Previous Article | Next Article 
Journal of Virology, October 2000, p. 8793-8802, Vol. 74, No. 19
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
RNase L-Independent Specific 28S rRNA Cleavage in
Murine Coronavirus-Infected Cells
Sangeeta
Banerjee,1,2
Sungwhan
An,2,
Aimin
Zhou,3
Robert H.
Silverman,3 and
Shinji
Makino1,2,*
Department of Microbiology and Immunology,
The University of Texas Medical Branch at Galveston, Galveston, Texas
77555-10191; Department of Microbiology
and Institute for Cellular and Molecular Biology, The University of
Texas at Austin, Austin, Texas 78712-10952; and
Department of Cancer Biology, Lerner Research Institute,
The Cleveland Clinic Foundation, Cleveland, Ohio
441953
Received 13 March 2000/Accepted 29 June 2000
 |
ABSTRACT |
We characterized a novel 28S rRNA cleavage in cells infected with
the murine coronavirus mouse hepatitis virus (MHV). The 28S rRNA
cleavage occurred as early as 4 h postinfection (p.i.) in
MHV-infected DBT cells, with the appearance of subsequent cleavage products and a decrease in the amount of intact 28S rRNA with increasing times of infection; almost all of the intact 28S rRNA disappeared by 24 h p.i. In contrast, no specific 18S rRNA
cleavage was detected in infected cells. MHV-induced 28S rRNA cleavage was detected in all MHV-susceptible cell lines and all MHV strains tested. MHV replication was required for the 28S rRNA cleavage, and
mature cytoplasmic 28S rRNA underwent cleavage. In certain combination
of cells and viruses, pretreatment of virus-infected cells with
interferon activates a cellular endoribonuclease, RNase L, that causes
rRNA degradation. No interferon was detected in the inoculum used for
MHV infection. Addition of anti-interferon antibody to MHV-infected
cells did not inhibit 28S rRNA cleavage. Furthermore, 28S rRNA cleavage
occurred in an MHV-infected mouse embryonic fibroblast cell line
derived from RNase L knockout mice. Thus, MHV-induced 28S rRNA cleavage
was independent of the activation of RNase L. MHV-induced 28S rRNA
cleavage was also different from apoptosis-related rRNA degradation,
which usually occurs concomitantly with DNA fragmentation. In
MHV-infected 17Cl-1 cells, 28S rRNA cleavage preceded DNA fragmentation
by at least 18 h. Blockage of apoptosis in MHV-infected 17Cl-1
cells by treatment with a caspase inhibitor did not block 28S rRNA
cleavage. Furthermore, MHV-induced 28S rRNA cleavage occurred in
MHV-infected DBT cells that do not show apoptotic signs, including
activation of caspase-3 and DNA fragmentation. Thus, MHV-induced 28S
rRNA cleavage appeared to differ from any rRNA degradation mechanism
described previously.
 |
INTRODUCTION |
Coronaviruses are enveloped RNA
viruses that cause gastrointestinal and upper respiratory tract
illnesses in animals and humans. These range, in severity, from very
serious neonatal enteritis in domestic animals to the common cold in
humans. Although coronavirus infections are usually acute, some
coronaviruses cause persistent neurotropic infections in animals
(2, 38, 53). Among the coronaviruses, mouse hepatitis virus
(MHV) is one of the best characterized in terms of pathogenesis and
molecular biology. MHV causes various diseases, including hepatitis,
enteritis, and encephalitis in rodents (6, 53). MHV contains
a 32-kb-long, positive-sense, single-stranded RNA genome (27, 29,
36) that encodes 11 open reading frames, which are expressed
through the production of a genomic-size mRNA and six to eight species of subgenomic mRNAs (26, 30). The identical leader sequence, about 70 nucleotides long, present at the 5' ends of all MHV mRNAs and
each MHV-specific protein, is translated from each subgenomic mRNA.
Genomic-size mRNA encodes the most 5' gene, the 22-kb-long gene 1, which encodes the RNA polymerase function (29). Expression of gene 1 and N protein, which is encoded by the smallest mRNA, mRNA 7, is sufficient for MHV RNA synthesis (24). MHV contains three
envelope proteins, S, M, and E. S protein binds to the coronavirus receptor (7) and forms the characteristic coronavirus
peplomer. M protein and E protein play an important role in the
formation of MHV envelope (4, 23, 52). MHV genomic RNA is
associated with N protein, forming a helical nucleocapsid
(47).
Extensive morphological, physiological, and biochemical changes occur
in coronavirus-infected cells. Some of these changes contribute to the
damage of cells and tissues. Progress in molecular biological and
biochemical techniques has advanced our knowledge of the intracellular
biochemical events of coronavirus replication, whereas the specific
basis for the deleterious effects on host cells is not as well
understood. Some progress has been made regarding the mechanism of cell
death in coronavirus-infected cells; infection of coronavirus
transmissible gastroenteritis virus and MHV induces apoptosis in
certain cells (1, 3, 8). As found for some lytic viruses
(9, 11, 20, 21), host protein translation is inhibited
(12, 42, 49, 50) but not completely shut off in MHV-infected
cells. Inhibition of host protein synthesis is accompanied by an
increase in MHV protein synthesis (42, 43, 44). Specific
host mRNAs are degraded in MHV-infected cells, while transcriptional
upregulation of some other host mRNAs occurs in MHV-infected cells
(25). The mechanism of selective MHV-specific protein
synthesis, which occurs concomitantly with host protein inhibition, in
infected cells is also poorly characterized, although it has been
suggested that MHV mRNAs containing 5'-end leader sequences bind to N
protein, forming a complex that may act as a strong translation
initiation signal (50, 51).
In this study, we described the specific cleavage of 28S rRNA in
MHV-infected cells; cleavage of 28S rRNA in coronavirus-infected cells
has not been described previously. There are a few examples of specific
28S rRNA cleavage: interferon (IFN) secretion activates the cytoplasmic
endoribonuclease, RNase L, via activation of the 2',5'-oligoadenylate
(2-5A) system; activated RNase L causes 28S and 18S rRNA cleavage in
murine cells and human cells (45, 46); in some human and rat
tumor cells, apoptosis triggers 28S rRNA cleavage when induced by
chemicals like actinomycin D or cyclic AMP (16, 17); porcine
reproductive and respiratory syndrome virus (PRRSV) infection results
in rRNA degradation that is related to nucleosomal DNA cleavage and
apoptosis (48); and rabbit reticulocytes contain a
membrane-associated endonuclease activity that cleaves 28S rRNA
(54). The present study demonstrates that MHV-induced 28S
rRNA cleavage is different from other known rRNA cleavage events. The
possible biological significance of 28S rRNA cleavage in MHV infection
is discussed.
 |
MATERIALS AND METHODS |
Viruses and cells.
The plaque-cloned A59 strain of MHV
(26), MHV-JHM (33), and MHV-2 (22)
were used. Mouse DBT cells (14) were used for the
propagation of virus stocks. DBT cells were maintained in minimal
essential medium supplemented with 8% heat-inactivated newborn calf
serum. Mouse L929 cells were used for IFN assay. 17Cl-1 cells
(1) and mouse embryonic fibroblasts (MEF cells) derived from
wild-type (RNase L+/+) and RNase L knockout (RNase
L
/
) mice (55) were grown in Dulbecco's
modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated
fetal bovine serum.
Northern (RNA) blotting.
Northern blot analysis was
performed using [
-32P]ATP-labeled oligonucleotide
probes as previously described (32). Oligonucleotide probe 1 (5' CTAATCATTCGCTTTACCGG 3'), which specifically binds to
nucleotides 1532 to 1551 from the 5' end of mouse 28S rRNA, was used
for the detection of 28S rRNA and its cleavage products. Oligonucleotide probes 2 (5' ATGCCCCCGGCCGTCCCTCT 3') and 3 (5' TAATGATCCTTCCGCAGGTTCACC 3'), which bind to nucleotides
921 to 940 and 1846 to 1870, respectively, from the 5' end of mouse 18S rRNA, were used to detect 18S rRNA. All hybridizations were performed at 60°C. To detect MHV-specific RNAs, Northern blot analysis was performed using a digoxigenin (DIG)-labeled random-primed probe (Boehringer), corresponding to the 3' end of MHV genomic RNA, and
visualized by using a DIG luminescence detection kit (Boehringer) according to the manufacturer's protocol.
Host protein synthesis analysis.
Intracellular proteins were
labeled as described previously (23). Briefly, mock-infected
and MHV-infected cells were incubated in methionine-cysteine-free
medium for 0.5 h before labeling. Cells were labeled with
Tran35S-label (75 µCi/ml; ICN) for 30 min at various
times postinfection (p.i.). Labeled cells were lysed in buffer (1%
Triton X-100, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl
sulfate [SDS] in phosphate-buffered saline), and the postnuclear
supernatant was separated by SDS-polyacrylamide gel electrophoresis (PAGE).
IFN assay.
Functional IFN was detected by the vesicular
stomatitis virus (VSV) plaque reduction method as previously described
(28). Briefly, confluent DBT cells in 60-mm-diameter dishes
were mock infected or infected with MHV-A59 at a multiplicity of
infection (MOI) of 10. At 12 h and 24 h p.i., supernatants
were harvested and irradiated with UV light (wavelength, 253 nm) for 12 min to inactivate MHV. To 96-well clusters, seeded 24 h earlier
with 4 × 104 mouse L929 cells per well and containing
100 µl of complete medium (DMEM supplemented with 10% fetal bovine
serum), 50-µl duplicate aliquots of mock-infected or MHV-infected
supernatant were added. Each sample was then serially threefold diluted
11 times. After 24 h of incubation at 37°C, 6 × 105 PFU of VSV, in 25 µl of complete medium, was added to
each well. After another 24 h incubation at 37°C, L929 cell
viability was determined by counting the number of plaques in each
dilution. The dilution which yielded a 50% reduction in plaque number
was used to determine the IFN concentration in the original
supernatant. Calculations were according to IFN concentrations based on
National Institutes of Health (NIH) standards for murine IFN-
and
IFN-
.
Caspase-3 activity assay.
Presence of activated caspase-3
was detected using a caspase-3/CPP32 calorimetric protease assay kit
(BioSource International Inc., Camarillo, Calif.); this assay system
measures cleavage of the synthetic tetrapeptide Asp-Glu-Val-Asp (DEVD),
linked to the chromophore p-nitroanilide, by activated
caspase-3. Cell extracts were prepared by solubilizing mock-infected or
MHV-A59-infected DBT cells at 4.5 and 8.5 h p.i. in a buffer
consisting of 10 mM Tris-HCl (pH 7.5), 10 mM
NaH2PO4, 10 mM Na2HPO4,
150 mM NaCl, and 1% Triton X-100. Cell extracts from DBT cells that
were treated continuously in the presence of 50 µM etoposide for
35.5 h were used as a positive control. As a negative control, the
8.5-h-p.i. DBT lysate was incubated with 250 µM Z-DEVD-fmk (Enzyme
Systems, Livermore, Calif.), a caspase-3 inhibitor, for 30 min at
37°C. Aliquots of each sample, corresponding to 200 µg of protein,
were mixed with the reaction buffer {40 mM HEPES, 200 mM NaCl, 2 mM EDTA, 0.2%
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS),
20% glycerol, 10 mM dithiothreitol, 200 µM DEVD-p
nitroanilide substrate} and incubated in 96-well clusters. The amount
of substrate hydrolyzed was measured at an optical density of 405 nm.
Background readings from cell lysates and buffers were subtracted from
both mock-infected and MHV-infected samples before determining the fold
increase in caspase-3 activation, calculated as (infected lysate + substrate)
(infected lysate
substrate)/(mock
lysate + substrate)
(mock lysate
substrate).
 |
RESULTS |
Cleavage of 28S rRNA in MHV-infected cells.
We noticed the
appearance of a major band that migrated between the 28S and 18S rRNAs
after agarose gel electrophoresis of intracellular RNA from
MHV-A59-infected DBT cells. This band was easily detected after
ethidium bromide staining of the gels (data not shown) or by methylene
blue staining of intracellular RNAs transferred to a nylon membrane
(Fig. 1A). MHV subgenomic mRNA 6 migrated
slightly faster than this major band, and mRNA 7 comigrated with 18S
rRNA. This band appeared to be an RNA of non-MHV origin, as DNase
treatment did not affect it and the size differed from that of any of
the MHV subgenomic mRNAs. The size and abundance of the band suggested
that this RNA may be a cleavage product of 28S rRNA. We tested this
possibility by Northern blot analysis of intracellular RNAs from
MHV-A59-infected DBT cells, using an oligonucleotide (probe 1) that
specifically hybridizes with the mature mouse 28S rRNA at 1.5 kb from
the 5' end (Fig. 1B). This probe specifically hybridized with an intact
28S rRNA and four additional minor bands from uninfected cells; these
minor bands most probably represented degraded RNAs that were generated
by the normal turnover of 28S rRNAs. The same probe hybridized with intact 28S rRNA and a 3.2-kb-long RNA (28S-CL1) from intracellular RNAs
extracted from MHV-A59-infected cells at 8 h p.i. Using two other
oligonucleotide probes, each of which hybridized with 28S rRNA at 1.0 and 2.0 kb from the 5' end, we observed the same 28S rRNA cleavage
(data not shown). Judging from the size and amount of this 28S
rRNA-related RNA, 28S-CL1 was the cleavage product that we initially
noticed (Fig. 1A). Parallel Northern blots of the same RNA samples were
probed with the 28S rRNA-specific oligonucleotide probe 1 and an
MHV-specific probe that hybridizes with all of the MHV RNAs (Fig. 1B).
The 28S-CL1 product differed in size from any MHV mRNA, eliminating the
possibility that it was the result of nonspecific hybridization of
probe 1 to MHV mRNAs.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 1.
Characterization of 28S and 18S rRNAs in
MHV-A59-infected cells. (A) DBT cells were mock infected (M) or
infected with MHV-A59 (I) at an MOI of 10. At 8 h p.i.,
cytoplasmic RNA was extracted and a portion of the RNA was
electrophoresed on a denaturing 1% agarose-formaldehyde gel. The RNA
was blotted onto a nylon membrane, which was stained with methylene
blue. MHV-A59-specific mRNAs 1, 2, 3, and 6 are indicated by
arrowheads. Intact 28S rRNA, 18S rRNA, and the cleaved 28S rRNA product
are indicated by arrows. (B) Cytoplasmic RNA was extracted from
mock-infected DBT cells (M) or MHV-A59-infected DBT cells at 8 h
p.i. (8h). RNAs were electrophoresed on a denaturing 1%
agarose-formaldehyde gel. The RNA was blotted onto a nylon membrane,
which was cut into two identical halves. One-half was probed with the
5'-end-labeled oligonucleotide probe 1, which specifically binds to
mouse 28S rRNA (lanes 1 and 2), and the other half was probed with a
random-primed DIG-labeled probe specific for MHV mRNAs (lanes 3 and 4).
(C and D) Cytoplasmic RNA was extracted from MHV-A59-infected DBT cells
at various times p.i., as shown above the lanes. RNAs were
electrophoresed on a denaturing gel and examined by Northern blot
analysis, using the 28S rRNA-specific probe 1 to detect 28S rRNA and
its cleavage products (C) and a mixture of oligonucleotide probes 2 and
3 to detect 18S rRNA (D). The mock-infected RNA sample (lanes 1 in
panels C and D) was extracted at 24 h p.i.
|
|
A precise time course analysis of 28S rRNA cleavage during MHV-A59
infection showed that a reduction in the amount of 28S
rRNA was
detectable at 7 h p.i. (Fig.
1C). Densitometric scanning
analysis
showed a 60% decrease in the amount of intact 28S rRNA
from infected
cells by 8 to 9 h p.i. compared to uninfected cells.
The amount of
28S rRNA decreased continuously, and 28S rRNA was
hardly detectable by
24 h p.i. The first cleavage product, 28S-CL1,
appeared as a faint
band as early as 4 h p.i., and it increased
substantially between
5 and 6 h p.i. 28S-CL1 remained the major
rRNA species from 9 to
12 h p.i. Probe 1 also hybridized with
four additional RNA bands,
2.8-kb-long 28S-CL2, 2.1-kb-long 28S-CL3,
2.0-kb-long 28S-CL4, and
1.0-kb-long 28S-CL5, from MHV-A59-infected
cells; none of these smaller
28S rRNA cleavage products comigrated
with MHV mRNAs, and all were
clearly visible by 12 h p.i. 28S-CL3
and 28S-CL4 were visible at
9 h p.i., and they accumulated transiently
until 16 h p.i.
28S-CL2 and 28S-CL5 appeared around 12 h p.i.
Late in infection,
28S-CL4 and 28S-CL5 were the major cleavage
products. By 24 h
p.i., the cleavage products had virtually disappeared
and very little
intact 28S rRNA was
present.
In contrast to the extensive cleavage of 28S rRNA in MHV-A59-infected
cells, Northern blot analysis of 18S rRNA, using two
18S rRNA-specific
oligonucleotide probes, showed that 18S rRNA
did not undergo cleavage
in MHV-infected DBT cells even late in
infection (Fig.
1D). The amount
of 18S rRNA in MHV-A59-infected
cells was similar to that in uninfected
cells until 12 h p.i.,
while the amount of intact 18S rRNA in
MHV-A59-infected cells
decreased slightly at 16 h p.i. By 24 h p.i. there was a decrease
in the total amount of intact 18S
rRNA; the mechanism of reduction
in the amount of 18S rRNA late
in infection is not known. The
amount of intact 18S rRNA remained
unchanged until 12 h p.i.,
and Northern blot analysis detected no
specific cleavage products;
hence, we concluded that 28S rRNA, but not
18S rRNA, underwent
specific cleavage in MHV-A59-infected
cells.
MHV replication was required for 28S rRNA cleavage.
To test
whether binding of MHV to MHV receptors, or some unidentified
substances other than MHV present in the inoculum, induced 28S rRNA
cleavage, the inoculum used in the above experiments was exposed to UV
light (wavelength, 253 nm) for 12 min prior to addition to DBT cells.
MHV infectivity of UV-irradiated samples was less than 1 PFU/0.2 ml.
After incubation for 1 h at 37°C, the inoculum was removed and
the cells were incubated for up to 8 h. No 28S rRNA cleavage was
detected in cells that underwent this treatment (Fig.
2), demonstrating that binding of MHV to MHV receptors alone or to unidentified substances which may have been
present in the inoculum did not induce 28S rRNA cleavage. Induction of
28S rRNA cleavage required MHV replication.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 2.
Northern blot analysis of 28S rRNA after inoculation of
UV-irradiated MHV-A59. DBT cells were mock infected (M) or inoculated
(I) with the UV-irradiated MHV-A59 sample. Cytoplasmic RNA was
extracted at 8 h p.i., and Northern blot analysis was performed
with 5'-end-labeled probe 1. The arrow indicates intact 28S rRNA.
|
|
Relationship between 28S rRNA cleavage and other MHV-induced
changes in infected cells.
We compared the kinetics of 28S rRNA
cleavage with other cellular changes that occurred in MHV-infected
cells. MHV-A59 infection in DBT cells induces cell fusion mediated by S
protein (7). MHV-A59-induced cell fusion appeared 5 h
p.i. Fused cells became 60% and nearly 100% of the total cell
population by 6 and 8 h p.i., respectively, but they did not start
floating until 18 to 20 h p.i. (data not shown). As shown in Fig.
1C, 28S rRNA cleavage started earlier than the onset of MHV-A59-induced
cell fusion.
MHV RNA synthesis peaks at 6 to 7 h p.i. (
39). Amounts
of MHV RNAs are roughly constant from 8 to 10 h p.i. and then
decline
at 11 h p.i. (
39). A substantial increase in
28S-CL1 in MHV-infected
cells preceded the peak of MHV RNA synthesis,
and 28S rRNA cleavage
continued beyond 12 h p.i. (Fig.
1C).
28S rRNA is an integral component of the large subunit of the ribosome;
cleavage of 28S rRNA may affect ribosome structure
or function and
subsequently protein synthesis. Hence we examined
the relationship
between 28S rRNA cleavage and protein synthesis
in MHV-infected cells.
MHV-A59-infected DBT cells were labeled
with Tran
35S-label
for 30 min at different times p.i., and cell extracts
were analyzed by
SDS-PAGE (Fig.
3). Synthesis of S, N, and
M proteins
was detectable at 5 h p.i.; these MHV structural
proteins became
major proteins by 6 h p.i. Consistent with
previous studies (
12,
42,
49,
50), host protein synthesis
was inhibited in MHV-infected
cells (Fig.
3); inhibition of host
protein synthesis was seen
around 7 h p.i. and proceeded further.
As shown in Fig.
1C, 28S-CL1
appeared as a major cleavage product
starting 5 h p.i. These data
showed that there was a slight lag
period between host protein
synthesis inhibition and 28S-CL1
production. Thereafter, both
28S rRNA cleavage and host protein
synthesis inhibition continued
as infection proceeded.

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 3.
Host protein synthesis inhibition in MHV-A59-infected
DBT cells. DBT cells were mock infected (M) or infected with MHV-A59
(I) at an MOI of 10. Culture medium was replaced with
methionine-cysteine-free medium 30 min prior to each indicated time
point. After 30 min of incubation, Tran35S-label was added
to the culture medium at a final concentration of 75 µCi/ml.
Intracellular proteins were extracted after 30 min of incubation and
analyzed by SDS-PAGE (12% gel). Positions of MHV-A59 S, N, and M
structural proteins are indicated by arrows.
|
|
Cleavage of 28S rRNA after infection with different MHV strains in
different cell lines.
We examined whether 28S rRNA cleavage was
confined to a particular cell type or MHV strain. MHV-A59 infection of
17Cl-1 cells also produced all 28S rRNA cleavage products; the kinetics
of appearance of cleavage products and reduction in the amount of mature 28S rRNA in MHV-A59-infected 17CL-1 cells were similar to
results for MHV-infected DBT cells (data not shown). MHV-JHM-infected DBT cells also induced the same 28S rRNA cleavage products as found in
MHV-A59-infected DBT cells, but 28S rRNA cleavage was less prominent in
MHV-JHM-infected cells; the amount of intact 28S rRNA remaining in
MHV-A59-infected cells was much less than that in MHV-JHM-infected
cells at 24 h p.i. (data not shown). MHV-JHM-induced 28S rRNA
cleavage was slower than MHV-A59-induced 28S rRNA cleavage, yet 28S-CL1
was clearly detectable at 9 h p.i. in MHV-JHM-infected cells.
Cleaved 28S rRNA products were also less abundant than in
MHV-A59-infected cells. We detected no major differences in the
patterns of 28S rRNA cleavage in MHV-JHM-infected 17CL-1 cells and
MHV-JHM-infected DBT cells. Production of infectious MHV from
MHV-JHM-infected cells is about 10 times lower than that from
MHV-A59-infected cells, and the amount of MHV-specific RNAs in
MHV-JHM-infected cells is also lower than that in MHV-A59-infected cells (data not shown). A lower level of MHV-JHM replication efficiency in infected cells may be related to less efficient 28S rRNA cleavage.
We used a nonfusogenic MHV strain, MHV-2, to test whether MHV-induced
cell fusion was required for 28S rRNA cleavage. The
same 28S rRNA
cleavage products accumulated in MHV-2-infected
DBT cells (data not
shown). Kinetics of 28S rRNA cleavage in MHV-2-infected
DBT cells was
similar to that of MHV-JHM-infected DBT cells. These
data demonstrated
that MHV-induced 28S rRNA cleavage was not restricted
to any particular
MHV strain or MHV-susceptible cell
line.
Evidence for cleavage of mature cytoplasmic 28S rRNA in
MHV-infected cells.
Mature cytoplasmic 28S rRNA is generated from
a precursor 45S rRNA; 45S rRNA undergoes specific cleavages to produce
28S rRNA, 18S rRNA, and other small rRNAs in the nucleolus
(37). After processing, 28S rRNA associates with ribosomal
proteins to form the large subunit, which is then transported to the
cytoplasm (37). Accumulation of 28S rRNA cleavage products
in MHV-infected cells may be the result of cleavage of mature
cytoplasmic 28S rRNA or of aberrant rRNA processing, which takes place
in the nucleolus. To examine the possibility that mature cytoplasmic 28S rRNA is cleaved in MHV-infected cells, we first determined the time
taken by the precursor rRNA to be transported from the nucleolus to the
cytoplasm. DBT cells at 50% confluency were incubated in the presence
of [3H]uridine (60 µCi/ml). After 16 h of
incubation, the culture medium was replaced with growth medium lacking
[3H]uridine. The labeled rRNAs were chased in medium
without [3H]uridine. At various times during this chase
period, intracellular RNA was extracted and analyzed on a 1%
agarose-formaldehyde gel. Labeled mature 28S and 18S rRNAs were
detected in the cytoplasm after a 5.5- to 12-h chase (data not shown).
To test whether mature cytoplasmic 28S rRNA was cleaved in MHV-infected
cells, 50% confluent DBT cells were incubated in the presence of
[3H]uridine (100 µCi/ml). After 16 h of
incubation, the culture medium was replaced with growth medium lacking
[3H]uridine and chased for another 13 h; processing
and transportation of 28S rRNA were completed during this chase period.
Cells were then mock infected or infected with MHV-A59. After 1 h
of virus adsorption, the inoculum was removed and cells were incubated in a medium containing actinomycin D (5 µg/ml) to prevent
transcription of host RNAs, including rRNAs. Cytoplasmic RNA was
extracted at 8 h p.i. and analyzed by electrophoresis on a 1%
denaturing agarose-formaldehyde gel (Fig.
4). Both 28S and 18S rRNAs were seen in
mock-infected cells, while 28S-CL1 and a reduced level of 28S rRNA were
detected in MHV-infected cells. Since the majority of intact rRNAs were radiolabeled and transported to the cytoplasm prior to MHV infection, and only cytoplasmic RNAs were extracted in this experiment, rRNAs detected in this study should represent cytoplasmic rRNAs that were
made prior to MHV infection. Reduction of intact 28S rRNA and the
presence of 28S-CL1 in MHV-infected cells demonstrated that MHV
infection induced cleavage of mature cytoplasmic 28S rRNA that was made
prior to MHV infection. Thus, cytoplasmic 28S rRNA, which is part of
the large subunit, was cleaved during MHV infection.

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 4.
Evidence for the cleavage of mature cytoplasmic 28S rRNA
in MHV-infected DBT cells. DBT cells at a low confluency were labeled
with [3H]uridine for 16 h and then chased, in a
medium lacking isotope, for 13 h. Cells were then mock infected
(M) or infected with MHV-A59 (I) at an MOI of 10. After adsorption for
1 h, cells were incubated in the presence of actinomycin D (5 µg/ml), and cytoplasmic RNA was extracted at 8 h p.i.
Cytoplasmic RNAs were electrophoresed on a 1% denaturing gel. The gel
was washed and enhanced prior to autoradiography. The gel was exposed
at 80°C for 60 days. The arrows indicate intact 28S rRNA, 28S-CL1,
and 18S rRNA.
|
|
Independence of MHV-induced 28S rRNA cleavage from 2-5A
system-mediated rRNA degradation.
In certain combination of
viruses and cells, pretreatment of cells with IFN and subsequent viral
infection result in rRNA degradation (45). This rRNA
degradation is mediated by the 2-5A system (45, 46), in
which IFN upregulates the enzyme 2-5A synthetase, which synthesizes
2-5A molecules. These 2-5A moieties are highly unstable and are rapidly
degraded by phosphatases. In the presence of viral double-stranded
RNAs, 2-5A binds and activates the endoribonuclease, RNase L. RNase L
activation is localized and serves to cleave viral mRNAs, thus
inhibiting viral replication and limiting viral spread. At high 2-5A
concentrations, RNase L activation leads to extensive degradation of
rRNAs (31).
We examined whether the 28S rRNA cleavage in MHV-infected cells was due
to activation of the 2-5A system. RNase L-mediated
rRNA degradation
usually requires treatment of cells with IFN
prior to virus infection
(
45). MHV-induced 28S rRNA cleavage
occurred in the absence
of IFN pretreatment; therefore, it was
less likely that the
conventional 2-5A system was mediating MHV-induced
28S rRNA cleavage.
However, the MHV sample used for virus inoculation
could contain IFN
secreted from infected cells. Subsequent infection
using that inoculum
would then expose the cells to IFN during
virus adsorption. Such a
brief exposure of cells to IFN and the
subsequent replication of MHV
may be sufficient to activate the
2-5A system in the infected cell. We
tested this possibility by
examining the production of IFN from
MHV-infected DBT cells, as
all MHV stocks used for virus inoculation
were grown in DBT cells.
A classical biological assay for IFN, which
uses the susceptibility
of VSV replication in IFN-pretreated L929 cells
(
28), was used
to detect biologically active IFN in
MHV-infected supernatants.
VSV replication in L929 cells was very
sensitive to pretreatment
with a mixture of IFN-

and IFN-

NIH
standards, as no VSV plaques
formed at moderate dilutions of these NIH
standards. In contrast,
supernatant from MHV-infected and mock-infected
cells failed to
protect L929 cells from VSV replication (data not
shown), suggesting
that MHV-infected culture fluid contained no or an
undetectable
level of biologically active
IFN.
Next we examined the possibility that the autocrine pathway of IFN
action (
40) could mediate MHV-induced 28S rRNA cleavage.
If
very low levels of IFN mediate MHV-induced 28S rRNA cleavage
through
the autocrine pathway, then neutralizing the putative
IFN which is
secreted into MHV-infected culture fluid should block
this pathway.
After adsorption of MHV-A59, DBT cells were incubated
in the presence
of an anti-mouse IFN-

and -

rabbit antibody
mixture (20%
IFN-

-80% IFN-

; 30 U/ml; NIAID catalog no. G024-501-568).
This
amount of anti-IFN antibodies can neutralize 3,000 U of IFN.
This
concentration of antibodies was more than enough to neutralize
any IFN
that might be produced from MHV-infected cells, because
the IFN
bioassay showed that less than 3 U of IFN per ml may be
secreted by
MHV-infected cells. Northern blot analysis of intracellular
RNAs that
were extracted at 8 h p.i. showed that incubation of
MHV-infected
cells with anti-IFN antibodies did not block 28S
rRNA cleavage (Fig.
5). Taken together, these data
demonstrated
that IFN was not involved in 28S rRNA cleavage in
MHV-infected
cells.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of anti-mouse IFN antibodies on MHV-induced 28S
rRNA cleavage. DBT cells were mock infected (lanes 3 and 4) or infected
with MHV-A59 (lanes 1 and 2) at an MOI of 10. After virus adsorption
for 1 h, cells were incubated in the absence (lanes 1 and 3) or
presence of 30 U of rabbit anti-mouse IFN antibodies (Ab) per ml (lanes
2 and 4). Cytoplasmic RNA was extracted at 8 h p.i., and 28S rRNA
cleavage was examined by Northern blot analysis using 5'-end-labeled
probe 1.
|
|
We tested yet another possibility, that MHV infection directly
activates RNase L in the absence of IFN. We used RNase L
+/+
and RNase L
/
MEF cells to examine this possibility. If
RNase L plays a vital
role in 28S rRNA cleavage in MHV-infected cells,
28S rRNA cleavage
should not occur in MHV-infected RNase
L
/
cells. We conducted a [
32P]2-5A
cross-linking assay (
35) to confirm the absence of RNase
L
in RNase L
/
cells; our data unambiguously showed the
lack of RNase L in RNase
L
/
cells and the presence of
RNase L in RNase L
+/+ cells (data not
shown).
One-step MHV-A59 growth curve analysis showed that MHV replicated with
similar kinetics, with maximum virus titer at about
24 h p.i. in
both RNase L
+/+ and RNase L
/
cell lines.
The maximum MHV titer in both cell lines was about
5 to 10 times lower
than that in DBT cells. Immunofluorescence
studies using an anti-N
protein monoclonal antibody showed that
in both cell lines
approximately 15% cells supported MHV replication
after MHV
inoculation at an MOI of 10 (data not shown); we do
not know why only
15% of cells supported MHV replication. Both
cell lines showed no
apparent cytopathic effects, including cell
fusion, after MHV-A59
infection. To determine whether MHV-induced
28S rRNA cleavage occurred
in the absence of RNase L expression,
RNase L
+/+ and RNase
L
/
cells were infected with MHV-A59 at an MOI of 10. Intracellular
RNA was extracted at various times p.i., and 28S rRNA
cleavage
was examined by Northern blot analysis. Cleavage of 28S rRNA
occurred
in both cell lines (Fig.
6). The
sizes of the 28S rRNA cleavage
products in both cell lines were the
same as those found in MHV-infected
DBT cells. The amount of intact 28S
rRNA did not decrease drastically
in either type of MEF cells after MHV
infection. This was not
surprising, as only 15% of each cell type was
infected with MHV;
28S rRNA cleavage did not occur in uninfected cells.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 6.
MHV-induced 28S rRNA cleavage in RNase L+/+
(A) and RNase L / (B) MEF cells. RNase L+/+
(RNL+/+) and RNase L /
(RNL / ) MEF cells were mock infected (M) or infected
with MHV-A59 (I) at an MOI of 10. Cytoplasmic RNA was extracted at the
indicated times and electrophoresed on a 1% denaturing gel. Cleavage
of 28S rRNA was examined by Northern blot analysis using 5'-end-labeled
probe 1.
|
|
Blocking apoptosis did not affect MHV-induced 28S rRNA
cleavage.
There have been some reports of rRNA degradation
occurring in apoptotic cells. Treatment of certain tumor cells with
chemical inducers of apoptosis, e.g., actinomycin D and cyclic AMP,
causes 28S rRNA degradation coincident with DNA fragmentation, which is
a characteristic change found in apoptotic cells (16, 17). PRRSV infection of susceptible cells causes apoptosis, characterized by
DNA fragmentation, concomitant with cleavage of both 18S and 28S rRNAs
(48).
Apoptosis is induced in MHV-infected 17Cl-1 cells but not in
MHV-infected DBT cells (
1). Nevertheless 28S rRNA cleavage
occurred in both DBT cells (Fig.
1) and 17Cl-1 cells (data not
shown).
Furthermore, a DNA ladder, representing apoptotic DNA
fragmentation, is
detected at about 24 h p.i. in MHV-infected
17Cl-1 cells
(
1), while significant 28S rRNA cleavage occurred
much
earlier, around 5 h p.i. (data not shown). These differences
signify that 28S rRNA cleavage detected in MHV-infected cells
and rRNA
degradation associated with apoptosis are not identical,
yet
MHV-induced 28S rRNA cleavage and apoptosis may be related.
A possible
relationship between MHV-induced 28S rRNA cleavage
and apoptosis was
examined.
First we examined whether induction of apoptosis in DBT cells resulted
in 28S rRNA cleavage, i.e., whether 28S rRNA cleavage
is a typical
change that occurs in apoptotic DBT cells. DBT cells
at 50% confluency
were incubated in medium containing 2% serum
for 18 h. After
addition of 50 µM etoposide, cells were incubated
for 33 h, and
then internucleosomal DNA (
13) and intracellular
RNA were
extracted. Etoposide treatment of DBT cells resulted
in DNA ladder
formation, demonstrating that DBT cells can die
by apoptosis. However,
no specific cleavage of either 18S or 28S
rRNA occurred (data not
shown), indicating that 28S rRNA cleavage
was not a common apoptotic
change in DBT cells that underwent
apoptosis.
Although MHV-infected DBT cells showed no apoptotic signs, certain
steps of the apoptotic process may occur in MHV-infected
DBT cells but
apoptosis may be blocked. Caspase-3 plays a central
role in
caspase-dependent apoptosis (
5,
34). We wondered
whether
caspase-3 was activated in MHV-infected DBT cells; caspase-3
may be
activated early in MHV-infected DBT cells, and activated
caspase-3 may
trigger 28S rRNA cleavage. To examine this possibility,
DBT cells were
mock infected or infected with MHV-A59 at an MOI
of 10, and cell
lysates were prepared at 4.5 and 8.5 h p.i.
Etoposide-treated
DBT cells were used as a positive control.
Caspase-3 activity
assay demonstrated a fourfold increase in
caspase-3 activation
in etoposide-treated DBT cells, with no caspase-3
activation in
MHV-infected DBT cells at 4.5 and 8.5 h p.i. These
data suggested
that 28S rRNA cleavage was upstream of the activation of
caspase-3
or not regulated by caspase-3.
MHV-infected 17Cl-1 cells die by apoptosis (
1). Treatment of
MHV-infected 17Cl-1 cells with the irreversible, cell-permeable
caspase-3 inhibitor Z-DEVD-fmk inhibits MHV-induced apoptosis
without
suppressing MHV growth (
1). If MHV-induced 28S rRNA
cleavage
is an event downstream of caspase-3 activation, then
Z-DEVD-fmk
treatment of MHV-infected 17Cl-1 cells would inhibit
MHV-induced 28S
rRNA cleavage. For 2 h prior to MHV-A59 infection
and after
MHV-A59 infection, 17Cl-1 cells were incubated with
80 µM Z-DEVD-fmk,
because apoptosis is blocked in MHV-infected
17CL-1 cells under this
experimental condition (
1). Control
samples were incubated
with dimethyl sulfoxide, which was used
to dissolve Z-DEVD-fmk. As
expected, a DNA ladder assay at 24
h p.i. showed that Z-DEVD-fmk
treatment blocked apoptosis, while
MHV-infected cells that were
incubated with dimethyl sulfoxide
showed clear DNA fragmentation (data
not shown). Northern blot
analysis of intracellular RNAs that were
extracted at 8 and 16
h p.i. showed that Z-DEVD-fmk treatment had
no effect on MHV-induced
28S rRNA cleavage (Fig.
7). Inhibition of caspase-3 activity in
MHV-infected 17Cl-1 cells did not block or delay 28S rRNA cleavage,
indicating that MHV-induced 28S rRNA cleavage was not an event
downstream of caspase-3 activation.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of the caspase inhibitor Z-DEVD-fmk on
MHV-induced 28S rRNA cleavage. Mouse 17Cl-1 cells were incubated in
serum-free DMEM (lanes 1, 4, 5, and 8) or 80 µM Z-DEVD-fmk (lanes 2, 3, 6 and 7) for 2 h prior to MHV infection. Cells were then mock
infected (lanes 1, 2, 5, and 6) or infected with MHV-A59 (lanes 3, 4, 7, and 8) at an MOI of 10. After adsorption, cells were incubated in
the presence (lanes 2, 3, 6, and 7) or absence (lanes 1, 4, 5, and 8)
of 80 µM Z-DEVD-fmk. Cytoplasmic RNA was extracted at the indicated
times. Cleavage of 28S rRNA was examined by Northern blot analysis
using 5'-end-labeled probe 1.
|
|
In summary, triggering apoptosis by etoposide treatment in DBT cells
did not cause any 28S rRNA cleavage. Conversely, blocking
apoptosis by
Z-DEVD-fmk treatment in MHV-infected 17Cl-1 cells
did not block
MHV-induced 28S rRNA cleavage. Also, no activation
of caspase-3 was
detected in MHV-infected DBT cells. These data
strongly indicated
either that 28S rRNA degradation was occurring
upstream of
caspase-3 activation or that apoptosis induction and
28S rRNA
cleavage occurred via two independent
pathways.
 |
DISCUSSION |
Comparison of MHV-induced 28S rRNA cleavage and other 28S rRNA
cleavage mechanisms.
In this study, we report a novel MHV-induced
28S rRNA cleavage. The MHV-induced rRNA cleavage occurred only in 28S
rRNA, not in 18S rRNA; generation of 28S rRNA cleavage products of
specific sizes argues against a random RNase activation, which would
result in smeared bands of degraded rRNAs, with no preference for 18S rRNA or 28S rRNA. The cleavage products appeared around 4 h p.i., with further cleavage products appearing with increasing times of
infection. Mature cytoplasmic 28S rRNA, a part of the 60S large ribosomal subunit, underwent cleavage. UV-inactivated MHV failed to
induce 28S rRNA cleavage, demonstrating that the binding of virus to
the cell surface receptor or unidentified substances which may be
present in the inoculum did not induce 28S rRNA cleavage. Specific
cleavage of 28S rRNA required ongoing MHV replication. Currently,
however, we do not know which step of the viral life cycle or specific
viral factor(s) causes this 28S rRNA cleavage. MHV infection to all
susceptible cell lines, using several different MHV strains, induced
28S rRNA cleavage; MHV-induced 28S rRNA cleavage was independent of
virus-induced cytopathic effect. Kyuwa et al. reported a 50% decrease
in intact 28S rRNA at 12 h p.i. in MHV-JHM-infected J774.1 BALB/c
monocytic cells (25). Their data are consistent with our
observation of reduced amount of intact 28S rRNA with increasing times
of MHV infection.
One of the known mechanisms of rRNA degradation is through the
activation of RNase L, a cellular endoribonuclease, activated
by the
2-5A system. We showed that MHV-induced 28S rRNA cleavage
was
independent of the 2-5A system and RNase L activation. Namely,
IFN was
undetectable in the inoculum used for MHV infection. Also,
neutralization of putative IFN in the culture fluid from MHV-infected
cells by anti-IFN antibodies did not affect MHV-induced 28S rRNA
cleavage. Furthermore, MHV infection of RNase L
/
MEF
cells induced a pattern of 28S rRNA cleavage similar to that
induced in
RNase L
+/+ MEF
cells.
Apoptosis-associated rRNA cleavage is another known mechanism of rRNA
degradation; DNA fragmentation and RNA fragmentation
are usually
temporally linked in this type of rRNA cleavage (
16,
17).
The only report of rRNA degradation during viral infection
is during
PRRSV infection or expression of the PRRSV p25 gene
product
(
48). In both cases, rRNA degradation is coincident
with DNA
fragmentation and other morphological features of apoptosis.
MHV-induced 28S rRNA cleavage differed from apoptosis-related
rRNA
degradation and PRRSV-induced rRNA degradation. MHV-induced
28S rRNA
cleavage occurred in DBT cells that do not undergo apoptosis
(
1), and no activated caspase-3 was detected in MHV-infected
DBT cells. MHV-infected 17Cl-1 cells undergo caspase-dependent
apoptosis, where DNA fragmentation is detected at about 24 h p.i.
(
1), whereas MHV-induced 28S rRNA cleavage was detected much
earlier. Treatment of MHV-infected 17Cl-1 cells with the caspase-3
inhibitor Z-DEVD-fmk did not affect 28S rRNA cleavage, whereas
this
treatment did inhibit DNA fragmentation; hence, inhibition
of apoptosis
did not block 28S rRNA cleavage. These data argue
against the
involvement of an activated caspase-3 and the triggering
of apoptosis
in inducing 28S rRNA cleavage. MHV-induced 28S rRNA
cleavage was
probably an event independent of apoptosis or, if
related, was upstream
of the activation of caspase-3 and a very
early event in MHV
infection.
Wreschner et al. (
54) have reported the presence in rabbit
reticulocyte lysates of a membrane-bound RNase M which is inactivated
during maturation of reticulocytes to erythrocytes. RNase M cleaves
28S
rRNA. No such RNase has been found in DBT or 17Cl-1 cells,
and since
these are immortalized, transformed cell lines, the
presence of a
developmentally regulated RNase is questionable.
Specific 28S rRNA
cleavage and DNA fragmentation are seen in rat
brains during traumatic
brain injury (
10), and the authors concluded
that the rRNA
fragmentation in their system may be related to
either necrosis or
apoptosis. Cleavage of 28S rRNA by RNase M
or during rat brain injury
generated 28S rRNA cleavage products
that differed in size from the 28S
rRNA cleavage products found
in MHV-infected cells. Thus, MHV-induced
28S rRNA specific cleavage
appeared to be different from other reported
rRNA
degradations.
The mechanism of MHV-induced 28S rRNA cleavage.
Although RNase
L was not responsible for MHV-induced 28S rRNA cleavage, it is possible
that such a cleavage was the result of activation of another RNase of
cellular or viral origin. Others have reported the degradation of few
cellular mRNAs during MHV infection (12, 25, 49). Therefore,
it is conceivable that the RNase responsible for cleaving 28S rRNA may
also degrade these host mRNAs, as the reduction of cellular mRNAs
appears to be, at least in part, responsible for the host protein
synthesis inhibition in MHV-infected cells (12). MHV-encoded
RNase activity has not been demonstrated. Another possibility is that
the structure of 60S ribosome may be altered by binding of unidentified
MHV factors or host factors which are induced by infection in
MHV-infected cells. This putative structural alteration may allow a
cellular or viral RNase to access specific regions of 28S rRNA,
resulting in specific cleavage of 28S rRNA.
MHV-induced 28S rRNA cleavage and protein translation.
28S
rRNA is an integral component of 60S ribosome, whose major function is
protein translation. Hence, MHV-induced 28S rRNA cleavage may affect
protein synthesis. Indeed, consistent with previous studies (12,
42, 49, 50), host protein translation was severely inhibited but
not completely shut off in MHV-infected cells (Fig. 3). It is tempting
to speculate that ribosomes containing the cleaved 28S rRNA may not be
able to form polysomes or may be functionally inactive in protein
synthesis. In that case, MHV-specific protein synthesis may take place
on polysomes containing intact 28S rRNAs. This possibility is
consistent with the finding that the amount of 80S monosome which is
not involved in protein translation increased in MHV-infected cells
(12), and both MHV and host proteins were poorly synthesized
late in MHV infection, when only a minute amount of intact 28S rRNA was
detected (Fig. 1C). Alternatively, most host protein synthesis does not
occur on ribosomes containing cleaved 28S rRNA, while MHV-specific
proteins are preferentially synthesized on ribosomes containing the
cleaved 28S rRNA species. 28S-CL1, the first cleavage product, appeared
early in infection and remained a major stable rRNA species until
12 h p.i. (Fig. 1C). It is conceivable that ribosomes containing
28S-CL1 are functional but structurally altered to better translate the
increasing amounts of MHV-specific mRNAs, which begin to accumulate
from 5 h p.i. Tahara et al. reported that chimeric mRNAs
containing the MHV leader sequence upstream of the human
-globin
region translate more efficiently than the authentic human
-globin
mRNA in extracts from MHV-infected cells, whereas this translational
enhancement is not seen in extracts from uninfected cells
(50). Recent studies on translation analysis of bovine
coronavirus (BCV) mRNAs also showed that the presence of BCV leader
sequence in chimeric mRNAs increases their translation activity in
BCV-infected cells (41). Since MHV N protein binds to the
leader sequence (51), Tahara et al. speculated that binding
of N protein to the 5' end of the MHV leader sequence may augment
translation efficiency in MHV-infected cells (51). Presence
of MHV leader sequence at the 5' ends of MHV mRNAs and N protein
binding may allow MHV protein synthesis in ribosomes containing cleaved
28S rRNAs. There is yet another possibility, that 28S rRNA cleavage
does not affect the translational activity of ribosomes; ribosomes
containing cleaved 28S rRNAs may be biologically active for translation
of both host and MHV proteins. In that case, the inhibition of host
protein synthesis in MHV-infected cells is mediated by some other,
unidentified mechanism(s).
Biological significance of MHV-induced 28S rRNA cleavage.
What
is the biological significance of a specific 28S rRNA cleavage
occurring early in MHV infection? It has been proposed that 28S rRNAs
may serve as cytoplasmic "biosensors" regulating cellular processes
(18, 19). In apoptosis-related 28S rRNA cleavage, the
cleavages occur at specific sites within rRNA D domains
(17). Although the biological function of D domains of 28S
rRNA has not been established, Houge and Doskeland speculated that
various proapoptotic signal transduction pathways, e.g., those
involving phosphorylation and/or proteolysis, can convert the D domain
from a passive to an active state (15). If a sufficient number of ribosomes are in the active state, the threshold for apoptosis is exceeded. Secondary to the postulated D-domain
modulations, apoptotic rRNA cleavage may inactivate the D domains or
liberate the cleaved 28S rRNA fragments, which may have additional
biological effects (15). Iordanov et al. described other
cellular responses to changes in the status of 28S rRNA, reporting that
damage at a specific loop of the 28S rRNA, or binding of
peptidyltransferase inhibitors to the adjacent peptidyltransferase
center of the 28S rRNA, induced a ribotoxic stress response
(19). This response involves the activation of the
stress-activated protein kinase/c-Jun NH2-terminal kinase,
the p38 mitogen-activated protein kinase, and the transcriptional
induction of immediate-early genes such as c-fos and
c-jun (18, 19). The signal transduction cascade promotes either cell recovery and survival after cellular damage or
apoptotic cell death (reference 19 and references
therein). MHV-induced 28S rRNA cleavage may have a similar biological
consequence as ribotoxic stress response; MHV-induced 28S rRNA cleavage
may activate a signal transduction pathway(s), which may result in the
alteration of the cellular environment. The altered environment may
suppress MHV replication as a cellular countermeasure
against MHV infection. Alternatively, MHV may have evolved to
trigger a signal transduction pathway to enhance its replication; such an altered cellular environment, triggered by the MHV-induced 28S rRNA
cleavage-mediated transduction pathway, may offer a better environment
for efficient MHV replication.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grants AI29984
(to S.M.) and CA44059 (to R.H.S.) from the National Institutes of Health.
We thank Chun-Jen Chen and Gunnar Houge for valuable information and
suggestions for etoposide-induced apoptosis in DBT cells and for the
Northern blot analyses of 28S rRNA, respectively. We also thank Samuel
Baron and Joyce Poast for the anti-IFN antibodies and invaluable help
with the IFN assays.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, The University of Texas Medical Branch at Galveston, Galveston, TX 77555-1019. Phone: (409) 772-2323. Fax: (409)
772-5065. E-mail: shmakino{at}utmb.edu.
Present address: Department of Microbiology and Immunology,
Stanford University, Stanford, CA 94305.
 |
REFERENCES |
| 1.
|
An, S.,
C.-J. Chen,
X. Yu,
J. L. Leibowitz, and S. Makino.
1999.
Induction of apoptosis in murine coronavirus-infected cultured cells and demonstration of E protein as an apoptosis inducer.
J. Virol.
73:7853-7859[Abstract/Free Full Text].
|
| 2.
|
Bailey, O.,
A. M. Pappenheimer,
F. S. Cheever, and J. B. Daniels.
1949.
A murine virus (JHM) causing disseminated encephalomyelitis with extensive destruction of myelin. II. Pathology.
J. Exp. Med.
90:195-205[Abstract].
|
| 3.
|
Belyavskyi, M.,
E. Belyavskaya,
G. A. Levy, and J. L. Leibowitz.
1998.
Coronavirus MHV-3-induced apoptosis in macrophages.
Virology
250:41-49[CrossRef][Medline].
|
| 4.
|
Bos, E. C. W.,
W. Luytjes,
H. van der Meulen,
H. K. Koerten, and W. J. M. Spaan.
1996.
The production of recombinant infectious DI-particles of a murine coronavirus in the absence of helper virus.
Virology
218:52-60[CrossRef][Medline].
|
| 5.
|
Cohen, G. M.
1997.
Caspases: the executioners of apoptosis.
Biochem. J.
326:1-16.
|
| 6.
|
Compton, S. R.,
S. W. Barthold, and A. L. Smith.
1993.
The cellular and molecular pathogenesis of coronaviruses.
Lab. Anim. Sci.
43:15-28[Medline]. (Erratum, 43:203.)
|
| 7.
|
Dveksler, G. S.,
M. N. Pensiero,
C. B. Cardellichio,
R. K. Williams,
G.-S. Jiang,
K. V. Holmes, and C. W. Dieffenbach.
1991.
Cloning of the mouse hepatitis virus (MHV) receptor: expression in human and hamster cell lines confers susceptibility to MHV.
J. Virol.
65:6881-6891[Abstract/Free Full Text].
|
| 8.
|
Eleouet, J.-F.,
S. Chilmonczyk,
L. Besnardeau, and H. Laude.
1998.
Transmissible gastroenteritis coronavirus induces programmed cell death in infected cells through a caspase-dependent pathway.
J. Virol.
72:4918-4924[Abstract/Free Full Text].
|
| 9.
|
Etchison, D.,
S. C. Milburn,
I. Edery,
N. Sonenberg, and J. W. B. Hershey.
1982.
Inhibition of HeLa cell protein synthesis following poliovirus infection correlates with the proteolysis of a 220,000-dalton polypeptide associated with eukaryotic initiation factor 3 and a cap binding protein complex.
J. Biol. Chem.
257:14806-14810[Abstract/Free Full Text].
|
| 10.
|
Fan, L.,
A. G. Yakovlev, and A. L. Faden.
1999.
Site-specific cleavage of 28S rRNA as a marker of traumatic brain injury.
J. Neurotrauma
16:357-364[Medline].
|
| 11.
|
Her, L. S.,
E. Lund, and J. E. Dahlberg.
1997.
Inhibition of Ran guanosine triphosphate-dependent nuclear transport by the matrix protein of vesicular stomatitis virus.
Science
276:1845-1848[Abstract/Free Full Text].
|
| 12.
|
Hilton, A.,
L. Mizzen,
G. Macintyre,
S. Cheley, and R. Anderson.
1986.
Translational control in murine hepatitis virus infection.
J. Gen. Virol.
67:923-932[Abstract/Free Full Text].
|
| 13.
|
Hinshaw, V. S.,
C. W. Olsen,
N. Dybdahl-Sissoko, and D. Evans.
1994.
Apoptosis: a mechanism of cell killing by influenza A and B viruses.
J. Virol.
68:3667-3673[Abstract/Free Full Text].
|
| 14.
|
Hirano, N.,
K. Fujiwara,
S. Hino, and M. Matsumoto.
1974.
Replication and plaque formation of mouse hepatitis virus (MHV-2) in mouse cell line DBT culture.
Arch. Gesamte Virusforsch.
44:298-302[CrossRef][Medline].
|
| 15.
|
Houge, G., and S. O. Doskeland.
1996.
Divergence towards a dead end? Cleavage of the divergent domains of ribosomal RNA in apoptosis.
Experientia
52:963-967[CrossRef][Medline].
|
| 16.
|
Houge, G.,
S. O. Doskeland,
R. Boe, and M. Lanotte.
1993.
Selective cleavage of 28S rRNA variable regions V3 and V13 in myeloid leukemia cell apoptosis.
FEBS Lett.
315:16-20[CrossRef][Medline].
|
| 17.
|
Houge, G.,
B. Robaye,
T. S. Eikhom,
J. Golstein,
G. Mellgren,
B. T. Gjertsen,
M. Lanotte, and S. O. Doskeland.
1995.
Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis.
Mol. Cell. Biol.
15:2051-2062[Abstract].
|
| 18.
|
Iordanov, M. S.,
J. M. Paranjape,
A. Zhou,
J. Wong,
B. R. Williams,
E. F. Meurs,
R. H. Silverman, and B. E. Magun.
2000.
Activation of p38 mitogen-activated protein kinase and c-Jun NH2-terminal kinase by double-stranded RNA and encephalomyocarditis virus: involvement of RNase L, protein kinase R, and alternative pathways.
Mol. Cell. Biol.
20:617-627[Abstract/Free Full Text].
|
| 19.
|
Iordanov, M. S.,
D. Pribnow,
J. L. Magun,
T.-H. Dinh,
J. A. Pearson,
S. L.-Y. Chen, and B. E. Magun.
1997.
Ribotoxic stress response: activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by the sequence-specific RNA damage to the -sarcin/ricin loop in the 28S rRNA.
Mol. Cell. Biol.
17:3373-3381[Abstract].
|
| 20.
|
Katze, M. G.,
D. DeCorato, and R. Krug.
1986.
Cellular mRNA translation is blocked at both initiation and elongation after infection by influenza virus and adenovirus.
J. Virol.
60:1027-1039[Abstract/Free Full Text].
|
| 21.
|
Katze, M. G., and R. Krug.
1984.
Metabolism and expression of RNA polymerase II transcripts in influenza virus-infected cells.
Mol. Cell. Biol.
4:2198-2206[Abstract/Free Full Text].
|
| 22.
|
Keck, J. G.,
L. H. Soe,
S. Makino,
S. Stohlman, and M. M. C. Lai.
1988.
RNA recombination of murine coronaviruses: recombination between fusion-positive mouse hepatitis virus A59 and fusion-negative mouse hepatitis virus 2.
J. Virol.
62:1989-1998[Abstract/Free Full Text].
|
| 23.
|
Kim, K.-H.,
K. Narayanan, and S. Makino.
1997.
Assembled coronavirus from complementation of two defective interfering RNAs.
J. Virol.
71:3922-3931[Abstract].
|
| 24.
|
Kim, K. H., and S. Makino.
1995.
Two murine coronavirus genes suffice for viral RNA synthesis.
J. Virol.
69:2313-2321[Abstract].
|
| 25.
|
Kyuwa, S.,
M. Cohen,
G. W. Nelson,
S. M. Tahara, and S. A. Stohlman.
1994.
Modulation of cellular macromolecular synthesis by coronavirus: implications for pathogenesis.
J. Virol.
68:6815-6819[Abstract/Free Full Text].
|
| 26.
|
Lai, M. M. C.,
P. R. Brayton,
R. C. Armen,
C. D. Patton,
C. Pugh, and S. A. Stohlman.
1981.
Mouse hepatitis virus A59: mRNA structure and genetic localization of the sequence divergence from hepatotropic strain MHV-3.
J. Virol.
39:823-834[Abstract/Free Full Text].
|
| 27.
|
Lai, M. M. C., and S. A. Stohlman.
1978.
RNA of mouse hepatitis virus.
J. Virol.
26:236-242[Abstract/Free Full Text].
|
| 28.
|
Langford, M. P.,
D. A. Weigent,
G. J. Stanton, and S. Baron.
1981.
Virus plaque reduction assay for interferon: microplaque reduction assays, p. 330-346.
In
S. Petska (ed.), Methods in enzymology. Academic Press, New York, N.Y.
|
| 29.
|
Lee, H.-J.,
C.-K. Shieh,
A. E. Gorbalenya,
E. V. Koonin,
N. La Monica,
J. Tuler,
A. Bagdzhadzhyan, and M. M. C. Lai.
1991.
The complete sequence (22 kilobases) of murine coronavirus gene 1 encoding the putative proteases and RNA polymerase.
Virology
180:567-582[CrossRef][Medline].
|
| 30.
|
Leibowitz, J. L.,
K. C. Wilhemsen, and C. W. Bond.
1981.
The virus-specific intracellular RNA species of two murine coronaviruses: MHV-A59 and MHV-JHM.
Virology
114:39-51[CrossRef][Medline].
|
| 31.
|
Li, X.-L.,
J. A. Blackfoot, and B. A. Hassel.
1998.
RNase L mediates the antiviral effect of interferon through a selective reduction in viral RNA during encephalomyocarditis virus infection.
J. Virol.
72:2752-2759[Abstract/Free Full Text].
|
| 32.
|
Makino, S.,
M. Joo, and J. K. Makino.
1991.
A system for study of coronavirus mRNA synthesis: a regulated, expressed subgenomic defective interfering RNA results from intergenic site insertion.
J. Virol.
65:6031-6041[Abstract/Free Full Text].
|
| 33.
|
Makino, S.,
C.-K. Shieh,
J. G. Keck, and M. M. C. Lai.
1988.
Defective interfering particles of murine coronavirus: mechanism of synthesis of defective viral RNAs.
Virology
163:104-111[CrossRef][Medline].
|
| 34.
|
Nicholson, D. W., and N. A. Thornberry.
1997.
Caspases: killer proteases.
Trends Biochem. Sci.
22:299-306[CrossRef][Medline].
|
| 35.
|
Nolan-Sorden, N. L.,
K. Lesiak,
B. Bayard,
P. F. Torrence, and R. H. Silverman.
1990.
Photochemical crosslinking in oligonucleotide-protein complexes between a bromine-substituted 2-5A analog and 2-5A-dependent RNase by ultraviolet lamp or laser.
Anal. Biochem.
184:298-304[CrossRef][Medline].
|
| 36.
|
Pachuk, C. J.,
P. J. Bredenbeek,
P. W. Zoltick,
W. J. M. Spaan, and S. R. Weiss.
1989.
Molecular cloning of the gene encoding the putative polymerase of mouse hepatitis virus, strain A59.
Virology
171:141-148[CrossRef][Medline].
|
| 37.
|
Raue, H. A., and R. J. Planta.
1991.
Ribosome biogenesis in yeast.
Prog. Nucleic Acid Res. Mol. Biol.
41:89-129[Medline].
|
| 38.
|
Rowe, C. L.,
S. C. Baker,
M. J. Nathan, and J. O. Fleming.
1997.
Evolution of mouse hepatitis virus: detection and characterization of spike deletion variants during persistent infection.
J. Virol.
71:2959-2969[Abstract].
|
| 39.
|
Sawicki, S. G., and D. L. Sawicki.
1986.
Coronavirus minus-strand RNA synthesis and effect of cycloheximide on coronavirus RNA synthesis.
J. Virol.
57:328-334[Abstract/Free Full Text].
|
| 40.
|
Sen, G. C., and P. Lengyel.
1992.
The interferon system: a bird's eye view of its biochemistry.
J. Biol. Chem.
267:5017-5020[Free Full Text].
|
| 41.
|
Senanayake, S. D., and D. A. Brian.
1999.
Translation from the 5' untranslated region (UTR) of mRNA 1 is repressed but that from the 5' UTR of mRNA 7 is stimulated in coronavirus-infected cells.
J. Virol.
73:8003-8009[Abstract/Free Full Text].
|
| 42.
|
Siddell, S.,
H. Wege,
A. Barthel, and V. ter Meulen.
1981.
Coronavirus JHM: intracellular protein synthesis.
J. Gen. Virol.
53:145-155[Abstract/Free Full Text].
|
| 43.
|
Siddell, S.,
H. Wege,
A. Barthel, and V. ter Meulen.
1981.
Intracellular protein synthesis and the in vitro translation of coronavirus JHM mRNA.
Adv. Exp. Med. Biol.
142:193-207[Medline].
|
| 44.
|
Siddell, S.,
H. Wege,
A. Barthel, and V. ter Meulen.
1980.
Coronavirus JHM: cell-free translation of structural protein p60.
J. Virol.
33:10-17[Abstract/Free Full Text].
|
| 45.
|
Silverman, R. H.
1997.
2-5A-dependent RNase L: a regulated endoribonuclease in the interferon system, p. 515-551.
In
G. D'Alessio, and J. F. Riordan (ed.), Ribonucleases: structure and function. Academic Press, New York, N.Y.
|
| 46.
|
Silverman, R. H.,
J. J. Skehel,
T. C. James,
D. H. Wreschner, and I. M. Kerr.
1983.
rRNA cleavage as an index of ppp(A2'p)nA activity in interferon-treated encephalomyocarditis virus-infected cells.
J. Virol.
46:1051-1055[Abstract/Free Full Text].
|
| 47.
|
Sturman, L. S.,
K. V. Holmes, and J. Behnke.
1980.
Isolation of coronavirus envelope glycoproteins and interaction with the viral nucleocapsid.
J. Virol.
33:449-462[Abstract/Free Full Text].
|
| 48.
|
Suarez, P.,
M. Diaz-Guerra,
C. Prieto,
M. Esteban,
J. M. Castro,
A. Nieto, and J. Ortin.
1996.
Open reading frame 5 of porcine reproductive and respiratory syndrome virus as a cause of virus-induced apoptosis.
J. Virol.
70:2876-2882[Abstract].
|
| 49.
|
Tahara, S. M.,
C. C. Bergmann,
G. W. Nelson,
R. P. Anthony,
T. A. Dietlin,
S. Kyuwa, and S. A. Stohlman.
1994.
Effects of mouse hepatitis virus infection on host cell metabolism.
Adv. Exp. Med. Biol.
342:111-116.
|
| 50.
|
Tahara, S. M.,
T. A. Dietlin,
C. C. Bergmann,
G. W. Nelson,
S. Kyuwa,
R. P. Anthony, and S. A. Stohlman.
1994.
Coronavirus translation regulation: leader affects mRNA efficiency.
Virology
202:621-630[CrossRef][Medline].
|
| 51.
|
Tahara, S. M.,
T. A. Dietlin,
G. W. Nelson,
S. A. Stohlman, and D. J. Manno.
1998.
Mouse hepatitis virus nucleocapsid protein as a translational effector of viral mRNAs.
Adv. Exp. Med. Biol.
440:313-318[Medline].
|
| 52.
|
Vennema, H.,
G.-J. Godeke,
J. W. A. Rossen,
W. F. Voorhout,
M. C. Horzinek,
D.-J. E. Opstelten, and P. J. M. Rottier.
1996.
Nucleocapsid-independent assembly of coronavirus-like particles by co-expression of viral envelope protein genes.
EMBO J.
15:2020-2028[Medline].
|
| 53.
|
Wege, H.,
S. Siddell, and V. ter Meulen.
1982.
The biology and pathogenesis of coronaviruses.
Curr. Top. Microbiol. Immunol.
99:165-200[Medline].
|
| 54.
|
Wreschner, D.,
D. Melloul, and M. Herzberg.
1978.
Interaction between membrane functions and protein synthesis in reticulocytes: specific cleavage of 28S ribosomal RNA by a membrane constituent.
Eur. J. Biochem.
85:233-240[CrossRef][Medline].
|
| 55.
|
Zhou, A.,
J. Paranjape,
T. L. Brown,
H. Nie,
S. Naik,
B. Dong,
A. Chang,
B. Trapp,
R. Fairchild,
C. Colmenares, and R. H. Silverman.
1997.
Interferon action and apoptosis are defective in mice devoid of 2',5'-oligoadenylate-dependent RNase L.
EMBO J.
16:6355-6363[CrossRef][Medline].
|
Journal of Virology, October 2000, p. 8793-8802, Vol. 74, No. 19
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bechill, J., Chen, Z., Brewer, J. W., Baker, S. C.
(2008). Coronavirus Infection Modulates the Unfolded Protein Response and Mediates Sustained Translational Repression. J. Virol.
82: 4492-4501
[Abstract]
[Full Text]
-
Mroczek, S., Kufel, J.
(2008). Apoptotic signals induce specific degradation of ribosomal RNA in yeast. Nucleic Acids Res
36: 2874-2888
[Abstract]
[Full Text]
-
Silverman, R. H.
(2007). Viral Encounters with 2',5'-Oligoadenylate Synthetase and RNase L during the Interferon Antiviral Response. J. Virol.
81: 12720-12729
[Full Text]
-
Yang, C.-W., Yang, Y.-N., Liang, P.-H., Chen, C.-M., Chen, W.-L., Chang, H.-Y., Chao, Y.-S., Lee, S.-J.
(2007). Novel Small-Molecule Inhibitors of Transmissible Gastroenteritis Virus. Antimicrob. Agents Chemother.
51: 3924-3931
[Abstract]
[Full Text]
-
Ye, Y., Hauns, K., Langland, J. O., Jacobs, B. L., Hogue, B. G.
(2007). Mouse Hepatitis Coronavirus A59 Nucleocapsid Protein Is a Type I Interferon Antagonist. J. Virol.
81: 2554-2563
[Abstract]
[Full Text]
-
Scherbik, S. V., Paranjape, J. M., Stockman, B. M., Silverman, R. H., Brinton, M. A.
(2006). RNase L Plays a Role in the Antiviral Response to West Nile Virus. J. Virol.
80: 2987-2999
[Abstract]
[Full Text]
-
Sobol, P. T., Mossman, K. L.
(2006). ICP0 Prevents RNase L-Independent rRNA Cleavage in Herpes Simplex Virus Type 1-Infected Cells. J. Virol.
80: 218-225
[Abstract]
[Full Text]
-
Uno, T., Hirabayashi, K., Murai, M., Yano, J., Ozato, K.
(2005). The role of IFN regulatory factor-3 in the cytotoxic activity of NS-9, a polyinosinic-polycytidylic acid/cationic liposome complex, against tumor cells. Molecular Cancer Therapeutics
4: 799-805
[Abstract]
[Full Text]
-
Imbeaud, S., Graudens, E., Boulanger, V., Barlet, X., Zaborski, P., Eveno, E., Mueller, O., Schroeder, A., Auffray, C.
(2005). Towards standardization of RNA quality assessment using user-independent classifiers of microcapillary electrophoresis traces. Nucleic Acids Res
33: e56-e56
[Abstract]
[Full Text]
-
Chen, C.-J., Makino, S.
(2004). Murine Coronavirus Replication Induces Cell Cycle Arrest in G0/G1 Phase. J. Virol.
78: 5658-5669
[Abstract]
[Full Text]
-
Banerjee, S., Narayanan, K., Mizutani, T., Makino, S.
(2002). Murine Coronavirus Replication-Induced p38 Mitogen-Activated Protein Kinase Activation Promotes Interleukin-6 Production and Virus Replication in Cultured Cells. J. Virol.
76: 5937-5948
[Abstract]
[Full Text]