Previous Article | Next Article 
Journal of Virology, January 2000, p. 627-643, Vol. 74, No. 2
Aaron Diamond AIDS Research Center, The
Rockefeller University, New York, New York
100161; Department of Human
Retrovirology, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands2; and
Progenics Pharmaceuticals, Inc., Tarrytown, New York
105913
Received 29 June 1999/Accepted 1 October 1999
The few antibodies that can potently neutralize human
immunodeficiency virus type 1 (HIV-1) recognize the limited number of envelope glycoprotein epitopes exposed on infectious virions. These
native envelope glycoprotein complexes comprise three gp120 subunits
noncovalently and weakly associated with three gp41 moieties. The
individual subunits induce neutralizing antibodies inefficiently but
raise many nonneutralizing antibodies. Consequently, recombinant envelope glycoproteins do not elicit strong antiviral antibody responses, particularly against primary HIV-1 isolates. To try to
develop recombinant proteins that are better antigenic mimics of the
native envelope glycoprotein complex, we have introduced a disulfide
bond between the C-terminal region of gp120 and the immunodominant
segment of the gp41 ectodomain. The resulting gp140 protein is
processed efficiently, producing a properly folded envelope
glycoprotein complex. The association of gp120 with gp41 is now
stabilized by the supplementary intermolecular disulfide bond, which
forms with approximately 50% efficiency. The gp140 protein has
antigenic properties which resemble those of the virion-associated complex. This type of gp140 protein may be worth evaluating for immunogenicity as a component of a multivalent HIV-1 vaccine.
The urgent need for an effective
vaccine against human immunodeficiency virus type 1 (HIV-1) is
undoubted, for only by vaccination will the worldwide spread of AIDS be
stemmed (44, 46, 62). Although there is not yet universal
consensus on what components will be needed in a vaccine that is able
to induce protective immunity against HIV-1 infection or disease, a
popular view is that both the humoral and the cellular arms of the
human immune system should be efficiently stimulated (12-14, 43,
44, 46, 57, 64, 94). To do this will probably require the
creation of a multivalent vaccine that incorporates several categories of immunogen, each intended to optimally evoke different, necessary immune responses. Examples would be a live recombinant virus or a DNA
vector to stimulate cellular immunity, combined with a subunit protein
to generate antibody responses (4, 5, 32, 93).
There has, arguably, been more progress with evoking HIV-1-specific
cellular immunity than humoral immunity in recent years, although some
new concepts relating to neutralizing-antibody induction that merit
continued evaluation have recently been described (18, 52, 81, 90,
103). The most widely tried method of neutralizing-antibody induction, i.e., that involving recombinant monomeric gp120 proteins, has not been successful at inducing antibodies able to neutralize heterologous primary isolates at significant titers (4, 5, 22, 40,
58, 59, 81, 111, 120). This raises serious questions about the
protective efficacy of vaccines that include such proteins, either
alone or in combination with other immunogens (14). One of
the major obstacles to neutralizing-antibody induction is the inherent
resistance of primary HIV-1 isolates to such antibodies (10, 12,
13, 58, 59, 64, 66-68, 80, 81, 102, 107, 112, 120), a feature
that HIV-1 shares with other lentiviruses and one which is probably
necessary for viral persistence in vivo (3, 23, 65). The
native HIV-1 envelope glycoprotein complex on virions, a heterotrimer
containing three gp120 proteins noncovalently associated with three
gp41 moieties, is recognized poorly by antibodies that efficiently bind
to the individual gp120 and gp41 subunits (51, 66, 81, 98, 102,
122).
Notwithstanding the natural defenses used by HIV-1 to resist or evade
humoral immunity, proteins which faithfully represent the antigenic
structure of the virion-associated envelope glycoprotein complex may be
worth evaluating as vaccine immunogens. For instance, the three
most potent HIV-1 neutralizing antibodies yet identified, immunoglobulin b12 (IgG1b12), 2G12, and 2F5, have a high affinity for the native trimer which is comparable to or sometimes greater than
their affinity for the individual gp120 or gp41 subunits (15, 34,
77, 92, 96, 98, 102, 109). These antibodies may therefore have
been raised by an immune response to virions rather than to viral
debris or dissociated subunits (13, 68, 80, 81).
The lability of the noncovalent interaction between gp120 and gp41,
which causes extensive gp120 dissociation from virions or
virus-infected cells (38, 61, 70, 87), is a major obstacle to making stable recombinant, oligomeric envelope glycoproteins. Initial attempts at making stable oligomers therefore involved the
introduction of mutations to remove or replace the gp120-gp41 cleavage
recognition sequence (6, 27-29). Usually, such proteins are
also truncated N-terminal to the transmembrane-spanning region of gp41,
so that they are efficiently secreted as soluble proteins (the internal
segment of gp41 is of limited relevance for induction of humoral immune
responses). A broadly similar nonrecombinant protein was isolated from
a virus-infected cell line (110). The resulting proteins
(gp140s) contain the gp120 moiety linked to the 20-kDa gp41 ectodomain
by a peptide bond between the C terminus of gp120 and the N terminus of
gp41, which is not present in the virion-associated complex. Although
these uncleaved gp140 proteins (designated gp140UNC) are
oligomerized by strong, noncovalent intermolecular interactions between
gp41 subunits (19, 101, 116), it is questionable whether
they truly mimic the native envelope glycoprotein complex. Thus,
epitopes are exposed on gp140UNC proteins that are not
accessible on virions (27, 28), and there are indications
that coreceptor interactions of gp140UNC proteins are
inefficient (31). Together, these observations imply that a
structural perturbation is caused to the gp120 component by the
covalently attached, improperly associated gp41 ectodomain (31). For whatever reason, immunogenicity studies carried
out to date with gp140UNC proteins have not been
particularly encouraging, in that primary virus-neutralizing antibodies
have not been induced (27, 90, 110).
We have therefore pursued a different approach: the expression of gp140
proteins with the natural gp120-gp41 cleavage site preserved but with a
disulfide bond introduced between gp120 and the gp41 ectodomain to
stabilize the association of these two subunits. We report here on the
antigenic properties of such a gp140 protein.
Cloning of gp140 and furin.
Plasmid pPPI4 is a eukaryotic
shuttle vector generated at Progenics Pharmaceuticals Inc. The
expression of HIV-1 envelope proteins is under the control of the
cytomegalovirus major immediate-early promoter-enhancer with a tissue
plasminogen activator leader and bovine growth hormone poly(A) signal
(106). The vector contains the dihydroxyfolate reductase
gene and a simian virus 40 SV40 origin of replication, which promotes
high-level replication and transient expression of open reading frames
in cells expressing the SV40 large T antigen. PCR was used to clone DNA
encoding the gp140 segment of the env genes of isolates
JR-FL (50), DH123 (100), HxB2 (88),
GUN-1wt (104), and 89.6 (21) from the corresponding HIV-1 genomic plasmids. The primers used were 5'Kpnlenv (5'-GTCTATTATGGGGTACCTGTGTGGAAAGAAGC-3') and
3'BstB1env
(5'-CGCAGACGCAGATTCGAATTAATACCACAGCCAGTT-3'). The restriction sites are underlined. The PCR products were
cloned into pPPI4 by using KpnI and BstB1. These
plasmids are designated gp140WT (wild type) to distinguish
them from the mutated forms described below. A furin-expressing
plasmid, pGEMfurin, was obtained from Gary Thomas, Vollum Institute,
Portland, Oreg. (63). The EcoRI-HindIII fragment of furin was
subcloned into pcDNA3.1( Mutagenesis of gp140.
A variety of double cysteine
substitutions were introduced into the gp120 and gp41 moieties of
gp140WT (HIV-1 JR-FL) in pPPI4 by using Quickchange
mutagenesis kits (Stratagene, La Jolla, Calif.) and verified by
sequencing. Details of the positions of these substitutions are
provided in Results (see Fig. 3). A similar strategy was used to make
the corresponding cysteine substitutions in other HIV-1 gp140 proteins.
A gp120-gp41 cleavage site mutant of JR-FL gp140UNC was
generated by substitution of the sequence Lys-Arg-Arg-Val-Val-Gln-Arg-Glu-Lys-Arg-Ala-Val (the C
terminus of gp120 and the first two residues of gp41) by a hexameric
Leu-Arg motif. This eliminates the furin cleavage motif (underlined), as described previously (30) (see Fig. 3). The PCR primers
were 3'140M
(TCGAAGGCGGAGACGAAGTCGTAGCCGCAGTGCCTTGGTGGGTGCTACTCCTAATGGTTC) with 5'KpnIenv and 5'140M
(5'-CTACGACTTGTCTCCGCCTTCGACTACGGGGAATAGGAGCTGTG TTCCTTGGGTTCTTG-3')
with 3'BstB1env. The PCR products of these two reactions were
purified, and an overlap PCR reaction was performed to generate a
full-length env gene that was cloned into pPPI4 by
KpnI-BstBI digestion.
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Recombinant Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Complex Stabilized by an Intermolecular Disulfide
Bond between the gp120 and gp41 Subunits Is an Antigenic Mimic of the
Trimeric Virion-Associated Structure
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) (Invitrogen Inc.) to make pcDNA3.1furin.
Transfection, labeling, and immunoprecipitation. Adherent 293T cells were grown in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal calf serum, penicillin, streptomycin, and L-glutamine. Transient transfection of 293T cells was performed by calcium phosphate precipitation. The gp140 expression plasmids pPPI4-gp140 were transfected with or without cotransfection of the furin expression vector pcDNA3.1-furin, each at 10 µg per 10-cm2 plate. At 1 day posttransfection, the medium was changed to Dulbecco's modified Eagle's medium supplemented with 0.2% bovine serum albumin, penicillin, streptomycin and L-glutamine. For radioimmunoprecipitation analysis (RIPA), [35S]cysteine and [35S]methionine (200 µCi per plate; Amersham International PLC) were added for 24 h. The culture supernatants were then cleared of debris by centrifugation before addition of concentrated RIPA buffer to adjust the composition to 50 mM Tris-HCl-150 mM NaCl-1 mM EDTA (pH 7.2). Envelope glycoproteins were immunoprecipitated with monoclonal antibodies (MAbs) to a variety of epitopes. In some instances, the MAbs had been labeled with biotin (42). The MAbs were added in a 1-ml volume for 10 min at room temperature and then precipitated by incubation overnight at 4°C with either streptavidin-coated agarose beads (Vector Laboratories) or protein G-coated agarose beads (Pierce Inc.), as appropriate. The beads were washed three times with RIPA buffer containing 1% Nonidet P-40 detergent, and then the proteins were eluted by heating at 100°C for 5 min in 60 µl of polyacrylamide gel electrophoresis (PAGE) buffer supplemented with 2% sodium dodecyl sulfate (SDS) and, when indicated, 100 mM dithiothreitol (DTT). The immunoprecipitates were fractionated by SDS-PAGE (8% polyacrylamide) at 200 V for 1 h. Unless otherwise specified (e.g., see Fig. 2 and 10), the amounts of immunoprecipitated envelope glycoproteins loaded onto each lane were comparable, in that fixed numbers of cells were transfected with the same amount of plasmid and then a constant volume of supernatant was precipitated with a standard amount of MAb. The gels were dried and exposed to a phosphor screen. The positions of the radiolabeled proteins were determined by using a PhosphorImager with ImageQuant software (Molecular Dynamics Inc.).
MAbs to HIV-1 envelope glycoprotein epitopes, and sCD4. The epitopes for, and some immunochemical properties of, anti-gp120 MAbs from various donors have been described previously (9, 71, 72). These include 19b and 83.1 to the V3 loop (74, 118), IgG1b12 and F91 to the CD4 binding site (CD4bs) (15, 72), 2G12 to a unique C3-V4 glycan-dependent epitope (108, 109), M90 to the C1 region (113), 23A and sheep antibody D7324 to the C5 region (69, 72), C11 to a discontinuous C1-C5 epitope (75), 17b to a CD4-inducible epitope (9, 47, 72, 91, 103, 105, 122, 123), A32 to a CD4-inducible C1-C4 epitope (72, 103), and G3-519 and G3-42 to C4 and C4/V3 epitopes, respectively (72, 73). MAbs to gp41 epitopes included 7B2 to epitope cluster I (a gift from James Robinson); 4D4 to cluster I (11); T4, an oligomer-specific MAb overlapping the cluster I region (28); 2.2B to cluster II (a gift from James Robinson); T15G1 to cluster II (a gift from Ab Notkins); and 2F5 to a neutralizing epitope encompassing residues 653 to 659 (11, 77, 108). The tetrameric CD4-IgG2 and monomeric soluble CD4 (sCD4) molecules, from Progenics Pharmaceuticals Inc., have also been described previously (2).
Quantitation of gp120 and gp140 proteins by ELISA. To measure the secretion of gp120 and gp140 proteins from transfected 293T cells, we used a gp120 antigen capture enzyme-linked immunosorbent assay (ELISA) based on one that has been described previously (7, 69, 71). Briefly, envelope glycoproteins in the culture supernatants were denatured and reduced by boiling with 1% SDS and 50 mM DTT. Purified monomeric JR-FL gp120 treated in the same way was used as a reference standard for gp120 expression (106). The denatured proteins were captured on plastic by sheep antibody D7324, which was raised to the continuous sequence APTKAKRRVVQREKR at the C terminus of gp120. Bound envelope glycoproteins were detected by using a mixture of MAbs B12 and B13 against epitopes exposed on denatured gp120 (1, 71). This assay allows the efficient detection of both gp120 and any gp140 molecules in which the peptide bond between gp120 and the gp140 ectodomain is still intact (71, 106).
Sucrose velocity gradient centrifugation. Culture supernatants from env-transfected 293T cells were concentrated by 100-fold on Millipore concentrators, and then a 100-µl aliquot was layered onto a 5 to 20% sucrose step gradient of 8.8 ml comprising 11 steps of 800 µl each. The gradient was overlaid to bring the volume up to 12 ml and then centrifuged for 20 h at 40,000 × g in an SW41Ti rotor at 4°C. Gradient fractions of 500 µl taken sequentially from the top were immunoprecipitated with MAb 2G12, boiled with SDS, and analyzed by SDS-PAGE.
Gel filtration analysis. Culture supernatants from 35S-labeled env-transfected 293T cells were concentrated 100-fold on Millipore concentrators. A 100-µl aliquot of the concentrate was loaded onto fast protein liquid chromatography Superdex 200 HR 10/30 column (Pharmacia, Piscataway, N.J.), equilibrated with Ca2+- and Mg2+-free phosphate-buffered saline. The column was eluted at a flow rate of 0.4 ml/min, and 0.25-ml fractions were collected. Identical fractions from four runs were pooled and immunoprecipitated with MAb 2G12 as described above. Comparison of the envelope glycoprotein elution profiles with those of known protein standards allowed an approximate assessment of molecular weights.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Wild-type gp140 is incompletely processed by cellular proteases. We chose to use the HIV-1 JR-FL strain (subtype B) as our template for studies of the antigenic structure of oligomerized envelope glycoproteins. Several reasons underlay this choice: (i) HIV-1 JR-FL is a primary R5 isolate with a typical neutralization resistance profile and so is representative of the most commonly transmitted HIV-1 strains (34, 107); (ii) it is a molecularly cloned virus with a well-characterized env gene (50); (iii) we have previously expressed the gp120 monomer protein from HIV-1 JR-FL (106); and (iv) we have already studied the MAb reactivity profiles of the JR-FL gp120 monomer and cell surface-expressed gp120/gp140 complex and so are familiar with their antigenic properties (34, 35, 106).
To gain experience with the gp140 form of the JR-FL envelope glycoprotein, we expressed a protein which had the natural cleavage site between gp120 and gp41 maintained intact (gp140WT). In common with all the mutants that we subsequently describe, the gp140WT protein has the gp41 moiety truncated close to the transmembrane-spanning region, so that it contains both gp120 and the gp41 ectodomain (gp41ECTO) (Fig. 1). When we expressed the gp140WT construct in 293T cells by transient transfection, we could detect envelope glycoproteins in the supernatants at between 100 and 500 ng per ml by using an antigen-capture ELISA that recognizes both gp120 and gp140 proteins after they have been deliberately denatured. When the culture supernatants were immunoprecipitated with various anti-gp120 antibodies and then subjected to denaturing SDS-PAGE analysis, two bands appeared consistently on the gels. The results of one such immunoprecipitation experiment, with the 2G12 MAb as the precipitating antibody, are shown in Fig. 2. Although higher-molecular-mass aggregates were also present, two discrete bands can be seen; one of these, which we assumed to be free gp120, migrated at 120 kDa, and the other ran at 140 kDa (Fig. 2, lane 1). This latter protein migrated identically to a gp140 protein that we had mutated in the gp120-gp41 cleavage site (gp140UNC) (lane 3).
|
|
Stabilization of the gp120-gp41 interaction by introduction of double cysteine substitutions. With furin cotransfection, we could now express a soluble gp140 protein in which the gp120 and gp41ECTO components were associated only through a noncovalent linkage, mimicking what occurs in the native trimeric envelope glycoprotein complex on virions. However, the natural, noncovalent association between gp120 and gp41 is weak, leading to the gradual shedding of gp120 from virions and the surface of infected cells (38, 61, 70, 87). In practice, an unstable gp120-gp41ECTO complex is unlikely to be useful for vaccination purposes; it would, for example, be difficult to purify. We therefore sought ways to stabilize the gp120-gp41 interaction by the introduction of an intermolecular disulfide bond between the gp120 and gp41 subunits. Of note is that such bonds occur in at least a fraction of the envelope glycoprotein complexes of type C retroviruses, such as murine leukemia virus (MuLV) and human T-lymphotropic virus type 1 (HTLV-1) (25, 37, 48, 54, 55, 78, 82-86, 99).
Our mutagenesis strategy was guided by our earlier theoretical consideration of which regions of gp120 and gp41 were involved in their association (99). This analysis had, itself, been influenced by the mutational studies of Helseth et al. (45). Thus, there is strong mutagenic evidence that the first and last conserved regions of gp120 (C1 and C5 domains) are the contact sites for gp41 (45, 121). The corresponding sites on gp41 are known with less certainty. However, the positions of cysteine residues available for intermolecular disulfide bond formation in, e.g., the MuLV and HTLV-1 envelope glycoproteins strongly suggested that we should focus our attention on the central region of the gp41 ectodomain, in proximity to the intramolecular disulfide-linked loop (99). This loop is a conserved feature of retroviral envelope glycoproteins (37, 82). More recent information on the structure on the gp41 ectodomain supports this choice (8, 16, 19, 116). Precedent for the introduction of paired cysteine residues leading to the formation of intermolecular disulfide bonds has arisen from studies of HIV-1 gp41 (33) and of other viral envelope glycoproteins (39). We therefore substituted single cysteine residues at several different positions in the C1 and C5 regions of gp120, focusing on amino acids previously shown to be important for the gp120-gp41 interaction (Fig. 3A). Simultaneously, we introduced a second cysteine substitution at several residues near the intramolecular disulfide loop of gp41 (Fig. 3B). The intent was to identify pairs of cysteine residues whose physical juxtaposition during gp140 processing was such that an intermolecular disulfide bond would form spontaneously. In all, 53 different double-cysteine substitution mutants were generated in the context of the JR-FL gp140WT protein and then coexpressed with furin by transient transfection of 293T cells (Fig. 4 and 5).
|
|
|
Characterization of the SOS gp140 protein. We verified that the SOS gp140 protein was indeed stabilized by an intermolecular disulfide bond by boiling the 2G12-immunoprecipitated proteins with SDS and DTT prior to gel electrophoresis; under these conditions, only a 120-kDa band was detected (Fig. 6A, lane 4, and Fig. 6B, lane 3). However, boiling with SDS alone did not eliminate the 140-kDa band (Fig. 6A and B, lanes 1). Taken together, the data imply the presence of a covalent bond between the gp120 moiety and the gp41 ectodomain of the SOS gp140 protein that is sensitive to the presence of a reducing agent, i.e., a disulfide bond. In contrast, the 140-kDa bands produced from the gp140NON (gp140WT without furin) and gp140UNC proteins were unaffected by boiling in the presence of DTT (Fig. 6A, lanes 5 and 6). In these two proteins, the gp120 and gp41ECTO subunits are attached via the uncleaved peptide bond, which is unaffected by reducing agents.
|
Attempts to improve the efficiency of disulfide bond formation in the SOS gp140 protein. Although disulfide-stabilized gp140 proteins are secreted from cells expressing the SOS gp140 mutant, there is also significant production of gp120 monomers (Fig. 4 and 6). This implies that the disulfide bond between gp120 and the gp41 ectodomain forms with imperfect efficiency. We attempted to improve this by introducing additional amino acid substitutions near the inserted cysteines or by varying where the cysteines were positioned in gp120. We retained the gp41 cysteine at residue 605, where it is in the SOS gp140 protein, because this position seemed to be the one at which intermolecular disulfide bond formation was most favored (Fig. 5).
We first varied the position of the cysteine substitution in gp120, by placing it either N-terminal or C-terminal to alanine-501. The ratio of gp140 to gp140 + gp120 was not increased in any of these new mutants; it remained comparable to, or lower than, the ratio derived from the SOS gp140 protein (Fig. 7, lanes 1 to 8). Furthermore, there was a decrease in the mobility and sharpness of the gp140 band compared to that derived from the SOS gp140 protein (lanes 1 to 8). Next, we considered whether the bulky, charged side chains of the lysine residues adjacent to alanine-501 might interfere with disulfide bond formation. We therefore mutated either or both of the lysines at positions 500 and 502 to alanines in the context of the SOS gp140 protein, but these changes neither increased the ratio of gp140 to gp140 + gp120 nor affected the migration of gp140 (lanes 9 to 11). Finally, we introduced a second pair of cysteines into the SOS gp140 protein at residues 45 of gp120 and 609 of gp41, since a disulfide bond formed fairly efficiently when this cysteine pair was introduced into the wild-type protein (Fig. 5). The quadruple-cysteine mutant (W45C/A501C/T605C/P609C) was, however, poorly expressed, and the gp120 and gp140 bands that were produced both migrated unusually slowly. The same was observed with two other similar mutants (W45C/K500C/T605C/P609C) and (W45C/K502C/T605C/P609C) (Fig. 7, lanes 12 to 14). This implies that there may be protein-folding or other expression problems with quadruple-cysteine mutants of gp140.
|
Antigenic properties of the SOS gp140 protein. Among the JR-FL env mutants we have yet made, the efficiency of intermolecular disulfide bond formation is apparently the highest in the SOS gp140 protein (A501C/T605C). We therefore characterized the antigenic structure of this protein, by probing its topology with a panel of MAbs to a variety of gp120 and gp41 epitopes (Fig. 8). For comparison, we studied the reactivity of the same MAbs with the gp140NON protein produced when the gp140WT gene is expressed in the absence of cotransfected furin. The gp140NON protein still contains a peptide bond between the gp120 and gp140ECTO subunits (Fig. 6). Structurally, the gp140NON protein is essentially identical to the gp140UNC protein, in which the gp120-gp140 cleavage site has been deliberately replaced by mutagenesis (see Fig. 9). As an additional comparator, we used a double-cysteine mutant in which the gp120 cysteine substitution was in the C1 domain, the W45C/T605C gp140 protein (Fig. 8).
|
Comparing the antigenic structures of gp140NON and gp140UNC. We next studied the antigenic structure of the gp140 protein produced when the cleavage site between gp120 and gp41 is replaced by mutation (gp140UNC), since this type of protein is being used in vaccine-related studies on the grounds that it is oligomeric (27, 90, 110). We compared gp140UNC with the gp140NON and gp120 proteins produced when gp140WT is expressed in the absence of cotransfected furin (Fig. 9). The gp140NON and gp140UNC proteins could not be distinguished from one another by the reactivity of any of the test MAbs; they are essentially isomorphic. The major differences in antigenic structure between the SOS gp140 protein and the gp140NON protein that were demonstrated in Fig. 8 therefore also apply to the gp140UNC protein. Of particular note is the negligible induction of the 17b epitope on the gp140UNC protein by sCD4 (Fig. 9, compare lanes 6 and 8), which may help explain why proteins of the gp140UNC type interact poorly with the CCR5 coreceptor (31). The aberrant exposure of gp41 in the gp140UNC and gp140NON proteins is also clearly revealed (compare Fig. 9, lanes 11 and 12, with Fig. 8D, lane 2).
|
Intersubunit disulfide bonds form in SOS gp140 proteins from other HIV-1 isolates. To assess the generality of our observations with gp140 proteins derived from the R5 HIV-1 isolate JR-FL, we generated double-cysteine mutants of gp140s from four other HIV-1 strains. These were the R5X4 viruses GUN-1wt, 89.6, and DH123 and the T-cell-line-adapted X4 virus HxB2. In each case, the cysteines were introduced at the residues equivalent to alanine-501 and threonine-605 of HxB2. The resulting SOS gp140 proteins were precipitated with the 2G12 MAb, in comparison with the gp140WT proteins from each isolate (Fig. 10). In general, the results obtained with the GUN-1wt, 89.6, DH123, and HxB2 proteins were very similar to what was observed with JR-FL gp140s. Disulfide-stabilized gp140 proteins could be efficiently expressed from each isolate, as confirmed by the disappearance of the 140-kDa band when the immunoprecipitates were boiled with DTT before being subjected to SDS-PAGE analysis. In each case, the ratio of gp140 to gp140 + gp120 was comparable to or greater than that observed for the JR-FL SOS gp140 protein. One unexpected but advantageous observation was that furin cotransfection significantly increased the secretion of envelope glycoproteins from 89.6 gp140-transfected cells (Fig. 10B, compare lanes 6 and 7 with lane 5). This may be due to a decrease in the degradation of misfolded proteins when the scissile bond between gp120 and gp41 is correctly cleaved. We do not yet know why this should be an isolate-dependent phenomenon. To some extent, it occurs also with DH123 proteins.
|
Sucrose gradient analysis of the SOS gp140 and gp140UNC proteins. The oligomeric state of the secreted gp140 complex cannot be determined by immunoprecipitations of unfractionated supernatants, since the proteins are subsequently denatured by boiling with SDS prior to gel electrophoresis. To obtain information on the size of the gp140 protein complex under nondenaturing conditions, we performed a sucrose velocity gradient analysis on 100-fold concentrates of the proteins secreted from 293T cells transfected with SOS gp140 (JR-FL) and furin or, for comparison, with the gp140UNC mutant (Fig. 11A). To detect where various molecular species had migrated on the sucrose velocity gradient, the gradient fractions were immunoprecipitated with MAb 2G12, boiled with SDS, and analyzed by SDS-PAGE.
|
Gel filtration analysis of the SOS gp140 and gp140UNC proteins. To obtain additional information on the molecular size of the gp140 protein complexes under nondenaturing conditions, we used size exclusion gel filtration chromatography (Fig. 12). This was performed on concentrates of the proteins secreted from 293T cells transfected with SOS gp140 (JR-FL) plus furin (Fig. 12A) and, for comparison, gp140UNC (Fig. 12B). To detect where various molecular species had migrated, the gradient fractions were immunoprecipitated with MAb 2G12, boiled with SDS, and analyzed by SDS-PAGE.
|
,
gp140UNC; 
, the 140-kDa component of SOS gp140; 
, the
120-kDa component of SOS gp140. The positions of molecular mass
standards are indicated by arrows. These were thyroglobulin (669 kDa),
ferritin (440 kDa), and aldolase (158 kDa).
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Our goals are to make a recombinant HIV-1 envelope glycoprotein with antigenic properties mimicking those of the native, trimeric gp120/gp41 complex found on virions or virus-infected cells and then evaluate whether such a protein might be a useful component of a multivalent HIV-1 vaccine. We believe we have accomplished the initial phase in creating the SOS gp140 protein. Whether this protein will be a superior immunogen to gp120 monomers, gp140 proteins with a peptide linkage retained between the gp120 and gp41ECTO moieties, or full-length gp160, remains to be determined. We believe that the disulfide bridge in the SOS gp140 protein should provide sufficient stability for this to be a practical immunogen, considering that the 140-kDa band survives boiling and SDS treatment during PAGE analysis.
There were two technical steps necessary for the generation of the SOS gp140 protein. The first was the use of cotransfected furin to increase the efficiency with which a secreted gp140 protein is proteolytically processed into gp120 and gp41ECTO moieties. The second was the introduction of a disulfide bond, at an appropriate position, to cross-link the gp120 subunit to the gp41 ectodomain and thereby increase its stability. During the synthesis of envelope glycoproteins in HIV-1-infected cells, trimerization of the gp41 moieties in the context of the gp160 precursor precedes the cleavage of the peptide bond linking gp120 to gp41 (25, 79). The cleavage step is mediated by proteases of the furin family (25, 41, 76). This step is inefficient, but unprocessed gp160 is generally sorted intracellularly into the lysosomal pathway, and little or no uncleaved gp160 is incorporated into virions (25, 26, 60, 119). However, when the HIV-1 env gene is expressed at high levels in mammalian cells, uncleaved gp160 cleavage can be found at the cell surface, perhaps because the natural cellular complement of furin proteases is saturated or because of differences in how gp160s are routed in infected and transfected cells (60, 119; Q. J. Sattentau, personal communication). These differences may be exacerbated when soluble rather than membrane-associated proteins are expressed, as is the case with gp140s. For whatever reason, when we expressed the JR-FL gp140WT gene in 293T cells, only a fraction of the secreted gp140 proteins were properly cleaved to gp120 and gp41ECTO subunits. This problem was overcome by the exogenous supplementation of furin via transfection, a device previously used to increase the efficiency of Ebola virus envelope glycoprotein proteolytic processing (114) and one that may have general relevance for vaccine development. Furin transfection did, however, reduce the extent of envelope glycoprotein expression (except with 89.6 and perhaps DH123), perhaps because of competition between plasmids for protein translation. Careful optimization of the furin content of permanent cell lines will be required when scaling up the production of the SOS gp140 protein.
The solution to the first problem created the second: the properly processed gp120 and gp41ECTO subunits are only weakly associated by noncovalent interactions. Consequently, the gp120 moieties are rapidly shed as the complex disassembles (38, 61, 70). To overcome this, we considered whether we could modify the gp120 or gp41 primary sequences to increase the strength of the noncovalent interaction between the subunits. However, in the absence of detailed information on the structure of the gp120-gp41 interactive sites, there was no good way to predict what amino acid substitutions might work. Indeed, most of the substitutions in relevant regions of gp120 and gp41 that have been described in the literature actually weaken rather than strengthen the intersubunit association (17, 20, 45). We therefore focused on a second strategy: the stabilization of the gp120-gp41 interaction by the formation of an intersubunit disulfide bond between cysteine residues introduced into appropriate positions within gp120 and gp41.
We found that the precise positioning of the two cysteine residues introduced into gp120 and gp41 was important. Of the many double-cysteine mutants that we evaluated, the SOS gp140 protein (A501C/T605C) had the highest efficiency of disulfide bond formation, the fewest indications of poor folding, and the most favorable antigenic properties. In this protein, the cysteine substitution in gp120 is at a residue previously shown to be critical for any association of gp120 with gp41 (45). The N- and C-terminal ends of gp120 probably assume disordered, flexible conformations, a factor which provoked their deletion from the crystallized gp120 core fragment (51, 122). The flexibility of these regions may explain why so many different cysteine substitutions of residues near the gp120 N and C termini permitted at least some disulfide linking to gp140. However, several such mutants were associated with smearing of gp140 bands on SDS-PAGE gels, suggesting that an imperfectly positioned disulfide bond does have some negative effects on envelope glycoprotein folding.
The corresponding substitution in gp41 is at a location exactly equivalent to where a cysteine residue is naturally positioned in the transmembrane glycoproteins of many retroviruses, including MuLV and HTLV-1 (37, 82, 99). This cysteine is immediately C-terminal to a small loop bounded by an intramolecular disulfide bond that is a common feature of retrovirus and lentivirus transmembrane glycoproteins (37, 82). On intuitive grounds, we postulated that this region of HIV-1 gp41 was involved in gp120 binding (99); the additional cysteine present in other retroviruses probably accounts for the disulfide bond that can sometimes form between the surface and transmembrane glycoproteins (25, 54, 55, 78, 83-86). There may be a conserved mechanism of subunit association among many viral families, sometimes with the involvement of a disulfide bond and sometimes not (36, 37, 99, 124). The crystal structure of the major fragment of the gp41 ectodomain in its postfusion conformation reveals that the C-terminal helix of the gp41 trimeric coiled coil is positioned antiparallel to, and stacked on the outside of, an N-terminal trimer (19, 101, 116). This implies that the cysteine residue substituted for alanine-605 protrudes outward in the postfusion conformation of gp41. The crystal structures of the TM glycoproteins of other viruses, such as MuLV and Ebola virus, also show that the region near the intramolecular disulfide-bonded loop is solvent accessible (16, 33a, 57a, 117). At present, the conformation of the prefusion form of the gp41 ectodomain is unknown, but presumably alanine-605 must also protrude in this form of the protein since the cysteine residue substituted at this position is available for disulfide bond formation with cysteine-501 of gp120. In the correctly folded, prefusion form of the gp120-gp41 complex, these two residues must be sufficiently proximal for disulfide bond formation to be possible. If and when the prefusion form of the gp41 ectodomain is crystallized, the exact positioning of alanine-605 will be revealed.
Although we can clearly make a gp140 protein in which the gp120 and gp41ECTO moieties are stabilized by an intermolecular disulfide bond, the formation of the disulfide bond occurs with imperfect efficiency. Thus, only a fraction (perhaps 40 to 50%) of the envelope glycoprotein complexes secreted from 293T cells expressing the A501C/T605C double cysteine mutant in the presence of furin are in the form of the SOS gp140 protein (Fig. 12C). The remaining proteins are present as gp120 monomers. This reflects inefficient formation of the intermolecular disulfide bond in the transfected 293T cells, rather than a lability of this bond once it has formed; the gp120 subunit still remains attached to the gp41 ectodomain even when the SOS gp140 protein is boiled in SDS and partially denatured, indicating that the intermolecular disulfide bond is quite stable. Preliminary studies of a permanent CHO cell line show that these cells secrete essentially only disulfide-stabilized SOS gp140 proteins, with virtually no gp120 moieties being present (data not shown). The efficiency of intermolecular disulfide bond formation is probably cell type dependent.
Biophysical analyses showed that the SOS gp140 protein has a higher molecular weight than monomeric gp120. It also differs in its biophysical properties from uncleaved gp140. However, we have not yet determined whether the SOS gp140 protein contains three gp41 ectodomains, each linked to a gp120 moiety via a disulfide bond, or whether only one or two gp120s are successfully attached to trimerized gp41 subunits. A mixture of molecular species may be present. Additional studies of SOS gp140 proteins purified from a permanent cell line are necessary to address these issues.
We are, however, encouraged by the antigenic properties of the SOS gp140 protein; it has a MAb reactivity pattern that is consistent with what has been learnt from prior studies of the native trimer and of the relationship between MAb binding and HIV-1 neutralization (34, 71, 72, 98, 102, 106, 115). Thus the most commonly exposed regions on the gp120 moiety of the SOS gp140 protein correspond to neutralizing-antibody epitopes. These include areas near the CD4 binding site (e.g., the binding sites for MAb IgG1b12 and the CD4-IgG2 molecule), the C3-V4 glycan-dependent epitope for MAb 2G12, the V3 loop, and, in the presence of sCD4, the CD4-induced epitope for MAb 17b that overlaps the coreceptor binding site. For some MAbs, notably 2G12, the reactivity with the SOS gp140 protein is better than with the gp120 monomer. MAbs to nonneutralizing epitopes in the C1 and C5 domains do not bind to the SOS gp140 protein, although they recognize the uncleaved gp140 proteins quite efficiently because of the abnormal conformation conferred upon the gp120 moiety when the gp41 ectodomain is attached via a peptide bond.
Some MAbs to CD4-binding site and V3 loop epitopes (e.g., F91 and 19b) do, however, bind efficiently to the SOS gp140 protein while lacking strong neutralization activity against HIV-1 JR-FL. The binding of the nonneutralizing A32 MAb to the SOS gp140 protein in the presence of sCD4 is another example. The ability of weakly neutralizing MAbs to bind to native envelope glycoprotein complexes on the cell surface has been described previously (35). Factors such as the on-rate may be important in determining precisely which MAbs to closely related epitopes do (e.g., IgG1b12) and do not (e.g., F91) neutralize HIV-1. Kinetic parameters might not be identical in RIPA and neutralization assays, in that the slow binding of some MAbs to the native trimer might be rapid enough to be detectable in a binding assay yet too slow to be able to interfere with virus attachment and entry in a neutralization assay. There may also be differences in the rates at which neutralizing antibodies bind to soluble and membrane-associated forms of the same protein complex.
On the gp41 moiety of the SOS gp140 protein, only the epitope for the neutralizing MAb 2F5 is accessible. Nonneutralizing gp120 and gp41 antibody epitopes components are not exposed on the SOS gp140 protein, just as they are inaccessible on native trimers (71, 98). However, we cannot rule out the possibility that the occlusion of the nonneutralizing gp41 epitopes is a direct consequence of the formation of the intermolecular disulfide bond. The almost complete occlusion of the CD4-induced epitope on the SOS gp140 protein in the absence of CD4, combined with its substantial induction upon CD4 binding, is consistent with how the gp120 moieties in a native trimer are thought to be arranged (122). In this conformation, the CD4-induced epitopes are partially covered by the V1/V2 and V3 loop structures and partially occluded by interactions between the individual gp120 components of a trimer. In the gp120 monomer, the occlusion of the CD4-induced epitopes is only partial (105, 122, 123), and we observed this to be the case also in the uncleaved gp140 proteins. Thus the MAb reactivity patterns of the SOS gp140 protein are, in general, consistent with its existing as a native, oligomeric structure. We believe that the SOS gp140 protein is in a prefusion conformation, judged by the dramatic induction of the 17b epitope upon sCD4 binding.
The above properties of the SOS gp140 protein contrast markedly with the antigenic structure of gp140 proteins that retain the peptide bond between gp120 and the gp41 ectodomain. Proteins of this category have not, to date, been significantly superior to gp120 monomers as immunogens (27, 90, 110). This may be because they do not properly mimic the structure of the native trimer, as indicated by their limited ability to interact with coreceptors (31); it is probably not the ability of a protein to oligomerize that most strongly influences its immunogenicity, but its overall structure. The acid test of the value of our work to vaccine development will come from immunogenicity studies, the outcomes of which are inherently unpredictable. The preservation of the best neutralizing-antibody epitopes on the SOS gp140 protein (those for MAbs IgG1b12, 2G12, and 2F5), combined with the elimination of irrelevant epitopes, might be valuable for focusing the humoral immune response.
It may, however, be found necessary to further modify the antigenic structure of the SOS gp140 protein to improve its immunogenicity, for example by removing some of its glycan residues or variable loops (18, 89). In preliminary studies, we have found that such modifications can be made to the SOS gp140 protein without having significant effects on the efficiency of intermolecular disulfide bond formation (R. Sanders, F. Kajumo, A. Master, L. Schiffner, T. Dragic, J. P. Moore, and J. M. Binley, unpublished results). The ability of the SOS gp140 protein to bind soluble CD4 and undergo relevant conformational changes allows a further way to explore its immunogenicity, i.e., as an sCD4 complex (49). It may also be possible to make full-length, membrane-bound versions of the SOS gp140 protein by restoring the transmembrane domain. Such a protein, expressed in the context of a DNA plasmid or a live recombinant virus vector, might be useful for priming the immune system prior to boosting with a soluble version.
That the A501C/T605C double cysteine substitution works in the context not only of HIV-1 JR-FL but also with several other primary and T-cell-line-adapted subtype B isolates (Gun-1wt, DH123, 89.6, and HxB2) suggests that the method will be generally useful for generating stable trimers. We are presently making similar mutants derived from HIV-1 subtype C isolates. Thus, if the SOS gp140 mutant, or antigenic variants thereof, does induce superior neutralizing-antibody responses in small-animal models, its overall utility as a vaccine antigen could be evaluated in monkey models by using homologous and heterologous SHIVs as challenge viruses (24, 53). It may also be possible to make SOS gp140 proteins derived from SIVmac or other lentiviruses, given the likely similarity of the gp120-gp41 association among retroviruses (99). This could have useful implications for the development of vaccines against retroviruses in general and perhaps other viral families as well.
| |
ACKNOWLEDGMENTS |
|---|
We thank Gary Thomas for provision of the pGEMfurin plasmid and James Robinson and Herman Katinger for the gifts of several monoclonal antibodies. We are grateful for the sage advice of Dennis Burton and Bob Doms on the biophysical properties of HIV-1 envelope glycoproteins. We appreciate the technical assistance of Daryl Schiller.
This work was supported by RO1 grants AI 39420 and AI 45463.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Aaron Diamond AIDS Research Center, 455 First Ave., New York, NY 10016. Phone: (212) 725-0018. Fax: (212) 725-1126. E-mail for J. M. Binley: jbinley{at}adarc.org E-mail for J. P. Moore: jmoore{at}adarc.org.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Abacioglu, Y. H., T. R. Fouts, J. D. Laman, E. Claassen, S. H. Pincus, J. P. Moore, C. A. Roby, R. Kamin-Lewis, and G. K. Lewis. 1994. Epitope mapping and topology of baculovirus expressed HIV-1 gp160 determined with a panel of murine monoclonal antibodies. AIDS Res. Hum. Retroviruses 10:371-381[Medline]. |
| 2. | Allaway, G. P., K. L. Davis-Bruno, G. A. Beaudry, E. B. Garcia, E. L. Wong, A. M. Ryder, K. W. Hasel, M.-C. Gauduin, R. A. Koup, J. S. McDougal, and P. J. Maddon. 1995. Expression and characterization of CD4lgG2, a novel heterotetramer which neutralizes primary HIV-1 isolates. AIDS Res. Hum. Retroviruses 11:533-540[Medline]. |
| 3. |
Baldinotti, F.,
D. Matteucci,
P. Mazzetti,
C. Giannelli,
P. Bandecchi,
F. Tozzini, and M. Bendinelli.
1994.
Serum neutralization of feline immunodeficiency virus is markedly dependent on passage history of the virus and host system.
J. Virol.
68:4572-4579 |
| 4. | Barnett, S. W., S. Rajasekar, H. Legg, B. Doe, D. H. Fuller, J. R. Haynes, C. M. Walker, and K. S. Steimer. 1997. Vaccination with HIV-1 gp120 DNA induces immune responses that are boosted by a recombinant gp120 protein subunit. Vaccine 15:869-873[CrossRef][Medline]. |
| 5. | Belshe, R. B., G. J. Gorse, M. J. Mulligan, T. G. Evans, M. C. Keefer, J.-L. Excler, A. M. Duliege, J. Tartaglia, W. I. Cox, J. McNamara, K.-L. Hwang, A. Bradney, D. C. Montefiori, and K. J. Weinhold. 1998. Induction of immune responses to HIV-1 by canarypox virus (ALVAC) HIV-1 and gp120 SF-2 recombinant vaccines in uninfected volunteers. AIDS 12:2407-2415[CrossRef][Medline]. |
| 6. |
Berman, P. W.,
W. M. Nunes, and O. K. Haffar.
1988.
Expression of membrane associated and secreted variants of gp160 of human immunodeficiency virus type 1 in vitro and in continuous cell lines.
J. Virol.
62:3135-3142 |
| 7. | Binley, J. M., P. J. Klasse, Y. Cao, I. M. Jones, M. Markowitz, D. D. Ho, and J. P. Moore. 1997. Differential regulation of the antibody responses to gag and env proteins of human immunodeficiency virus type 1. J. Virol. 71:2799-2809[Abstract]. |
| 8. | Binley, J. M., and J. P. Moore. 1997. The viral mousetrap. Nature 387:346-348[CrossRef][Medline]. |
| 9. | Binley, J. M., R. Wyatt, E. Desjardins, P. D. Kwong, W. Hendrickson, J. P. Moore, and J. Sodroski. 1998. Analysis of the interaction of antibodies with a conserved, enzymatically deglycosylated core of the HIV type 1 envelope glycoprotein 120. AIDS Res. Hum. Retroviruses 14:191-198[Medline]. |
| 10. |
Bou-Habib, D. C.,
G. Roderiquez,
T. Oravecz,
P. W. Berman,
P. Lusso, and M. A. Norcross.
1994.
Cryptic nature of envelope V3 region epitopes protects primary human immunodeficiency virus type 1 from antibody neutralization.
J. Virol.
68:6006-6013 |
| 11. | Buchacher, A., R. Predl, K. Strutzenberger, W. Steinfellner, A. Trkola, M. Purtscher, G. Gruber, C. Tauer, F. Steindl, A. Jungbauer, and H. Katinger. 1994. Generation of human monoclonal antibodies against HIV-1 proteins: electrofusion and Epstein-Barr virus transformation for peripheral blood lymphocyte immortalization. AIDS Res. Hum. Retroviruses 10:359-369[Medline]. |
| 12. |
Burton, D. R.
1997.
A vaccine for HIV type 1: the antibody perspective.
Proc. Natl. Acad. Sci. USA
94:10018-10023 |
| 13. | Burton, D. R., and D. C. Montefiori. 1997. The antibody response in HIV-1 infection. AIDS 11(Suppl. A):587-598[CrossRef][Medline]. |
| 14. | Burton, D. R., and J. P. Moore. 1998. Why do we not have an HIV vaccine and how can we make one? Nat. Med. 4:495-498[CrossRef][Medline]. |
| 15. |
Burton, D. R.,
J. Pyati,
R. Koduri,
G. B. Thornton,
L. S. W. Sawyer,
R. M. Hendry,
N. Dunlop,
P. L. Nara,
M. Lamacchia,
E. Garratty,
E. R. Stiehm,
Y. J. Bryson,
J. P. Moore,
D. D. Ho, and C. F. Barbas, III.
1994.
Efficient neutralization of primary isolates of HIV-1 by a recombinant human monoclonal antibody.
Science
266:1024-1027 |
| 16. | Caffrey, M., M. Cai, J. Kaufman, S. J. Stahl, P. T. Wingfield, D. G. Covell, A. M. Gronenborn, and G. M. Clore. 1998. Three dimensional solution structure of the 44 kDa ectodomain of SIV gp41. EMBO J. 17:4572-4584[CrossRef][Medline]. |
| 17. |
Cao, J.,
L. Bergeron,
E. Helseth,
M. Thali,
H. Repke, and J. Sodroski.
1993.
Effects of amino acid changes in the extracellular domain of the HIV-1 gp41 envelope glycoprotein.
J. Virol.
67:2747-2755 |
| 18. | Cao, J., N. Sullivan, E. Desjardin, C. Parolin, J. Robinson, R. Wyatt, and J. Sodroski. 1997. Replication and neutralization of human immunodeficiency virus type 1 lacking the V1 and V2 variable loops of the gp120 envelope glycoprotein. J. Virol. 71:9808-9812[Abstract]. |
| 19. | Chan, D. C., D. Fass, J. M. Berger, and P. S. Kim. 1997. Core structure of gp41 from the HIV envelope glycoprotein. Cell 89:263-273[CrossRef][Medline]. |
| 20. |
Chen, S. L.
1994.
Functional role of the leucine zipper motif region of HIV-1 transmembrane protein gp41.
J. Virol.
68:2002-2010 |
| 21. |
Collman, R.,
J. W. Balliet,
S. A. Gregory,
H. Friedman,
D. L. Kolson,
N. Nathanson, and A. Srinivasan.
1992.
An infectious molecular clone of an unusual macrophage-tropic and highly cytopathic strain of human immunodeficiency virus type 1.
J. Virol.
66:7517-7521 |
| 22. |
Connor, R. I.,
B. T. M. Korber,
B. S. Graham,
B. H. Hahn,
D. D. Ho,
B. D. Walker,
A. U. Neumann,
S. H. Vermund,
J. Mestecky,
S. Jackson,
E. Fenamore,
Y. Cao,
F. Gao,
S. Kalams,
K. Kuntsman,
D. McDonald,
N. McWilliams,
A. Trkola,
J. P. Moore, and S. M. Wolinsky.
1998.
Immunological and virological analyses of persons infected by human immunodeficiency virus type 1 while participating in trials of recombinant gp120 subunit vaccines.
J. Virol.
72:1552-1576 |
| 23. | Cook, R. F., S. L. Berger, K. E. Rushlow, J. E. McManus, S. J. Cook, S. Harrold, M. L. Raabe, R. C. Montelaro, and C. J. Issel. 1995. Enhanced sensitivity to neutralizing antibodies in a variant of equine infectious anemia virus is linked to amino acid substitutions in the surface unit envelope glycoprotein. J. Virol. 69:1493-1499[Abstract]. |
| 24. | Desrosiers, R. C. 1995. Non-human primate models for AIDS vaccines. AIDS 9(Suppl. A):S137-S141. |
| 25. | Doms, R. W., R. A. Lamb, J. K. Rose, and A. Helenius. 1993. Folding and assembly of viral membrane proteins. Virology 193:545-562[CrossRef][Medline]. |
| 26. | Dubay, J. W., S. R. Dubay, H.-J. Shin, and E. Hunter. 1995. Analysis of the cleavage site of the human immunodeficiency virus type glycoprotein: requirement of precursor cleavage for glycoprotein incorporation. J. Virol. 69:4675-4682[Abstract]. |
| 27. | Earl, P. L., C. C. Broder, R. W. Doms, and B. Moss. 1997. Epitope map of human immunodeficiency virus type 1 gp41 derived from 47 monoclonal antibodies produced by immunization with oligomeric envelope protein. J. Virol. 71:2674-2684[Abstract]. |
| 28. |
Earl, P. L.,
C. C. Broder,
D. Long,
S. A. Lee,
J. Peterson,
S. Chakrabarti,
R. W. Doms, and B. Moss.
1994.
Native oligomeric human immunodeficiency virus type 1 envelope glycoprotein elicits diverse monoclonal antibody reactivities.
J. Virol.
68:3015-3026 |
| 29. |
Earl, P. L.,
R. W. Doms, and B. Moss.
1990.
Oligomeric structure of the human immunodeficiency virus type 1 envelope glycoprotein.
Proc. Natl. Acad. Sci. USA
87:648-652 |
| 30. |
Earl, P. L.,
S. Koenig, and B. Moss.
1991.
Biological and immunological properties of human immunodeficiency virus type 1 envelope glycoprotein: analysis of proteins with truncations and deletions expressed by recombinant vaccinia viruses.
J. Virol.
65:31-41 |
| 31. |
Edinger, A. L.,
C. Blanpain,
K. J. Kuntsman,
S. M. Wolinsky,
M. Parmentier, and R. W. Doms.
1999.
Functional dissection of CCR5 coreceptor function through the use of CD4-independent simian immunodeficiency virus strains.
J. Virol.
73:4062-4073 |
| 32. | Excler, D., and S. Plotkin. 1997. The prime-boost concept applied to HIV preventive vaccines. AIDS 11(Suppl. A):S127-S137. |
| 33. |
Farzan, M.,
H. Choe,
E. Desjardins,
Y. Sun,
J. Kuhn,
J. Cao,
D. Archambault,
P. Kolchinsky,
M. Koch,
R. Wyatt, and J. Sodroski.
1998.
Stabilization of human immunodeficiency virus type 1 envelope glycoprotein trimers by disulfide bonds introduced into the gp41 ectodomain.
J. Virol.
72:7620-7625 |
| 33a. | Fass, D., S. C. Harrison, and P. S. Kim. 1996. Retrovirus envelope domain at 1.7Å resolution. Nat. Struct. Biol. 3:465-469[CrossRef][Medline]. |
| 34. | Fouts, T. R., J. M. Binley, A. Trkola, J. E. Robinson, and J. P. Moore. 1997. Neutralization of the HIV-1 primary isolate JR-FL by human monoclonal antibodies correlates with antibody binding to the oligomeric form of the envelope glycoprotein complex. J. Virol. 71:2779-2785[Abstract]. |
| 35. | Fouts, T. R., A. Trkola, M. S. Fung, and J. P. Moore. 1998. Interactions of polyclonal and monoclonal anti-glycoprotein 120 antibodies with oligomeric glycoprotein 120-glycoprotein 41 complexes of a primary HIV type 1 isolate: relationship to neutralization. AIDS Res. Hum. Retroviruses 14:591-598[Medline]. |
| 36. | Gallaher, W. R. 1996. Similar structural models of the transmembrane proteins of Ebola and avian sarcoma viruses. Cell 85:477-478[CrossRef][Medline]. |
| 37. | Gallaher, W. R., J. M. Ball, R. F. Garry, A. M. Martin-Amedec, and R. C. Montelaro. 1995. A general model for the surface glycoproteins of HIV and other retroviruses. AIDS Res. Hum. Retroviruses 11:191-202[Medline]. |
| 38. | Gelderblom, H. R., H. Reupke, and G. Pauli. 1985. Loss envelope antigens of HTLV-III/LAV, a factor in AIDS pathogenesis? Lancet ii:1016-1017. |
| 39. | Godley, L., J. Pfeifer, D. Steinhauer, B. Ely, G. Shaw, R. Kaufmann, E. Suchanek, C. Pabo, J. J. Skehel, D. C. Wiley, and S. Wharton. 1992. Introduction of intersubunit disulfide bonds in the membrane-distal region of the influenza hemagglutinin abolishes membrane fusion activity. Cell 68:635-645[CrossRef][Medline]. |
| 40. | Graham, B. S., M. J. McElrath, R. I. Connor, D. H. Schwartz, G. J. Gorse, M. C. Keefer, M. J. Mulligan, T. J. Matthews, S. M. Wolinsky, D. C. Montefiori, S. H. Vermund, J. S. Lambert, L. Corey, R. B. Belshe, R. Dolin, P. F. Wright, B. T. Korber, M. C. Wolff, and P. E. Fast. 1998. Analysis of intercurrent human immunodeficiency virus type 1 infections in phase I and II trials of current AIDS vaccines. J. Infect. Dis. 177:310-319[Medline]. |
| 41. | Hallenberger, S., V. Bosch, H. Angliker, E. Shaw, H. D. Klenk, and W. Garten. 1992. Inhibition of furin-mediated cleavage activation of HIV-1 glycoprotein gp160. Nature 360:358-361[CrossRef][Medline]. |
| 42. | Harlow, E., and D. Lane. 1988. Antibodies: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 43. | Haynes, B. F., G. Pantaleo, and A. S. Fauci. 1996. Towards an understanding of the correlates of protective immunity to HIV infection. Science 271:324-328[Abstract]. |
| 44. |
Heilman, C. A., and D. Baltimore.
1998.
HIV vaccines where are we going?
Nat. Med.
4:532-534[CrossRef][Medline].
|
| 45. |
Helseth, E.,
U. Olshevsky,
C. Furman, and J. Sodroski.
1991.
Human immunodeficiency virus type 1 gp120 envelope glycoprotein regions important for association with the gp41 transmembrane glycoprotein.
J. Virol.
65:2119-2123 |
| 46. | Hilleman, M. R. 1998. A simplified vaccinologist's vaccinology and the pursuit of a vaccine against AIDS. Vaccine 16:778-793[CrossRef][Medline]. |
| 47. |
Hoffman, T. L.,
C. C. LaBranche,
W. Zhang,
G. Canziani,
J. Robinson,
I. Chaiken,
J. A. Hoxie, and R. W. Doms.
1999.
Stable exposure of the coreceptor-binding site in a CD4-independent HIV-1 envelope protein.
Proc. Natl. Acad. Sci. USA
96:6359-6364 |
| 48. | Hunter, E., and R. Swanstrom. 1990. Retrovirus envelope glycoproteins. Curr. Top. Microbiol. Immunol. 157:187-253[Medline]. |
| 49. |
Kang, C.-Y.,
K. Hariharan,
P. L. Nara,
J. Sodroski, and J. P. Moore.
1994.
Immunization with a soluble CD4-gp120 complex preferentially induces neutralizing anti-human immunodeficiency virus type 1 antibodies directed to conformation-dependent epitopes of gp120.
J. Virol.
68:5854-5862 |
| 50. |
Koyanagi, Y.,
S. Miles,
R. T. Mitsuyasu,
J. E. Merrill,
H. V. Vinters, and I. S. Chen.
1987.
Dual infection of the central nervous system by AIDS viruses with distinct cellular tropisms.
Science
236:819-822 |
| 51. | Kwong, P. D., R. Wyatt, J. Robinson, R. W. Sweet, J. Sodroski, and W. A. Hendrickson. 1998. Structure of an HIV gp120 envelope glycoprotein complex with the CD4 receptor and a neutralizing human antibody. Nature 393:648-659[CrossRef][Medline]. |
| 52. |
LaCasse, R. A.,
K. E. Follis,
M. Trahey,
J. D. Scarborough,
D. R. Littman, and J. H. Nunberg.
1999.
Fusion-competent vaccines: broad neutralization of primary isolates of HIV.
Science
283:357-362 |
| 53. | Lamb-Wharton, R. J., S. V. Joag, E. B. Stephens, and O. Narayan. 1997. Primate models of AIDS vaccine development. AIDS 11(Suppl. A):S121-S126. |
| 54. |
Leamnson, R. N., and M. S. Halpern.
1976.
Subunit structure of the glycoprotein complex of avian tumor virus.
J. Virol.
18:956-968 |
| 55. | Leamnson, R. N., M. H. M. Shander, and M. S. Halpern. 1977. A structural protein complex in Moloney leukemia virus. Virology 76:437-439[CrossRef][Medline]. |
| 56. |
Leonard, C. K.,
M. W. Spellman,
L. Riddle,
R. J. Harris,
J. N. Thomas, and T. J. Gregory.
1990.
Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 recombinant human immunodeficiency virus envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells.
J. Biol. Chem.
265:10373-10382 |
| 57. |
Letvin, N. L.
1998.
Progress in the development of an HIV-1 vaccine.
Science
280:1875-1880 |
| 57a. | Malashkevich, V. N., B. J. Schneider, M. L. McNally, M. A. Milhollen, J. X. Pang, and P. S. Kim. 1999. Core structure of the envelope glycoprotein GP2 from Ebola virus at 1.9-Å resolution. Proc. Natl. Acad. Sci. USA 96:2622-2667. |
| 58. | Mascola, J. R., S. W. Snyder, O. S. Weislow, S. M. Belay, R. B. Belshe, D. H. Schwartz, M. L. Clements, R. Dolin, B. S. Graham, G. J. Gorse, M. C. Keefer, M. J. McElrath, M. C. Walker, K. F. Wagner, J. G. McNeil, F. E. McCutchan, D. S. Burke, and the National Institute of Allergy and Infectious Diseases AIDS Vaccine Evaluation Group. 1996. Immunization with envelope subunit vaccine products elicits neutralizing antibodies against laboratory adapted but not primary isolates of human immunodeficiency virus type 1. J. Infect. Dis. 173:340-348[Medline]. |
| 59. | Matthews, T. J. 1994. Dilemma of neutralization resistance of HIV-1 field isolates and vaccine development. AIDS Res. Hum. Retroviruses 10:631-632[Medline]. |
| 60. | McCune, J. M., L. B. Rabin, M. B. Feinberg, M. Lieberman, J. C. Kosek, G. Reyes, and I. L. Weissman. 1988. Endoproteolytic cleavage of gp160 is required for the activation of human immunodeficiency virus. Cell 53:55-67[CrossRef][Medline]. |
| 61. |
McKeating, J. A.,
A. McKnight, and J. P. Moore.
1991.
Differential loss of envelope glycoprotein gp120 from virions of human immunodeficiency virus type 1 isolates: effect on infectivity and neutralization.
J. Virol.
65:852-860 |
| 62. | Mertens, T. E., and A. Burton. 1996. Global estimates and epidemiology of HIV-1 infection and AIDS. AIDS 10(Suppl. A):S221-S228. |
| 63. | Molloy, S. S., L. Thomas, J. K. VanSlyke, P. E. Stenberg, and G. Thomas. 1994. Intracellular trafficking and activation of the furin proprotein convertase: localization to the TGN and recycling from the cell surface. EMBO J. 13:18-33[Medline]. |
| 64. | Montefiori, D. C., and T. G. Evans. 1999. Toward an HIV type 1 vaccine that generates potent, broadly cross-reactive neutralizing antibodies. AIDS Res. Hum. Retroviruses 15:689-698[CrossRef][Medline]. |
| 65. |
Montefiori, D. C.,
K. A. Reimann,
M. S. Wyand,
K. Manson,
M. G. Lewis,
R. G. Collman,
J. G. Sodroski,
D. P. Bolognesi, and N. L. Letvin.
1998.
Neutralizing antibodies in sera from macaques infected with chimeric simian-human immunodeficiency virus containing the envelope glycoproteins of either a laboratory-adapted variant or a primary isolate of human immunodeficiency virus type 1.
J. Virol.
72:3427-3431 |
| 66. | Moore, J. P., and J. M. Binley. 1998. Envelope's letters boxed into shape. Nature 393:630-631[CrossRef][Medline]. |
| 67. | Moore, J. P., Y. Cao, L. Qing, Q. J. Sattentau, J. Pyati, R. Koduri, J. Robinson, C. F. Barbas III, D. R. Burton, and D. D. Ho. 1995. Primary isolates of human immunodeficiency virus type 1 are relatively resistant to neutralization by monoclonal antibodies to gp120 and their neutralization is not predicted by studies with monomeric gp120. J. Virol. 69:101-109[Abstract]. |
| 68. | Moore, J. P., and D. D. Ho. 1995. HIV-1 neutralization: the consequences of viral adaptation to growth on transformed T cells. AIDS 9(Suppl. A):S117-S136. |
| 69. | Moore, J. P., J. A. McKeating, I. M. Jones, P. E. Stephens, G. Clements, S. Thomson, and R. A. Weiss. 1990. Characterisation of recombinant gp120 and gp160 from HIV-1: binding to monoclonal antibodies and sCD4. AIDS 4:307-315[Medline]. |
| 70. |
Moore, J. P.,
J. A. McKeating,
R. A. Weiss, and Q. J. Sattentau.
1990.
Dissociation of gp120 from HIV-1 virions induced by soluble CD4.
Science
250:1139-1142 |
| 71. |
Moore, J. P.,
Q. J. Sattentau,
R. Wyatt, and J. Sodroski.
1994.
Probing the structure of the human immunodeficiency virus surface glycoprotein gp120 with a panel of monoclonal antibodies.
J. Virol.
68:469-484 |
| 72. | Moore, J. P., and J. Sodroski. 1996. Antibody cross-competition analysis of the human immunodeficiency virus type 1 exterior envelope glycoprotein. J. Virol. 70:1863-1872[Abstract]. |
| 73. |
Moore, J. P.,
M. Thali,
B. A. Jameson,
F. Vignaux,
G. K. Lewis,
S.-W. Poon,
M. S. Fung,
N. C. Sun,
M. Charles,
P. J. Durda,
L. Åkerblom,
B. Wahren,
D. D. Ho,
Q. J. Sattentau, and J. Sodroski.
1993.
Immunochemical analysis of human immunodeficiency virus type 1: probing the structure of the C4 and V4 domains and the interaction of the C4 domain with the V3 loop.
J. Virol.
67:4785-4796 |
| 74. | Moore, J. P., A. Trkola, B. Korber, L. J. Boots, J. A. Kessler II, F. E. McCutchan, J. Mascola, D. D. Ho, J. Robinson, and A. J. Conley. 1995. A human monoclonal antibody to a complex epitope in the V3 region of gp120 of human immunodeficiency virus type 1 has broad reactivity within and outside clade B. J. Virol. 69:122-130[Abstract]. |
| 75. |
Moore, J. P.,
R. L. Willey,
G. K. Lewis,
J. Robinson, and J. Sodroski.
1994.
Immunological evidence for interactions between the first, second and fifth conserved domains of the gp120 surface glycoprotein of human immunodeficiency virus type 1.
J. Virol.
68:6836-6847 |
| 76. | Morikawa, Y., E. Barsov, and I. Jones. 1993. Legitimate and illegitimate cleavage of human immunodeficiency virus glycoproteins by furin. J. Virol. 167:3601-3604. |
| 77. |
Muster, T.,
R. Guinea,
A. Trkola,
M. Purtscher,
A. Klima,
F. Steindl,
P. Palese, and H. Katinger.
1994.
Cross-neutralizing antibodies against divergent human immunodeficiency virus type 1 isolates induced by the gp41 sequence ELDKWAS.
J. Virol.
68:4031-4034 |
| 78. |
Opstelten, D. E.,
M. Wallin, and H. Garoff.
1998.
Moloney murine leukemia virus envelope subunits, gp70 and Pr15E, form a stable disulfide-linked complex.
J. Virol.
72:6537-6545 |
| 79. | Otteken, A., P. L. Earl, and B. Moss. 1996. Folding, assembly, and intracellular trafficking of the HIV-1 envelope glycoprotein analyzed with monoclonal antibodies recognizing maturational intermediates. J. Virol. 70:3407-3415[Abstract]. |
| 80. |
Parren, P. W. H. I.,
D. R. Burton, and Q. J. Sattentau.
1997.
HIV-1 antibodydebris or virion?
Nat. Med.
3:366-367[Medline].
|
| 81. | Parren, P. W. H. I., J. P. Moore, D. R. Burton, and Q. J. Sattentau. 1999. The neutralizing antibody response to HIV-1: viral evasion and escape from humoral immunity. AIDS 13(Suppl. A):S137-S162. |
| 82. | Patarca, R., and W. A. Haseltine. 1984. Similarities among retrovirus proteins. Nature 312:496[CrossRef][Medline]. |
| 83. | Pinter, A., and E. Fleissner. 1977. The presence of disulfide-linked gp70 p15(E) complexes in AKR MuLV. Virology 83:417-422[CrossRef][Medline]. |
| 84. |
Pinter, A., and E. Fleissner.
1979.
Characterization of oligomeric complexes of murine and feline leukemia virus envelope and core components formed upon cross-linking.
J. Virol.
30:157-165 |
| 85. | Pinter, A., R. Kopelman, Z. Li, S. C. Kayman, and D. A. Sanders. 1997. Localization of the labile disulfide bond between SU and TM of the murine leukemia virus protein complex to a highly conserved CWLC motif in SU that resembles the active-site sequence of thiol-disulfide exchange enzymes. J. Virol. 71:8073-8077[Abstract]. |
| 86. |
Pique, C.,
D. Pham,
T. Tursz, and M. C. Dokhelar.
1992.
Human T-cell leukemia virus type 1 envelope protein maturation process: requirements for syncytium formation.
J. Virol.
66:906-913 |
| 87. |
Poignard, P.,
T. Fouts,
D. Naniche,
J. P. Moore, and Q. J. Sattentau.
1996.
Neutralizing antibodies to human immunodeficiency virus type-1 gp120 induce envelope glycoprotein subunit dissociation.
J. Exp. Med.
183:473-484 |
| 88. | Ratner, L., A. Fisher, L. L. Jagodzinski, H. Mitsuya, R.-S. Liou, R. C. Gallo, and F. Wong-Staal. 1987. Complete nucleotide sequences of functional clones of the AIDS virus. AIDS Res. Hum. Retroviruses 3:57-69[Medline]. |
| 89. | Reiter, J. N., R. E. Means, and R. C. Desrosiers. 1998. A role for carbohydrates in immune evasion in AIDS. Nat. Med. 4:679-684[CrossRef][Medline]. |
| 90. | Richardson, T. M., Jr., B. L. Stryjewski, C. C. Broder, J. A. Hoxie, J. R. Mascola, P. L. Earl, and R. W. Doms. 1996. Humoral response to oligomeric human immunodeficiency virus type 1 envelope protein. J. Virol. 70:753-762[Abstract]. |
| 91. |
Rizzuto, C. D.,
R. Wyatt,
N. Hernandez-Ramos,
Y. Sun,
P. D. Kwong,
W. A. Hendrickson, and J. G. Sodroski.
1998.
A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding.
Science
280:1949-1953 |
| 92. |
Roben, P.,
J. P. Moore,
M. Thali,
J. Sodroski,
C. F. Barbas III, and D. R. Burton.
1994.
Recognition properties of a panel of human recombinant Fab fragments to the CD4 binding site of gp120 showing differing ability to neutralize human immunodeficiency virus type 1.
J. Virol.
68:4821-4828 |
| 93. | Robinson, H. L. 1997. DNA vaccines for immunodeficiency viruses. AIDS 11(Suppl. A):S109-S119. |
| 94. | Rowland-Jones, S., R. Tan, and A. McMichael. 1997. The role of cellular immunity in protection against HIV infection. Adv. Immunol. 65:448-455. |
| 95. |
Sattentau, Q. J., and J. P. Moore.
1991.
Conformational changes induced in the human immunodeficiency virus envelope glycoproteins by soluble CD4 binding.
J. Exp. Med.
174:407-415 |
| 96. |
Sattentau, Q. J., and J. P. Moore.
1995.
Human immunodeficiency virus type 1 neutralization is determined by epitope exposure on the glycoprotein gp120 oligomer.
J. Exp. Med.
182:185-196 |
| 97. |
Sattentau, Q. J.,
J. P. Moore,
F. Vignaux,
F. Traincard, and P. Poignard.
1993.
Conformational changes induced in the envelope glycoproteins of the human and simian immunodeficiency viruses by soluble receptor binding.
J. Virol.
67:7383-7393 |
| 98. | Sattentau, Q. J., S. Zolla-Pazner, and P. Poignard. 1995. Epitope exposure on functional, oligomeric HIV-1 gp41 molecules. Virology 206:713-717[CrossRef][Medline]. |
| 99. | Schultz, T. F., B. A. Jameson, L. Lopalco, A. G. Siccardi, R. A. Weiss, and J. P. Moore. 1992. Conserved structural features in the interaction between retroviral surface and transmembrane glycoproteins. AIDS Res. Hum. Retroviruses 8:1585-1594. |
| 100. | Shibata, R., M. D. Hoggan, C. Broscius, G. Englund, T. S. Theodore, A. Buckler White, L. O. Arthur, Z. Israel, A. Schultz, H. C. Lane, and M. A. Martin. 1995. Isolation and characterization of a syncytium inducing macrophage/T-cell line tropic human immunodeficiency virus type 1 isolate that readily infects chimpanzee cells in vitro and in vivo. J. Virol. 69:4453-4462[Abstract]. |
| 101. | Shu, W., H. Ji, and M. Lu. 1999. Trimerization specificity in HIV-1 gp41: analysis with a GCN4 leucine zipper model. Biochemistry 38:5378-5385[CrossRef][Medline]. |
| 102. | Sullivan, N., Y. Sun, J. Li, W. Hofmann, and J. Sodroski. 1995. Replicative function and neutralization sensitivity of envelope glycoprotein from primary and T-cell-line-passaged human immunodeficiency virus type isolates. J. Virol. 69:4413-4422[Abstract]. |
| 103. |
Sullivan, N.,
Y. Sun,
Q. Sattentau,
M. Thali,
D. Wu,
G. Denisova,
J. Gershoni,
J. Robinson,
J. P. Moore, and J. Sodroski.
1998.
CD4-induced conformational changes in the human immunodeficiency virus type 1 gp120 glycoprotein: consequences for virus entry and neutralization.
J. Virol.
72:4694-4703 |
| 104. |
Takeuchi, Y.,
M. Akutsu,
K. Murayama,
N. Shimizu, and H. Hoshino.
1991.
Host range mutant of human immunodeficiency virus type 1: modification of cell tropism by a single point mutation at the neutralization epitope in the env gene.
J. Virol.
65:1710-1718 |
| 105. |
Thali, M.,
J. P. Moore,
C. Furman,
M. Charles,
D. D. Ho,
J. Robinson, and J. Sodroski.
1993.
Characterization of human immunodeficiency virus type 1 (HIV-1) gp120 neutralization epitopes exposed upon gp120-CD4 binding.
J. Virol.
67:3978-3988 |
| 106. | Trkola, A., T. Dragic, J. Arthos, J. M. Binley, W. C. Olson, G. P. Allaway, C. Cheng Mayer, J. Robinson, P. J. Maddon, and J. P. Moore. 1996. CD4-dependent, antibody-sensitive interactions between HIV-1 and its co-receptor CCR-5. Nature 384:184-187[CrossRef][Medline]. |
| 107. |
Trkola, A.,
T. Ketas,
V. N. KewalRamani,
F. Endorf,
J. M. Binley,
H. Katinger,
J. Robinson,
D. R. Littman, and J. P. Moore.
1998.
Neutralization sensitivity of human immunodeficiency virus type 1 primary isolates to antibodies and CD4-based reagents is independent of coreceptor usage.
J. Virol.
72:1876-1885 |
| 108. | Trkola, A., A. B. Pomales, H. Yuan, B. Korber, P. J. Maddon, G. P. Allaway, H. Katinger, C. F. Barbas III, D. R. Burton, D. D. Ho, and J. P. Moore. 1995. Cross-clade neutralization of primary isolates of human immunodeficiency virus type 1 by human monoclonal antibodies and tetrameric CD4 IgG. J. Virol. 69:6609-6617[Abstract]. |
| 109. | Trkola, A., M. Purtscher, T. Muster, C. Ballaun, A. Buchacher, N. Sullivan, K. Srinivasan, J. Sodroski, J. P. Moore, and H. Katinger. 1996. Human monoclonal antibody 2G12 defines a distinctive neutralization epitope on the gp120 glycoprotein of human immunodeficiency virus type 1. J. Virol. 70:1100-1108[Abstract]. |
| 110. | VanCott, T. C., J. R. Mascola, R. W. Kaminski, V. Kalyanraman, P. L. Hallberg, P. R. Burnett, J. T. Ulrich, D. J. Rechtman, and D. L. Birx. 1997. Antibodies with specificity to native gp120 and neutralization activity against primary human immunodeficiency virus type 1 isolates elicited by immunization with oligomeric gp160. J. Virol. 71:4319-4330[Abstract]. |
| 111. |
VanCott, T. C.,
J. R. Mascola,
L. D. Loomis-Price,
F. Sinangil,
N. Zitomersky,
J. McNeil,
M. L. Robb,
D. L. Birx, and S. Barnett.
1999.
Cross-subtype neutralizing antibodies induced in baboons by a subtype E gp120 immunogen based on an R5 primary human immunodeficiency virus type 1 envelope.
J. Virol.
73:4640-4650 |
| 112. | Van Cott, T. C., V. R. Polonis, L. D. Loomis, N. L. Michael, P. L. Nara, and D. L. Birx. 1995. Differential role of V3-specific antibodies in neutralization assays involving primary and laboratory adapted isolates of HIV-1. AIDS Res. Hum. Retroviruses 11:1379-1392[Medline]. |
| 113. | Veronese, F. D., R. Rahman, R. Pal, C. Boyer, J. Romano, V. S. Kalyanaraman, B. C. Nair, R. C. Gallo, and M. G. Sarngadharan. 1992. Delineation of immunoreactive, conserved regions in the external envelope glycoprotein of the human immunodeficiency virus type 1. AIDS Res. Hum. Retroviruses 8:1125-1132[Medline]. |
| 114. |
Volchkov, V. E.,
H. Feldmann,
V. A. Volchkova, and H. D. Klenk.
1998.
Processing of the ebola virus glycoprotein by the proprotein convertase furin.
Proc. Natl. Acad. Sci. USA
95:5762-5767 |
| 115. | Watkins, B. A., S. Buge, K. Aldrich, A. E. Davis, J. Robinson, M. S. Reitz, and M. Robert-Guroff. 1996. Resistance of human immunodeficiency virus type 1 to neutralization by natural antisera occurs through single amino acid substitutions that cause changes in antibody binding at multiple sites. J. Virol. 70:8431-8437[Abstract]. |
| 116. | Weissenhorn, W., A. Dessen, S. C. Harrison, J. J. Shekel, and D. C. Wiley. 1997. Atomic structure of the ectodomain from HIV-1 gp41. Nature 387:426-430[CrossRef][Medline]. |
| 117. | Weissenhorn, W., A. Carfi, K. H. Lee, J. J. Skehel, and D. C. Wiley. 1998. Crystal structure of Ebola virus membrane fusion subunit, GP2, from the envelope glycoprotein ectodomain. Mol. Cell 2:605-616[CrossRef][Medline]. |
| 118. | White-Scharf, M. E., B. J. Potts, L. M. Smith, K. A. Sokolowski, J. R. Rusche, and S. Silver. 1993. Broadly neutralizing monoclonal antibodies to the V3 region of HIV-1 can be elicited by peptide immunization. Virology 192:197-206[CrossRef][Medline]. |
| 119. |
Willey, R. L.,
J. S. Bonifacino,
B. J. Potts,
M. A. Martin, and R. D. Klausner.
1988.
Biosynthesis, cleavage, and degradation of the human immunodeficiency virus type 1 envelope protein.
Proc. Natl. Acad. Sci. USA
85:9580-9584 |
| 120. | Wrin, T., and J. H. Nunberg. 1994. HIV-1 MN recombinant gp120 vaccine serum, which fails to neutralize primary isolates of HIV-1, does not antagonize neutralization by antibodies from infected individuals. AIDS 8:1622-1623[CrossRef][Medline]. |
| 121. | Wyatt, R., E. Desjardin, U. Olshevsky, C. Nixon, J. Binley, V. Olshevsky, and J. Sodroski. 1997. Analysis of the interaction of the human immunodeficiency virus type 1 gp120 envelope glycoprotein with the gp41 transmembrane glycoprotein. J. Virol. 71:9722-9731[Abstract]. |
| 122. | Wyatt, R., P. D. Kwong, E. Desjardin, R. W. Sweet, J. Robinson, W. A. Hendrickson, and J. G. Sodroski. 1998. The antigenic structure of the HIV gp120 envelope glycoprotein. Nature 393:705-711[CrossRef][Medline]. |
| 123. | Wyatt, R., J. P. Moore, M. Accola, E. Desjardin, J. Robinson, and J. Sodroski. 1995. Involvement of the V1/V2 variable loop structure in the exposure of human immunodeficiency virus type 1 gp120 epitopes induced by receptor binding. J. Virol. 69:5723-5733[Abstract]. |
| 124. | Zhou, N., C. M. Kay, and R. S. Hodges. 1993. Disulphide bond contribution to protein stability: positional effects of substitution in the hydrophobic core of the two-stranded alpha-helical coiled-coil. Biochemistry 32:3178-3187[CrossRef][Medline]. |
Journal of Virology, January 2000, p. 627-643, Vol. 74, No. 2
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gray, E. S., Taylor, N., Wycuff, D., Moore, P. L., Tomaras, G. D., Wibmer, C. K., Puren, A., DeCamp, A., Gilbert, P. B., Wood, B., Montefiori, D. C., Binley, J. M., Shaw, G. M., Haynes, B. F., Mascola, J. R., Morris, L.
(2009). Antibody Specificities Associated with Neutralization Breadth in Plasma from Human Immunodeficiency Virus Type 1 Subtype C-Infected Blood Donors. J. Virol.
83: 8925-8937
[Abstract] [Full Text] -
Dosenovic, P., Chakrabarti, B., Soldemo, M., Douagi, I., Forsell, M. N. E., Li, Y., Phogat, A., Paulie, S., Hoxie, J., Wyatt, R. T., Karlsson Hedestam, G. B.
(2009). Selective Expansion of HIV-1 Envelope Glycoprotein-Specific B Cell Subsets Recognizing Distinct Structural Elements Following Immunization. J. Immunol.
183: 3373-3382
[Abstract] [Full Text] -
O'Rourke, S. M., Schweighardt, B., Scott, W. G., Wrin, T., Fonseca, D. P. A. J., Sinangil, F., Berman, P. W.
(2009). Novel Ring Structure in the gp41 Trimer of Human Immunodeficiency Virus Type 1 That Modulates Sensitivity and Resistance to Broadly Neutralizing Antibodies. J. Virol.
83: 7728-7738
[Abstract] [Full Text] -
Kassa, A., Finzi, A., Pancera, M., Courter, J. R., Smith, A. B. III, Sodroski, J.
(2009). Identification of a Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Variant Resistant to Cold Inactivation. J. Virol.
83: 4476-4488
[Abstract] [Full Text] -
Morner, A., Douagi, I., Forsell, M. N. E., Sundling, C., Dosenovic, P., O'Dell, S., Dey, B., Kwong, P. D., Voss, G., Thorstensson, R., Mascola, J. R., Wyatt, R. T., Karlsson Hedestam, G. B.
(2009). Human Immunodeficiency Virus Type 1 Env Trimer Immunization of Macaques and Impact of Priming with Viral Vector or Stabilized Core Protein. J. Virol.
83: 540-551
[Abstract] [Full Text] -
Bontjer, I., Land, A., Eggink, D., Verkade, E., Tuin, K., Baldwin, C., Pollakis, G., Paxton, W. A., Braakman, I., Berkhout, B., Sanders, R. W.
(2009). Optimization of Human Immunodeficiency Virus Type 1 Envelope Glycoproteins with V1/V2 Deleted, Using Virus Evolution. J. Virol.
83: 368-383
[Abstract] [Full Text] -
Doria-Rose, N. A., Klein, R. M., Manion, M. M., O'Dell, S., Phogat, A., Chakrabarti, B., Hallahan, C. W., Migueles, S. A., Wrammert, J., Ahmed, R., Nason, M., Wyatt, R. T., Mascola, J. R., Connors, M.
(2009). Frequency and Phenotype of Human Immunodeficiency Virus Envelope-Specific B Cells from Patients with Broadly Cross-Neutralizing Antibodies. J. Virol.
83: 188-199
[Abstract] [Full Text] -
Sundling, C., Schon, K., Morner, A., Forsell, M. N. E., Wyatt, R. T., Thorstensson, R., Hedestam, G. B. K., Lycke, N. Y.
(2008). CTA1-DD adjuvant promotes strong immunity against human immunodeficiency virus type 1 envelope glycoproteins following mucosal immunization. J. Gen. Virol.
89: 2954-2964
[Abstract] [Full Text] -
Wang, J., Sen, J., Rong, L., Caffrey, M.
(2008). Role of the HIV gp120 Conserved Domain 1 in Processing and Viral Entry. J. Biol. Chem.
283: 32644-32649
[Abstract] [Full Text] -
Kraft, Z., Strouss, K., Sutton, W. F., Cleveland, B., Tso, F. Y., Polacino, P., Overbaugh, J., Hu, S.-L., Stamatatos, L.
(2008). Characterization of Neutralizing Antibody Responses Elicited by Clade A Envelope Immunogens Derived from Early Transmitted Viruses. J. Virol.
82: 5912-5921
[Abstract] [Full Text] -
Chien, M.-P., Jiang, S., Chang, D.-K.
(2008). The function of coreceptor as a basis for the kinetic dissection of HIV type 1 envelope protein-mediated cell fusion. FASEB J.
22: 1179-1192
[Abstract] [Full Text] -
Lazear, E., Carfi, A., Whitbeck, J. C., Cairns, T. M., Krummenacher, C., Cohen, G. H., Eisenberg, R. J.
(2008). Engineered Disulfide Bonds in Herpes Simplex Virus Type 1 gD Separate Receptor Binding from Fusion Initiation and Viral Entry. J. Virol.
82: 700-709
[Abstract] [Full Text] -
Blay, W. M., Kasprzyk, T., Misher, L., Richardson, B. A., Haigwood, N. L.
(2007). Mutations in Envelope gp120 Can Impact Proteolytic Processing of the gp160 Precursor and Thereby Affect Neutralization Sensitivity of Human Immunodeficiency Virus Type 1 Pseudoviruses. J. Virol.
81: 13037-13049
[Abstract] [Full Text] -
Forsell, M. N. E., McInerney, G. M., Dosenovic, P., Hidmark, A. S., Eriksson, C., Liljestrom, P., Grundner, C., Karlsson Hedestam, G. B.
(2007). Increased human immunodeficiency virus type 1 Env expression and antibody induction using an enhanced alphavirus vector. J. Gen. Virol.
88: 2774-2779
[Abstract] [Full Text] -
Davis, C. W., Mattei, L. M., Nguyen, H.-Y., Ansarah-Sobrinho, C., Doms, R. W., Pierson, T. C.
(2006). The Location of Asparagine-linked Glycans on West Nile Virions Controls Their Interactions with CD209 (Dendritic Cell-specific ICAM-3 Grabbing Nonintegrin). J. Biol. Chem.
281: 37183-37194
[Abstract] [Full Text] -
Derby, N. R., Kraft, Z., Kan, E., Crooks, E. T., Barnett, S. W., Srivastava, I. K., Binley, J. M., Stamatatos, L.
(2006). Antibody Responses Elicited in Macaques Immunized with Human Immunodeficiency Virus Type 1 (HIV-1) SF162-Derived gp140 Envelope Immunogens: Comparison with Those Elicited during Homologous Simian/Human Immunodeficiency Virus SHIVSF162P4 and Heterologous HIV-1 Infection.. J. Virol.
80: 8745-8762
[Abstract] [Full Text] -
Hager-Braun, C., Katinger, H., Tomer, K. B.
(2006). The HIV-Neutralizing Monoclonal Antibody 4E10 Recognizes N-Terminal Sequences on the Native Antigen.. J. Immunol.
176: 7471-7481
[Abstract] [Full Text] -
Melikyan, G. B., Egelhofer, M., von Laer, D.
(2006). Membrane-Anchored Inhibitory Peptides Capture Human Immunodeficiency Virus Type 1 gp41 Conformations That Engage the Target Membrane prior to Fusion.. J. Virol.
80: 3249-3258
[Abstract] [Full Text] -
Moore, P. L., Crooks, E. T., Porter, L., Zhu, P., Cayanan, C. S., Grise, H., Corcoran, P., Zwick, M. B., Franti, M., Morris, L., Roux, K. H., Burton, D. R., Binley, J. M.
(2006). Nature of Nonfunctional Envelope Proteins on the Surface of Human Immunodeficiency Virus Type 1. J. Virol.
80: 2515-2528
[Abstract] [Full Text] -
Davis, C. W., Nguyen, H.-Y., Hanna, S. L., Sanchez, M. D., Doms, R. W., Pierson, T. C.
(2006). West Nile Virus Discriminates between DC-SIGN and DC-SIGNR for Cellular Attachment and Infection. J. Virol.
80: 1290-1301
[Abstract] [Full Text] -
Li, Y., Svehla, K., Mathy, N. L., Voss, G., Mascola, J. R., Wyatt, R.
(2006). Characterization of Antibody Responses Elicited by Human Immunodeficiency Virus Type 1 Primary Isolate Trimeric and Monomeric Envelope Glycoproteins in Selected Adjuvants. J. Virol.
80: 1414-1426
[Abstract] [Full Text] -
Selvarajah, S., Puffer, B., Pantophlet, R., Law, M., Doms, R. W., Burton, D. R.
(2005). Comparing Antigenicity and Immunogenicity of Engineered gp120. J. Virol.
79: 12148-12163
[Abstract] [Full Text] -
Forsell, M. N. E., Li, Y., Sundback, M., Svehla, K., Liljestrom, P., Mascola, J. R., Wyatt, R., Hedestam, G. B. K.
(2005). Biochemical and Immunogenic Characterization of Soluble Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Trimers Expressed by Semliki Forest Virus. J. Virol.
79: 10902-10914
[Abstract] [Full Text] -
Li, M., Gao, F., Mascola, J. R., Stamatatos, L., Polonis, V. R., Koutsoukos, M., Voss, G., Goepfert, P., Gilbert, P., Greene, K. M., Bilska, M., Kothe, D. L., Salazar-Gonzalez, J. F., Wei, X., Decker, J. M., Hahn, B. H., Montefiori, D. C.
(2005). Human Immunodeficiency Virus Type 1 env Clones from Acute and Early Subtype B Infections for Standardized Assessments of Vaccine-Elicited Neutralizing Antibodies. J. Virol.
79: 10108-10125
[Abstract] [Full Text] -
Poon, B., Hsu, J. F., Gudeman, V., Chen, I. S. Y., Grovit-Ferbas, K.
(2005). Formaldehyde-Treated, Heat-Inactivated Virions with Increased Human Immunodeficiency Virus Type 1 Env Can Be Used To Induce High-Titer Neutralizing Antibody Responses. J. Virol.
79: 10210-10217
[Abstract] [Full Text] -
Jacobs, A., Sen, J., Rong, L., Caffrey, M.
(2005). Alanine Scanning Mutants of the HIV gp41 Loop. J. Biol. Chem.
280: 27284-27288
[Abstract] [Full Text] -
Beddows, S., Schulke, N., Kirschner, M., Barnes, K., Franti, M., Michael, E., Ketas, T., Sanders, R. W., Maddon, P. J., Olson, W. C., Moore, J. P.
(2005). Evaluating the Immunogenicity of a Disulfide-Stabilized, Cleaved, Trimeric Form of the Envelope Glycoprotein Complex of Human Immunodeficiency Virus Type 1. J. Virol.
79: 8812-8827
[Abstract] [Full Text] -
Pinter, A., Honnen, W. J., D'Agostino, P., Gorny, M. K., Zolla-Pazner, S., Kayman, S. C.
(2005). The C108g Epitope in the V2 Domain of gp120 Functions as a Potent Neutralization Target When Introduced into Envelope Proteins Derived from Human Immunodeficiency Virus Type 1 Primary Isolates. J. Virol.
79: 6909-6917
[Abstract] [Full Text] -
Delos, S. E., Godby, J. A., White, J. M.
(2005). Receptor-Induced Conformational Changes in the SU Subunit of the Avian Sarcoma/Leukosis Virus A Envelope Protein: Implications for Fusion Activation. J. Virol.
79: 3488-3499
[Abstract] [Full Text] -
Varadarajan, R., Sharma, D., Chakraborty, K., Patel, M., Citron, M., Sinha, P., Yadav, R., Rashid, U., Kennedy, S., Eckert, D., Geleziunas, R., Bramhill, D., Schleif, W., Liang, X., Shiver, J.
(2005). Characterization of gp120 and Its Single-Chain Derivatives, gp120-CD4D12 and gp120-M9: Implications for Targeting the CD4i Epitope in Human Immunodeficiency Virus Vaccine Design. J. Virol.
79: 1713-1723
[Abstract] [Full Text] -
Hosie, M. J., Klein, D., Binley, J. M., Dunsford, T. H., Jarrett, O., Neil, J. C., Knapp, E., Giannecchini, S., Matteucci, D., Bendinelli, M., Hoxie, J. A., Willett, B. J.
(2005). Vaccination with an Inactivated Virulent Feline Immunodeficiency Virus Engineered To Express High Levels of Env. J. Virol.
79: 1954-1957
[Abstract] [Full Text] -
Yang, X., Tomov, V., Kurteva, S., Wang, L., Ren, X., Gorny, M. K., Zolla-Pazner, S., Sodroski, J.
(2004). Characterization of the Outer Domain of the gp120 Glycoprotein from Human Immunodeficiency Virus Type 1. J. Virol.
78: 12975-12986
[Abstract] [Full Text] -
York, J., Romanowski, V., Lu, M., Nunberg, J. H.
(2004). The Signal Peptide of the Junin Arenavirus Envelope Glycoprotein Is Myristoylated and Forms an Essential Subunit of the Mature G1-G2 Complex. J. Virol.
78: 10783-10792
[Abstract] [Full Text] -
Chen, B., Cheng, Y., Calder, L., Harrison, S. C., Reinherz, E. L., Skehel, J. J., Wiley, D. C.
(2004). A Chimeric Protein of Simian Immunodeficiency Virus Envelope Glycoprotein gp140 and Escherichia coli Aspartate Transcarbamoylase. J. Virol.
78: 4508-4516
[Abstract] [Full Text] -
Bower, J. F., Yang, X., Sodroski, J., Ross, T. M.
(2004). Elicitation of Neutralizing Antibodies with DNA Vaccines Expressing Soluble Stabilized Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Trimers Conjugated to C3d. J. Virol.
78: 4710-4719
[Abstract] [Full Text] -
York, J., Nunberg, J. H.
(2004). Role of Hydrophobic Residues in the Central Ectodomain of gp41 in Maintaining the Association between Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Subunits gp120 and gp41. J. Virol.
78: 4921-4926
[Abstract] [Full Text] -
Kuhmann, S. E., Pugach, P., Kunstman, K. J., Taylor, J., Stanfield, R. L., Snyder, A., Strizki, J. M., Riley, J., Baroudy, B. M., Wilson, I. A., Korber, B. T., Wolinsky, S. M., Moore, J. P.
(2004). Genetic and Phenotypic Analyses of Human Immunodeficiency Virus Type 1 Escape from a Small-Molecule CCR5 Inhibitor. J. Virol.
78: 2790-2807
[Abstract] [Full Text] -
Lorin, C., Mollet, L., Delebecque, F., Combredet, C., Hurtrel, B., Charneau, P., Brahic, M., Tangy, F.
(2004). A Single Injection of Recombinant Measles Virus Vaccines Expressing Human Immunodeficiency Virus (HIV) Type 1 Clade B Envelope Glycoproteins Induces Neutralizing Antibodies and Cellular Immune Responses to HIV. J. Virol.
78: 146-157
[Abstract] [Full Text] -
Nishimura, Y., Igarashi, T., Haigwood, N. L., Sadjadpour, R., Donau, O. K., Buckler, C., Plishka, R. J., Buckler-White, A., Martin, M. A.
(2003). Transfer of neutralizing IgG to macaques 6 h but not 24 h after SHIV infection confers sterilizing protection: Implications for HIV-1 vaccine development. Proc. Natl. Acad. Sci. USA
100: 15131-15136
[Abstract] [Full Text] -
McKenna, P. M., Pomerantz, R. J., Dietzschold, B., McGettigan, J. P., Schnell, M. J.
(2003). Covalently Linked Human Immunodeficiency Virus Type 1 gp120/gp41 Is Stably Anchored in Rhabdovirus Particles and Exposes Critical Neutralizing Epitopes. J. Virol.
77: 12782-12794
[Abstract] [Full Text] -
Poumbourios, P., Maerz, A. L., Drummer, H. E.
(2003). Functional Evolution of the HIV-1 Envelope Glycoprotein 120 Association Site of Glycoprotein 41. J. Biol. Chem.
278: 42149-42160
[Abstract] [Full Text] -
Srivastava, I. K., Stamatatos, L., Kan, E., Vajdy, M., Lian, Y., Hilt, S., Martin, L., Vita, C., Zhu, P., Roux, K. H., Vojtech, L., C. Montefiori, D., Donnelly, J., Ulmer, J. B., Barnett, S. W.
(2003). Purification, Characterization, and Immunogenicity of a Soluble Trimeric Envelope Protein Containing a Partial Deletion of the V2 Loop Derived from SF162, an R5-Tropic Human Immunodeficiency Virus Type 1 Isolate. J. Virol.
77: 11244-11259
[Abstract] [Full Text] -
Labrijn, A. F., Poignard, P., Raja, A., Zwick, M. B., Delgado, K., Franti, M., Binley, J., Vivona, V., Grundner, C., Huang, C.-C., Venturi, M., Petropoulos, C. J., Wrin, T., Dimitrov, D. S., Robinson, J., Kwong, P. D., Wyatt, R. T., Sodroski, J., Burton, D. R.
(2003). Access of Antibody Molecules to the Conserved Coreceptor Binding Site on Glycoprotein gp120 Is Sterically Restricted on Primary Human Immunodeficiency Virus Type 1. J. Virol.
77: 10557-10565
[Abstract] [Full Text] -
Binley, J. M., Cayanan, C. S., Wiley, C., Schulke, N., Olson, W. C., Burton, D. R.
(2003). Redox-Triggered Infection by Disulfide-Shackled Human Immunodeficiency Virus Type 1 Pseudovirions. J. Virol.
77: 5678-5684
[Abstract] [Full Text] -
Abrahamyan, L. G., Markosyan, R. M., Moore, J. P., Cohen, F. S., Melikyan, G. B.
(2003). Human Immunodeficiency Virus Type 1 Env with an Intersubunit Disulfide Bond Engages Coreceptors but Requires Bond Reduction after Engagement To Induce Fusion. J. Virol.
77: 5829-5836
[Abstract] [Full Text] -
Pantophlet, R., Wilson, I. A., Burton, D. R.
(2003). Hyperglycosylated Mutants of Human Immunodeficiency Virus (HIV) Type 1 Monomeric gp120 as Novel Antigens for HIV Vaccine Design. J. Virol.
77: 5889-5901
[Abstract] [Full Text] -
Sailaja, G., Husain, S., Nayak, B. P., Jabbar, A. M.
(2003). Long-Term Maintenance of gp120-Specific Immune Responses by Genetic Vaccination with the HIV-1 Envelope Genes Linked to the Gene Encoding Flt-3 Ligand. J. Immunol.
170: 2496-2507
[Abstract] [Full Text] -
Green, T. D., Montefiori, D. C., Ross, T. M.
(2003). Enhancement of Antibodies to the Human Immunodeficiency Virus Type 1 Envelope by Using the Molecular Adjuvant C3d. J. Virol.
77: 2046-2055
[Abstract] [Full Text] -
Santiago, M. L., Bibollet-Ruche, F., Bailes, E., Kamenya, S., Muller, M. N., Lukasik, M., Pusey, A. E., Collins, D. A., Wrangham, R. W., Goodall, J., Shaw, G. M., Sharp, P. M., Hahn, B. H.
(2003). Amplification of a Complete Simian Immunodeficiency Virus Genome from Fecal RNA of a Wild Chimpanzee. J. Virol.
77: 2233-2242
[Abstract] [Full Text] -
Herrera, C., Spenlehauer, C., Fung, M. S., Burton, D. R., Beddows, S., Moore, J. P.
(2002). Nonneutralizing Antibodies to the CD4-Binding Site on the gp120 Subunit of Human Immunodeficiency Virus Type 1 Do Not Interfere with the Activity of a Neutralizing Antibody against the Same Site. J. Virol.
77: 1084-1091
[Abstract] [Full Text] -
Willey, R. L., Byrum, R., Piatak, M., Kim, Y. B., Cho, M. W., Rossio, J. L. Jr., Bess, J. Jr., Igarashi, T., Endo, Y., Arthur, L. O., Lifson, J. D., Martin, M. A.
(2002). Control of Viremia and Prevention of Simian-Human Immunodeficiency Virus-Induced Disease in Rhesus Macaques Immunized with Recombinant Vaccinia Viruses plus Inactivated Simian Immunodeficiency Virus and Human Immunodeficiency Virus Type 1 Particles. J. Virol.
77: 1163-1174
[Abstract] [Full Text] -
Jeffs, S. A., Shotton, C., Balfe, P., McKeating, J. A.
(2002). Truncated gp120 envelope glycoprotein of human immunodeficiency virus 1 elicits a broadly reactive neutralizing immune response. J. Gen. Virol.
83: 2723-2732
[Abstract] [Full Text] -
Sanders, R. W., Vesanen, M., Schuelke, N., Master, A., Schiffner, L., Kalyanaraman, R., Paluch, M., Berkhout, B., Maddon, P. J., Olson, W. C., Lu, M., Moore, J. P.
(2002). Stabilization of the Soluble, Cleaved, Trimeric Form of the Envelope Glycoprotein Complex of Human Immunodeficiency Virus Type 1. J. Virol.
76: 8875-8889
[Abstract] [Full Text] -
Cormier, E. G., Dragic, T.
(2002). The Crown and Stem of the V3 Loop Play Distinct Roles in Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Interactions with the CCR5 Coreceptor. J. Virol.
76: 8953-8957
[Abstract] [Full Text] -
He, Y., Honnen, W. J., Krachmarov, C. P., Burkhart, M., Kayman, S. C., Corvalan, J., Pinter, A.
(2002). Efficient Isolation of Novel Human Monoclonal Antibodies with Neutralizing Activity Against HIV-1 from Transgenic Mice Expressing Human Ig Loci. J. Immunol.
169: 595-605
[Abstract] [Full Text] -
Gaschen, B., Taylor, J., Yusim, K., Foley, B., Gao, F., Lang, D., Novitsky, V., Haynes, B., Hahn, B. H., Bhattacharya, T., Korber, B.
(2002). Diversity Considerations in HIV-1 Vaccine Selection. Science
296: 2354-2360
[Abstract] [Full Text] -
Schulke, N., Vesanen, M. S., Sanders, R. W., Zhu, P., Lu, M., Anselma, D. J., Villa, A. R., Parren, P. W. H. I., Binley, J. M., Roux, K. H., Maddon, P. J., Moore, J. P., Olson, W. C.
(2002). Oligomeric and Conformational Properties of a Proteolytically Mature, Disulfide-Stabilized Human Immunodeficiency Virus Type 1 gp140 Envelope Glycoprotein. J. Virol.
76: 7760-7776
[Abstract] [Full Text] -
Giannecchini, S., Isola, P., Sichi, O., Matteucci, D., Pistello, M., Zaccaro, L., Del Mauro, D., Bendinelli, M.
(2002). AIDS Vaccination Studies Using an Ex Vivo Feline Immunodeficiency Virus Model: Failure To Protect and Possible Enhancement of Challenge Infection by Four Cell-Based Vaccines Prepared with Autologous Lymphoblasts. J. Virol.
76: 6882-6892
[Abstract] [Full Text] -
Sanders, R. W., Venturi, M., Schiffner, L., Kalyanaraman, R., Katinger, H., Lloyd, K. O., Kwong, P. D., Moore, J. P.
(2002). The Mannose-Dependent Epitope for Neutralizing Antibody 2G12 on Human Immunodeficiency Virus Type 1 Glycoprotein gp120. J. Virol.
76: 7293-7305
[Abstract] [Full Text] -
Moulard, M., Phogat, S. K., Shu, Y., Labrijn, A. F., Xiao, X., Binley, J. M., Zhang, M.-Y., Sidorov, I. A., Broder, C. C., Robinson, J., Parren, P. W. H. I., Burton, D. R., Dimitrov, D. S.
(2002). Broadly cross-reactive HIV-1-neutralizing human monoclonal Fab selected for binding to gp120-CD4-CCR5 complexes. Proc. Natl. Acad. Sci. USA
99: 6913-6918
[Abstract] [Full Text] -
Chakrabarti, B. K., Kong, W.-p., Wu, B.-y., Yang, Z.-Y., Friborg, J., Ling, X., King, S. R., Montefiori, D. C., Nabel, G. J.
(2002). Modifications of the Human Immunodeficiency Virus Envelope Glycoprotein Enhance Immunogenicity for Genetic Immunization. J. Virol.
76: 5357-5368
[Abstract] [Full Text] -
Liu, J., Wang, S., Hoxie, J. A., LaBranche, C. C., Lu, M.
(2002). Mutations That Destabilize the gp41 Core Are Determinants for Stabilizing the Simian Immunodeficiency Virus-CPmac Envelope Glycoprotein Complex. J. Biol. Chem.
277: 12891-12900
[Abstract] [Full Text] -
Kiszka, I., Kmieciak, D., Gzyl, J., Naito, T., Bolesta, E., Sieron, A., Singh, S. P., Srinivasan, A., Trinchieri, G., Kaneko, Y., Kozbor, D.
(2002). Effect of the V3 Loop Deletion of Envelope Glycoprotein on Cellular Responses and Protection against Challenge with Recombinant Vaccinia Virus Expressing gp160 of Primary Human Immunodeficiency Virus Type 1 Isolates. J. Virol.
76: 4222-4232
[Abstract] [Full Text] -
Grundner, C., Mirzabekov, T., Sodroski, J., Wyatt, R.
(2002). Solid-Phase Proteoliposomes Containing Human Immunodeficiency Virus Envelope Glycoproteins. J. Virol.
76: 3511-3521
[Abstract] [Full Text] -
Binley, J. M., Sanders, R. W., Master, A., Cayanan, C. S., Wiley, C. L., Schiffner, L., Travis, B., Kuhmann, S., Burton, D. R., Hu, S.-L., Olson, W. C., Moore, J. P.
(2002). Enhancing the Proteolytic Maturation of Human Immunodeficiency Virus Type 1 Envelope Glycoproteins. J. Virol.
76: 2606-2616
[Abstract] [Full Text] -
Srivastava, I. K., Stamatatos, L., Legg, H., Kan, E., Fong, A., Coates, S. R., Leung, L., Wininger, M., Donnelly, J. J., Ulmer, J. B., Barnett, S. W.
(2002). Purification and Characterization of Oligomeric Envelope Glycoprotein from a Primary R5 Subtype B Human Immunodeficiency Virus. J. Virol.
76: 2835-2847
[Abstract] [Full Text] -
Zwick, M. B., Labrijn, A. F., Wang, M., Spenlehauer, C., Saphire, E. O., Binley, J. M., Moore, J. P., Stiegler, G., Katinger, H., Burton, D. R., Parren, P. W. H. I.
(2001). Broadly Neutralizing Antibodies Targeted to the Membrane-Proximal External Region of Human Immunodeficiency Virus Type 1 Glycoprotein gp41. J. Virol.
75: 10892-10905
[Abstract] [Full Text] -
Parker, C. E., Deterding, L. J., Hager-Braun, C., Binley, J. M., Schulke, N., Katinger, H., Moore, J. P., Tomer, K. B.
(2001). Fine Definition of the Epitope on the gp41 Glycoprotein of Human Immunodeficiency Virus Type 1 for the Neutralizing Monoclonal Antibody 2F5. J. Virol.
75: 10906-10911
[Abstract] [Full Text] -
Finnegan, C. M., Berg, W., Lewis, G. K., DeVico, A. L.
(2001). Antigenic Properties of the Human Immunodeficiency Virus Envelope during Cell-Cell Fusion. J. Virol.
75: 11096-11105
[Abstract] [Full Text] -
Lu, M., Stoller, M. O., Wang, S., Liu, J., Fagan, M. B., Nunberg, J. H.
(2001). Structural and Functional Analysis of Interhelical Interactions in the Human Immunodeficiency Virus Type 1 gp41 Envelope Glycoprotein by Alanine-Scanning Mutagenesis. J. Virol.
75: 11146-11156
[Abstract] [Full Text] -
Zhang, C. W-H., Chishti, Y., Hussey, R. E., Reinherz, E. L.
(2001). Expression, Purification, and Characterization of Recombinant HIV gp140. THE gp41 ECTODOMAIN OF HIV OR SIMIAN IMMUNODEFICIENCY VIRUS IS SUFFICIENT TO MAINTAIN THE RETROVIRAL ENVELOPE GLYCOPROTEIN AS A TRIMER. J. Biol. Chem.
276: 39577-39585
[Abstract] [Full Text] -
Korber, B., Gaschen, B., Yusim, K., Thakallapally, R., Kesmir, C., Detours, V.
(2001). Evolutionary and immunological implications of contemporary HIV-1 variation. Br Med Bull
58: 19-42
[Abstract] [Full Text] -
Maerz, A. L., Drummer, H. E., Wilson, K. A., Poumbourios, P.
(2001). Functional Analysis of the Disulfide-Bonded Loop/Chain Reversal Region of Human Immunodeficiency Virus Type 1 gp41 Reveals a Critical Role in gp120-gp41 Association. J. Virol.
75: 6635-6644
[Abstract] [Full Text] -
Moore, J. P., Parren, P. W. H. I., Burton, D. R.
(2001). Genetic Subtypes, Humoral Immunity, and Human Immunodeficiency Virus Type 1 Vaccine Development. J. Virol.
75: 5721-5729
[Full Text] -
Cormier, E. G., Tran, D. N. H., Yukhayeva, L., Olson, W. C., Dragic, T.
(2001). Mapping the Determinants of the CCR5 Amino-Terminal Sulfopeptide Interaction with Soluble Human Immunodeficiency Virus Type 1 gp120-CD4 Complexes. J. Virol.
75: 5541-5549
[Abstract] [Full Text] -
York, J., Follis, K. E., Trahey, M., Nyambi, P. N., Zolla-Pazner, S., Nunberg, J. H.
(2001). Antibody Binding and Neutralization of Primary and T-Cell Line-Adapted Isolates of Human Immunodeficiency Virus Type 1. J. Virol.
75: 2741-2752
[Abstract] [Full Text] -
Yang, X., Wyatt, R., Sodroski, J.
(2001). Improved Elicitation of Neutralizing Antibodies against Primary Human Immunodeficiency Viruses by Soluble Stabilized Envelope Glycoprotein Trimers. J. Virol.
75: 1165-1171
[Abstract] [Full Text] -
Earl, P. L., Sugiura, W., Montefiori, D. C., Broder, C. C., Lee, S. A., Wild, C., Lifson, J., Moss, B.
(2001). Immunogenicity and Protective Efficacy of Oligomeric Human Immunodeficiency Virus Type 1 gp140. J. Virol.
75: 645-653
[Abstract] [Full Text] -
Maerz, A. L., Center, R. J., Kemp, B. E., Kobe, B., Poumbourios, P.
(2000). Functional Implications of the Human T-Lymphotropic Virus Type 1 Transmembrane Glycoprotein Helical Hairpin Structure. J. Virol.
74: 6614-6621
[Abstract] [Full Text] -
D'Souza, M. P., Cairns, J. S., Plaeger, S. F.
(2000). Current Evidence and Future Directions for Targeting HIV Entry: Therapeutic and Prophylactic Strategies. JAMA
284: 215-222
[Abstract] [Full Text] -
Yang, X., Farzan, M., Wyatt, R., Sodroski, J.
(2000). Characterization of Stable, Soluble Trimers Containing Complete Ectodomains of Human Immunodeficiency Virus Type 1 Envelope Glycoproteins. J. Virol.
74: 5716-5725
[Abstract] [Full Text] -
Sanders, R. W., Schiffner, L., Master, A., Kajumo, F., Guo, Y., Dragic, T., Moore, J. P., Binley, J. M.
(2000). Variable-Loop-Deleted Variants of the Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Can Be Stabilized by an Intermolecular Disulfide Bond between the gp120 and gp41 Subunits. J. Virol.
74: 5091-5100
[Abstract] [Full Text] -
Staropoli, I., Chanel, C., Girard, M., Altmeyer, R.
(2000). Processing, Stability, and Receptor Binding Properties of Oligomeric Envelope Glycoprotein from a Primary HIV-1 Isolate. J. Biol. Chem.
275: 35137-35145
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»