INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The recent sequencing of the genomes of several fungus-transmitted rod-shaped viruses (furoviruses and furo-like viruses) has revealed members of the Pecluvirus, Furovirus, and Pomovirus genera to possess genomic RNAs with a tRNA-like structure (TLS) at the 3' end of the 3'-untranslated region (7, 17). All of these TLSs can be specifically and efficiently aminoacylated with valine and thus are functionally related in their in vitro properties to the TLSs of tymoviruses (7). The TLSs of the furoviruses and pomoviruses are indeed closely related in structure to the TLSs of Turnip yellow mosaic virus (TYMV) and other tymoviruses, while the TLSs of Peanut clump and Indian peanut clump pecluvirus RNAs have a 42-nucleotide (nt) insert between the aminoacyl acceptor/T and anticodon/ D halves of a TYMV-like TLS (see Fig. 1) (7). A unique aspect of the TLSs of the two peanut clump virus genomic RNAs is the association of a valine anticodon and efficient valine acceptance with the TLS of RNA1 but the absence of both from the TLS of RNA2 due to a single nucleotide deletion (see Fig. 1) (7, 8, 12). Such differential aminoacylation properties have not been previously described for a plant virus and suggest the existence of RNA component-specific regulation of some aspect of the virus replication cycle in a way that is sensitive to the aminoacylation status of the RNA.

Apart from the tymoviruses and furo-like viruses mentioned above, aminoacylatable TLSs are also found in the genomes of bromoviruses, cucumoviruses, hordeiviruses and tobamoviruses (13). The functions of TLSs in viral biology have been studied in the TYMV and Brome mosaic virus (BMV) systems by investigating the effects of mutations that decrease or effectively abolish the aminoacylation capacity of the viral RNA. Point mutations in the CAC valine anticodon of the genomic RNA of TYMV (a monopartite virus) resulted in parallel losses of in vitro valine binding and replication in protoplasts (18). Because valine identity is strongly centered on the middle and 3' anticodon nucleotides (4), single or double mutations at these positions decrease valine charging to background levels. Such mutant genomic RNAs are noninfectious to Chinese cabbage plants and replicate to trace levels (0.2% of wild type) in protoplasts (18), demonstrating the importance of an intact valine anticodon. Conversion of aminoacylation identity from valine to methionine, in part by mutation of the anticodon, further demonstrated that efficient aminoacylation rather than the presence of a valine anticodon is required for infectivity and amplification in protoplasts (5). Although we have found means to circumvent the requirement for aminoacylation with chimeric TYMV genomes bearing heterologous 3' termini (7), wild-type TYMV RNA clearly has a strong requirement for efficient aminoacylation.

Experiments with BMV, whose three genomic RNAs have near-identical TLSs that accept tyrosine, have also utilized mutations designed to specifically decrease the RNAs' aminoacylation efficiency (2). However, since the tyrosine identity elements within the BMV TLS have not been mapped, strong point mutations of the type used with TYMV RNA were not available and the role of aminoacylation has not been so clearly identified. The presence of aminoacylation mutations on RNA3, which does not encode essential replication proteins, has little if any influence on RNA amplification (3, 16). On the other hand, marked decreases in viral RNA amplification in protoplasts result when these mutations are present on RNA1 (6; A. L. N. Rao, personal communication) and RNA2 (16), which encode essential RNA replication proteins. These observations suggest that the role of aminoacylation in a multipartite virus can differ among the genomic RNAs. This could be a consequence of the increased debilitation of a replication defect in an RNA component that itself encodes an essential replication protein (an RNA replicated in cis) compared to the same defect in an RNA not encoding an essential protein (an RNA replicated in trans).

Peanut clump virus (PCV) was chosen as an excellent system for further studying the role of aminoacylation in a multipartite virus, with likely differential effects of aminoacylation on RNAs replicated in cis and in trans. Because of the similarity of the PCV TLS to that from TYMV, strong point mutations with known effects on valylation were available. A differential role for aminoacylation of RNA1 and RNA2 in the bipartite PCV genome was suggested by the existence of an intact GAC valine anticodon in RNA1 (8) but an incomplete GC anticodon in RNA2 (see Fig. 1) (12). The PCV RNA1 TLS can be valylated as efficiently as the TYMV TLS and tRNA^Val, but virtually no valylation was detected for the RNA2 TLS (7). PCV RNA1 (5,897 nt) encodes all the essential viral replication proteins and is able to replicate independently in protoplasts (9). PCV RNA2 (4,503 nt) encodes proteins involved in viral spread through the plant and probably in fungus transmission (9).

In order to address the role of valylation in the bipartite genome of PCV, we have compared the amplification of viral RNAs in protoplasts and plants after inoculation with valylation-proficient and -deficient variants of both genomic RNAs. We find that valylatability is not essential for infectivity, although valylatable RNAs 1 and 2 are able to outcompete nonvalylatable RNAs during virus amplification in plants. These results differ sharply from the effects of similar mutations in TYMV RNA. Our results also indicate that the differential valylatability of PCV RNAs 1 and 2 does not serve a critical regulatory function in plants and is not characteristic of all Pecluvirus isolates.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Preparation of wild-type and mutant genomic RNAs. A 380-bp fragment containing the 3' TLS of PCV RNA1 was subcloned from pPC1, which contains full-length infectious RNA1 sequences (9), into the phagemid pLITMUS39 (New England Biolabs) using NheI and MluI restriction enzymes. The corresponding 358-bp RNA2 fragment from pPC2 (9) was subcloned using SpeI and HindIII. Single-stranded deoxyuridine-containing encapsidated DNA was prepared using M13K07 helper phage, and oligonucleotide-directed mutagenesis was performed as described before (11). The following mutagenic deoxyoligomers, with anticodon sequences underlined, were used (note that the RNA1 and RNA2 sequences were cloned in opposite orientations): AAGTGTCGTGCTTGACACTCCCGA and AAGTGTCGTTGGTTGACACTCCCGA for mutation of the RNA1 TLS to GC and CCA anticodons, respectively; GAGTGTCAAGACACGACACTTAGTGGCT and GAGTGTCAACCAACGACACTTAGTGGCT for mutation of the RNA2 TLS to GAC and CCA anticodons, respectively. After sequencing of the entire subcloned fragments, each mutated sequence was returned to the full-length genomic clones using the restriction sites mentioned above.

Aminoacylation analysis. To test the valine acceptance after mutation of the anticodon, 136- or 135-nt-long RNAs comprising the TLS adjacent to a heterologous stem-loop (PCV1-SLTLS and PCV2-SLTLS and their variants; see Fig. 1) were prepared by T7 transcription from PCR-generated template DNA as described previously (7). Valine acceptance was assessed by incubation with partially purified wheat germ valyl-tRNA synthetase in TM buffer (25 mM Tris-HCl [pH 8.0], 2 mM MgCl₂, 1 mM ATP, and 0.1 mM spermidine) and 10 µM [³H]valine at 30°C (7).

Inoculation and analysis of protoplasts and plants. Protoplasts were prepared from Nicotiana tabacum suspension cell line BY-2 (10), and 10⁶ protoplasts were inoculated by electroporation with 5 µg each of capped RNA1 and RNA2 transcripts as described before (9). Total nucleic acids were extracted 48 h postinoculation.

Sequence analysis of progeny RNA isolated from infected plants. Total RNA was extracted from 200 mg of N. benthamiana leaves as described above. The RNAs were 3' polyadenylated using Escherichia coli poly(A) polymerase (Gibco-BRL), and subjected to reverse transcription-PCR (RT-PCR), using T₃₅GG to prime reverse transcription and as the downstream PCR primer. To amplify RNA1 and RNA2 3' sequences, the upstream primers AGCGAGAAACTCTGTTGGCT and CATAGCTTTTGCATCCTACTAC, respectively, were used. This resulted in amplification of a 436- or 435-bp product from RNA1 and a 373/372-bp product from RNA2. The specificity of these amplifications was verified with test template mixtures.

Nucleotide sequence accession number. The 3'-untranslated region of RNA2 from strain PO2A has been deposited in GenBank (accession no. AJ277545).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Valylation mutants of PCV RNAs 1 and 2. In order to investigate the role of valylation in PCV, mutations were introduced into the anticodons of the RNA1 and RNA2 TLSs, permitting the influence of GAC, GC, and CCA anticodons (Fig. 1) to be tested for each genomic RNA. A GAC anticodon, as present in the wild-type sequence of RNA1 of PCV (isolate PCV2; reference 8), results in highly efficient valylation. A GC anticodon, present in the wild-type sequence of PCV RNA2 (isolate PCV2; reference 12), lacks the central nucleotide of the anticodon and directs virtually no valylation: the V_max/K_m ratio for valylation of the PCV RNA2 TLS is 7.6 × 10⁴ relative to that for the RNA1 TLS (7). A CCA anticodon in the structurally related TYMV TLS results in a similar loss of valylatability (18). This anticodon sequence was chosen because of its strong effect on viral replication in the TYMV system. Inoculation of Chinese cabbage protoplasts with genomic RNA bearing a CCA anticodon led to 0.002 times the levels of coat protein accumulated after inoculation with wild-type TYMV RNA, and the mutant RNA was not infectious in plants (18). Interconversion between the GAC, GC, and CCA anticodons by mutation during plant inoculation experiments is unlikely in view of the deletion or triple substitutions distinguishing these anticodons.

View larger version (20K): [in this window] [in a new window]   FIG. 1.   Sequences and proposed secondary structures of TYMV and PCV TLSs. The main structural features of the TLSs are depicted on the TYMV structure: T and D loops analogous to those of tRNAs, the acceptor/T arm pseudoknot indicated by helical segments S1 and S2 and connecting loops L1 and L2, and the major valine identity nucleotides (arrowheads) in the anticodon loop (anticodon underlined), which are recognized by valyl-tRNA synthetase. The nucleotide in reverse shading in the PCV RNA2 TLS is one of the two nucleotides that differ from the PCV RNA2 TLS sequence. The other difference, a single nucleotide deletion in the anticodon of PCV RNA2, is shown with a dash. The stem-loop (5'-SL) structure shown beside the PCV RNA1 TLS is present at the 5' end of the PCV RNA1 and -2 TLS RNAs used for in vitro valylation assays and is represented by "SL" in each structure. Nucleotides shown in lowercase at the 3' ends of the PCV RNA1 and -2 TLSs are of nonviral origin, derived from the MluI and HindIII linearization, respectively, of plasmid templates used to make the infectious transcripts used in in vivo replication experiments. Those nucleotides are not present in the SLTLS transcripts used for valylation assays. During plant cell inoculation, the additional nucleotides are thought to be removed by exonuclease action and repair of the 3' CCA by CCA nucleotidyltransferase or by internal initiation during minus-strand synthesis. The mutations introduced into the RNA1 and RNA2 anticodons are indicated below the structures. TLS nucleotides are numbered from the 3' A of the viral sequences.

View larger version (20K): [in this window] [in a new window]   FIG. 2.   Comparison of the in vitro valylation profiles of PCV RNA1 and -2 TLSs with GAC, GC, and CCA anticodons. RNAs comprising the TLS and the additional 5' stem-loop (SLTLS RNAs as shown in Fig. 1) were valylated with wheat germ valyl-tRNA synthetase in TM buffer. The valylation profiles of SLTLS RNAs 1GC, 1CCA, and 2CCA coincided with that of the water control and are omitted from the graph for reasons of clarity.

RNA accumulation in protoplasts is affected by anticodon mutations in RNA1 but not in RNA2. BY-2 tobacco protoplasts were inoculated with all combinations of the valylatable and nonvalylatable capped genomic transcripts. Since RNA1 is able to replicate independently in protoplasts, replication of the RNA1 mutants was also studied without RNA2 coinoculation. Total RNA was extracted from protoplasts 48 h postinoculation, and RNA1 and RNA2 were detected by Northern blot hybridization using a 124-nt riboprobe complementary to the PCV TLSs. The use of a probe that hybridizes equally to both genomic RNAs enabled a direct comparison of RNA1 and RNA2 levels.

View larger version (56K): [in this window] [in a new window]   FIG. 3.   Northern blot analysis of PCV RNAs with GAC, GC, and CCA anticodons amplified in tobacco BY-2 protoplasts. Protoplasts (106) were inoculated with the RNA1 variants or with all possible combinations of RNA1 and -2 transcripts as indicated above each lane. At 48 h postinfection, total RNAs were extracted and separated on a 1% agarose gel, and the viral RNAs were detected by Northern hybridization using a riboprobe complementary to the 3'-most 124 nt, whose sequences are almost identical in RNA1 and 2. The positions of RNA1 and -2 are indicated at the left. The relative accumulations of RNA1 and RNA2, as well as the RNA1/RNA2 ratios, are shown beneath each lane (averages of three independent inoculations).

All anticodon mutants are similarly infectious in whole plants. N. benthamiana plants, systemic hosts for PCV, were inoculated with the same combinations of RNA1 + RNA2 used above. Surprisingly, in view of the protoplast results, symptoms developed at similar times (6 to 8 dpi) and to similar severities in all inoculated plants. At 11 dpi, total RNA was extracted from apical leaves, and the viral genomic RNAs were detected by Northern blotting (Fig. 4). Similar levels of viral RNA were present in all plants, with at most only a slight reduction in RNA1 accumulations for infections including nonvalylatable RNA1 relative to those with RNA 1GAC (Fig. 4, lanes 2 and 3, 5 and 6, and 8 and 9; cf. lanes 1, 4, and 7). No systematic differences were observed in RNA2 accumulations among the various infections. Note that, for unknown reasons, RNA1/RNA2 ratios are typically lower in whole plant extracts than in protoplast extracts (9).

View larger version (69K): [in this window] [in a new window]   FIG. 4.   Northern blot analysis of PCV RNAs with GAC, GC, and CCA anticodons amplified in N. benthamiana plants. The indicated RNA1 + RNA2 combinations (as in Fig. 3) were inoculated onto N. benthamiana plants. Total RNAs were extracted at 11 dpi and separated on a 1% agarose gel, and the positive strands of the viral RNA genome were detected by Northern hybridization as in Fig. 3. The positions of RNAs 1 and 2 are indicated at left. The relative accumulations of RNA1 and RNA2, as well as the RNA1/RNA2 ratios, are shown beneath each lane.

Competition experiments in plants indicate an advantage for valylation of both RNA1 and RNA2. In order to explore further a possible role of valylation in N. benthamiana plants and the difference from the results obtained with protoplasts, coinoculations involving two RNA1 or two RNA2 variants (together with the other wild-type genomic RNA) were conducted, permitting direct competition between the two genotypes to occur in planta. At 11 dpi, both apical and inoculated leaves were collected separately for total RNA extraction and 3' sequencing of RNA1 and RNA2 as described above. Mixed sequences involving the GC anticodon were readily evident in the fluorescent dye trace generated by the automated sequencer, with a clear transition from a single sequence to a mixed sequence occurring at the anticodon (Fig. 5). By sequencing known mixtures of GAC and GC or CCA and GC DNAs in the ratios 5:1, 2:1, and 1:1, we verified that isolated nucleotides downstream of the anticodon could be used to estimate the allele ratio by determining the extent of peak splitting into a doublet; the relative peak areas of each peak in the doublet were proportional to the input GAC/GC ratios. Thus, three or four peaks in the fluorescence profile (Fig. 5), which became doublets when both 3-nt (GAC or CCA) and 2-nt (GC) anticodons were present, were used to estimate the ratio of alleles present in the viral RNAs extracted from the plants. The identification of mixed sequences containing GAC and CCA anticodons relied on the sequence of the anticodon triplet alone. Test mixtures verified that both alleles in a mixture with a GAC/CCA ratio of 1:1 could be detected.

View larger version (49K): [in this window] [in a new window]   FIG. 5.   Sequence profile of the RNA1 from apical leaves of the mixed inoculations of wild-type RNA 1GAC and RNA 1GC. The sequence profile was obtained from the RT-PCR products whose template RNAs had been extracted from the inoculated and apical leaves of an N. benthamiana plant 11 dpi with an equal amount of the 5'-capped RNA 1GAC and RNA 1GC transcripts. No mixed nucleotide peak was observed in the profile upstream of the second nucleotide of the anticodon (boxed, upper panel), where the signal of A overlaps with that of C. The 1-nt-shifted peaks (examples of such red and blue doublets are indicated on the right of the upper panel) were evident throughout the remaining viral sequence. The doublet peak areas representing G6, C14, C19, and T24 shown in the lower panel (refer to Fig. 1) were measured and used to estimate the ratio of wild-type to mutant RNA in the extract.

A GAC anticodon is present in the RNA2 TLS of PCV isolate PO2A. The indication from our competition experiments that valylatability of RNA2 should be a selection criterion in the evolution and maintenance of PCV suggests that isolate PCV2 is not an optimized strain. In order to see whether RNA2 in another PCV strain has the expected GAC anticodon, we sequenced the 3'-untranslated region of RNA2 from strain PO2A. The origin of strain PO2A has been described by Manohar et al. (12). The only difference from RNA2 of strain PCV2 in the 3' 200 nt (i.e., including the entire TLS) is the presence in strain PO2A of a GAC instead of a GC anticodon. This result makes it clear that there is no fundamental requirement for a GC anticodon in the RNA2 TLS of PCV.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Protoplast and plant experiments with valylatable and nonvalylatable PCV RNAs 1 and 2 have clearly demonstrated that the GAC valine anticodon and the capacity for efficient valylation are not essential properties for the amplification of either RNA1 or RNA2, nor for PCV infectivity in general. This result contrasts sharply with results from the TYMV system, in which the loss of valylatability through mutation of the valine anticodonincluding mutation to the same CCA anticodon as studied in this paper with PCVabrogated infectivity (18). Nevertheless, while nonvalylatable PCV mutants supported efficient infections in plants (Fig. 4), definite replicational advantages were observed for the valylatable RNA1 (RNA 1GAC) over the two nonvalylatable variants, both in N. tabacum BY-2 protoplasts (Fig. 3) and in competition experiments in N. benthamiana plants (Fig. 5 and Table 1). A similar replicational advantage of the RNA 2GAC allele was also observed in the plant competition experiments (Table 1), even though the natural sequence of RNA2 of the PCV2 isolate of PCV is a GC anticodon (12). Differential effects were observed between the GC and CCA mutations in both protoplasts (Fig. 3) and in the whole plant competition experiments (Table 1), but the reasons for these differences are not understood.

We conclude that an intact valine anticodon and the resultant valylatability are mildly advantageous attributes to both of the PCV genomic RNAs, perhaps more so for RNA1, although the protoplast and whole plant experiments differ on this point, for unknown reasons that may be related to the specific host cell. Our protoplast results indicating a greater role for valylation in RNA1 than in RNA2 are reminiscent of results from the BMV system, in which nonaminoacylation mutations are more critical in RNA1 and in RNA2 than in RNA3 (6). BMV RNA1 and PCV RNA1 both encode essential replication proteins whose action may be at least partially cis-limited, acting preferentially (presumably at the earliest stages of an infection) on the replication of RNA1 itself. Aminoacylation may play a role in this process and so be more crucial for those RNAs of a multipartite virus that are replicated in cis than for those replicated in trans (BMV RNA3 and PCV RNA2). There is no information on what mechanistic role valylation plays in the replication of PCV, nor on whether that role is similar to, though less crucial than, the postulated role of valylation in the regulated suppression of minus-strand synthesis in the TYMV system (1).

Curiosity about the significance of the differential valylation of RNA1 and -2 from the PCV2 isolate was a major incentive in conducting these studies. Protoplast inoculations failed to detect any effect of RNA valylatability on the accumulation of positive- relative to negative-sense RNA1 or RNA2, and thus on RNA1/RNA2 ratios (Fig. 3 and data not shown). We had imagined that differential valylatability might have evolved because of an involvement in the fine regulation of viral RNA synthesis. However, the plant competition experiments make it clear that a valylatable RNA2 with a GAC anticodon is at a competitive advantage over the GC anticodon of RNA2 of isolate PCV2, at least in N. benthamiana plants. In this regard, the sequences of other PCV or Indian PCV isolates should be informative. Indeed, we find that RNA2 from PCV isolate PO2A possesses a GAC instead of GC anticodon. The same is true of RNA2 from the closely related Indian peanut clump virus, L serotype (15), whose RNA1 contains a valylatable TLS very similar to that of PCV RNA (7, 14).

It thus appears that a GC anticodon has become fixed in RNA2 of the PCV2 isolate by a replicational error and that differential valylation is not an important biological trait nor a defining characteristic of the Pecluviridae. The survival of this mutation is indicative of the minor role played by valylation in the PCV system, especially in the case of RNA2. Nevertheless, sufficient advantage is conferred during infections in N. benthamiana plants for the selection of RNAs 1 and 2 with intact GAC valine anticodons that are capable of efficient valylation. Further studies are needed to determine whether this selective advantage is mechanistically related to the crucial role of valylation in TYMV.