INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

In the early stages of positive-strand RNA virus infection, the viral genomic RNA is translated to yield the virus-encoded RNA replication proteins, which include an RNA-dependent RNA polymerase and commonly several additional factors. These act to recruit the viral RNA from translation to the replication complex, where it is used as a template for the synthesis of complementary negative strands. The negative strands, in turn, are utilized as templates for the production of progeny positive strands, which include new genomic positive-strand RNAs and, for several virus groups, additional subgenomic mRNAs.

Brome mosaic virus (BMV) is a representative member of the large alphavirus-like superfamily of positive-strand RNA viruses. All members of the alphavirus-like superfamily contain three homologous domains in their encoded replication proteins, which implies that these viruses share common mechanisms of RNA replication. The conserved domains are differently organized in different family members, and several subfamilies encode additional replication factors. The three conserved domains are a unique RNA capping enzyme domain, a superfamily I helicase-like domain, and a polymerase-related domain (30). Within the alphavirus-like superfamily, RNA-dependent RNA polymerase activity has been demonstrated for the bamboo mosaic potexvirus polymerase domain, expressed in Escherichia coli (35). Recombinant Semliki Forest virus (an alphavirus) nsP2 has both RNA helicase and nucleotide triphosphatase (NTPase) activities (15, 47), and rubella virus (19) and turnip yellow mosaic tymovirus (28) helicase-like domains possess NTPase activity. Capping-related activities, namely, methyltransferase and covalent binding of methylated guanylate, have been demonstrated for proteins encoded by alphaviruses (4, 32, 48), tobacco mosaic virus (36), and BMV (3, 29). The RNA-dependent RNA polymerase activity is presumably required for all steps of replication involving RNA synthesis, but what are the roles of the other enzymatic activities? Is the helicase or NTPase activity required for negative-strand or positive-strand synthesis, for both, or for some additional steps in the replication cycle? Is the capping enzyme active only in capping positive-strand genomic and subgenomic RNAs and not involved in negative-strand synthesis, as the negative-strand RNAs are not capped (37, 52)?

The BMV genome consists of three positive-sense RNA molecules. RNA1 encodes the 1a protein, which contains the capping enzyme and helicase-like domains, whereas RNA2 encodes the polymerase-like 2a protein. Both 1a and 2a are required for BMV RNA replication. The dicistronic RNA3 encodes the 3a protein required for cell-to-cell movement within infected plants, and the virus coat protein, which is translated from a subgenomic mRNA (RNA4) representing the 3' end of RNA3 (reviewed in references 1 and 11). BMV proteins 1a and 2a are capable of catalyzing efficient replication and subgenomic mRNA transcription of BMV RNA3 in the yeast Saccharomyces cerevisiae (27). RNA3 can be introduced to the yeast cells either by RNA transfection or by RNA polymerase II-mediated transcription from a suitable DNA plasmid (24, 27). BMV RNA replication takes place in membrane-associated replication complexes located on the endoplasmic reticulum of both plant and yeast cells (44, 45). The yeast system can be used to study both host and viral functions involved in BMV RNA replication, and it has been shown that multiple yeast genes affect BMV replication (12, 23).

1a- and 2a-mediated RNA3 replication and subgenomic mRNA synthesis in yeast are specific for BMV RNAs and utilize previously characterized cis-acting RNA synthesis signals present in the 5', 3', and intergenic regions of RNA3 (27, 43, 49). Specifically, conserved tRNA-like 3' end sequences and an intergenic replication enhancer (RE) are required for efficient synthesis of negative strands, the 5' end sequence is required for positive-strand synthesis, and the subgenomic promoter, located in the intergenic region and partially overlapping the RE, is required for subgenomic mRNA synthesis. Genetic exchanges show that 1a and the RE regulate the selection of RNA3 templates for replication (41, 50). The 1a protein can dramatically stabilize RNA3 in yeast, in the absence of 2a protein and RNA replication (26). 1a-mediated RNA3 stabilization depends on the same RE sequences that are required for approximately 100-fold enhancement of negative-strand synthesis both in plant cells and in yeast (14, 43, 49). The 1a-stabilized RNA3 is also poorly translated in yeast (26). These combined results imply that 1a-mediated RNA3 stabilization represents an intermediate involved in RNA3 recruitment from translation to RNA replication.

As one step toward understanding the functions involved in various stages of positive-strand RNA virus replication, we have constructed defined point mutations at the predicted active sites of BMV 1a protein, designed to destroy individual activities. Unexpectedly, mutations at both the helicase and capping enzyme active sites of BMV 1a caused pronounced defects in the early step of 1a-mediated RNA3 stabilization or template recruitment for RNA replication. Additionally, the helicase domain was implicated in the synthesis of negative-strand RNA, and direct evidence for the importance of the viral mRNA capping function was obtained.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Yeast methods. Yeast strain YPH500 (MAT ura3-52 lys2-801 ade2-101 trp1-63 his3-200 leu2-1) was used in most experiments. Where indicated, its derivative YMI04, which contains chromosomally integrated derivatives of BMV RNA3 with URA3 and -glucuronidase (GUS) open reading frames replacing the coat protein gene (23), was used. In other specified experiments, a YPH500 derivative with deletion of the XRN1 gene was used (33). Yeast cultures were grown at 30°C in defined synthetic medium containing 2% galactose or 2% glucose as a carbon source (7). Histidine, leucine, tryptophan, uracil, or combinations thereof were omitted to maintain plasmid selection. Yeast cells were transformed by the lithium acetate-polyethylene glycol method (25).

Plasmids and plasmid construction. BMV 1a and 2a expression plasmids pB1CT19 and pB2CT15 have been described previously (27). They are 2µm plasmids containing the BMV 1a and 2a open reading frames flanked by constitutive ADH1 promoter and ADH1 polyadenylation sequences and containing HIS3 and LEU2 selectable markers, respectively. GAL1 promoter-driven centromeric 1a expression vectors pB1YT3 and pB1YT3H with URA3 and HIS3 selectable markers and 2a expression vector pB2YT5 with LEU2 selectable marker (Y. Tomita, M. Ishikawa, and M. Janda, unpublished data) were used to increase the levels of 1a and 2a expression in some experiments. Wild-type (wt) RNA3 expression was achieved using centromeric TRP1 marker-containing plasmid pB3RQ39 (24), in which RNA3 is flanked by GAL1 promoter and self-cleaving hepatitis delta ribozyme sequences. In assays of full RNA replication, an RNA3 derivative from which coat protein expression was abolished was transcribed from plasmid pB3MS82 (M. Sullivan, unpublished data). This plasmid contains a four-nucleotide insertion immediately following the coat protein gene initiation codon and an additional point mutation that changes a second in-frame AUG in the transcript to AUC, the same changes as described for pB3MS89 (49) but in the context of full-length RNA3. The use of pB3MS82 avoids any possible effects due to coat protein expression and RNA encapsidation. To study negative-strand synthesis in the absence of concomitant positive-strand synthesis, an RNA3 derivative lacking the 5'-end RNA replication signals was derived from plasmid pB3MS114 (Sullivan, unpublished). This construct removes 86 of the 91 nucleotides in the 5' noncoding region of RNA3 (leaving the 5 nucleotides proximal to AUG) and replaces them with 38 nucleotides derived from the 5' end of the yeast GAL1 message.

RNA analysis. Yeast cultures derived from single colonies of transformants on selective plates containing glucose were grown in selective liquid medium containing galactose and harvested in mid-logarithmic phase (optical density at 600 nm, 0.5 to 0.6). Total yeast RNA was isolated by extraction with hot acidic phenol, and concentrated by ethanol precipitation, as described elsewhere (34); 5-µg aliquots of total RNA were analyzed by formaldehyde-agarose gel electrophoresis as described elsewhere (39), followed by blotting onto Nytran nylon membranes (Schleicher & Schuell). Specific ³²P-labeled hybridization probes were generated by transcription from plasmid restriction fragment templates with a Strip-EZ kit (Ambion). The probe used to detect BMV positive-strand RNAs was derived from fragment HindIII-EcoRI at the conserved 3' end of RNA3, and the probe used to detect negative-strand RNA was derived from fragment SalI-XbaI in the coat protein coding region. Radioactive signals were detected and measured with a Molecular Dynamics PhosphorImager model 425 imaging system. All RNA analysis experiments were done with at least three independent yeast transformants, which gave reproducible results.

Primer extension. Oligonucleotide d(GCGGTCCAACGATTTCTGCG), complementary to nucleotides 64 to 83 of BMV subgenomic RNA4, was labeled with [-³²P]ATP and T4 polynucleotide kinase; 10⁶ cpm of labeled primer was annealed with 5 µg of yeast RNA, with 20 ng of BMV virion RNA, or with 10 ng of an in vitro-transcribed BMV RNA4 derivative, which was obtained by using a Megascript T7 kit (Ambion) with a PCR product containing RNA4 nucleotides 1 to 520 fused to T7 promoter as a template. The primer was extended in a 30-µl final volume containing 20 mM Tris-HCl (pH 8.3), 2.5 mM MgCl₂, 7 mM dithiothreitol, 0.25 mM dATP, dGTP, dCTP, and dTTP, and 10 U of avian myeloblastosis virus reverse transcriptase (Promega) for 5 min at 42°C. Nucleic acids were precipitated with ethanol and analyzed in 6% polyacrylamide-urea gels. DNA sequencing ladder was generated with the same oligonucleotide with plasmid pB3MS82 as a template, using a Sequitherm cycle sequencing kit (Epicentre Technologies).

Other methods. Preparation of total yeast membranes by flotation and assays for the methyltransferase and covalent guanylate binding activities of 1a have been recently described (3). For Western blotting, proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were transferred to a polyvinylidene fluoride membrane (Immobilon P; Millipore). After blocking with 5% nonfat dry milk and treatment with polyclonal rabbit anti-1a antiserum (1:6,000) (44), detection was performed with an Immun-Star kit (Bio-Rad) and Lumi-Imager luminescence imager (Boehringer Mannheim). GUS activity was measured with the chemiluminescence-based assay GUS-Light (Tropix Inc., Bedford, Mass.) according to the manufacturer's instructions.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

BMV 1a mutants. Our aim was to construct defined single-point mutations in BMV 1a that would abolish either the capping-related functions or the putative helicase/NTPase activities of BMV 1a protein. The effects of the capping domain mutations H80A, D106A, and R136A (Fig. 1A) on the enzymatic activities of 1a have been previously described (3). All three mutations reduced both the guanine-7-methyltransferase and covalent guanylate binding activities to very low or undetectable levels. The most significant activity remaining was the ability of mutant H80A to methylate GTP at 3% of the wt level. However, as this derivative was completely prevented from forming the covalent guanylate complex, a presumed intermediate in mRNA capping, it should also be blocked in the RNA capping reaction. Possible roles for these residues in enzymatic activities have been discussed previously (3, 5), and the homologous residues of Sindbis virus nsP1 are essential for virus replication (51). We included a further mutant, L52P (Fig. 1A), located at the N-terminal end of the capping domain, in our analysis. This mutant may be more disruptive of the structure of BMV 1a, as it introduces a rigid proline residue into the sequence, whereas the other mutations are mainly alanine substitutions, which are generally presumed not to alter the overall structure of mutated proteins. The enzymatic activities of L52P were compared with those of wt BMV 1a: L52P had no detectable activity in covalently binding guanylate or in methyltransferase assays with GTP as the methyl acceptor substrate (Fig. 1B). Thus, mutation L52P also disrupts the enzymatic activities of 1a involved in RNA capping.

View larger version (35K): [in this window] [in a new window]   FIG. 1.   (A) Schematic of BMV 1a protein. The capping domain, the seven conserved helicase motifs, and the proline-rich linker sequence (PPP) separating the capping enzyme and helicase-like domains are indicated. The subregion of the capping enzyme domain showing similarity with methyltransferases (5) is shaded. The mutations studied in this work are marked by arrows at the top. (B) Enzymatic activity of BMV 1a mutant L52P. Extracts of yeast transformants expressing wt 1a or mutant L52P were assayed in the presence of S-adenosylmethionine and [-32P]GTP for covalent binding of methylated guanylate (3) (left). The reaction mixtures were analyzed by SDS-PAGE and autoradiography to visualize covalently radiolabeled proteins. Positions of molecular weight markers, in kilodaltons, are shown on the left. The arrow indicates the position of full-length 1a. The smaller labeled proteins are proteolytic fragments of 1a, commonly observed in these preparations (3). The same extracts were assayed for guanine-7-methyltransferase activity (3) (right). The bars show averages and standard deviations of an experiment performed in quadruplicate. (C) Schematic of the replication of BMV RNA3 derivatives in yeast. RNA3(+), originally derived from DNA template by RNA polymerase II-mediated transcription and ribozyme cleavage, gives rise to complementary negative strands, which can be used as templates for production of progeny positive strands or for transcription of subgenomic RNA4. The open reading frame (marked X) within RNA4 can be translated only after the steps previously described. In wt RNA3, the open reading frame encodes BMV coat protein, but it can be replaced by reporter genes, such as URA3 or GUS. Methylated cap structures at the 5' end, tRNA-like structures at the 3' end, and the intergenic RE are indicated. (D) RNA3 replication-dependent growth of yeast expressing wt BMV 1a or its derivatives. Yeast strain YMI04, which has an inactivating mutation in its chromosomal URA3 gene but contains BMV RNA3 derivatives B3URA3 and B3GUS integrated in the chromosome, was transformed with plasmids expressing BMV 2a and BMV 1a or its mutated derivatives or with a plasmid lacking the 1a open reading frame (1a) as indicated. Individual transformants were streaked on a plate containing galactose as a carbon source (to induce RNA3 derivative expression), lacking histidine and leucine (to select for 1a and 2a plasmids), and lacking uracil. These yeast cells show sustained growth on this medium only if they are capable of BMV RNA replication, RNA4 transcription, and translation of the reporter gene URA3 from RNA4.

Effects of 1a mutations on RNA3 replication in yeast. When BMV 1a and 2a proteins are expressed in yeast together with BMV RNA3, they catalyze RNA3 replication and subgenomic RNA4 synthesis, which also leads to the expression of any open reading frame appropriately inserted on RNA4 (X in Fig. 1C). Such an open reading frame cannot be translated directly from RNA3 since it is downstream of the 3a gene (24, 27). Thus, translation products of RNA4 are indicative of RNA3 negative-strand production and subgenomic RNA4 synthesis. As a first step in studying the functionality of mutated 1a derivatives, we transformed the relevant plasmids together with a wt 2a-expressing plasmid into a yeast strain with chromosomally integrated cDNA expression cassettes for RNA3 derivatives with the coat protein gene replaced by the URA3 or GUS gene as a reporter (23) (Fig. 1C). In the presence of wt 1a and 2a, this yeast strain can efficiently grow on plates lacking uracil, as the URA3 protein necessary for uracil biosynthesis is translated following BMV replication (Fig. 1D). However, none of the yeast strains containing mutated 1a derivatives was able to grow on plates lacking uracil, and they closely resembled the yeast strain lacking 1a (Fig. 1D). Also, the reporter strain containing wt 1a expressed high levels of GUS activity (300,000 arbitrary units), whereas no activity (<1,500 units; similar to strains without 1a expression) was detected in extracts of strains containing any of the mutated derivatives of 1a. Thus, all of the 1a mutants constructed appeared to be grossly defective at some stage of BMV RNA3 replication, subgenomic mRNA synthesis, or both.

View larger version (59K): [in this window] [in a new window]   FIG. 2.   RNA3 replication and negative-strand synthesis in yeast expressing BMV 1a or its mutated derivatives together with 2a. (A) Total RNA and protein were isolated from yeast expressing RNA3, 2a, and the 1a derivatives indicated at the top. Aliquots were analyzed by Western blotting for 1a expression (uppermost panel) and by Northern blotting using specific RNA probes to detect RNA3 positive strands or negative strands as indicated on the left. (B) Total RNA was isolated from yeast expressing an RNA3 derivative with substitution of GAL1 leader sequence for the wt 5' noncoding sequence, together with 2a and the indicated 1a derivatives. Aliquots were analyzed by Northern blotting to detect RNA3 negative strands.

Effects of 1a mutations on 1a-mediated RNA3 stabilization. 1a alone, in the absence of 2a and RNA replication, can mediate dramatic stabilization of RNA3 in yeast. As described in the introduction, multiple results link this stabilization to the ability of 1a to recruit RNA3 from translation to replication. Therefore, this step would precede negative-strand RNA synthesis, which additionally requires the polymerase-like 2a protein. In our experiments, as in previous studies with 1a expressed from the ADH1 promoter (26), wt 1a caused RNA3 to accumulate to concentrations 8- to 10-fold higher than those observed in the absence of 1a expression (Fig. 3, lanes 1 and 2). The helicase domain mutants K691A, D755A, and G781S were defective in 1a-mediated RNA3 stabilization (lanes 7 to 9), showing no significant increase in RNA3 accumulation over the minus-1a control (lane 1). Surprisingly, the capping domain mutants divided into two groups. Mutants L52P and H80A displayed increased RNA3 stabilization approximately twofold higher than the wt 1a level (lanes 2 to 4), whereas mutants D106A and R136A showed very little if any increase in RNA3 accumulation over the minus-1a control (lanes 5 and 6), resembling the helicase mutants in this respect. Thus, the earliest observed defect for D106A and R136A capping domain mutants and for all helicase domain mutants was at the level of 1a-mediated RNA3 stabilization. Mutants L52P and H80A, despite showing increased RNA3 stabilization, were defective in negative-strand RNA synthesis.

View larger version (20K): [in this window] [in a new window]   FIG. 3.   RNA3 accumulation in yeast expressing BMV 1a or its mutated derivatives in the absence of 2a. Total RNA was isolated from yeast expressing RNA3 and the 1a derivatives indicated at the top. Aliquots were analyzed by Northern blotting to detect RNA3 positive strands.

Deletion of XRN1 suppresses a subset of 1a capping mutants. The yeast chromosomal gene XRN1 encodes a 5'-3' exoribonuclease specific for uncapped RNAs, which is centrally involved in the major pathway of mRNA degradation (22, 38). Specifically, shortening of the poly(A) tail of mRNA triggers decapping, which is followed by XRN1 nuclease-catalyzed degradation of the message body. Thus, in yeast strains devoid of XRN1, mRNAs lacking a cap structure are stabilized. Since in wt yeast uncapped viral RNA products will not accumulate, and failure to cap RNAs would appear similar to a failure to synthesize them, we used a xrn1 yeast strain to discern more directly the contribution of RNA capping defects to the poor RNA3 and RNA4 accumulation catalyzed by BMV 1a capping enzyme mutants. A subset of mutants was analyzed for RNA3 replication in xrn1 yeast compared with wt yeast (Fig. 4). The three 1a derivatives containing mutations at the capping enzyme active site residues were included in this analysis. Only one helicase domain mutant was included, since the three helicase mutants had shown similar phenotypes in earlier experiments. In the absence of 1a, DNA-derived RNA3 transcripts accumulated to approximately 12-fold-higher concentrations in xrn1 than in wt yeast (lanes 1 and 7). The increased accumulation presumably reflects an increase in the half-life of RNA3 due to accumulation of decapped RNA molecules, suggesting that the XRN1 pathway plays a role in RNA3 degradation in wt yeast cells. In the presence of wt 1a and 2a, under conditions of complete RNA3 replication, RNA3 accumulated twofold more in xrn1 than wt yeast (lanes 2 and 8). As the half-life of RNA3 in the presence of 1a is already very long in wt cells (26), XRN1 deletion has a proportionally much smaller effect in this situation. Subgenomic RNA4 accumulation was increased in xrn1 yeast to an even greater extent, four- to sixfold, than RNA3. In contrast, negative-strand RNA3 accumulation was twofold lower in xrn1 than in wt yeast, showing that under these conditions the elevated level of positive-strand RNA3 does not necessarily lead to increased negative-strand synthesis.

View larger version (68K): [in this window] [in a new window]   FIG. 4.   RNA3 replication in wt yeast and xrn1 yeast expressing BMV 1a or its mutated derivatives together with 2a. Total RNA was isolated, and aliquots were analyzed by Northern blotting to detect RNA3 positive or negative strands as indicated on the left.

View larger version (33K): [in this window] [in a new window]   FIG. 5.   Primer extension analysis of the 5' ends of BMV subgenomic RNA4 species. In vitro-transcribed RNA4, virion RNA, or total RNA from yeast (wt or xrn1 strain) containing the indicated 1a derivatives together with wt 2a was annealed with an oligonucleotide complementary to RNA4 bases 64 to 83. The primer was extended as described in Materials and Methods. Nucleotide position relative to the wt RNA4 cDNA sequence is shown on the left, and nucleotide position relative to the RNA4 derivative produced in yeast cells is shown on the right. The RNA4 produced in yeast in these experiments is four nucleotides longer than wt RNA4, due to an engineered insertion disrupting the coat protein open reading frame (see Materials and Methods).

Combined 1a mutations within the same protein. Combining mutations may provide insight into the order or manner in which multiple functions are organized in a pathway. We combined mutation H80A, which showed greater than wt stabilization of RNA3 and retained partial functionality in negative-strand synthesis, with capping domain mutation R136A or with helicase mutation K691A, both of which on their own showed only minimal function (Fig. 2 and 3). The double mutants were compared with their parents with respect to both 1a-mediated RNA3 stabilization and full RNA3 replication (Fig. 6). In mutant combination H80A-K691, the nonfunctionality of mutant K691 was dominant, and this combination was completely defective in RNA3 stabilization and in negative-strand RNA3 synthesis (lane 5). Thus, the distinct function provided by the helicase-like domain is absolutely required also in this double-mutant context. The mutant combination H80A-R136A gave more complex results, showing phenotypes intermediate between its parents (lane 4). 1a bearing mutations H80A and R136A mediated an approximately 4-fold increase in RNA3 accumulation in the absence of 2a, less than H80A (18-fold) or wt 1a (8- to 10-fold) but clearly more than the nonfunctional single mutant R136A. During full replication, negative-strand synthesis of H80A-R136 was very close to that of H80A, a severalfold increase over R136A. Overall levels of positive-strand RNA3 and subgenomic RNA4 were intermediate between H80A and R136A. Thus, in the H80A-R136 combination, mutation H80A partially suppresses R136A, leading to increased function.

View larger version (53K): [in this window] [in a new window]   FIG. 6.   Effects of combining mutations within BMV 1a on RNA3 replication. Total RNA was isolated from yeast expressing RNA3 and the 1a derivatives indicated at the top. BMV 2a was either present (the two lower panels) or absent (uppermost panel), as indicated. Aliquots were analyzed by Northern blotting to detect RNA3 positive or negative strands, as indicated on the left.

Expression of two 1a alleles. To study possible complementation or other types of genetic interaction between 1a mutants, we expressed two 1a derivatives simultaneously in yeast cells, using plasmids containing HIS3 and URA3 selectable markers. In a first series of experiments, we used plasmids similar to those used in all previous experiments, containing 1a derivatives expressed from the ADH1 promoter. Under these conditions, RNA3 replication was responsive to the gene dosage of 1a: two wt 1a-encoding plasmids caused a twofold increase in replication, as assessed by negative-strand RNA3 accumulation (Fig. 7A, lanes 1 to 3). Expression of wt 1a together with nonfunctional variants, either capping domain mutant D106A or helicase mutant K691A, gave wt levels of negative-strand RNA synthesis (lanes 4 to 7). When the two mutants were expressed together, RNA3 negative-strand synthesis was very low (lanes 8 and 9), similar to that of mutant D106A on its own (Fig. 2A, lane 5). Thus, there was no indication of intragenic complementation between these two helicase and capping domain mutants.

View larger version (53K): [in this window] [in a new window]   FIG. 7.   RNA3 replication in yeast expressing two BMV 1a derivatives together with 2a. Total RNA was isolated from yeast, and aliquots were analyzed by Northern blotting to detect RNA3 negative or positive strands as indicated on the left. (A) 1a derivatives were expressed from the ADH1 promoter. Above each lane, the derivative expressed from a HIS3 marker-containing plasmid is given first, followed by the derivative expressed from a URA3 marker-containing plasmid. "Empty" indicates that no 1a open reading frame was present on the plasmid. (B) The same 1a derivatives as in panel A were expressed from the GAL1 promoter.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Functions of the 1a helicase-like domain. We have constructed point mutations at the capping enzyme and helicase active sites of BMV protein 1a (Fig. 1A), in order to discern some aspects of the contribution of these activities to different stages of RNA replication. All three mutations constructed in the conserved residues of BMV 1a helicase motifs gave rise to indistinguishable phenotypes: no synthesis of negative-strand RNA was detected (Fig. 2). Furthermore, 1a-mediated stabilization of RNA3 derivatives, which reflects recruitment of RNA3 to the replication complex, was also abolished (Fig. 3). Thus, the presumed helicase/NTPase activity may function at or near the earliest steps of BMV RNA replication. It is possible to envision multiple ways in which a helicase/NTPase activity might facilitate RNA recruitment from translation to replication. It might be involved in RNA recognition or in modifying RNA structure to facilitate other recognition events. It might be involved in inhibiting translation or in mediating some kind of RNA transport process, which may be needed in formation of the replication complexes on the endoplasmic reticulum membrane. New assay systems need to be devised to distinguish between these and other possibilities.

Functions of the 1a capping enzyme domain. Our results indicate that the BMV 1a capping domain mutants previously shown to be defective in guanylate methylation and binding in vitro (3) were also defective in capping subgenomic RNA4 in vivo, as confirmed by primer extension (Fig. 5). As predicted, deletion of the yeast chromosomal gene XRN1, encoding the cap-sensitive 5'-3' RNA exonuclease, was able to partially suppress the effects BMV 1a capping mutations D106A and R136A. In wt yeast with D106A or R136A, the level of RNA4 is extremely low, often undetectable (Fig. 2A and 4), whereas in xrn1 yeast these two mutants accumulated large amounts of uncapped RNA4 (Fig. 4 and 5). These results show that mRNA capping is normally an essential function for a positive-strand RNA virus utilizing capped RNAs and that BMV defective in RNA capping can replicate only in a suitably altered host genetic background. It is notable that mutant H80A, which is also defective in capping RNA4 (Fig. 5), was suppressed to a much lower level than D106A or R136A in xrn1 yeast (Fig. 4). This implies that H80 is also defective in steps other than RNA capping, as discussed below.