Previous Article | Next Article 
Journal of Virology, September 2000, p. 8307-8315, Vol. 74, No. 18
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Development of Minimal Lentivirus Vectors Derived
from Simian Immunodeficiency Virus (SIVmac251) and Their Use for
Gene Transfer into Human Dendritic Cells
Philippe-Emmanuel
Mangeot,1
Didier
Nègre,2
Bertrand
Dubois,3
Arend J.
Winter,4
Philippe
Leissner,4
Majid
Mehtali,4
Dominique
Kaiserlian,3
François-Loïc
Cosset,2 and
Jean-Luc
Darlix1,*
LaboRetro1 and
Vectorologie Rétrovirale & Thérapie Génique,
Unité de Virologie Humaine (INSERM-ENS no.
412),2 69364 Lyon, Immunité des
muqueuses et Vaccination, INSERM no. 404, 69365 Lyon,3 and Transgene SA, 67000 Strasbourg,4 France
Received 11 February 2000/Accepted 16 June 2000
 |
ABSTRACT |
Lentivirus-derived vectors are very promising gene delivery systems
since they are able to transduce nonproliferating differentiated cells,
while murine leukemia virus-based vectors can only transduce cycling
cells. Here we report the construction and characterization of highly
efficient minimal vectors derived from simian immunodeficiency virus
(SIVmac251). High-fidelity PCR amplification of DNA fragments was used
to generate a minimal SIV vector formed from a 5' cytomegalovirus early
promoter, the 5' viral sequences up to the 5' end of gag required for reverse transcription and packaging, the Rev-responsive element, a gene-expressing cassette, and the 3' long terminal repeat
(LTR). Production of SIV vector particles was achieved by transfecting
293T cells with the vector DNA and helper constructs coding for the
viral genes and the vesicular stomatitis virus glycoprotein G envelope.
These SIV vectors were found to have transducing titers reaching
107 transducing units/ml on HeLa cells and to deliver a
gene without transfer of helper functions to target cells. The central
polypurine tract can be included in the minimal vector, resulting in a
two- to threefold increase in the transduction titers on dividing or growth-arrested cells. Based on this minimal SIV vector, a
sin vector was designed by deleting 151 nucleotides in the
3' LTR U3 region, and this SIV sin vector retained high
transduction titers. Furthermore, the minimal SIV vector was efficient
at transducing terminally differentiated human CD34+
cell-derived or monocyte-derived dendritic cells (DCs). Results show
that up to 40% of human primary DCs can be transduced by the SIV
vectors. This opens a new perspective in the field of immunotherapy.
 |
INTRODUCTION |
Gene transfer with potential
therapeutic applications represents a very important and exciting
challenge in biology and medicine. To this end, several generations of
retroviral vectors derived from type C retroviruses have been developed
that are capable of delivering a gene into many different cell types.
For example, MLV-based dicistronic vectors were recently found to
efficiently deliver two genes in human multipotent neuronal precursors
(9). However, an important limitation of murine leukemia
virus (MLV)-based vectors is their inability to deliver a gene into
highly differentiated or growth-arrested cells. On the other hand, MLV
vectors can be used in cancer gene therapy (17).
Interestingly enough, lentiviruses are able to infect growth-arrested
cells (19) and this appears to be under the control of
genetic determinants located in the integrase domain and in the
vpx gene encoding a highly basic protein. In support of
these genetic findings, the integrase and Vpx proteins are present in the viral particle and are thought to drive the nuclear import of the
reverse transcription complex, also called the preintegration complex,
probably by interacting with components of the nuclear pore complex
(13). This route of viral infection, which appears to be
unique to lentiviruses in the retrovirus family, has been exploited for
the development of lentivirus vectors derived from human
immunodeficiency virus type 1 (HIV-1) (29, 34), HIV-2 (2), feline immunodeficiency virus (30), equine
infectious anemia virus (24), and more recently simian
immunodeficiency virus (SIV) (37). As expected, these
lentivirus vectors can achieve gene transfer into growth-arrested and
differentiated cells ex vivo and in vivo (28).
Here we report the construction and characterization of several
retroviral vectors based on SIVmac251. The minimal SIV vectors contain
less than 20% of the original viral sequences, and recombinant viruses
produced by 293T cells were found to carry out very efficient gene
transfer into both cycling and growth-arrested cell lines. As a first
step toward gene transfer applications, we used the minimal SIV vectors
to transduce primary human dendritic cells (DCs). The results show that
up to 40% of terminally differentiated DCs can be transduced.
 |
MATERIALS AND METHODS |
Plasmid DNA construction and amplification.
In plasmid
pSIV-TGP, which was constructed by Transgene SA and derives from the
SIVmac251 genome (GenBank accession no. M19499), a green fluorescent
protein (GFP) expression cassette driven by the early cytomegalovirus
(CMV) promoter was inserted in place of the env 5' region
(see Fig. 1) and an early CMV promoter pCMV replaced U3 in the 5' long
terminal repeat (LTR). The pSIV-REV and pMLV-VL30 (GFP) vectors were
provided by Transgene SA.
pSIV3+ is a packaging plasmid described elsewhere (29a).
Briefly, it derives from SIVmac251 in which the 5' region from U3 to
the major splice donor (nucleotides [nt] 967 to 980) was replaced with the human CMV early promoter and enhancer region. In addition, the
5' half of the env gene was removed, leaving intact the RRE (Rev-responsive element) and the 5' and 3' exons of the tat
and rev genes. Furthermore, the 3' LTR was replaced with a
simian virus 40 polyadenylation sequence that deleted the
nef gene.
The pSIV-T1 vector contains the complete 5' encapsidation and
dimerization sequence (E/DLS), the first 218 5' nt of
gag,
and
the last 1,011 3' nt of
pol but out of frame, together
with the
central polypurine tract (cPPT) and the central termination
sequence
(CTS). It has been generated after deletion of a 3,114-nt
HpaI/
DraI
fragment from the original vector
pSIV-TGP. pSIV-T0 was constructed
after deletion of a 4,823-nt
KpnI/
KpnI fragment from pSIV-TGP,
resulting in
deletion of the major splice donor and the putative
E/DLS sequence
while conserving the primer-binding site
(PBS).
To construct pSIV-RMES vectors, we used DNA fragments generated by
primer-directed high-fidelity PCR amplification of the
pSIV-TGP
template. The DNA oligonucleotide primers (oligonucleotides
1 to 12)
that were utilized for the PCR amplifications are as
follows: (5' to
3'): 1, AGGCCTCGAGTTTTATAAAAGAAAAGGGGG (5'-U3);
2, CCGGTACCATGCTAGGGATTTTCCTGC (3'-U5); 3, AGGCCTCGAGAATTCACTTGTACAGCTCGTC
(3'-GFP); 4, GGATCGATCCATTGCATACGTTGTATCCATATC (5'-pCMV); 5, TAGACGCGTGATTGGAGTTGGGAGATTAT
(5'-RRE); 6, GGATCGATGGTCCTTTAAGTACTTCTC (3'-RRE); 7, GCTCTAGAATTCCCATTGCATACGTTG
(5'-pCMV); 8, GGCACGCGTCCTTTTTAAGAAAACAAAATTAATTAATAATTTTTTCAATTCATCTGCTTTCTTCC
(3'-E/DLS); 9, GCCTCGCGATCGCATGAATTTTAAAAGAAGG
(5'-cPPT); 10,
GCCGTACGCGTGAGCTCTGTAATAGACCCGAA
(3'-CTS); 11, TCTGACAGGCCTGACTTGC
(3' in U3); 12, GCAAGTCAGGCCCTGTCAGAACTGCATTTCGCTCTGTA (5' in
U3).
All PCR amplifications for vector construction used a high-fidelity
polymerase protocol (Boehringer Mannheim). PCRs consisted
of 20 cycles
in 50 µl as follows: 94°C for 45 s, 50 to 55°C (depending
on
the primers used) for 45 s, and 72°C (68°C for fragments
longer
than 1,500 nt) for 1 min. The DNA fragments were gel purified
and recovered using the JETSORB protocol
(Genomed).
Construction of pSIV-RMES3.
(i) The 3' PPT LTR was amplified
using primers 1 and 2, and the resulting DNA was cut by KpnI
and XhoI and inserted into pBlueScript KS+. (ii) The
pCMV-GFP cassette was amplified using primers 3 and 4, and the DNA was
cut by ClaI and XhoI and inserted into the
plasmid generated in step i. (iii) The RRE region was amplified using
primers 5 and 6, and the resulting DNA was cut by MluI and ClaI and inserted into the MluI and
ClaI sites in the plasmid generated in step ii. (iv) The 5'
pCMV-R-U5-PBS-Leader and the 5' gag region were amplified
using primers 7 and 8, and the DNA was cut by XbaI and
MluI and inserted into the XbaI and
MluI sites of the plasmid generated in step iii, giving rise
to pSIV-RMES3, where 57 nt of the 5' end of gag are present
(Fig. 1). Note that a stop codon has been engineered 15 nt downstream
of the AUG translation initiation codon of gag.
To construct pSIV-RMES4, the cPPT-CTS domain was amplified using
primers 9 and 10 and the DNA was cut by
MluI and
PvuI (
PacI
compatible) and inserted into
pSIV-RMES3 digested with
MluI and
PacI.
pSIV-RMES4

R derives from pSIV-RMES4, which was cut by
ClaI
and
MluI, Klenow filled, and
religated.
The self-inactivating pSIV-gaMES4sin vector was constructed by means of
a two-step process. (i) To engineer an inactivated
3' LTR with a 151-nt
deletion encompassing the NF-

B and SP1 binding
sites and the TATA
box (positions 9778 to 9928 in SIVmac251),
two DNA fragments were
generated by PCR, one using primers 1 and
11 (deletion in U3) and the
other one using primers 12 and 2 (R-U5).
The two purified DNAs carrying
overlapping sequences were mixed
and subjected to a second round of PCR
amplification using primers
1 and 2. The 3'

-LTR was then cut by
KpnI and
XhoI and inserted
into pBlueScript KS+
as in step i above. (ii) Next, the 3,122-nt
fragment of pSIV-RMES4,
between the
XbaI and
XhoI sites, was inserted
into the above plasmid cut by
XbaI and
XhoI to
generate pSIV-gaMES4sin
(Fig.
1).
Plasmid DNAs were amplified in
Escherichia coli HB101 and
purified using Qiagen
protocols.
Cell culture and differentiation of human CD34+ cells
and monocytes.
HeLa, sMAGI, and 293T cells were cultured at 37°C
in an atmosphere of 5% CO2 and in Dulbecco's modified
Eagle's medium (Life Technologies-Gibco-BRL) complemented with 10%
fetal calf serum (FCS), penicillin (100 IU/ml), streptomycin (100 µg/ml), and L-glutamine (2 mM). The selection medium for
sMAGI cells contained hygromycin (50 µg/ml) and G418 (200 µg/ml).
DCs were generated as previously described (
4), by culturing
human cord blood CD34
+ progenitors in the presence of
recombinant human granulocyte-macrophage
colony-stimulating factor
(rhGM-CSF; specific activity, 2 × 10
6 U/mg; Schering
Plough Research Institute) at 100 ng/ml, recombinant
human tumor
necrosis factor alpha (specific activity, 2 × 10
7
U/ml; Genzyme Corp.) at 2.5 ng/ml (50 U/ml), and stem cell factor
(R&D)
at 25 ng/ml of RPMI 1640 medium (Gibco) supplemented with
10% FCS
(Eurobio), 10 mM HEPES, 2 mM
L-glutamine, 5 × 10
5 M 2-mercaptoethanol, penicillin at 100 U/ml, and
streptomycin
at 100 µg/ml. Cell populations collected on days 8 to 10 contained
70 to 90% CD1a
+ CD80
+ DCs and will
be referred to as CD34
+ cell-derived DCs. The remaining
cells consist of undifferentiated
precursors and other progenitors,
including monocytes and granulocytes
(
4).
Monocyte-derived DCs were established by culturing peripheral blood
monocytes (>90% CD14
+) in complete RPMI 1640 medium
containing rhGM-CSF (100 ng/ml)
and recombinant human interleukin-4 (20 ng/ml; Genzyme Corp.).
After 5 days of differentiation, analysis of
cell markers showed
that 90 to 95% of the cells were CD1a
+
CD14

, indicating that most of the cells had entered into
a dendritic
differentiation
pathway.
Production of SIV vectors.
Transfections of cells were
performed using the calcium phosphate protocol as previously described
(8). For large-scale production, we used the calcium
phosphate transfection kit (Gibco-BRL). The pSIV vectors were produced
in six-well plates by cotransfecting three different plasmids, a SIV
vector (2 µg), the helper pSIV3+ coding for Gag-Pol and the
regulatory viral proteins except Env and Nef (1.7 µg), and pVSV-G
(0.8 µg), into 293T cells seeded the day before transfection at
3.5 · 105 per well. To transfect cells in
10-cm-diameter dishes, amounts of DNAs and volumes were scaled up
sixfold. The medium was replaced after 16 h of incubation.
Vector-containing media were collected at 48 h or twice at 40 and
48 h after transfection (for large-scale production), clarified by
5 min of centrifugation at 800 × g, and filtered through a
0.45-µm-pore-size-filter. For high-titer preparations, SIV vectors
were concentrated by ultracentrifugation at 50,000 × g
for 90 min. The viral pellet was resuspended overnight at 4°C in 50 mM Tris · Cl (pH 8)-130 mM NaCl-1 mM EDTA or in
phosphate-buffered saline.
Transduction and calculation of the titer in transducing
units.
For transduction assays, HeLa or 293T cells were seeded at
1 × 105 to 3 × 105 per well in
12-well plates the day before transduction. At day 1, the medium was
removed and replaced with transduction medium made of 100 µl of
vector, 300 µl of serum-free medium, and Polybrene at 6 µg/ml.
After 3 h of incubation, 1 ml of complete medium was added. At day
1, cells from three nontransduced wells were trypsinized and fixed to
allow calculation of the rate of cell division. At day 3, cells were
trypsinized and GFP expression was analyzed by flow cytometry
(FACScalibur; Becton-Dickinson).
Transduction titers (in transducing units per milliliter) were
calculated using the percentage of GFP-positive cells, the
rate of cell
division between the day of transduction and the
day of analysis, and
the flow of the FACScalibur. Multiple serial
dilutions of
vector-containing medium (1/10, 1/100, and 1/1,000)
were used for the
transduction assays, and titers were calculated
for linearly correlated
values. In addition, experiments were
designed to verify the absence of
pseudotransduction that could
occur using vesicular stomatitis virus
glycoprotein G (VSV-G)
pseudotyping (
21). 293T cells were
transfected with increasing
amounts of the vector,
rev, and
envelope plasmids but without
the helper construct. Results showed that
under these experimental
conditions the medium was unable to confer GFP
expression on HeLa
cells (data not shown). In addition, highly
transduced cells were
transfected with the VSV-G plasmid but the medium
recovered was
also unable to confer GFP expression on naive HeLa cells
(data
not
shown).
Transduction of DCs was performed on 2 × 10
5 cells in
a volume of 200 µl composed of the diluted medium-containing vector
in
2% FCS-RPMI medium-0.12 µg of Polybrene. After 2 h of
incubation
at 37°C, the media were transferred to a 12-well plate and
complemented
with 1 ml of 10% FCS-RPMI 1640 medium in the presence of
rhGM-CSF
and tumor necrosis factor alpha or rhGM-CSF and interleukin-4
for CD34
+ cell-derived and monocyte-derived DCs,
respectively. After 5
days of culture, cells were EDTA treated and
collected for analysis
of GFP expression by fluorescence-activated cell
sorter
(FACS).
Mobilization of the integrated SIV vector.
pSIV-TGP,
pSIV-T1, pSIV-RMES4, and pSIV-gaMES4sin were produced as described
above and used to transduce 293T cells. At 48 h later, most of the
cells scored positive for GFP expression (>75%). At 72 h after
transduction, the same cells were transfected with a mixture containing
Tat-encoding plasmid pSIV3+ (1.8 µg), pSIV-Rev (1.5 µg), and pVSV-G
(0.5 µg). The culture medium was changed 1 day later and then
collected four times at 8-h intervals, filtered, and used to transduce
HeLa cells (400 µl of vector in 400 µl of serum-free Dulbecco's
modified Eagle's medium with Polybrene at 12 µg/ml). Three days
after transduction, HeLa cells were trypsinized and FACS analyzed for
GFP expression.
PCR amplification.
To analyze potential transfer of helper
functions, 293T cells were transduced with either pSIV-gaMES4sin,
pSIV-RMES4, pSIV-T1, or pSIVTGP or left untransduced. For all
constructs, transduction efficiencies reached >70% of GFP-positive
cells. At 48 h after transduction, 106 cells were
trypsinized, pelleted, and resuspended in an excess of lysis buffer
containing 50 mM Tris-HCl (pH 8), 30 mM EDTA, 500 mM LiCl, 0.5% sodium
dodecyl sulfate, 0.1%
-mercaptoethanol, and proteinase K at 100 µg/ml. After 1 h of incubation at 37°C, lysates were phenol
extracted and DNAs were alcohol precipitated. DNAs were resuspended in
pure water and handled to avoid contamination. PCR amplifications were
performed as follows on 100 or 300 ng (for gag) of DNA: 40 cycles of 45 s at 94°C, 45 s at 55°C, and 45 s at
72°C in a 50 µl volume containing 40 µl of H2O, 5 µl of 10× polymerase buffer (Gibco), 2 µl of 25 mM
MgCl2, 0.8 µl of 25 mM deoxynucleoside triphosphate, 5 U
of Taq DNA polymerase (Gibco), and 25 pmol of each primer.
The primers used were as follows: pCMV-GFP, primers 3 and 4 (detailed
in plasmid construction; LTR-E/DLS,
5'-GGCACGCGTCTTCCCTCACAAGACGGAGTTTC and primer 1;
gag, 5'-GCAGATGAATTGAAAAAATTAG-3' and
5'-TTATTATCCCTTCCTGGATAACAAGACAGC-3'.
RCR detection.
To detect a potential replication-competent
virus (RCR) in the SIV vector preparation, pSIV-TGP, pSIV-RMES4, and
pSIV-gaMES4sin were produced in a six-well plate as already described.
Supernatants were clarified and filtered through a 0.45-µm-pore-size
filter, and 1 ml of each vector stock was added to 3 × 105 sMAGI cells in a six-well plate. On the same day, a
SIVmac251 stock whose titer was predetermined at 3 × 103 infectious units (IU)/ml (on sMAGI cells) was diluted
10 and 100 times and 100 µl of the stock or of each dilution was used to infect 3 × 105 naive sMAGI cells in a six-well
plate. Thus, the numbers of infectious units added for each dilution
can be estimated to be 300, 30, and 3. After 24 h, infected and
transduced cells were washed twice and allow to grow for 1 week. Titers
of the three vector stocks and efficiencies of transduction were
determined by FACS analysis of sMAGI cells transduced in a control
experiment. After 7 days, all sMAGI cells were fixed in
phosphate-buffered saline-4% formaldehyde (15 min at 4°C) and
stained for
-galactosidase expression (1 h at 37°C). Infection was
evident in wells infected with the three dilutions of SIVmac251 as
revealed by blue foci of infection. A large number of blue cells were
observed upon transduction with pSIV-TGP, which codes for the
tat gene, but no blue cells were detected upon transduction
with the minimal SIV vectors.
 |
RESULTS |
Construction of minimal SIV vectors.
Starting from the
SIVmac251V molecular clone, the first SIVmac-derived vector (pSIV-TGP)
was constructed by inserting a GFP expression cassette in place of
env and by replacing the 5' LTR U3 region with the CMV early
promoter (pCMV). SIV vector production was achieved by cotransfecting
pSIV-TGP together with pVSV-G, encoding the VSV-G envelope, into 293T
cells. This first SIV vector was found to have GFP transduction titers
on the order of 1.4 × 107 transducing units (TU)/ml
on HeLa cells (Fig. 1 and
2). The strategy used to engineer a
minimal SIV vector was to keep the essential cis elements,
i.e., the LTR, the PBS, the E/DLS, the RRE, and the PPT, on the vector
construct while segregating the viral helper functions on other
constructs (Fig. 1, vector and helper plasmids). Since the E/DLS
packaging signal is thought to extend into the 5' end of gag
(22) (33), a functional E/DLS packaging signal was selected by progressively deleting the gag-pol region.
Deletion of all but the 5' 218 nt of gag did not result in
serious adverse effects on the transduction titer of the SIV vector
(pSIV-T1; Fig. 1 and 2) while removing all of gag and the 3'
100 nt of the leader caused a 40-fold reduction in the transduction
titer (compare pSIV-T0 to pSIV-T1; Fig. 1 and 2). These data indicate
that the 3' end of the leader and the first 5' nucleotide of
gag must be included in a minimal SIV vector since they
probably are part of the E/DLS packaging signal. In agreement with this
result, in vitro SIV RNA dimerization was found to require sequences
located from the PBS to the AUG start codon of gag (data not
shown).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of SIV-derived vectors and
helper plasmids. pSIV-T0, -T1, -RMES, and -gaMES4sin were constructed
as described in Materials and Methods. Viral genes and restriction
sites of interest are indicated on the SIV proviral map. gag
sequences present in the vector constructs are shown in black.
Abbreviations: pCMV, early CMV promoter; LTR SIN, 3' LTR with U3
partially deleted. Note that nef is nonfunctional in all SIV
constructs.
|
|

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 2.
Transduction titers of SIV vectors. All vectors, except
the MLV vector and pSIV-TGP, were produced by cotransfection of 293T
cells with the indicated vector, pSIV3+, and pVSV-G. Vector-containing
supernatants were clarified and diluted before transduction of HeLa
cells. To calculate titers and standard deviations, three distinct
vector preparations were analyzed. The SIV vector constructs are shown
in Fig. 1.
|
|
To systematically examine the role of each of the
cis
elements in the transduction ability of a minimal SIV vector, we used
high-fidelity PCR to amplify viral DNA sequences, enabling careful
construction of a series of minimal SIV vectors named pSIV-RMES
(Fig.
1). The contribution of the 5'
gag sequences was examined
by
shortening this region from 218 nt to a small number of nucleotides.
Results show that it was necessary to include between 32 and 57
nt of
the 5' end of
gag to get a high-titer minimal vector
(pSIV-RMES4
in Fig.
1 and
2; data not
shown).
To evaluate the role of the cPPT, which has been reported to be
important for HIV-1 replication (
6,
7), the cPPT was
not
included in the minimal vector construct giving rise to pSIV-RMES3.
The
cPPT had a small but reproducible positive effect, since its
deletion
caused a two- to threefold decreased in the vector titer
(compare
pSIV-RMES3 and pSIV-RMES4; Fig.
1 and
2).
As expected, deletion of the RRE caused a strong reduction in the
transduction titer but it was interesting that the titer
of
pSIV-RMES

R remained in the range of 10
6 TU/ml (Fig.
1
and
2).
Although transduction titers may vary, the relative efficiencies of the
different SIV vectors were conserved in seven distinct
experiments.
Analysis of RCR.
The helper functions encoding the viral
genes, the envelope, and the SIV vector are segregated on distinct
plasmid constructs (Fig. 1), and this is thought to prevent the
generation of replication-competent SIV-derived viruses. However, 293T
cells are transfected with large quantities of plasmid DNAs in order to
produce large amounts of SIV vector particles and this may be the
source of multiple recombination events giving rise to SIV-derived RCRs
potentially carrying helper functions.
To first examine the potential transfer of helper sequences into
transduced cells, gene amplification assays were performed
on
transduced 293T cells to look for GFP-encoding, LTR, and
gag sequences. After highly efficient transduction with either pSIV-RMES4,
pSIV-gaMES4sin, pSIV-T1, or pSIV-TGP, 293T cells were harvested
and
total DNA was extracted (see Materials and Methods). Specific
DNA
oligonucleotides were used in order to PCR amplify pCMV-GFP,
LTR-E/DLS,
and
gag sequences (see Materials and Methods). As expected,
pCMV-GFP and LTR-E/DLS sequences were amplified in all of the
extracts
derived from transduced cells (Fig.
3A,
lanes 2 to 5),
which is in agreement with the transduction results and
indicates
that reverse transcription and integration did take place. On
the other hand,
gag sequences were solely amplified after
cell
transduction with the pSIV-TGP vector containing the
gag-pol domain
(Fig.
3B, lane 5).
gag
amplification was still detectable in extracts
from cells transduced
with a 100-fold dilution of pSIV-TGP (data
not shown), indicating that
detection of the
gag sequence is not
an effect of the high
titer of the pSIV-TGP stock used to transduce
293T cells. As the
1/100-diluted pSIV-TGP preparation gave 9%
GFP-positive cells, the
gag PCR assay can detect at least one
copy in 10 cells.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
PCR analysis of SIV-directed gene transfer into 293T
cells. Production of pSIV-TGP, pSIV-T1, pSIV-RMES4, and pSIV-gaMES4sin
is described in Materials and Methods. Virus-containing supernatants
were filtered and used to transduce 293T target cells. Three days after
transduction, cells were lysed and genomic DNAs were extracted to
perform PCR amplifications. (A) PCR assays performed on DNA extracted
from transduced 293T cells that corresponds to the pCMV-GFP expression
cassette (1,400 bp) and the 5' LTR-E/DLS region (1,100 bp). (B)
Amplification of gag in transduced cells. The viral
supernatants used to transduce 293T cells were pSIV-gaMES4sin (lane 2),
pSIV-RMES4 (lane 3), pSIV-T1 (lane 4), and pSIV-TGP (lane 5). As
internal controls, PCR assays were performed on nontransduced cells
(lane 1) or H2O (lane 6). DNA extracted from every cell
population allowed amplification of -globin (80-bp bands in panel
A). (C) PCR assays performed on serial dilutions of control plasmids
(pSIV-RMES4 for GFP and pSIV3+ for Gag). Calculated numbers of copies
are indicated. Domains subjected to amplification and localization of
the primers are depicted. While the GFP and LTR-E/DLS regions were
amplified in all of the DNA samples from transduced cells, Gag was
detected only in DNA corresponding to cells transduced with pSIV-TGP
(B, lane 5). In lane 2, note the 150-nt deletion present only in the
LTR DNA from cells transduced with pSIV-gaMES4sin.
|
|
To look for the presence of possible RCRs in a vector stock,
10
6 293T cells were transduced with 1 ml of pSIV-RM4 coding
for

-galactosidase.
At 24 and 36 h later, the supernatant of
the transduced cells
was harvested twice (2 × 10 ml at 12-h
interval) and added to
10
6 naive HeLa cells. After 3 days
of culture, which should allow
the spread of a potential
lacZ-carrying RCR, no blue foci were
detected in
the HeLa culture after
5-bromo-4-chloro-3-indolyl-

-
D-galactopyranoside
(X-Gal)
staining. As 1 ml of vector preparation was originally
used to
transduce 293T cells, the titer of a potential
lacZ-carrying
RCR should be below 1/ml.
Further RCR analysis comes from experiments using sMAGI cells which
carry a
lacZ gene under the control of the HIV-1 LTR.
sMAGI
cells are commonly used as an indicators to detect SIV infection
(
5). sMAGI cells (3 × 10
5) were transduced
with a pSIV-TGP, pSIV-RMES4, or pSIV-gaMES4
vector or left
untransduced. Under the same conditions, a SIVmac251
stock whose titer
had been predetermined was used to infect sMAGI
at different
multiplicities of infection (MOIs) (see Materials
and Methods for
details). After 1 week of culture, blue foci were
detected in sMAGI
cells infected with SIV even at an MOI of 10
5
(calculated, 1 IU of SIVmac/10
5 cells), showing that
infection was productive. Also, blue cells
were detected in cells
transduced with pSIV-TGP, which codes for
Tat. On the other hand, no
sign of infection was detected in sMAGI
cells transduced with either
pSIV-RMES4 or pSIV-gaMES4 after X-Gal
staining. Since the assay using
the sMAGI cell line was able to
detect an infection initiated by a
calculated 3 IU of the wild-type
virus, these results show that the
titer of a potential RCR carrying
the
tat gene is below 3/ml
of SIV vector preparation. The titer
of the pSIV-RMES4 preparation used
in this experiment was 9 ×
10
5 TU/ml. Thus, the
estimated probability of emergence of a Tat-encoding
RCR is around
3 × 10
6.
Construction of a minimal self-inactivating SIV vector.
Due to
the reverse transcription process, replication of the SIV vector will
regenerate two copies of the 3' LTR and both of them will be integrated
into the host genome. The presence of such possibly functional LTRs in
the cellular genome has raised concerns regarding abnormal gene
expression driven by the LTR in transduced cells. This prompted us to
generate a minimal SIV vector with a large deletion in the 3' LTR U3
domain, which encompasses the binding sites for the Elf-1, NF-
B, and
SP1 transcription factors and the TATA box (Fig.
4), which are essential for SIV transcription (31). Deletion of this 151-nt region was
carried out as described in Materials and Methods and enabled
construction of the minimal pSIV-gaMES4sin vector. This minimal SIV
sin vector was found to have a high transduction titer on
HeLa cells (2 × 106 TU/ml; Fig. 2) and was able to
carry out gene transfer in growth-arrested cells with an efficiency
comparable to that of other SIV vectors (see Fig. 6; compare pSIV-T1,
pSIV-RMES4, and pSIV-gaMES4sin).

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 4.
Representation of the SIVmac core enhancer region and
flanking sequences. The SIVmac251 sequence is in the GenBank database
(accession no. M19499). The major functional elements of the core
enhancer and flanking sequences have homology with the same genetic
domain of SIVmac239 (31). Purine-rich regions PuB1 and PuB2
were deduced by homology with HIV-2 (18). Important binding
motifs are boxed and arrows show the sin deletion (positions
334 to 485).
|
|
To verify that the SIV
sin vector was indeed a
self-inactivating vector, we performed mobilization assays to examine
the ability
of Tat to transactivate the LTR in cells transduced either
with
the SIV
sin vector or the parental SIV vector
(pSIV-gaMES4sin
or pSIV-RMES4, respectively; also, Fig.
3, lanes 2 and
3) or with
pSIV-TGP or the pSIV-T1 vector (Fig.
1). Transduced cells
were
cotransfected with the helper constructs pSIV3+, pSIV-REV, and
pVSV-G (Fig.
1 and Materials and Methods). Medium was then collected
at
12-h intervals and put four times onto naive HeLa cells. Results
show
that vector mobilization was very high with the pSIV-TGP
and pSIV-T1
vectors, low with pSIV-RMES4, and close to zero with
the
SIV
sin vector (Fig.
5). On the
basis of FACS analysis, the
sin deletion reduces
mobilization by a factor of 200 in comparision
with pSIV-RMES4 and
1,500 in comparison with pSIV-T1.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Mobilization of the integrated SIV vector. Mobilization
of either pSIV-TGP, pSIV-T1, pSIV-RMES4, or pSIV-gaMES4sin was carried
out as described in Materials and Methods. Briefly, 293T cells
transduced with the indicated vector were cotransfected with pSIV3+,
pSIV-Rev, and pVSV-G. Media of transduced and transfected cells were
used to transduce naive HeLa cells. GFP expression in HeLa cells was
analyzed by FACS 72 h after transduction. Note the high levels of
mobilization obtained for pSIV-TGP and pSIV-T1 (91 and 74%,
respectively). Mobilization of the integrated pSIV-RMES4 vector was
drastically reduced (10% of GFP-positive cells) and <0.1% for the
pSIV-gaMES4sin vector.
|
|
Transduction of growth-arrested human cells.
One major
interest in developing lentivirus vectors resides in their ability to
transduce growth-arrested cells, and this paves the way to a large
number of gene transfer applications impossible to achieve with
MLV-derived vectors. A useful protocol by which to examine the ability
of lentivirus vectors to transduce growth-arrested cells is to
irradiate the target cells in order to block them in the G2
phase (19). To validate the present SIV vectors for the
transduction of growth-arrested cells, 293T cells were
irradiated 1 day before transduction and then GFP gene transfer by the SIV vectors
was measured as before (see Materials and Methods) and compared to that
obtained with an MLV vector under the same conditions. Figure
6 reports the percentages of cell
transduction obtained with the SIV and MLV vectors. Clearly, the
transduction efficiencies of the SIV vectors on growth-arrested cells
are comparable to the values obtained on proliferating cells (Fig. 6).
On the other hand, transduction with the MLV vector was high on cycling
293T cells but about 100-fold lower on arrested cells (Fig. 6).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 6.
SIV vector transduction of proliferating and
growth-arrested human cells. SIV vectors were produced as indicated in
Materials and Methods. The vector-containing medium was filtered and
added to proliferating 293T cells (filled bars) or to 293T cells irradiated at 4,000 rads the day before use (open bars). Two days after
transduction, cells were trypsinized and analyzed by FACS (see
Materials and Methods). Percentages of GFP-positive cells are
indicated. As expected, the MLV vector (pMLV-VL30) was unable to
transduce growth-arrested cells. This result and the relative
efficiencies with which SIV vectors transduced arrested HeLa cells were
reproducible in three separate experiments.
|
|
Similar data were obtained upon transduction of growth-arrested HeLa
cells and medulloblastoma-derived DEV cells (
14) with
the
minimal SIV vectors (data not shown). Taken together, these
findings
indicate that the E/DLS packaging sequence is critical
for the
transduction of arrested cells (Fig.
6, compare pSIV-T0,
pSIV-T1, and
pSIV-RMES4) while the cPPT does not appear to be
a major determinant
(Fig.
6, compare pSIV-RMES4 and pSIV-RMES3).
Transduction of CD34+ cell- and monocyte-derived human
DCs.
DCs are of great interest for gene transfer, since as
antigen-presenting cells they are key actors in the immune response (3). DCs are found in many nonlymphoid tissues such as the skin and mucosa but remain difficult to isolate. In cell cultures, DCs
can be established from CD34+ progenitor cells or from
peripheral blood monocytes by culturing the purified precursors in the
presence of a cocktail of cytokines (4, 35). As MLV vectors
require cell division to achieve gene transfer, MLV vector-directed
transduction into DCs was performed first on CD34+
progenitors prior to interleukin-directed differentiation (26, 27,
32).
To explore the possibility that the minimal SIV vectors could
efficiently transduce DCs and to compare the influence of the
differentiation pathway on transduction efficiency, terminally
differentiated DCs were established in vitro from CD34
+
progenitors or from peripheral blood monocytes after culture
with an
appropriate combination of cytokines. Both differentiation
pathways led
to the obtention of 70 to 90% CD1a
+ CD14

DCs
which were transduced with either vector pSIV-RMES4 or pMLV-VL30
at two
MOIs. Transduction efficiencies were recorded as percentages
of
GFP-expressing
cells.
As shown in Table
1, pSIV-RMES4
transduced DCs established from either CD34
+ progenitors or
monocytes with similar efficiencies, resulting
in around 20%
GFP
+ cells at an MOI of 1. Raising the MOI to 6 allowed the
transduction
of as much as 40% of the DCs, showing that SIV vector
transduction
is dose dependent. Alternatively, monocyte-derived DCs,
which
comprise a homogeneous population of 90% of nondividing
CD14

CD1a
+ cells, were highly restrictive to
transduction performed with
the MLV vector, confirming that gene
transfer mediated by this
vector requires cell division. It can be
noted that the MLV vector
was able to transduce about 7% of all
CD34
+ cell-derived DCs, but increasing the MOI to 6 with
the MLV vector
did not improve the transduction of CD34
+
cell-derived DCs (Table
1). This finding is compatible with
the
percentage of CD14
+ cells remaining in this population,
which corresponds to dividing
precursors.
To verify that transduction by an SIV vector did not alter expression
of DC phenotypic markers, transduced DCs were analyzed
for the
expression of CD1a and CD80. As reported in Table
2,
the expression patterns of these
phenotypic markers were not affected
upon transduction with minimal SIV
vectors.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Analysis of phenotypic markers after transduction of
CD34+ cell-derived or monocyte-derived DCs with a
minimal SIV vectora
|
|
 |
DISCUSSION |
The data reported here summarize our efforts to construct minimal
SIV vectors capable of delivering a gene into simian or human cells in
culture. To this end, we took advantage of our growing knowledge of SIV
genetic structure and replication (10) and results show that
cis elements and trans-acting factors can be
segregated while preserving their functions. Regarding lentivirus vector development for gene transfer and biological safety concerns, it
should be pointed out that SIVmac provides a very interesting and
useful animal model for investigating pathogenesis and prevention of
HIV-1 infection (10). It should also be noted that our
minimal SIV vector expressing system does not code for the Env and Nef proteins that are required for SIV replication and pathogenesis in
rhesus macaques, the natural host of SIVmac (11, 16).
By means of a systematic approach using high-fidelity PCR amplification
to generate specific SIV DNA sequences, we have been able to construct
the minimal vectors SIV-RMES3 and SIV-RMES4, which combine small size
and the ability to efficiently transfer a gene to cells in culture. As
observed for other lentivirus vectors, the minimal and efficient
SIV-RMES vectors contain 20% or less of the original SIV sequences.
Interestingly, the functional E/DLS packaging sequence present in
SIV-RMES vectors does not extend more than 57 nt into gag
(Fig. 1 and 2). This situation is actually much different from that of
MLV-based vectors, in which an efficient E/DLS packaging sequence
contains 400 to 500 nt of the 5' gag region (1).
This feature of minimal lentivirus vectors should minimize possible
recombination events between the vector and helper RNAs and thus
improve their biological safety. In agreement with this notion, the
pSIV-T1 and minimal pSIV-RMES4 vectors were unable to transfer
gag-pol sequences into target cells, as measured by PCR
amplification (Fig. 3).
To further improve the predictive safety of the minimal pSIV-RMES
vector, essential cis transcription elements, such as the binding sites for the Elf-1, NF-
B, and SP1 transcription factors and
the TATA box, have been deleted from the 3' LTR (Fig. 4). Vector
mobilization assays showed that this U3 deletion completely prevented
LTR-driven transcription of the integrated SIV sin vector (Fig. 5). At the same time, the sin vector pSIV-gaMES4 was
still very efficient on both cycling and growth-arrested cells (Fig. 6).
As opposed to that of MLV-derived vectors, the production of large
amounts of SIV vectors, and of lentivirus vectors in general, suffers
from the fact that no high-producer helper cell lines are available.
This is thought to be due, at least in part, to the presence of toxic
viral regulatory proteins, such as Rev, which is essential for vector
and helper function expression (23, 25). Other viral
factors, such as Vif and Vpr, may also interfere with the establishment
of efficient producer helper cell lines, but our preliminary data
indicate that they are dispensable for SIV vector production
(29a). Large amounts of specific lentivirus vectors will
most probably be required for biomedical purposes but at the same time
will necessitate established and well-characterized cell lines
providing in trans all of the necessary packaging functions, and this is why the development of inducible SIV helper and producer cell lines is in progress.
DCs are present in lymphoepithelial tissues, including the mucosa and
skin, and are mandatory not only for the initiation of the primary
immune response to invasive pathogens but also in the control and
maintenance of tolerance (36). Immunotherapy using DCs has
been shown to induce immunity against tumors (38, 39) and
can be envisioned as a strategy to treat autoimmune disease and to
induce transplantation tolerance.
Previous studies have shown that a VSV-G-pseudotyped HIV-1 vector could
transduce proliferating CD34+ progenitors (20).
However, no evidence that a lentivirus vector could transfer a gene
into mature nondividing DCs has been reported. We show here that the
minimal SIV vector is highly efficient at delivering a gene into
terminally differentiated human DCs derived from two distinct
differentiation pathways. Transduction gave rise to up to 40%
transduced DCs while preserving the viability and expression of
DC-specific molecules, including CD1a, and of the costimulatory
molecule CD80 (Table 2).
Monocyte-derived DCs are highly phagocytic compared to
CD34+ cell-derived DCs (15), which are more
efficient at inducing antigen presentation and T-cell activation.
(12). The observations that transduction efficiencies were
similar in monocyte-derived DCs and CD34+ cell-derived DCs
and that an MLV vector was unable to transduce monocyte DCs indicate
that transduction results from infection and not from phagocytosis.
Moreover, these data suggest that the SIV vector may be valuable in
vivo to target DCs of epithelial tissues and mucosa specialized in
antigen processing, as well as DCs in secondary lymphoid organs
specialized in T-cell priming. Finally, since the SIV vector is able to
deliver genes without transferring the viral sequence, it is not
supposed to elicit an immune response in the host. This advantage
should allow repeated transductions with a limited risk of development
of immunity to the vector. Minimal SIV vectors may thus open new
avenues in many clinical applications requiring antigen targeting into
DCs, such as antitumor therapy or vaccination.
 |
ACKNOWLEDGMENTS |
This work was supported by INSERM, ANRS, Transgene SA, MGEN, and
the European Community (contract BMH4-CT96-0675).
We thank J. Mullins for the infectious molecular clone SIVmac251.
Thanks to Dider Trono for the gift of 293T cells and to the various
hospitals in Lyon for kindly providing human cord blood.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: LaboRetro,
Unité de Virologie Humaine (INSERM-ENS no. 412), ENS allée
d'Italie, 69364 Lyon, France. Phone: 334-72-72-81-69. Fax:
334-72-72-87-77. E-mail: Jean-Luc.Darlix{at}ens-lyon.fr.
 |
REFERENCES |
| 1.
|
Adam, M. A., and A. D. Miller.
1988.
Identification of a signal in a murine retrovirus that is sufficient for packaging of nonretroviral RNA into virions.
J. Virol.
62:3802-3806[Abstract/Free Full Text].
|
| 2.
|
Arya, S. K.,
M. Zamani, and P. Kundra.
1998.
Human immunodeficiency virus type 2 lentivirus vectors for gene transfer: expression and potential for helper virus-free packaging.
Hum. Gene Ther.
9:1371-1380[Medline].
|
| 3.
|
Banchereau, J., and R. M. Steinman.
1998.
Dendritic cells and the control of immunity.
Nature
392:245-252[CrossRef][Medline].
|
| 4.
|
Caux, C.,
C. Dezutter-Dambuyant,
D. Schmitt, and J. Banchereau.
1992.
GM-CSF and TNF-alpha cooperate in the generation of dendritic Langerhans cells.
Nature
360:258-261[CrossRef][Medline].
|
| 5.
|
Chackerian, B.,
N. L. Haigwood, and J. Overbaugh.
1995.
Characterization of a CD4-expressing macaque cell line that can detect virus after a single replication cycle and can be infected by diverse simian immunodeficiency virus isolates.
Virology
213:386-394[CrossRef][Medline].
|
| 6.
|
Charneau, P.,
M. Alizon, and F. Clavel.
1992.
A second origin of DNA plus-strand synthesis is required for optimal human immunodeficiency virus replication.
J. Virol.
66:2814-2820[Abstract/Free Full Text].
|
| 7.
|
Charneau, P., and F. Clavel.
1991.
A single-stranded gap in human immunodeficiency virus unintegrated linear DNA defined by a central copy of the polypurine tract.
J. Virol.
65:2415-2421[Abstract/Free Full Text].
|
| 8.
|
Chen, C., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752[Abstract/Free Full Text].
|
| 9.
|
Derrington, E. A.,
M. Lopez-Lastra,
S. Chapel-Fernandez,
F. L. Cosset,
M. F. Belin,
B. B. Rudkin, and J. L. Darlix.
1999.
Retroviral vectors for the expression of two genes in human multipotent neural precursors and their differentiated neuronal and glial progeny.
Hum. Gene Ther.
10:1129-1138[CrossRef][Medline].
|
| 10.
|
Desrosiers, R. C.
1995.
Non-human primate models for AIDS vaccines.
AIDS
9:S137-S141.
|
| 11.
|
Desrosiers, R. C.,
J. D. Lifson,
J. S. Gibbs,
S. C. Czajak,
A. Y. Howe,
L. O. Arthur, and R. P. Johnson.
1998.
Identification of highly attenuated mutants of simian immunodeficiency virus.
J. Virol.
72:1431-1437[Abstract/Free Full Text].
|
| 12.
|
Ferlazzo, G.,
A. Wesa,
W. Z. Wei, and A. Galy.
1999.
Dendritic cells generated either from CD34+ progenitor cells or from monocytes differ in their ability to activate antigen-specific CD8+ T cells.
J. Immunol.
163:3597-3604[Abstract/Free Full Text].
|
| 13.
|
Fouchier, R. A., and M. H. Malim.
1999.
Nuclear import of human immunodeficiency virus type-1 preintegration complexes.
Adv. Virus Res.
52:275-299[Medline].
|
| 14.
|
Giraudon, P.,
A. Bernard,
C. Malcus,
N. Dufay,
C. Desgranges, and M. F. Belin.
1995.
Retroviral infection (HTLV-I) induces cytokine-regulated immunomodulation and cytotoxicity of medulloblastoma cells.
J. Neuropathol. Exp. Neurol.
54:165-174[Medline].
|
| 15.
|
Herbst, B.,
G. Kohler,
A. Mackensen,
H. Veelken,
R. Mertelsmann, and A. Lindemann.
1997.
CD34+ peripheral blood progenitor cell and monocyte derived dendritic cells: a comparative analysis.
Br. J. Haematol.
99:490-499[CrossRef][Medline].
|
| 16.
|
Kestler, H. W. d.,
K. Mori,
D. P. Silva,
T. Kodama,
N. W. King,
M. D. Daniel, and R. C. Desrosiers.
1990.
Nef genes of SIV.
J. Med. Primatol.
19:421-429[Medline].
|
| 17.
|
Klatzmann, D.,
C. A. Valery,
G. Bensimon,
B. Marro,
O. Boyer,
K. Mokhtari,
B. Diquet,
J. L. Salzmann, and J. Philippon.
1998.
A phase I/II study of herpes simplex virus type 1 thymidine kinase "suicide" gene therapy for recurrent glioblastoma. Study Group on Gene Therapy for Glioblastoma.
Hum. Gene Ther.
9:2595-2604[CrossRef][Medline].
|
| 18.
|
Leiden, J. M.,
C.-Y. Wang,
B. Petryniak,
D. M. Markovitz,
G. J. Nabel, and C. B. Thompson.
1992.
A novel Ets-related transcription factor, Elf-1, binds to human immunodeficiency virus type 2 regulatory elements that are required for inducible trans activation in T cells.
J. Virol.
66:5890-5897[Abstract/Free Full Text].
|
| 19.
|
Lewis, P. F., and M. Emerman.
1994.
Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus.
J. Virol.
68:510-516[Abstract/Free Full Text].
|
| 20.
|
Li, X.,
T. Mukai,
D. Young,
S. Frankel,
P. Law, and F. Wong-Staal.
1998.
Transduction of CD34+ cells by a vesicular stomatitis virus protein G (VSV-G) pseudotyped HIV-1 vector. Stable gene expression in progeny cells, including dendritic cells.
J. Hum. Virol.
1:346-352[Medline].
|
| 21.
|
Liu, M. L.,
B. L. Winther, and M. A. Kay.
1996.
Pseudotransduction of hepatocytes by using concentrated pseudotyped vesicular stomatitis virus G glycoprotein (VSV-G)-Moloney murine leukemia virus-derived retrovirus vectors: comparison of VSV-G and amphotropic vectors for hepatic gene transfer.
J. Virol.
70:2497-2502[Abstract].
|
| 22.
|
Luban, J., and S. P. Goff.
1994.
Mutational analysis of cis-acting packaging signals in human immunodeficiency virus type 1 RNA.
J. Virol.
68:3784-3793[Abstract/Free Full Text].
|
| 23.
|
Mabrouk, K.,
J. Van Rietschoten,
E. Vives,
H. Darbon,
H. Rochat, and J. M. Sabatier.
1991.
Lethal neurotoxicity in mice of the basic domains of HIV and SIV Rev proteins. Study of these regions by circular dichroism.
FEBS Lett.
289:13-17[CrossRef][Medline].
|
| 24.
|
Mitrophanous, K.,
S. Yoon,
J. Rohll,
D. Patil,
F. Wilkes,
V. Kim,
S. Kingsman,
A. Kingsman, and N. Mazarakis.
1999.
Stable gene transfer to the nervous system using a non-primate lentiviral vector.
Gene Ther.
6:1808-1818[CrossRef][Medline].
|
| 25.
|
Miyazaki, Y.,
T. Takamatsu,
T. Nosaka,
S. Fujita,
T. E. Martin, and M. Hatanaka.
1995.
The cytotoxicity of human immunodeficiency virus type 1 Rev: implications for its interaction with the nucleolar protein B23.
Exp. Cell Res.
219:93-101[CrossRef][Medline].
|
| 26.
|
Mortarini, R.,
A. Anichini,
M. Di Nicola,
S. Siena,
M. Bregni,
F. Belli,
A. Molla,
A. M. Gianni, and G. Parmiani.
1997.
Autologous dendritic cells derived from CD34+ progenitors and from monocytes are not functionally equivalent antigen-presenting cells in the induction of melan-A/Mart-1(27-35)-specific CTLs from peripheral blood lymphocytes of melanoma patients with low frequency of CTL precursors.
Cancer Res.
57:5534-5541[Abstract/Free Full Text].
|
| 27.
|
Movassagh, M.,
C. Baillou,
F. L. Cosset,
D. Klatzmann,
M. Guigon, and F. M. Lemoine.
1999.
High level of retrovirus-mediated gene transfer into dendritic cells derived from cord blood and mobilized peripheral blood CD34+ cells.
Hum. Gene Ther.
10:175-187[CrossRef][Medline].
|
| 28.
|
Naldini, L.
1998.
Lentiviruses as gene transfer agents for delivery to non-dividing cells.
Curr. Opin. Biotechnol.
9:457-463[CrossRef][Medline].
|
| 29.
|
Naldini, L.,
U. Blomer,
P. Gallay,
D. Ory,
R. Mulligan,
F. H. Gage,
I. M. Verma, and D. Trono.
1996.
In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector.
Science
272:263-267[Abstract].
|
| 29a.
|
Nègre, D.,
P. E. Mangeot,
G. Duisit,
S. Blanchard,
P. O. Vidalain,
P. Leissner,
A. J. Winter,
C. Rabourdin-Combe,
M. Mehtali,
P. Moullier,
J.-L. Darlix, and F.-L. Cosset.
2000.
Characterization of novel lentiviral vectors derived from simian immunodeficiency virus that efficiently transduce mature dendritic cells.
Gene Ther., in press.
|
| 30.
|
Poeschla, E. M.,
F. Wong-Staal, and D. J. Looney.
1998.
Efficient transduction of nondividing human cells by feline immunodeficiency virus lentiviral vectors.
Nat. Med.
4:354-357[CrossRef][Medline].
|
| 31.
|
Pöhlmann, S.,
S. Flöss,
P. O. Ilyinskii,
T. Stamminger, and F. Kirchhoff.
1998.
Sequences just upstream of the simian immunodeficiency virus core enhancer allow efficient replication in the absence of NF- B and Sp1 binding elements.
J. Virol.
72:5589-5598[Abstract/Free Full Text].
|
| 32.
|
Reeves, M. E.,
R. E. Royal,
J. S. Lam,
S. A. Rosenberg, and P. Hwu.
1996.
Retroviral transduction of human dendritic cells with a tumor-associated antigen gene.
Cancer Res.
56:5672-5677[Abstract/Free Full Text].
|
| 33.
|
Richardson, J. H.,
L. A. Child, and A. M. Lever.
1993.
Packaging of human immunodeficiency virus type 1 RNA requires cis-acting sequences outside the 5' leader region.
J. Virol.
67:3997-4005[Abstract/Free Full Text].
|
| 34.
|
Richardson, J. H.,
J. F. Kaye,
L. A. Child, and A. M. Lever.
1995.
Helper virus-free transfer of human immunodeficiency virus type 1 vectors.
J. Gen. Virol.
76:691-696[Abstract/Free Full Text].
|
| 35.
|
Sallusto, F., and A. Lanzavecchia.
1994.
Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha.
J. Exp. Med.
179:1109-1118[Abstract/Free Full Text].
|
| 36.
|
Sallusto, F., and A. Lanzavecchia.
1999.
Mobilizing dendritic cells for tolerance, priming, and chronic inflammation.
J. Exp. Med.
189:611-614[Free Full Text].
|
| 37.
|
Schnell, T.,
P. Foley,
M. Wirth,
J. Munch, and K. Uberla.
2000.
Development of a self-inactivating, minimal lentivirus vector based on simian immunodeficiency virus.
Hum. Gene Ther.
11:439-447[CrossRef][Medline].
|
| 38.
|
Song, W.,
H. L. Kong,
H. Carpenter,
H. Torii,
R. Granstein,
S. Rafii,
M. A. Moore, and R. G. Crystal.
1997.
Dendritic cells genetically modified with an adenovirus vector encoding the cDNA for a model antigen induce protective and therapeutic antitumor immunity.
J. Exp. Med.
186:1247-1256[Abstract/Free Full Text].
|
| 39.
|
Specht, J. M.,
G. Wang,
M. T. Do,
J. S. Lam,
R. E. Royal,
M. E. Reeves,
S. A. Rosenberg, and P. Hwu.
1997.
Dendritic cells retrovirally transduced with a model antigen gene are therapeutically effective against established pulmonary metastases.
J. Exp. Med.
186:1213-1221[Abstract/Free Full Text].
|
Journal of Virology, September 2000, p. 8307-8315, Vol. 74, No. 18
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Camerini, V., Decimo, D., Balvay, L., Pistello, M., Bendinelli, M., Darlix, J.-L., Ohlmann, T.
(2008). A Dormant Internal Ribosome Entry Site Controls Translation of Feline Immunodeficiency Virus. J. Virol.
82: 3574-3583
[Abstract]
[Full Text]
-
An, D. S., Donahue, R. E., Kamata, M., Poon, B., Metzger, M., Mao, S.-H., Bonifacino, A., Krouse, A. E., Darlix, J.-L., Baltimore, D., Qin, F. X.-F., Chen, I. S. Y.
(2007). Stable reduction of CCR5 by RNAi through hematopoietic stem cell transplant in non-human primates. Proc. Natl. Acad. Sci. USA
104: 13110-13115
[Abstract]
[Full Text]
-
Paul, T. A., Quackenbush, S. L., Sutton, C., Casey, R. N., Bowser, P. R., Casey, J. W.
(2006). Identification and Characterization of an Exogenous Retrovirus from Atlantic Salmon Swim Bladder Sarcomas. J. Virol.
80: 2941-2948
[Abstract]
[Full Text]
-
Fluckiger, A.-C., Marcy, G., Marchand, M., Negre, D., Cosset, F.-L., Mitalipov, S., Wolf, D., Savatier, P., Dehay, C.
(2006). Cell Cycle Features of Primate Embryonic Stem Cells. Stem Cells
24: 547-556
[Abstract]
[Full Text]
-
Sandrin, V., Cosset, F.-L.
(2006). Intracellular Versus Cell Surface Assembly of Retroviral Pseudotypes Is Determined by the Cellular Localization of the Viral Glycoprotein, Its Capacity to Interact with Gag, and the Expression of the Nef Protein. J. Biol. Chem.
281: 528-542
[Abstract]
[Full Text]
-
Lucke, S., Grunwald, T., Uberla, K.
(2005). Reduced Mobilization of Rev-Responsive Element-Deficient Lentiviral Vectors. J. Virol.
79: 9359-9362
[Abstract]
[Full Text]
-
Mangeot, P.-E., Cosset, F.-L., Colas, P., Mikaelian, I.
(2004). A universal transgene silencing method based on RNA interference. Nucleic Acids Res
32: e102-e102
[Abstract]
[Full Text]
-
Sandrin, V., Muriaux, D., Darlix, J.-L., Cosset, F.-L.
(2004). Intracellular Trafficking of Gag and Env Proteins and Their Interactions Modulate Pseudotyping of Retroviruses. J. Virol.
78: 7153-7164
[Abstract]
[Full Text]
-
Morris, K. V., Grahn, R. A., Looney, D. J., Pedersen, N. C.
(2004). Characterization of a mobilization-competent simian immunodeficiency virus (SIV) vector containing a ribozyme against SIV polymerase. J. Gen. Virol.
85: 1489-1496
[Abstract]
[Full Text]
-
Goujon, C., Jarrosson-Wuilleme, L., Bernaud, J., Rigal, D., Darlix, J.-L., Cimarelli, A.
(2003). Heterologous Human Immunodeficiency Virus Type 1 Lentiviral Vectors Packaging a Simian Immunodeficiency Virus-Derived Genome Display a Specific Postentry Transduction Defect in Dendritic Cells. J. Virol.
77: 9295-9304
[Abstract]
[Full Text]
-
Wang, X., Messerle, M., Sapinoro, R., Santos, K., Hocknell, P. K., Jin, X., Dewhurst, S.
(2003). Murine Cytomegalovirus Abortively Infects Human Dendritic Cells, Leading to Expression and Presentation of Virally Vectored Genes. J. Virol.
77: 7182-7192
[Abstract]
[Full Text]
-
Sandrin, V., Boson, B., Salmon, P., Gay, W., Negre, D., Le Grand, R., Trono, D., Cosset, F.-L.
(2002). Lentiviral vectors pseudotyped with a modified RD114 envelope glycoprotein show increased stability in sera and augmented transduction of primary lymphocytes and CD34+ cells derived from human and nonhuman primates. Blood
100: 823-832
[Abstract]
[Full Text]
-
Hansen, A. C., Grunwald, T., Lund, A. H., Schmitz, A., Duch, M., Überla, K., Pedersen, F. S.
(2001). Transfer of Primer Binding Site-Mutated Simian Immunodeficiency Virus Vectors by Genetically Engineered Artificial and Hybrid tRNA-Like Primers. J. Virol.
75: 4922-4928
[Abstract]
[Full Text]