also showed that the envelope genes from HIV-1BORI and HIV-1BORI-15 utilize CCR5 as a coreceptor in conjunction with CD4 (58). Since several recent studies have demonstrated that coreceptors can be used as primary receptors (i.e., without CD4) by specific HIV-2 and HIV-1 isolates as well as by many simian immunodeficiency virus isolates (20-22, 31, 52), we performed additional cell-to-cell fusion assays with the HIV-1BORI and HIV-1BORI-15 env clones, paying particular attention to the use of coreceptors without CD4. The results (Fig. 1) indicated that the HIV-1BORI-15 envelope could not mediate fusion with target cells transfected with CCR5 only. However, we noted that in the presence of CCR5 and CD4, the HIV-1BORI-15 env demonstrated two- to threefold-higher levels of fusion than the HIV-1BORI env, although we could not rule out potential differences in glycoprotein expression at the cell surface.
|
Generation of recombinant viruses with envelope sequences from HIV-1BORI and HIV-1BORI-15. To determine whether the HIV-1BORI-15 env by itself could mediate the syncytium-forming phenotype, we cloned large fragments of env (KpnI-AvaI) from HIV-1BORI-15 or HIV-1BORI into a common full-length proviral backbone pIIIB (an HXB3-based clone) (33) to generate the recombinant viruses VH-BORI and VH-B15, respectively (Fig. 2) (see Materials and Methods). We also constructed additional recombinant viruses that contained chimeric env sequences (Fig. 2), either the upstream portion of env from HIV-1BORI-15 with the downstream portion of env from HIV-1BORI (VH-R4) or the upstream portion of the HIV-1BORI env with the downstream portion of the HIV-1BORI-15 env (VH-R7). There were no differences in the genes overlapping env in these constructs. To include as much of the gp160 sequence as possible in our recombinant viruses, we also replaced the pIIIB env sequences at the beginning of the env coding sequence of VH-BORI and VH-B15 with the corresponding env sequences from HIV-1BORI or HIV-1BORI-15 (constructs VH-rBORI and VH-rB15). Minor differences in vpu in these constructs are described below.
|
Replication of VH-BORI and VH-B15 in peripheral blood lymphocytes. To confirm that the recombinant viruses were functional, we infected PBMCs with VH-BORI, VH-B15, VH-R4, and VH-R7 and monitored viral replication over time by determining p24gag antigen concentration (Fig. 3) at regular intervals. All of the recombinant viruses replicated efficiently in PBMCs, and there were no gross differences in the kinetics of viral replication.
|
Syncytium formation in microglia due to VH-BORI and VH-B15. The recombinant viruses containing envelope sequences from HIV-1BORI or HIV-1BORI-15 were then assayed for syncytium formation in microglia. Equivalent p24gag antigen concentrations were used to infect the microglia, and the cultures were examined at several points for syncytium formation (Fig. 4). VH-BORI- and VH-B15-infected microglia demonstrated strikingly different syncytium formation phenotypes even under low-power magnification (Fig. 4A and B, respectively). VH-B15 induced classic syncytia, with focal aggregation of cells, often with circular arrangements of the corresponding nuclei. Under higher-power magnification (Fig. 4D), the large cells were easily identified as giant syncytia. In contrast to the results with VH-B15, VH-BORI did not induce syncytia (Fig. 4A and C).
|
|
Replication of VH-BORI and VH-B15 in microglia. We also determined whether VH-BORI and VH-B15 replicated in microglia. A representative experiment is shown in Fig. 5. Both VH-B15 and VH-BORI replicated slightly better than the X4 backbone virus pIIIB (HXB-3 env), which, as expected, did not replicate well in microglia. Interestingly, VH-B15 and VH-BORI replicated with similar kinetics and to similar peak levels, indicating that in the context of pIIIB the env sequences from HIV-1BORI-15 were not sufficient to mediate the high-replication phenotype observed with this isolate. Notably, the level of replication of VH-B15 was lower than that observed with the original microglia-passaged virus (HIV-1BORI-15) (60). Since it was formally possible that VH-B15-induced syncytium formation could inhibit virus replication, we infected microglia with 10- and 100-fold-lower inocula of VH-BORI and VH-B15, but we still did not observe differences in replication between VH-BORI and VH-B15 (data not shown). These data suggest that other regions of HIV-1BORI-15 are involved in its high replication in microglia.
|
Amino acid differences between
HIV-1BORI and
HIV-1BORI-15.
Comparison of the
env sequences of the two isolates showed differences in
eight amino acids (Table 2); seven were
in gp120, and there was a single change in gp41. Furthermore, four of
the differing amino acids were located in the V1/V2 loops of gp120, and
two of these (T162A and S190R) encoded the loss of potential N-linked
glycosylation sites. Most of the other changes were nonconservative. Using the chimeric data described above, it was clear that at most the
first five amino acid differences could be important in mediating the
VH-B15 syncytium-forming phenotype, since only those changes were
incorporated into VH-R4, which mediated extensive syncytia (Fig. 2 and
4). We analyzed the V1/V2/C2 region of two other functional
HIV-1BORI-15 env clones and one other
functional HIV-1BORI env clone and
confirmed that the amino acid differences were relatively conserved
within different env clones from the same virus. The loss of
the potential glycosylation site in V2 (S190R) was observed in all
three HIV-1BORI-15 env clones; however, one HIV-1BORI env clone contained an R
at position 190, even though infection with it did not result in
extensive syncytium formation (data not shown). Changes in V3
(60) previously noted by PCR sequencing of the wild-type
virus were variable when individual clones were examined (data not
shown). There were no differences between the V3 domains of the
env clones used in these experiments.
|
Mapping of the amino acid differences involved in the syncytium-forming phenotype. To exclude the possibility that the pIIIB env sequences at the beginning of the env coding sequence of VH-B15 were contributing to the observed fusogenicity, we replaced these pIIIB env sequences with the corresponding sequence from either HIV-1BORI-15 or HIV-1BORI. These additional recombinant viruses (VH-rBORI and VH-rB15) therefore contained full-length gp120 sequences from HIV-1BORI or HIV-1BORI-15 and demonstrated phenotypes similar to those of VH-B15 and VH-BORI in the syncytium-forming assay (Fig. 6). These constructions introduced a stop codon in the vpu reading frame, resulting in a slightly shorter deduced protein for VH-BORI. This did not have an effect on replication in PBMCs (data not shown). Furthermore, preincubation of microglia with the anti-CCR5 antibody (2D7) or an anti-CD4 antibody (no. 21; a gift of J. Hoxie) inhibited the syncytium formation due to VH-rB15 (Fig. 6). As with VH-B15, however, VH-rB15-induced syncytium formation was not inhibited by the reverse transcriptase inhibitors zidovudine and efavirenz (0.01 µM), indicating that viral replication was not required (data not shown).
|
Infection of cells with different amounts of CD4. One possibility that might explain the mechanism of syncytium formation by HIV-1BORI-15 is adaptation to the relatively low levels of CD4 present in microglia. To test this, we performed an experiment where env-pseudotyped viruses were used to infect 293T cells transfected with a CCR5-expressing plasmid and with 10-fold-decreasing amounts of plasmid expressing CD4. When we stained transfected cells for CD4 and analyzed cell surface expression by flow cytometry (Fig. 7A), we noted a close relationship between the amount of CD4-expressing plasmid transfected and the levels of CD4 expression. As shown in Fig. 7B, pseudotyped viruses with envelopes from HIV-1BORI-15 and HIV-1BORI infected 293T cells transfected with large amounts of CD4 and CCR5; however, only pseudotypes with the env from HIV-1BORI-15 maintained the ability to infect cells transfected with smaller amounts of CD4. Similar results were observed in similarly transfected U87 cells (data not shown). These results suggest a number of potential mechanisms for the adaptation of HIV-1BORI-15 and will provide a framework for future studies.
|
| |
DISCUSSION |
|---|
|
|
|---|
MGC, the result of fusion between infected and uninfected microglia and macrophages, are the signature neuropathological finding in HIVD and are the main reservoir for HIV within the CNS (27, 63). Given the evidence of genetic sequestration within the CNS provided by postmortem studies (23, 37, 70), it is likely that a subpopulation of viruses replicates in microglia and adapts to them over an indeterminate period. While studies have documented the phenotype and to some extent the evolution of viruses in the cerebrospinal fluid (6, 38), because of the obvious sampling problem, few studies have looked at the functional evolution of virus in the CNS parenchyma, necessitating the design of in vitro studies.
We characterized a virus, HIV-1BORI-15, that forms extensive syncytia in microglia cultures and compared it to its parental primary isolate, HIV-1BORI. The syncytium-forming phenotype could not be explained by a simple coreceptor switch or by CD4-independent entry. Rather, the HIV-1BORI-15 envelope had a quantitatively greater ability to mediate fusion of several CD4+CCR5+ cell types. In the context of pIIIB backbone, envelope sequences from HIV-1BORI-15 (VH-B15) mediated a high level of syncytium formation in microglia in comparison with an equivalent construct with the HIV-1BORI env (VH-BORI), whereas both viruses replicated equivalently in PBMCs. Furthermore, VH-B15 infected U373-MAGI-CCR5E cells with greater efficiency than VH-BORI, and pseudotypes incorporating the HIV-1BORI-15 env constructs were less sensitive to decreases in the amount of CD4 on the cell surface when CCR5 levels were held constant.
Surprisingly, VH-B15-mediated fusion was independent of viral replication, since it occurred within 24 h of exposure to the cells and was not decreased by reverse transcriptase inhibitors, indicating FFWO. However, the timing of fusion with the uncloned HIV-1BORI-15, which occurred at 2 to 3 weeks after infection, did not suggest FFWO. FFWO, or fusion mediated by viral particles in the absence of infection, is a well-known phenomenon in other enveloped viruses with high fusion potential (2, 28, 56, 59) and has previously been described in HIV under certain circumstances (14). We hypothesize that the high fusion activity mediated by VH-B15 is due to the intrinsically greater fusogenicity of the HIV-1BORI-15 env. It is unlikely that the gp41 sequences from HXB-3 present in the VH-based recombinants played a major role in this fusion, since VH-BORI did not demonstrate any significant syncytium formation. We also found equivalent envelope expression among the recombinant viruses (data not shown). In any case, the syncytium-forming phenotype was clearly mapped to four amino acids in the V1/V2 region, with the bulk of the VH-B15 fusogenicity accounted for by a single-amino-acid difference, E153G. Surprisingly, the loss of two potential glycosylation sites in the same region, while perhaps associated with changes in neutralization (data not shown), had no major effect on syncytium formation when introduced independently. Moreover, the full phenotype depended on all four amino acid differences between VH-BORI and VH-B15, indicating that it is probably related to the overall conformation of the region.
Our results support the idea that envelope sequences play a major role in HIV-1 tropism for microglia, although it is probably not the exclusive determinant. Since HIV-1 isolates obtained from the CNS are predominantly R5 (i.e., use CCR5 as coreceptor), once a mechanism for its enhanced syncytium formation has been defined, the experiments with HIV-1BORI-15 will provide information regarding the interactions between HIV and these specialized cells. Specifically, there may be requirements for interaction with CD4 and CCR5 at the ratio present in microglial cells.
We believe that there are different interactions between the HIV-1BORI and the HIV-1BORI-15 envelopes and CD4 or CCR5 and that the V1/V2 loops are critical to this difference. Although the effects of V3 on tropism, particularly in determining coreceptor use, have received the widest attention (10, 12, 32, 57, 65), some investigators have found that sequences in V1/V2 can influence virus spread in MDM (64). There is also an extensive literature indicating that these loops are involved in neutralization (7, 11) and other cellular tropisms (5, 8, 36, 44, 45, 47, 62, 72). In the current model of HIV entry, the V1/V2 loops are thought to shield the coreceptor binding site (73). CD4 binding probably induces a conformational change involving the V1/V2 loops that exposes a conserved coreceptor binding site (53). This conformational change is detectable through increased binding of some antibodies, like 17b (61, 73, 74).
How could the HIV-1BORI-15 envelope influence this interaction? We can propose several potential scenarios. Firstly, the V1/V2 loops of HIV-1BORI-15 gp120 may favor the conformation triggered by CD4 binding, increasing the exposure of the chemokine receptor-binding site. On a membrane with few CD4 molecules, like those of microglia (17), this more stable conformation may be necessary to promote a gp120-CCR5 interaction. Along the same lines, the interaction between HIV-1BORI-15 gp120 and CD4 could be stronger, resulting in a similar outcome. Indeed, HIV-1 strains may have different affinities for the CD4-coreceptor complex and demonstrate variations in infectivity of cells with different amounts of receptor and coreceptor (39, 48). Alternatively the HIV-1BORI-15 gp120 could interact with CCR5 more efficiently, with the more basic V1/V2 region of the HIV-1BORI-15 gp120 (in comparison with HIV-1BORI) facilitating gp120 interaction with the acidic residues in the CCR5 amino terminus (19, 24). Interaction with different extracellular domains of CCR5 or different conformational states of CCR5 may also play a role (3, 4, 41, 55). Future studies with purified preparations of HIV-1BORI-15 gp120 should determine which of these possibilities is most relevant to its phenotype. If the results are generalized to other HIV strains, these findings could provide mechanistic information regarding the development of syncytia in this area of HIV pathogenesis. Indeed a recent report focused on the involvement of V1/V2 regions in HIVD (50).
We were surprised that, when placed in the context of the pIIIB backbone, the HIV-1BORI-15 env did not produce a virus with high replication in microglia, in comparison with VH-BORI. This may indicate that other regions of the HIV-1BORI-15 virus are involved in its neurotropism. Alternatively, the high fusogenicity exhibited by its envelope could have affected p24gag release or viral spread. Defining the mechanism of the enhanced replication will be an area for future experimentation.
Finally, the neutralization pattern of HIV-1BORI-15 may provide additional evidence of the importance of the conformation of env in generating an effective immune response. Preliminary studies with these viruses showed that HIV-1BORI-15 may be easier to neutralize than its parent. In light of recent findings that fusogenic intermediates of env may generate broadly cross-reactive antibody responses (40) and that a CD4-independent HIV-1 stably exposing its coreceptor binding site is more easily neutralized (31), this isolate may be a candidate for a better understanding of the potential role of V1/V2 in immunity.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by PHS grants NS-27405, NS-35743, and MH-58958 and by the Medical Scientist Training Program (J.T.C.S.).
We thank G. Shaw (University of Alabama) for the HIV-1BORI isolate and B. Moss (NIH) for vTF1.1. Bob Doms, Jim Hoxie, Trevor Hoffman, and Andrew Albright provided excellent advice and reagents. We also thank L. Shawver and W. Cao for technical assistance. A number of reagents were obtained through the NIH AIDS Research Reagent and Reference Program, including the U373-MAGI cell lines from M. Emerman and A. Geballe and the MAGI-CCR5 cell line from J. Overbaugh.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Dept. of Neurology, University of Pennsylvania School of Medicine, Clinical Research Building, 415 Curie Blvd., Philadelphia, PA 19104-6146. Phone: (215) 662-3389. Fax: (215) 573-2029. E-mail: scarano{at}mail.med.upenn.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Albright, A. V.,
J. T. C. Shieh,
T. Itoh,
B. Lee,
D. Pleasure,
M. J. O'Connor,
R. W. Doms, and F. Gonzalez-Scarano.
1999.
Microglia express CCR5, CXCR4, and CCR3, but of these, CCR5 is the principal coreceptor for human immunodeficiency virus type 1 dementia isolates.
J. Virol.
73:205-213 |
| 2. |
Andersen, K. B.
1994.
A domain of murine retrovirus surface protein gp70 mediates fusion, as shown in a novel SC-1 cell fusion system.
J. Virol.
68:3175-3182 |
| 3. |
Atchison, R. E.,
J. Gosling,
F. S. Monteclaro,
C. Franci,
L. Digilio,
I. F. Charo, and M. A. Goldsmith.
1996.
Multiple extracellular elements of CCR5 and HIV-1 entry: dissociation from response to chemokines.
Science
274:1924-1926 |
| 4. | Bieniasz, D., R. A. Fridell, I. Aramori, S. S. G. Ferguson, M. G. Caron, and B. R. Cullen. 1997. HIV-1-induced cell fusion is mediated by multiple regions within the viral envelope and the CCR-5 co-receptor. EMBO J. 16:2599-2609[CrossRef][Medline]. |
| 5. |
Boyd, M. T.,
G. R. Simpson,
A. J. Cann,
M. A. Johnson, and R. A. Weiss.
1993.
A single amino acid substitution in the V1 loop of human immunodeficiency virus type 1 gp120 alters cellular tropism.
J. Virol.
67:3649-3652 |
| 6. | Brew, B. J., L. Evans, C. Byrne, L. Pemberton, and L. Hurren. 1996. The relationship between AIDS dementia complex and the presence of macrophage tropic and non syncytium inducing isolates of human immunodeficiency virus type 1 in the cerebrospinal fluid. J. Neurovirol. 2:152-157[Medline]. |
| 7. | Cao, J., N. Sullivan, E. Desjardin, C. Parolin, J. Robinson, R. Wyatt, and J. Sodroski. 1997. Replication and neutralization of human immunodeficiency virus type 1 lacking the V1 and V2 variable loops of the gp120 envelope glycoprotein. J. Virol. 71:9808-9812[Abstract]. |
| 8. | Carillo, A., and L. Ratner. 1996. Cooperative effects of the human immunodeficiency virus type 1 envelope variable loops V1 and V3 in mediating infectivity for T cells. J. Virol. 70:1310-1316[Abstract]. |
| 9. | Chackerian, B., E. M. Long, P. A. Luciw, and J. Overbaugh. 1997. Human immunodeficiency virus type 1 coreceptors participate in postentry stages in the virus replication cycle and function in simian immunodeficiency virus infection. J. Virol. 71:3932-3939[Abstract]. |
| 10. |
Chan, S. Y.,
R. F. Speck,
C. Power,
S. L. Gaffen,
B. Chesebro, and M. A. Goldsmith.
1999.
V3 recombinants indicate a central role for CCR5 as a coreceptor in tissue infection by human immunodeficiency virus type 1.
J. Virol.
73:2350-2358 |
| 11. |
Cheng-Mayer, C.,
A. Brown,
J. Harouse,
P. A. Luciw, and A. J. Mayer.
1999.
Selection for neutralization resistance of the Simian/Human Immunodeficiency Virus SHIVSF33A variant in vivo by virtue of sequence changes in the extracellular envelope glycoprotein that modify N-linked glycosylation.
J. Virol.
73:5294-5300 |
| 12. | Choe, H., M. Farzan, Y. Sun, N. Sullivan, B. Rollins, P. D. Ponath, J. Wu, C. R. Mackay, G. LaRosa, W. Newman, N. Gerard, C. Gerard, and J. Sodroski. 1996. The b-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell 85:1135-1148[CrossRef][Medline]. |
| 13. | Clark, S. J., M. S. Saag, W. D. Decker, S. Campbell-Hill, J. L. Roberson, P. J. Veldkamp, J. C. Kappes, B. H. Hahn, and G. M. Shaw. 1991. High titers of cytopathic virus in plasma of patients with symptomatic primary HIV-1 infection. N. Engl. J. Med. 324:954-960[Abstract]. |
| 14. |
Clavel, F., and P. Charneau.
1994.
Fusion from without directed by human immunodeficiency virus particles.
J. Virol.
68:1179-1185 |
| 15. |
Collman, R.,
J. W. Balliet,
S. A. Gregory,
H. Friedman,
D. L. Kolson,
N. Nathanson, and A. Srinivasan.
1992.
An infectious molecular clone of an unusual macrophage-tropic and highly cytopathic strain of human immunodeficiency virus type 1.
J. Virol.
66:7517-7521 |
| 16. | Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. Di Marzio, S. Marmon, R. E. Sutton, C. M. Hill, C. B. Davis, S. C. Peiper, T. J. Schall, D. R. Littman, and N. R. Landau. 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381:661-666[CrossRef][Medline]. |
| 17. | Dick, A. D., M. Pell, B. J. Brew, E. Foulcher, and J. D. Sedgwick. 1997. Direct ex vivo flow cytometric analysis of human microglial cell CD4 expression: examination of central nervous system biopsy specimens from HIV-seropositive patients and patients with other neurological disease. AIDS 11:1699-1708[CrossRef][Medline]. |
| 18. | Di Stefano, M., S. Wilt, F. Gray, M. Dubois-Dalcq, and F. Chiodi. 1996. HIV type 1 V3 sequences and the development of dementia during AIDS. AIDS Res. Hum. Retrovir. 12:471-476[Medline]. |
| 19. |
Dragic, T.,
A. Trkola,
S. W. Lin,
K. A. Nagashima,
F. Kajumo,
L. Zhao,
W. C. Olson,
L. Wu,
C. R. Mackay,
G. P. Allaway,
T. P. Sakmar,
J. P. Moore, and P. J. Maddon.
1998.
Amino-terminal substitutions in the CCR5 coreceptor impair gp120 binding and human immunodeficiency virus type 1 entry.
J. Virol.
72:279-285 |
| 20. |
Dumonceaux, J.,
S. Nisole,
C. Chanel,
L. Quivet,
A. Amara,
F. Baleux,
P. Briand, and U. Hazan.
1998.
Spontaneous mutations in the env gene of the human immunodeficiency virus type 1 NDK isolate are associated with a CD4-independent entry phenotype.
J. Virol.
72:512-519 |
| 21. |
Edinger, A. L.,
J. L. Mankowski,
B. J. Doranz,
B. J. Margulies,
B. Lee,
J. Rucker,
M. Sharron,
T. L. Hoffman,
J. F. Berson,
M. C. Zink,
V. M. Hirsch,
J. E. Clements, and R. W. Doms.
1997.
CD4-independent, CCR5-dependent infection of brain capillary endothelial cells by a neurovirulent simian immunodeficiency virus strain.
Proc. Natl. Acad. Sci. USA
94:14742-14747 |
| 22. | Endres, M. J., P. R. Clapham, M. Marsh, M. Ahuja, J. D. Turner, A. McKnight, J. F. Thomas, B. Stoebenau-Haggerty, S. Choe, P. J. Vance, T. N. Wells, C. A. Power, S. S. Sutterwala, R. W. Doms, N. R. Landau, and J. A. Hoxie. 1996. CD4-independent infection by HIV-2 is mediated by fusin/CXCR4. Cell 87:745-756[CrossRef][Medline]. |
| 23. | Epstein, L. G., C. Kuiken, B. M. Blumberg, S. Hartman, L. R. Sharer, M. Clement, and J. Goudsmit. 1991. HIV-1 V3 domain variation in brain and spleen of children with AIDS: tissue-specific evolution within host-determined quasispecies. Virology 180:583-590[CrossRef][Medline]. |
| 24. | Farzan, M., T. Mirzabekov, P. Kolchinsky, R. Wyatt, M. Cayabyab, N. P. Gerard, C. Gerard, J. Sodroski, and H. Choe. 1999. Tyrosine sulfation of the amino terminus of CCR5 facilitates HIV-1 entry. Cell 96:667-676[CrossRef][Medline]. |
| 25. | Gabuzda, D., J. He, A. Ohagen, and A. V. Vallat. 1998. Chemokine receptors in HIV-1 infection of the central nervous system. Semin. Immunol. 10:203-213[CrossRef][Medline]. |
| 26. |
Ghorpade, A.,
M. Q. Xia,
B. T. Hyman,
Y. Persidsky,
A. Nukuna,
P. Bock,
M. Che,
J. Limoges,
H. E. Gendelman, and C. R. MacKay.
1998.
Role of the beta-chemokine receptors CCR3 and CCR5 in human immunodeficiency virus type 1 infection of monocytes and microglia.
J. Virol.
72:3351-3361 |
| 27. |
Glass, J. D.,
S. L. Wesselingh,
O. A. Selnes, and J. C. McArthur.
1993.
Clinical-neuropathological correlation in HIV-associated dementia.
Neurology
43:2230-2237 |
| 28. | Gonzalez-Scarano, F., N. Pobjecky, and N. Nathanson. 1984. La Crosse bunyavirus can mediate pH-dependent fusion from without. Virology 132:222-225[CrossRef][Medline]. |
| 29. |
Harrington, R. D., and A. P. Geballe.
1993.
Cofactor requirement for human immunodeficiency virus type 1 entry into a CD4-expressing human cell line.
J. Virol.
67:5939-5947 |
| 30. | He, J., Y. Chen, M. Farzan, H. Choe, A. Ohagen, S. Gartner, J. Busciglio, X. Yang, W. Hofmann, W. Newman, C. R. Mackay, J. Sodroski, and D. Gabuzda. 1997. CCR3 and CCR5 are co-receptors for HIV-1 infection of microglia. Nature 385:645-649[CrossRef][Medline]. |
| 31. |
Hoffman, T. L.,
C. C. LaBranche,
W. Zhang,
G. Canziani,
J. Robinson,
I. Chaiken,
J. A. Hoxie, and R. W. Doms.
1999.
Stable exposure of the coreceptor-binding site in a CD4-independent HIV-1 envelope protein.
Proc. Natl. Acad. Sci. USA
96:6359-6364 |
| 32. |
Hoffman, T. L.,
E. B. Stephens,
O. Narayan, and R. W. Doms.
1998.
HIV type I envelope determinants for use of the CCR2b, CCR3, STRL33, and APJ coreceptors.
Proc. Natl. Acad. Sci. USA
95:11360-11365 |
| 33. |
Hwang, S. S.,
T. J. Boyle,
H. K. Lyerly, and B. R. Cullen.
1991.
Identification of the envelope V3 loop as the primary determinant of cell tropism in HIV-1.
Science
253:71-74 |
| 34. | Ioannidis, J. P. A., S. Reichlin, and P. R. Skolnik. 1995. Long-term productive human immunodeficiency virus-1 infection in human infant microglia. Am. J. Pathol. 147:1200-1206[Abstract]. |
| 35. | Keys, B., J. Karis, B. Fadeel, A. Valentin, G. Norkrans, L. Hagberg, and F. Chiodi. 1993. V3 sequences of paired HIV-1 isolates from blood and CSF cluster according to host and show variation related to the clinical stage of disease. Virology 196:475-483[CrossRef][Medline]. |
| 36. | Koito, A., G. Harrowe, J. A. Levy, and C. Cheng-Mayer. Functional role of the V1/V2 region of human immunodeficiency virus type 1 envelope glycoprotein in infection of primary macrophages and soluble CD4 neutralization. J. Virol. 68:2253-2259. |
| 37. |
Korber, B. T. M.,
K. J. Kunstman,
B. K. Patterson,
M. Furtado,
M. M. McEvilly,
R. Levy, and S. M. Wolinsky.
1994.
Genetic differences between blood- and brain-derived viral sequences from human immunodeficiency virus type 1-infected patients: evidence of conserved elements in the V3 region of the envelope protein of brain-derived sequences.
J. Virol.
68:7467-7481 |
| 38. |
Koyanagi, Y.,
S. Miles,
R. T. Mitsuyasu,
J. T. Merrill,
H. V. Vinters, and I. S. Y. Chen.
1987.
Dual infection of the central nervous system by AIDS virus with distinct cellular tropisms.
Science
236:819-822 |
| 39. | Kozak, S. L., E. J. Platt, N. Madani, F. E. Ferro, K. Peden, and D. Kabat. 1997. CD4, CXCR-4, and CCR-5 dependencies for infections by primary patient and laboratory-adapted isolates of human immunodeficiency virus type 1. J. Virol. 71:873-882[Abstract]. |
| 40. |
LaCasse, R. A.,
K. E. Follis,
M. Trahey,
J. D. Scarborough,
D. R. Littman, and J. H. Nunberg.
1999.
Fusion-competent vaccines: broad neutralization of primary isolates of HIV.
Science
283:357-362 |
| 41. |
Lee, B.,
M. Sharron,
C. Blanpain,
B. J. Doranz,
J. Vakili,
P. Setoh,
E. Berg,
G. Liu,
H. R. Guy,
S. R. Drell,
M. Parmentier,
C. N. Chang,
K. Price,
M. Tsang, and R. W. Doms.
1999.
Epitope mapping of CCR5 reveals multiple conformational states and distinct overlapping structures involved in chemokine and coreceptor function.
J. Biol. Chem.
274:9617-9626 |
| 42. | Lee, S. C., C. Hatch, W. Liu, Y. Kress, B. D. Lyman, and D. W. Dickson. 1993. Productive infection of human fetal microglia by HIV-1. Am. J. Pathol. 143:1032-1039[Abstract]. |
| 43. |
Lipton, S. A., and H. E. Gendelman.
1995.
Dementia associated with the acquired immunodeficiency syndrome.
N. Engl. J. Med.
332:934-940 |
| 44. | Mondor, I., M. Moulard, S. Ugolini, P. J. Klasse, J. Hoxie, A. Amara, T. Delaunay, R. Wyatt, J. Sodroski, and Q. J. Sattentau. 1998. Interactions among HIV gp120, CD4, and CXCR4: dependence on CD4 expression level, gp120 viral origin, conservation of the gp120 COOH- and NH2-termini and V1/V2 and V3 loops, and sensitivity to neutralizing antibodies. Virology 248:394-405[CrossRef][Medline]. |
| 45. | Morikita, T., Y. Maeda, S.-I. Fujii, S. Matsushita, K. Obaru, and K. Takatsuki. 1997. The V1/V2 region of Human Immunodeficiency Virus type 1 modulates the sensitivity to neutralization by soluble CD4 and cellular tropism. AIDS Res. Hum. Retrovir. 13:1291-1298[Medline]. |
| 46. |
Nussbaum, O.,
C. C. Broder, and E. A. Berger.
1994.
Fusogenic mechanisms of enveloped-virus glycoproteins analyzed by a novel recombinant vaccinia virus-based assay quantitating cell fusion-dependent reporter gene activation.
J. Virol.
68:5411-5418 |
| 47. | Palmer, C., P. Balfe, D. Fox, J. C. May, R. Frederiksson, E.-M. Fenyo, and J. A. McKeating. 1996. Functional characterization of the V1V2 region of Human Immunodeficiency Virus type 1. Virology 220:436-449[CrossRef][Medline]. |
| 48. | Platt, E. J., N. Madani, S. L. Kozak, and D. Kabat. 1997. Infectious properties of human immunodeficiency virus type 1 mutants with distinct affinities for the CD4 receptor. J. Virol. 71:883-890[Abstract]. |
| 49. |
Power, C.,
J. C. McArthur,
R. T. Johnson,
D. E. Griffin,
J. D. Glass,
S. Perryman, and B. Chesebro.
1994.
Demented and nondemented patients with AIDS differ in brain-derived human immunodeficiency virus type 1 envelope sequences.
J. Virol.
68:4643-4649 |
| 50. |
Power, C.,
J. C. McArthur,
A. Nath,
K. Wehrly,
M. Mayne,
J. Nishio,
T. Langelier,
R. T. Johnson, and B. Chesebro.
1998.
Neuronal death induced by brain-derived human immunodeficiency virus type 1 envelope genes differs between demented and nondemented AIDS patients.
J. Virol.
72:9045-9053 |
| 51. |
Price, R. W.,
B. Brew,
J. Sidtis,
J. Rosenblum,
A. C. Scheck, and P. Cleary.
1988.
The brain in AIDS: central nervous system HIV-1 infection and AIDS dementia complex.
Science
239:586-591 |
| 52. | Reeves, J. D., and T. F. Schulz. 1997. The CD4-independent tropism of HIV-2 involves several regions of the envelope protein and correlates with a reduced activation threshold for envelope-mediated fusion. J. Virol. 71:1453-1465[Abstract]. |
| 53. |
Rizzuto, C. D.,
R. Wyatt,
N. Hernandez-Ramos,
Y. Sun,
P. D. Kwong,
W. A. Hendrickson, and J. Sodroski.
1998.
A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding.
Science
280:1949-1953 |
| 54. | Rucker, J., B. J. Doranz, A. L. Edinger, D. Long, J. F. Berson, and R. W. Doms. 1997. Cell-cell fusion assay to study role of chemokine receptors in Human Immunodeficiency Virus type 1 entry. Methods Enzymol. 288:118-133[Medline]. |
| 55. | Rucker, J., M. Samson, B. J. Doranz, F. Libert, J. F. Berson, Y. Yi, R. J. Smyth, R. G. Collman, C. C. Broder, G. Vassart, R. W. Doms, and M. Parmentier. 1996. Regions in b-chemokine receptors CCR5 and CCR2b that determine HIV-1 cofactor specificity. Cell 87:437-446[CrossRef][Medline]. |
| 56. | Saharkhiz-Langroodi, A., and T. C. Holland. 1997. Identification of the fusion-from-without determinants of Herpes Simplex Virus type 1 glycoprotein B. Virology 227:153-159[CrossRef][Medline]. |
| 57. |
Sharpless, N. E.,
W. A. O'Brien,
E. Verdin,
C. V. Kufta,
I. S. Y. Chen, and M. Dubois-Dalcq.
1992.
Human immunodeficiency virus type 1 tropism for brain microglial cells is determined by a region of the env glycoprotein that also controls macrophage tropism.
J. Virol.
66:2588-2593 |
| 58. |
Shieh, J. T. C.,
A. V. Albright,
M. Sharron,
S. Gartner,
J. Strizki,
R. W. Doms, and F. Gonzalez-Scarano.
1998.
Chemokine receptor utilization by HIV-1 isolates that replicate in microglia.
J. Virol.
72:4243-4249 |
| 59. | Siess, D. C., S. L. Kozak, and D. Kabat. 1996. Exceptional fusogenicity of Chinese hamster ovary cells with murine retroviruses suggests roles for cellular factor(s) and receptor clusters in the membrane fusion process. J. Virol. 70:3432-3439[Abstract]. |
| 60. | Strizki, J. M., A. V. Albright, H. Sheng, M. O'Connor, L. Perrin, and F. Gonzalez-Scarano. 1996. Infection of primary human microglia and monocyte-derived macrophages with human immunodeficiency virus type 1 isolates: evidence of differential tropism. J. Virol. 70:7654-7662[Abstract]. |
| 61. |
Sullivan, N.,
Y. Sun,
Q. Sattentau,
M. Thali,
D. Wu,
G. Denisova,
J. Gershoni,
J. Robinson,
J. Moore, and J. Sodroski.
1998.
CD4-induced conformational changes in the human immunodeficiency virus type 1 gp120 glycoprotein: consequences for virus entry and neutralization.
J. Virol.
72:4694-4703 |
| 62. |
Sullivan, N.,
M. Thali,
C. Furman,
D. D. Ho, and J. Sodroski.
1993.
Effect of amino acid changes in the V1/V2 region of the human immunodeficiency virus type 1 gp120 glycoprotein on subunit association, syncytium formation, and recognition by a neutralizing antibody.
J. Virol.
67:3674-3679 |
| 63. | Takahashi, K., S. L. Wesselingh, D. E. Griffin, J. C. McArthur, R. T. Johnson, and J. D. Glass. 1996. Localization of HIV-1 in human brain using polymerase chain reaction/in situ hybridization and immunocytochemistry. Ann. Neurol. 39:705-711[CrossRef][Medline]. |
| 64. | Toohey, K., K. Wehrly, J. Nishio, S. Perryman, and B. Chesebro. 1995. Human immunodeficiency virus envelope V1 and V2 regions influence replication efficiency in macrophages by affecting virus spread. Virology 213:70-79[CrossRef][Medline]. |
| 65. | Trkola, A., T. Dragic, J. Arthos, J. M. Binley, W. C. Olson, G. P. Allaway, C. Cheng-Mayer, J. Robinson, P. J. Maddon, and J. P. Moore. 1996. CD4-dependent, antibody-sensitive interactions between HIV-1 and its co-receptor CCR5. Nature 14:184-187. |
| 66. | Vodicka, M. A., W. C. Goh, L. I. Wu, M. E. Rogel, S. R. Bartz, V. L. Schweickart, C. J. Raport, and M. Emerman. 1997. Indicator cell lines for detection of primary strains of human and simian immunodeficiency viruses. Virology 233:193-198[CrossRef][Medline]. |
| 67. |
Watkins, B. A.,
H. H. Dorn,
W. B. Kelly,
R. C. Armstrong,
B. J. Potts,
F. Michaels,
C. V. Kufta, and M. Dubois-Dalq.
1990.
Specific tropism of HIV-1 for microglial cells in primary human brain cultures.
Science
249:549-552 |
| 68. | Wiley, C. A., and C. L. Achim. 1994. Human immunodeficiency virus encephalitis is the pathological correlate of dementia in acquired immunodeficiency syndrome. Ann. Neurol. 36:673-676[CrossRef][Medline]. |
| 69. |
Wiley, C. A.,
R. D. Schrier,
J. A. Nelson,
P. W. Lampert, and M. B. A. Oldstone.
1986.
Cellular localization of human immunodeficiency virus infection within the brains of acquired immune deficiency syndrome patients.
Proc. Natl. Acad. Sci. USA
83:7089-7093 |
| 70. | Wong, J. K., C. C. Ignacio, F. Torriani, D. Havlir, N. J. S. Fitch, and D. D. Richman. 1997. In vivo compartmentalization of human immunodeficiency virus: evidence from the examination of pol sequences from autopsy tissues. J. Virol. 71:2059-2071[Abstract]. |
| 71. |
Wu, L.,
W. A. Paxton,
N. Kassam,
N. Ruffing,
J. B. Rottman,
N. Sullivan,
H. Choe,
J. Sodroski,
W. Newman,
R. A. Koup, and C. R. Mackay.
1997.
CCR5 levels and expression pattern correlate with infectability by macrophage-tropic HIV-1, in vitro.
J. Exp. Med.
185:1681-1691 |
| 72. | Wu, Z., S. C. Kayman, W. Honnen, K. Revesz, H. Chen, S. Vijh-Warrier, S. A. Tilley, J. McKeating, C. Shotton, and A. Pinter. 1995. Characterization of neutralization epitopes in the V2 region of human immunodeficiency virus type 1 gp120: role of glycosylation in the correct folding of the V1/V2 domain. J. Virol. 69:2271-2278[Abstract]. |
| 73. | Wyatt, R., P. D. Kwong, E. Desjardins, R. W. Sweet, J. Robinson, W. A. Hendrickson, and J. G. Sodroski. 1998. The antigenic structure of the HIV gp120 envelope glycoprotein. Nature 393:705-711[CrossRef][Medline]. |
| 74. | Wyatt, R., J. Moore, M. Accola, E. Desjardin, J. Robinson, and J. Sodroski. 1995. Involvement of the V1/V2 variable loop structure in the exposure of human immunodeficiency virus type 1 gp120 epitopes induced by receptor binding. J. Virol. 69:5723-5733[Abstract]. |
| 75. | Yong, V. W., and J. P. Antel. 1992. Culture of glial cells from human brain biopsies, p |