Previous Article | Next Article 
Journal of Virology, October 2000, p. 9071-9077, Vol. 74, No. 19
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Influence of the Theiler's Virus L* Protein on
Macrophage Infection, Viral Persistence, and Neurovirulence
Olivier
van Eyll and
Thomas
Michiels*
Christian de Duve Institute of Cellular
Pathology, Université Catholique de Louvain, B-1200 Brussels,
Belgium
Received 16 February 2000/Accepted 5 July 2000
 |
ABSTRACT |
The genome of picornaviruses contains a large open reading frame
(ORF) translated as a precursor polypeptide that is processed to yield all the proteins necessary for the viral life cycle. In
persistent but not in neurovirulent strains of Theiler's virus, an
overlapping ORF encodes an additional 18-kDa protein called L*. We
confirmed previous work showing that the L* ORF of persistent strains
facilitates the infection of macrophage cell lines, and we present
evidence that this effect is due to the L* protein itself rather
than to competition for the translation of the two overlapping ORFs. The introduction of an AUG codon to restore the L*
ORF of the neurovirulent GDVII strain also enhanced the infection of
macrophages, in spite of the divergent evolution of this protein. The
presence or the absence of the L* AUG initiation codon had only a
weak influence on the neurovirulence of the GDVII strain and on the
persistence of the DA1 strain. The results obtained with DA1 in vivo
contrast with the results reported previously for DAFL3, another
molecular clone of the same virus strain, where the AUG-to-ACG
mutation of the L* initiation codon totally blocked viral persistence
(G. D. Ghadge, L. Ma, S. Sato, J. Kim, and R. P. Roos,
J. Virol. 72:8605-8612, 1998). Thus, a factor that is critical
for the persistence of a given clone of Theiler's virus is dispensable for the persistence of a closely related clone, indicating that different adjustments in the expression of persistence determinants occur in related viral strains.
 |
INTRODUCTION |
Theiler's murine encephalomyelitis
virus (Theiler's virus or TMEV) is a picornavirus that infects the
central nervous system (CNS) of the mouse (30). Several
Theiler's virus strains were isolated and classified into two
subgroups on the basis of the diseases that they provoke. Neurovirulent
viruses, such as GDVII or FA, cause an acute fatal encephalomyelitis.
Persistent strains, such as DA or BeAn, sometimes referred to as
Theiler's original strains, cause a persistent CNS infection and a
chronic demyelinating disease considered an experimental model for
multiple sclerosis (for a review, see references 7
and 20).
Upon intracerebral inoculation, persistent strains of Theiler's
virus cause a biphasic disease in susceptible mice: first, the virus
induces a mild encephalitis in the gray matter of the brain;
subsequently, the virus is found predominantly in the white matter of
the spinal cord, where it persists lifelong, causing inflammation and demyelination.
Macrophages appear to play an important role in the infection process.
First, Lipton and coworkers (14) showed, by two-color fluorescence staining, that macrophages contained most of the viral
load during the chronic stage of the disease. In agreement with these
data, the depletion of infiltrating macrophages in vivo almost
completely cleared the infection (23). Second, demyelination was suggested to be related to a bystander effect of activated macrophages infiltrating the lesions (4). Accordingly, upon macrophage depletion, the numbers of demyelinating lesions were drastically reduced, confirming the crucial role of macrophages in the
pathology (23). However, there has been no evidence, until
now, that macrophages are the reservoir cells that allow the virus to
escape the immune response.
The genome of Theiler's virus is an 8-kb-long RNA molecule of positive
polarity. It contains a large open reading frame (ORF) translated as a
long precursor polyprotein that undergoes autoproteolytic processing to
yield all the viral proteins required to fulfill the viral life cycle.
However, in persistent strains of Theiler's virus, an additional
protein, called L*, was found to be translated from an alternative
ORF starting 13 nucleotides (nt) downstream from the AUG codon of the
main ORF and ending just upstream of the cis-acting
replication element recently discovered in the VP2-coding region
(11, 15). The L* ORF is conserved in all the persistent
strains analyzed so far (18). In neurovirulent strains of
Theiler's virus, an ACG codon is substituted for the AUG codon
initiating the translation of the alternative ORF. The presence of the
L* ORF in the persistent strain DAFL3 was found to enhance the
infection of macrophage cell lines (21, 28) but not of other
cell types (22), possibly via the inhibition of apoptosis
(9). It is not known whether this antiapoptotic activity
results from the expression of the L* protein itself or from the
presence of the L* alternative ORF that might compete with the
translation of some proapoptotic viral factor encoded by the main ORF.
In vivo, the L* ORF has been reported to be critical for viral
persistence in the CNS of the mouse (9, 13). This effect could be correlated with the alteration of the H-2K-restricted cytotoxic T-lymphocyte response of the host (13). However,
although recent works have reported the complete lack of persistence of a DAFL3 virus clone carrying an AUG-to-ACG mutation of the L* initiation codon, previous work done with the same virus as well as
work performed with a different clone of strain DA or with persistent
strain BeAn has shown the persistence of some recombinant viruses
lacking the L* ORF: the DA/GDVII recombinants GD5'-1B/DAFL3 (8,
24) and R2 (17) and the BeAn/GDVII recombinants 3B and
41 (1).
The aim of this work was fourfold: (i) to revisit the role of the L*
ORF in viral persistence, (ii) to check whether the expression of the
L* protein itself or competition between the translation of the L*
ORF and that of the main ORF is responsible for the enhancement of
macrophage infection, (iii) to analyze whether the L* ORF of virus
GDVII is functional upon reintroduction of a translation initiation
codon, and (iv) to evaluate the influence of the lack of the L* ORF
on the neurovirulence of virus GDVII.
 |
MATERIALS AND METHODS |
Cell culture.
BHK-21 cells were cultured in Glasgow minimum
essential medium (Gibco-BRL) supplemented with 10% newborn bovine
serum (Gibco-BRL), 100 IU of penicillin per ml, 100 µg of
streptomycin per ml, and 130 g of tryptose phosphate broth
(Gibco-BRL) per liter. L929 cells were cultured in Dulbecco's modified
Eagle medium (Gibco-BRL) supplemented with 10% fetal bovine serum
(Gibco-BRL), 100 IU of penicillin per ml, 100 µg of streptomycin per
ml, and 100 mM sodium pyruvate. Raw264.7 cells were cultured in
Dulbecco's modified Eagle medium supplemented with 100 IU of
penicillin per ml, 100 µg of streptomycin per ml, 100 mM sodium
pyruvate, and 5% either Myoclone fetal calf serum (Gibco-BRL Myoclone
Super Plus-Bovine Serum; catalog no. 10081-071, batch no. 30Q7351A) or
standard fetal calf serum (Gibco-BRL; catalog no. 10270-031, batch no. 40F8550J). The use of different sera allows modulation of the activation and differentiation states of these cells as well as their
susceptibility to Theiler's virus infection (26).
Construction of mutant viruses.
Viruses mutated in the L*
region were obtained by site-directed mutagenesis by the method of
Kunkel (12). Mutations were generated on subclones carrying
the appropriate region. The restriction fragment carrying the mutation
was sequenced to ensure that no unwanted mutation occurred and was then
cloned back in a full-length cDNA clone.
The two AUG-to-ACG mutations were introduced in virus DA1 with
oligonucleotide TM97 (CAAATAGGGCACACGTCTGGGTATCCGTGTTTGCAAGCCAT). Mutagenesis was performed on pTM410, a pTZ19R (Pharmacia)
derivative containing the 5' end (nt 1 to 1729) of the DA1 genome. The
BbrPI-BsiWI fragment (nt 804 to 1265 of DA1) was
then used to replace the corresponding fragment of pTMDA1 (16,
19). The recombinant plasmid obtained, carrying the two
AUG-to-ACG mutations, was called pOV23. The virus produced from that
construct is called OV23 (Fig. 1).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
Constructs with mutated L* ORFs. The sequences of the
mutated regions in OV23, OV28, OV41, and OV42 are shown under the
corresponding segment of the parental strain. Translation of the main
ORF is shown above and translation of the L* ORF is shown below the
nucleotide sequence. Amino acids of L* are numbered. The AUG codons
of the main and L* ORFs and the codons subjected to mutagenesis are
underlined.
|
|
A stop codon at codon 39 of the L* ORF was introduced into pTM410
with oligonucleotide TM223 (GACGTCATCGTCTAGGTCCACACAAA).
The
BbrPI-
BsiWI fragment was
cloned into pTM598, a pTMDA1 derivative
carrying a mutation in the
corresponding fragment. The recombinant
DA1 virus carrying the
Trp-to-stop mutation at codon 39 of L*
was called OV41 (on plasmid
pOV41).
To introduce a stop codon at codon 93 of the L* ORF, mutagenesis of
pTM410 was performed with oligonucleotide TM224
(GAATAGAAGTTGTTTATAATGACCCCTT).
The
BsiWI-
MscI fragment (nt 1265 to 1705 of DA1)
carrying the
mutation was then used to replace the corresponding
fragment of
pTM533, a pTMDA1 derivative carrying a deletion in the same
fragment
(
19). The recombinant DA1 virus carrying the
Leu-to-stop mutation
at codon 93 of L* was called OV42 (on plasmid
pOV42).
The ACG-to-AUG mutations restoring the L* initiation codon in the
genome of virus GDVII were introduced with oligonucleotide
TM98
(ATGGCTTGCAAACATGGATACCCAGATGTGTGCCCTATTTG).
Mutagenesis
was performed on pTM427, a pTZ18R (Pharmacia)
derivative containing
the 5' end (nt 1 to 1733) of the GDVII genome.
The
BbrPI-
AocI
fragment (nt 807 to 1334 of GDVII)
was then ligated to
AocI-
SgrAI
and
SgrAI-
BbrPI fragments of pTMGDVII (
29)
derivatives to form
pOV28. This plasmid contains the full-length genome
of the GDVII
virus with the ACG-to-AUG mutations at the first and fifth
codons
of L*. The virus produced from that construct is called OV28
(Fig.
1).
Virus production.
Viruses were produced as described
previously (19) by transfection of BHK-21 cells
with genomic RNAs transcribed in vitro from plasmids carrying the
corresponding cDNAs: pTMDA1 (16, 19), pTMGDVII
(29), and pOV23, pOV28, pOV41, and pOV42 (this work).
Culture supernatants were collected after the cytopathic effect was
reached (generally between 48 and 72 h after transfection).
The
culture supernatants were frozen, thawed, and centrifuged
at
4,000 ×
g for 10 min. The supernatants were then
collected
and stored in aliquots at

70°C. Viruses were titrated by
a standard
plaque assay on BHK-21
cells.
In vitro translation.
In vitro coupled
transcription-translation was performed with rabbit reticulocyte
lysates (Promega TNT) according to the manufacturer's recommendations.
Samples were run on standard Tris-glycine-sodium dodecyl sulfate-11
or 12.5% polyacrylamide gels.
Metabolic labeling. BHK-21 cells (2 × 10
5)
grown in a 1.5-cm well were infected in serum-free medium at a
multiplicity
of infection of 10 PFU per cell. After 1 h of incubation
at 37°C,
actinomycin D was added to a final concentration of 2 µg/ml and
newborn calf serum was added to a final concentration of
2%. Ten
hours after infection, cells were washed and cultured for 1 h
in methionine-deficient minimum essential medium (Gibco-BRL) containing
1% newborn calf serum. Twenty microcuries of a
35S-labeled
methionine-cysteine mixture (Promix; Amersham-Pharmacia
Biotech) was
added to the culture. After 10 h of incubation, cells
were
collected and resuspended in sample buffer (62.5 mM Tris
[pH 6.8],
2%

-mercaptoethanol, 3% sodium dodecyl sulfate, 10%
glycerol,
0.1% bromophenol blue). Samples were then run on Tris-Tricine-sodium
dodecyl sulfate-13% polyacrylamide
gels.
Analysis of mixed viral infections.
The proportions of DA1
and OV23 viruses in a mixture were estimated by restriction analysis of
reverse transcription (RT)-PCR products. To this end, RNA was extracted
from infected cells or tissues, and a 1.1-kb fragment of the viral
genome spanning the leader region was amplified by RT-PCR using primers
TM4 and TM132 (Table 1). This fragment
was subsequently digested with enzyme AflIII, which allowed
discrimination between the wild-type and mutant genomes. Upon gel
electrophoresis, the proportions of DA1 and OV23 viruses could be
estimated by the relative intensities of bands specific for each virus.
This approach is very sensitive for detecting small differences between
two viruses, since it is independent of sample-to-sample variations and
of any technical bias related to virus quantification, RNA extraction,
cDNA synthesis, or PCR amplification.
The same procedure was applied for the GDVII-OV28, DA1-OV41, and
DA1-OV42 mixtures. The restriction enzymes used to digest
the PCR
products were
AflIII,
BfaI, and
MseI,
respectively.
Infection of mice.
Three-week-old female SJL/J mice were
inoculated intracranially in the right hemisphere with 40 µl of a
virus suspension. For histological examination, tissues from four mice
were embedded in paraffin after 4% paraformaldehyde fixation and
tissues from two mice were embedded in O.C.T. compound (Tissue-tek) for
cryosectioning. Longitudinal sections (8-µm thick) of the spinal cord
were examined. Viral antigen was detected by immunohistochemical
analysis with a polyclonal rabbit antibody directed against the viral
capsid (kindly provided by Michel Brahic) and a secondary antibody
coupled to horseradish peroxidase (Envision; Dako). Diaminobenzidine
(Sigma) was used as the chromogenic substrate. Inflammatory foci were detected after hematoxylin staining. Demyelinating lesions were detected by standard Luxol fast blue staining.
Dot blot and RT-PCR.
For dot blot or RT-PCR analysis, RNA
was prepared from cells or tissues (brain and spinal cord) using the
technique of Chomczynski and Sacchi (3). Dot blotting and
RT-PCR to detect viral RNA were performed as described previously
(27). The PCR conditions used are presented in Table 1. The
primers were as follows: TM4, 5'-TTC CCT CCA TCG CGA CGT GGT; TM87,
5'-ATG GAT GAC GAT ATC GCT GC; TM88, 5'-GCT GGA AGG TGG ACA GTG AG;
TM132, 5'-GTG CCA TAG TAG CAA AAG CA; TM213, 5'-GTT CTA TGG CCC AGA CCC
TCA CA; TM214, 5'-TCC CAG GTA TAT GGG CTC ATA CC; TM215, 5'-TCC ATC CAG
TTG CCT TCT TG; TM216, 5'-CCA GTT TGG TAG CAT CCA TC; TM217, 5'-GCA ACT GTT CCT GAA CTC A; TM218, 5'-CTC GGA GCC TGT AGT GCA G; TM221, 5'-GCA
CAT CAG ACC AGG; TM222, 5'-CAA CGT TGC ATC CTA GGA TGG; TM233, 5'-GAC
AAT CAG GCC ATC AGC AAC; AND TM234, 5'-CGC AAT CAC AGT CTT GGC TAA.
 |
RESULTS |
Construction of a DA1 mutant lacking L* and of a GDVII mutant
expressing L*.
Two AUG codons, conserved in persistent strains,
could initiate the translation of the L* ORF (Fig. 1). The first AUG
codon (at nt 1079) is in a good context for translation initiation and is likely to be the actual L* initiation codon. Indeed, a mutant virus lacking this AUG was reported to lack the expression of the L*
protein (11). However, a second AUG codon, located four codons downstream from the first one and in the same phase, might be
able to initiate low levels of L* translation when the first AUG
codon is lacking. Strikingly, in the genome of the neurovirulent GDVII
virus, the L* ORF is conserved, but both AUG codons are replaced by
ACG codons.
We used site-directed mutagenesis to replace, in DA1, the two AUG
codons with ACG codons. These mutations did not affect the
amino acid
sequence of the L protein encoded by the main ORF.
The DA1
recombinant lacking the L* AUG codons was called OV23.
We also
constructed a mutant of GDVII in which two AUG codons
were substituted
for the ACG codons in order to restore the L*
ORF. This GDVII
derivative, expressing L*, was called
OV28.
As expected, translation in reticulocyte lysates of the RNAs
transcribed from pTMDA1 and pOV28 but not from pTMGDVII and
pOV23
yielded a protein corresponding to L* (Fig.
2A). The L* protein
expressed by pOV28
migrated slightly faster than that of pTMDA1,
although the predicted
molecular masses of these proteins are
18.230 and 17.863 kDa,
respectively. The L* protein was also detected
in extracts from
BHK-21 cells infected with viruses DA1 and OV28
but not with viruses
OV23 and GDVII (Fig.
2C). The production
and plaque size of the OV23
and OV28 viruses on BHK-21 cells did
not differ from those of their
corresponding parental wild-type
viruses.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
Wild-type and mutant L* protein expression in rabbit
reticulocyte lysates and in BHK-21 cells. (A and B) Detection of the
L* protein in coupled transcription-translation reactions programmed
with the indicated plasmids. L* (black arrows) was detected when the
clones contained the AUG initiation codon (pTMDA1 and pOV28) but not
when ACG codons replaced AUG codons (pOV23 and pTMGDVII). pOV42
contains a stop codon introduced at codon 93 of L* and produced
a truncated L* protein (white arrow) of the expected molecular mass
(10.532 kDa). The truncated L* protein expressed by pOV41 was too
small (4.375 kDa) to be seen on the gel. (C) Extracts of
[35S]methionine-labeled BHK-21 cells infected for 21 h
with viruses GDVII, OV28, DA1, OV23, and OV42 or mock infected. Black
arrowheads indicate wild-type L* proteins. The white arrowhead
indicates the truncated L* protein produced by OV42.
|
|
The L* ORF of viruses DA1 and OV28 (a GDVII derivative)
facilitates macrophage infection.
In previous work done with the
DAFL3 molecular clone of strain DA, the absence of the L* ORF
dramatically reduced the level of infection of different macrophage
cell lines (21, 22, 28). To verify that this result also
applied to the DA1 clone of strain DA and to analyze whether the
restored L* ORF of the GDVII variant (OV28) could also facilitate
infection of macrophages, we compared the growth kinetics of viruses
DA1 and GDVII with those of their counterparts lacking or expressing
the L* ORF.
Cultures of BHK-21 cells (hamster fibroblasts) or Raw264.7 cells (mouse
macrophages) were infected with the DA1, OV23, GDVII,
and OV28 viruses,
and viral replication was monitored by dot blot
hybridization (Fig.
3). The data suggested a weak influence
of
the presence of the L* AUG codons. This influence was noted in
the
neurovirulent strain background but was less clear in the
DA1
background. Similar conclusions were obtained when the production
of
infectious viruses by infected macrophages was measured by
plaque assay
(data not shown). Since the effect observed in this
study appeared to
be much weaker than that reported in previous
studies for strain
DAFL3 (
21,
22), we wanted to confirm the
influence of
L* on the infection of macrophages by a more sensitive
assay.
Therefore, we used mixed infections, a strategy that turned
out to be
much more sensitive for detecting minor differences
between viruses.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Infection of macrophages and BHK-21 cells by L* mutant
and wild-type viruses. RNA was extracted from BHK-21 cells (left
panels) or Raw264.7 cells (right panels) infected for the indicated
times with 2 PFU of virus DA1, OV23, or OV42 (upper panels) or of virus
GDVII or OV28 (lower panels) per cell. The amount of viral RNA was
measured by dot blot hybridization and normalized to the amount of
-actin RNA (arbitrary units). The histograms show the means and
standard deviations of data from an experiment done in triplicate.
Similar data were obtained when the experiment was repeated.
|
|
Cultures of BHK-21 cells, L929 cells (mouse fibroblasts), or Raw264.7
cells were infected with a 1:1 mixture of DA1 and OV23
viruses or with
a 1:1 mixture of GDVII and OV28 viruses. After
one to five
passages of the viruses, the proportions of the two
viruses were
evaluated (Fig.
4A and B). In BHK-21 and
L929 cells,
the proportions of wild-type and mutant viruses remained
about
1:1, even after up to five passages. In contrast, in Raw264.7
macrophages, the proportion of virus lacking the L* ORF clearly
dropped after the first or the second passage. The same effect
was
visible when the multiplicity of infection was kept below
1 PFU per
cell to rule out, in the case of BHK-21 cells, systematic
coinfection
of cells by wild-type and mutant viruses.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 4.
Competition of wild-type and L* mutant viruses for
growth in fibroblast and macrophage cell lines. Mixtures of
wild-type and mutant viruses (1:1) were prepared and used to infect
BHK-21 cells, L929 cells (fibroblasts), or Raw264.7 (Raw) cells
(macrophages). RNA was extracted from infected cells after one to
five passages of the virus mixture. As a control, RNA was extracted
from the virus mixture before infection and from the parental virus
stocks. The L* region was then amplified by RT-PCR and digested with
a restriction enzyme diagnostic for the wild-type or mutant viruses.
(Left panels) Control analysis of the parental viruses and of the
mixtures used. (Right panels) Analysis of the virus contained in
infected cells after one to five passages (P1 to P5). The fragments
that are diagnostic of a given virus are indicated by arrows. (A)
AflIII digests of PCR fragments from DA1 and OV23
infections. The sizes of the fragments are indicated in base
pairs. (B) AflIII digests of PCR fragments from GDVII and
OV28 infections. (C) MseI digests of PCR fragments from DA1
and OV42 infections.
|
|
This experiment confirms the implication of the L* ORF in the
infection of macrophages. In addition, it shows that, in spite
of some
divergent evolution, the L* ORF of the neurovirulent virus
GDVII can
play the same role when translation initiation is restored
by the
introduction of the AUG
codon.
Competition for translation of the two overlapping ORFs or effect
of the L* protein?
Enhancement of macrophage infection has been
proposed to occur via an antiapoptotic effect of L* (9).
On one hand, this could be due to the activity of the L* protein
itself. On the other hand, it could be caused by a subtle competition
between the translation of the main ORF encoding the viral polyprotein and of the ORF encoding L*. In the latter hypothesis, the presence of
the L* ORF would decrease the translation of a proapoptotic factor
expressed by the main ORF.
To discriminate between these possibilities, we constructed two
additional L* mutants of virus DA1 by introducing a stop codon
in the
L* ORF, either at codon 39 (OV41) or at codon 93 (OV42),
without
affecting the amino acid sequence of the polyprotein translated
from
the main ORF (Fig.
1). These mutants thus retained the initiation
codons for the two ORFs but produced truncated L* proteins (Fig.
2B).
The growth of OV42 in Raw264.7 cells appeared to be significantly
restricted compared to that of the wild-type virus (Fig.
3). Moreover,
in mixed-infection experiments, the OV41 (data not shown) and
OV42
(Fig.
4C) mutant viruses were clearly affected in their ability
to
infect macrophage cell lines. Since these mutants retained
the
translation initiation codons of the two overlapping ORFs,
enhancement
of macrophage infection appears to be due to the L*
protein
itself.
Effect of L* on the neurovirulence of virus GDVII.
On the
basis of phylogenetic data, we postulated that the GDVII strain of
Theiler's virus evolved from a subset of persistent strains and
selectively lost the L* initiation codon as a way to gain
neurovirulence (18). We were thus curious to see whether the
OV28 variant expressing L* would be attenuated compared to the
parental GDVII virus. SJL/J mice were infected intracerebrally with
103 PFU of either virus. From 4 days after infection, signs
of encephalitis were prominent in most of the mice, irrespective of the
virus with which they had been inoculated. Mice were sacrificed 5 days after inoculation, and the amounts of viral RNA present in the brains
and spinal cords of individual mice were quantified by dot blot
hybridization (Fig. 5A). No difference
was observed between the amounts of viral RNA in the brains and spinal
cords of the mice inoculated with the OV28 and GDVII viruses.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 5.
Detection of GDVII and OV28 RNAs in the brains and
spinal cords of infected mice. (A) RNA was extracted from the brains
and spinal cords of mice 5 days after intracerebral inoculation of
103 PFU of GDVII (n = 7) and OV28
(n = 6) viruses. Viral RNA was detected by dot blot
hybridization and normalized to the amount of ß-actin RNA (arbitrary
units). (B) AflIII cleavage of the PCR fragment amplified
from the brains and from the spinal cords of mice infected for 5 days
with 103 PFU of a 1:1 mixture of GDVII and OV28 viruses.
Arrows indicate fragments specific for each virus.
|
|
To confirm these data, we infected 10 SJL/J mice with 10
3
PFU of a 1:1 mixture of the GDVII and OV28 viruses. At 5 days
postinoculation,
mice were sacrificed and the proportions of the two
viruses were
evaluated by RT-PCR and restriction analysis as described
for
the infection of cultured cells (Fig.
5B). In the brain, the
proportions
of the two viruses did not differ significantly. Six mice
had
more GDVII, two mice had about equal amounts of the two viruses,
and two mice had more OV28. In each mouse, the proportion of GDVII
virus was higher in the spinal cord than in the brain, suggesting
that
the wild-type virus spread somewhat faster than did the L*-expressing
virus. However, the global influence of L* on neurovirulence was
very
weak.
Effect of the L* mutation on the persistence of virus DA1.
Groups of four SJL/J mice were inoculated intracerebrally with
2.5 × 105 PFU of the DA1 and OV23 viruses. Mice were
sacrificed 5 and 45 days after inoculation, and total RNA was prepared
from brains and spinal cords. The amounts of viral RNA in these organs
were measured by dot blot hybridization. Slightly more OV23 than DA1 was detected in the brains and spinal cords 5 days after inoculation (data not shown). Forty-five days after inoculation, the amounts of the
OV23 and DA1 viruses were similar (Fig.
6A and B). This observation was very
surprising, since previous work reported a total lack of persistence of
an L* mutant of DAFL3, another molecular clone of strain DA (9,
13). Hence, we wondered whether the virus that we detected in the
CNS 45 days after inoculation might have reverted to the wild-type
genotype. From the spinal cord RNA of the mice inoculated with OV23, we
amplified, by RT-PCR, cloned, and sequenced a fragment containing the
5' end of the L* region (nt 933 to 1230). In all four mice, the two
AUG-to-ACG mutations introduced to form OV23 were still present. In
addition, no mutation appeared in the first 150 nt of the L* region
that could restore the translation of the L* ORF by introducing a
frameshift or a start codon in the sequence. Thus, the OV23 virus was
able to persist in the CNS of the mouse in spite of the absence of the
L* AUG initiation codon.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 6.
Detection of viral RNA in the brains and spinal cords 45 days after inoculation. (A) Viral RNA was detected by dot blot
hybridization in total RNA extracted from the brains and spinal cords
of mice infected for 45 days with 105 PFU of DA1 and OV23
viruses. Control mice (T ) were inoculated with a nonpersistent DA1
virus mutant. (B) Quantification of the dot blot shown in panel A after
normalization to the amount of -actin RNA (arbitrary units). (C)
AflIII cleavage of the PCR fragment amplified from the
brains and spinal cords of four mice infected for 45 days with a 1:1
mixture of DA1 and OV23 viruses. Arrowheads indicate fragments specific
for each virus.
|
|
To confirm these data, we inoculated four SJL/J mice with
10
6 PFU of a 1:1 mixture of the DA1 and OV23 viruses. At 45 days
after inoculation, the proportions of the two viruses in the
brains
and spinal cords were assayed by RT-PCR and restriction analysis
as described above (Fig.
6C). In the spinal cord of one out of
four
mice (mouse 3), the proportions of the two viruses were equivalent.
In
three mice, the amount of wild-type virus (DA1) was slightly
higher
than that of OV23. The situation was different for the
brains: three
mice had similar amounts of the DA1 and OV23 viruses,
while one mouse
had more OV23 than DA1. Since the spinal cord
contains most of the
viral load during persistence, the data suggest
that the L* mutation
had, on average, a weak negative effect on
viral persistence.
Nevertheless, in all mice studied, the mutant
virus readily persisted
in amounts close to those of the wild-type
strain.
Characterization of CNS infection by virus OV23.
Since the
OV23 mutant had a slightly impaired ability to infect macrophages in
vitro and since macrophages are thought to contain the major viral load
in vivo, we tested whether the persistence of OV23 in the CNS would
generate an inflammatory demyelinating disease resembling the one
generated by DA1. First, we used comparative RT-PCR to evaluate the
production of proinflammatory cytokines (interleukin 1
[IL-1
],
IL-6, IL-12, tumor necrosis factor alpha [TNF-
], and gamma
interferon [IFN-
]) in the spinal cords of infected mice (the same
mice as those used for dot blotting and sequencing). The amounts of the
various cytokine mRNAs were higher for DA1- and OV23-infected mice than
for control mice but did not differ clearly between mice infected by
these two viruses (Fig. 7).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 7.
Comparative RT-PCR detection of proinflammatory cytokine
mRNAs in the spinal cords of mice 45 days after inoculation of
105 PFU of DA1 and OV23 viruses. Equal amounts of spinal
cord RNA, processed in parallel, from the mice indicated in Fig. 6A
were subjected to RT-PCR to compare the levels of IL-1 , IL-6, IL-12,
TNF- , and IFN- mRNAs, and, as controls, of viral RNA and
-actin mRNA.
|
|
Six additional SJL/J mice were then inoculated with 10
5 PFU
of DA1 or OV23 for histological examination. Longitudinal sections
were
examined for the presence of persistent virus by immunohistochemical
analysis. Inflammation was detected after hematoxylin staining,
and
Luxol fast blue staining was performed to detect demyelination.
In all
six mice inoculated with OV23, viral antigen, inflammation,
and
demyelinating lesions were observed, as in DA1-infected mice
(Fig.
8).

View larger version (107K):
[in this window]
[in a new window]
|
FIG. 8.
Longitudinal sections of the paraffin-embedded spinal
cord of a mouse infected for 45 days with the OV23 L* mutant virus.
(A) Immunohistochemical analysis and hematoxylin staining. Arrows
indicate viral antigen detected by immunohistochemical analysis.
Hematoxylin staining reveals extensive meningitis and inflammation in
the white matter. (B) Luxol fast blue-hematoxylin staining. An area
with extensive demyelination (Dem.) is shown. Normal white matter
(W.M.) and gray matter (G.M.) are indicated.
|
|
 |
DISCUSSION |
This study confirms work from other laboratories showing that the
presence of the L* ORF in the genome of persistent Theiler's virus
strains enhances the infection of macrophage cell lines (21, 22,
28). Given the close proximity of the AUG codon governing
translation initiation of the two ORFs, it was tempting to speculate
that the effect of the L* ORF could be mediated by modulating
translation of the main ORF through competition for translation
initiation. However, our data suggest that the L* protein itself
plays a role, since mutant DA1 viruses in which the initiation codons
were conserved but which produced a truncated L* protein were
impaired in macrophage infection.
The sequences of the L* proteins of DA1 and GDVII vary at 31 of 156 positions (80% identity). The amino acid sequences of proteins encoded
by the main ORF in the same genome region (L, VP4, and the N terminus
of VP2) vary at only 13 of 156 positions (92% identity). This suggests
that, in addition to the loss of the AUG codon, the L* region of
GDVII has evolved divergently and could have become ineffective.
Moreover, it was suggested that the GDVII internal ribosome entry site
could be inefficient in promoting translation of the L* ORF in
specific cell types (31). We observed that, after
reintroduction of an AUG initiation codon, the L* ORF of the
neurovirulent GDVII mutant virus was detectable in BHK-21 cells. The
L* ORF of this virus enhanced the infection of macrophage cell lines,
suggesting that the L* protein of GDVII is functional in spite of its
divergent evolution. Moreover, these results indicate that the internal
ribosome entry site of strain GDVII can also promote translation of the
L* ORF in these cells.
It is noteworthy that an ACG codon was reported, in rare cases, to
serve as an initiation codon (2, 5) so that, at this point,
we cannot rule out the possibility that the wild-type GDVII virus (and
the OV23 mutant) expresses small amounts of the L* protein. This
would explain why the entire L* ORF was conserved in the genomes of
neurovirulent viruses. This notion could also explain why the
introduction of a stop codon in L* (OV42) had a more pronounced
effect than the AUG-to-ACG mutation (OV23) with regard to infection of
macrophages (Fig. 3). On the other hand, the AUG-to-ACG mutation was
the only mutation of the start codon that could preserve the amino acid
sequence of the L protein translated from the main ORF.
Phylogenetic data suggested that the neurovirulent viruses evolved from
a subset of persistent strains and lost the two potential L*
initiation codons during evolution, probably as a way to gain neurovirulence (18). However, we observed that introduction of the L* AUG codons in the GDVII virus hardly reduced
neurovirulence. It is possible that the inactivation of the AUG codons
really provides some advantage to a persistent strain to evolve toward neurovirulence but that this influence is too weak to be seen in the
context of a highly neurovirulent strain.
Unexpectedly, in the DA1 virus background, inactivation of the L* AUG
initiation codon only slightly impaired macrophage infection in vitro
and hardly decreased persistence of the virus in the CNS of the mouse.
Although the mixed-infection data showed a slight negative effect of
the L* mutation on persistence, in all mice examined 45 days after
infection, the OV23 virus readily persisted and the infection closely
resembled that of the DA1 virus for any aspect examined: amounts of
viral RNA, detection of viral antigen, inflammation, or induction of
demyelination. These results are in strong contrast to those of Ghadge
et al. (9) and Lin et al. (13), who failed to
detect any persistence of an L* mutant virus by RT-PCR and by in situ
hybridization, respectively.
A few parameters differed between the experiments. First, OV23 was
constructed by mutating the two AUG codons likely to initiate the
translation of L*, while only the first AUG codon was mutated to ACG
in the DAFL3 mutant. Second, the molecular clones of the viruses
differed, although they were derived from the same parental strain (DA)
(6). However, SJL/J mice were used for all infection experiments.
Regarding the AUG-to-ACG mutations, it is difficult to correlate the
lack of persistence of the DAFL3 L* mutant with the mutation of only
the first AUG codon, since one would have expected exactly the
opposite. Regarding the molecular clones of the DA strain, DAFL3 was
used in the laboratory of R. Roos (25), while DA1 was used
in our experiments. It is known that several point mutations differentiate the two clones. Notably, a single amino acid difference at VP2 (residue 141) was found to affect the persistence of a GDVII-DA chimeric virus (10). Since the L* ORF appears
to be critical for the persistence of DAFL3 and dispensable for the persistence of DA1, one must assume that, in DA1, other factors can
compensate for the absence of L* (or possibly for its very low level
of expression from the ACG codon).
 |
ACKNOWLEDGMENTS |
We are grateful to Jean-Paul Coutelier for providing IL-12 and
IFN-
primers; to Jean-Christophe Renauld for advice on the selection
of IL-6 primers; and to Claire Landry, Danielle Godelaine, and
Lüder Behrens for help with histology and microscopy. We thank
Michel Brahic for long-term collaboration.
O.V.E. is a fellow of the Belgian FRIA (Fonds pour la Recherche dans
l'Industrie et l'Agriculture). T.M. is a senior research associate
with the FNRS (Belgian Fund for Scientific Research). This work was
supported by convention 3.4573.94F from the FRSM, by crédit aux
chercheurs 1.5.095.00 from the FNRS, by the Charcot Foundation, and by
the Fonds de Développement Scientifique (FSR) of the University
of Louvain.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Christian de
Duve Institute of Cellular Pathology, Université Catholique de
Louvain, MIPA-VIRO 74-49, 74 ave. Hippocrate, B-1200 Brussels, Belgium. Phone: 32 2 764 74 29. Fax: 32 2 764 74 95. E-mail:
michiels{at}mipa.ucl.ac.be.
 |
REFERENCES |
| 1.
|
Adami, C.,
A. E. Pritchard,
T. Knauf,
M. Luo, and H. L. Lipton.
1998.
A determinant for central nervous system persistence localized in the capsid of Theiler's murine encephalomyelitis virus by using recombinant viruses.
J. Virol.
72:1662-1665[Abstract/Free Full Text].
|
| 2.
|
Becerra, S. P.,
J. A. Rose,
M. Hardy,
B. M. Baroudy, and C. W. Anderson.
1985.
Direct mapping of adeno-associated virus capsid proteins B and C: a possible ACG initiation codon.
Proc. Natl. Acad. Sci. USA
82:7919-7923[Abstract/Free Full Text].
|
| 3.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 4.
|
Clatch, R. J.,
H. L. Lipton, and S. D. Miller.
1986.
Characterization of Theiler's murine encephalomyelitis virus (TMEV)-specific delayed-type hypersensitivity responses in TMEV-induced demyelinating disease: correlation with clinical signs.
J. Immunol.
136:920-927[Abstract].
|
| 5.
|
Curran, J., and D. Kolakofsky.
1988.
Ribosomal initiation from an ACG codon in the Sendai virus P/C mRNA.
EMBO J.
7:245-251[Medline].
|
| 6.
|
Daniels, J. B.,
A. M. Pappenheimer, and S. Richardson.
1952.
Observations on encephalomyelitis of mice (DA strain).
J. Exp. Med.
96:517-529[Abstract].
|
| 7.
|
Drescher, K. M.,
L. R. Pease, and M. Rodriguez.
1997.
Antiviral immune responses modulate the nature of central nervous system (CNS) disease in a murine model of multiple sclerosis.
Immunol. Rev.
159:177-193[CrossRef][Medline].
|
| 8.
|
Fu, J.,
M. Rodriguez, and R. P. Roos.
1990.
Strains from both Theiler's virus subgroups encode a determinant for demyelination.
J. Virol.
64:6345-6348[Abstract/Free Full Text].
|
| 9.
|
Ghadge, G. D.,
L. Ma,
S. Sato,
J. Kim, and R. P. Roos.
1998.
A protein critical for a Theiler's virus-induced immune system-mediated demyelinating disease has a cell type-specific antiapoptotic effect and a key role in virus persistence.
J. Virol.
72:8605-8612[Abstract/Free Full Text].
|
| 10.
|
Jarousse, N.,
R. A. Grant,
J. M. Hogle,
L. Zhang,
A. Senkowski,
R. P. Roos,
T. Michiels,
M. Brahic, and A. McAllister.
1994.
A single amino acid change determines persistence of a chimeric Theiler's virus.
J. Virol.
68:3364-3368[Abstract/Free Full Text].
|
| 11.
|
Kong, W.-P., and R. P. Roos.
1991.
Alternative translation initiation site in the DA strain of Theiler's murine encephalomyelitis virus.
J. Virol.
65:3395-3399[Abstract/Free Full Text].
|
| 12.
|
Kunkel, T.
1985.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Proc. Natl. Acad. Sci. USA
82:488-492[Abstract/Free Full Text].
|
| 13.
|
Lin, X.,
R. P. Roos,
L. R. Pease,
P. Wettstein, and M. Rodriguez.
1999.
A Theiler's virus alternatively initiated protein inhibits the generation of H-2K-restricted virus-specific cytotoxicity.
J. Immunol.
162:17-24[Abstract/Free Full Text].
|
| 14.
|
Lipton, H. L.,
G. Twaddle, and M. L. Jelachich.
1995.
The predominant virus antigen burden is present in macrophages in Theiler's murine encephalomyelitis virus-induced demyelinating disease.
J. Virol.
69:2525-2533[Abstract].
|
| 15.
|
Lobert, P.-E.,
N. Escriou,
J. Ruelle, and T. Michiels.
1999.
A coding RNA sequence acts as a replication signal in cardioviruses.
Proc. Natl. Acad. Sci. USA
96:11560-11565[Abstract/Free Full Text].
|
| 16.
|
McAllister, A.,
F. Tangy,
C. Aubert, and M. Brahic.
1989.
Molecular cloning of the complete genome of Theiler's virus, strain DA, and production of infectious transcripts.
Microb. Pathog.
7:381-388[CrossRef][Medline].
|
| 17.
|
McAllister, A.,
F. Tangy,
C. Aubert, and M. Brahic.
1990.
Genetic mapping of the ability of Theiler's virus to persist and demyelinate.
J. Virol.
64:4252-4257[Abstract/Free Full Text].
|
| 18.
|
Michiels, T.,
N. Jarousse, and M. Brahic.
1995.
Analysis of the leader and capsid coding regions of persistent and neurovirulent strains of Theiler's virus.
Virology
214:550-558[CrossRef][Medline].
|
| 19.
|
Michiels, T.,
V. Dejong,
R. Rodrigus, and C. Shaw-Jackson.
1997.
Protein 2A is not required for Theiler's virus replication.
J. Virol.
71:9549-9556[Abstract].
|
| 20.
|
Monteyne, P.,
J.-F. Bureau, and M. Brahic.
1997.
The infection of mouse by Theiler's virus: from genetics to immunology.
Immunol. Rev.
159:163-176[CrossRef][Medline].
|
| 21.
|
Obuchi, M.,
Y. Ohara,
T. Takegami,
T. Murayama,
H. Takada, and H. Iizuka.
1997.
Theiler's murine encephalomyelitis virus subgroup strain-specific infection in a murine macrophage-like cell line.
J. Virol.
71:729-733[Abstract].
|
| 22.
|
Obuchi, M.,
J. Yamamoto,
M. N. Uddin,
T. Odagiri,
H. Iizuka, and Y. Ohara.
1999.
Theiler's murine encephalomyelitis virus (TMEV) subgroup strain-specific infection in neural and non-neural cell lines.
Microbiol. Immunol.
43:885-892[Medline].
|
| 23.
|
Pena Rossi, C.,
M. Delcroix,
I. Huitinga,
A. McAllister,
N. van Rooijen,
E. Claassen, and M. Brahic.
1997.
Role of macrophages during Theiler's virus infection.
J. Virol.
71:3336-3340[Abstract].
|
| 24.
|
Rodriguez, M., and R. P. Roos.
1992.
Pathogenesis of early and late disease in mice infected with Theiler's virus, using intratypic recombinant GDVII/DA viruses.
J. Virol.
66:217-225[Abstract/Free Full Text].
|
| 25.
|
Roos, R. P.,
S. Stein,
Y. Ohara,
J. Fu, and B. L. Semler.
1989.
Infectious cDNA clones of the DA strain of Theiler's murine encephalomyelitis virus.
J. Virol.
63:5492-5496[Abstract/Free Full Text].
|
| 26.
|
Shaw-Jackson, C., and T. Michiels.
1997.
Infection of macrophages by Theiler's murine encephalomyelitis virus is highly dependent on their activation or differentiation state.
J. Virol.
71:8864-8867[Abstract].
|
| 27.
|
Shaw-Jackson, C., and T. Michiels.
1999.
Absence of internal ribosome entry site-mediated tissue specificity in the translation of a bicistronic transgene.
J. Virol.
73:2729-2738[Abstract/Free Full Text].
|
| 28.
|
Takata, H.,
M. Obuchi,
J. Yamamoto,
T. Odagiri,
R. P. Roos,
H. Iizuka, and Y. Ohara.
1998.
L* protein of the DA strain of Theiler's murine encephalomyelitis virus is important for virus growth in a murine macrophage-like cell line.
J. Virol.
72:4950-4955[Abstract/Free Full Text].
|
| 29.
|
Tangy, F.,
A. McAllister, and M. Brahic.
1989.
Molecular cloning of the complete genome of strain GDVII of Theiler's virus and production of infectious transcripts.
J. Virol.
63:1101-1106[Abstract/Free Full Text].
|
| 30.
|
Theiler, M.
1937.
Spontaneous encephalomyelitis of mice, a new virus disease.
J. Exp. Med.
65:705-719[Abstract].
|
| 31.
|
Yamasaki, K.,
C. C. Weihl, and R. P. Roos.
1999.
Alternative translation initiation of Theiler's murine encephalomyelitis virus.
J. Virol.
73:8519-8526[Abstract/Free Full Text].
|
Journal of Virology, October 2000, p. 9071-9077, Vol. 74, No. 19
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Taniura, N., Saito, M., Okuwa, T., Saito, K., Ohara, Y.
(2009). Different Subcellular Localization of Theiler's Murine Encephalomyelitis Virus Leader Proteins of GDVII and DA Strains in BHK-21 Cells. J. Virol.
83: 6624-6630
[Abstract]
[Full Text]
-
Blinkova, O., Kapoor, A., Victoria, J., Jones, M., Wolfe, N., Naeem, A., Shaukat, S., Sharif, S., Alam, M. M., Angez, M., Zaidi, S., Delwart, E. L.
(2009). Cardioviruses Are Genetically Diverse and Cause Common Enteric Infections in South Asian Children. J. Virol.
83: 4631-4641
[Abstract]
[Full Text]
-
Asakura, K., Murayama, H., Himeda, T., Ohara, Y.
(2007). Expression of L* protein of Theiler's murine encephalomyelitis virus in the chronic phase of infection. J. Gen. Virol.
88: 2268-2274
[Abstract]
[Full Text]
-
Paul, S., Michiels, T.
(2006). Cardiovirus leader proteins are functionally interchangeable and have evolved to adapt to virus replication fitness.. J. Gen. Virol.
87: 1237-1246
[Abstract]
[Full Text]
-
Baril, M., Brakier-Gingras, L.
(2005). Translation of the F protein of hepatitis C virus is initiated at a non-AUG codon in a +1 reading frame relative to the polyprotein. Nucleic Acids Res
33: 1474-1486
[Abstract]
[Full Text]
-
Oleszak, E. L., Chang, J. R., Friedman, H., Katsetos, C. D., Platsoucas, C. D.
(2004). Theiler's Virus Infection: a Model for Multiple Sclerosis. Clin. Microbiol. Rev.
17: 174-207
[Abstract]
[Full Text]
-
Asakura, K., Murayama, H., Himeda, T., Ohara, Y.
(2002). Epitope-Tagged L* Protein of Theiler's Murine Encephalomyelitis Virus Is Expressed in the Central Nervous System in the Acute Phase of Infection. J. Virol.
76: 13049-13054
[Abstract]
[Full Text]
-
van Eyll, O., Michiels, T.
(2002). Non-AUG-Initiated Internal Translation of the L* Protein of Theiler's Virus and Importance of This Protein for Viral Persistence. J. Virol.
76: 10665-10673
[Abstract]
[Full Text]
-
van Pesch, V., van Eyll, O., Michiels, T.
(2001). The Leader Protein of Theiler's Virus Inhibits Immediate-Early Alpha/Beta Interferon Production. J. Virol.
75: 7811-7817
[Abstract]
[Full Text]