Previous Article | Next Article 
Journal of Virology, September 2000, p. 8234-8242, Vol. 74, No. 18
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Bovine Respiratory Syncytial Virus Nonstructural
Proteins NS1 and NS2 Cooperatively Antagonize Alpha/Beta
Interferon-Induced Antiviral Response
Jörg
Schlender,
Birgit
Bossert,
Ursula
Buchholz,1 and
Karl-Klaus
Conzelmann*
Max von Pettenkofer Institute & Gene Center,
Ludwig-Maximilians-University Munich, D-81377
Munich,1 and Institute for Molecular
Biology, Federal Research Center for Virus Diseases of Animals,
D-17498 Insel Riems,2 Germany
Received 2 March 2000/Accepted 9 June 2000
 |
ABSTRACT |
The functions of bovine respiratory syncytial virus (BRSV)
nonstructural proteins NS1 and NS2 were studied by generation and analysis of recombinant BRSV carrying single and double gene deletions. Whereas in MDBK cells the lack of either or both NS genes resulted in a
5,000- to 10,000-fold reduction of virus titers, in Vero cells a
moderate (10-fold) reduction was observed. Interestingly, cell culture
supernatants from infected MDBK cells were able to restrain the growth
of NS deletion mutants in Vero cells, suggesting the involvement of NS
proteins in escape from cytokine-mediated host cell responses. The
responsible factors in MDBK supernatants were identified as type I
interferons by neutralization of the inhibitory effect with antibodies
blocking the alpha interferon (IFN-
) receptor. Treatment of cells
with recombinant universal IFN-
A/D or IFN-
revealed severe
inhibition of single and double deletion mutants, whereas growth of
full-length BRSV was not greatly affected. Surprisingly, all NS
deletion mutants were equally repressed, indicating an obligatory
cooperation of NS1 and NS2 in antagonizing IFN-mediated antiviral
mechanisms. To verify this finding, we generated recombinant rabies
virus (rRV) expressing either NS1 or NS2 and determined their IFN
sensitivity. In cells coinfected with NS1- and NS2-expressing rRVs,
virus replication was resistant to doses of IFN which caused a
1,000-fold reduction of replication in cells infected with wild-type RV
or with each of the NS-expressing rRVs alone. Thus, BRSV NS proteins
have the potential to cooperatively protect an unrelated virus from
IFN-
/
mediated antiviral responses. Interestingly, BRSV NS
proteins provided a more pronounced resistance to IFN in the bovine
cell line MDBK than in cell lines of other origins, suggesting
adaptation to host-specific antiviral responses. The findings described
have a major impact on the design of live recombinant BRSV and HRSV vaccines.
 |
INTRODUCTION |
Bovine respiratory syncytial virus
(BRSV) is a major etiological agent of respiratory tract disease in
calves and results in substantial economic loss (40, 45).
The immune response and pathology in calves mimic symptoms caused by
human respiratory syncytial virus (HRSV), which remains the leading
cause of serious bronchiolitis and pneumonia in infants and young
children throughout the world (9). Molecular cloning has
confirmed a very close relationship between BRSV and HRSV and has
revealed substantial differences from other members of the
Paramyxoviridae family, leading to the establishment of the
Pneumovirus genus within the Paramyxoviridae
family (36, 37).
As with all members of the order Mononegavirales, the 15-kb
genomic RNA of RSV is contained in a ribonucleoprotein (RNP) complex which serves as a template for sequential transcription of genes (25, 49). Eleven proteins are expressed from 10 transcription units, which are arranged in the order
3'-NS1-NS2-N-P-M-SH-G-F-M2-L-5' (5, 9, 30, 31). The proteins
encoded include five RNP-associated proteins, namely, the nucleoprotein
N, the phosphoprotein P, the large catalytic subunit L of the RNA
polymerase, and a transcription elongation factor (M2-1) encoded by the
first of two overlapping open reading frames of the M2 gene (8,
17, 27, 38). The second open reading frame of the M2
transcription unit (M2-2) was reported to encode a nonessential protein
(1) which is probably involved in the regulation of RNA
synthesis (4, 28). Three viral proteins are associated with
the viral envelope, namely, the fusion protein F, the putative
attachment protein G, and a small hydrophobic protein SH.
The presence of two nonstructural protein genes, NS1 and NS2, at the
3'-terminal position of the genome distinguishes pneumoviruses from all
other members of the Mononegavirales. Due to the 3'-proximal location, the NS genes are abundantly transcribed. The encoded proteins
have been demonstrated in infected cells (10, 16). The BRSV
NS1 and NS2 genes encode polypeptides of 136 and 124 amino acids,
respectively. Comparison with NS proteins of HRSV subgroup A and B
proteins revealed amino acid identities of 69 and 68% for NS1 proteins
and 84 and 83%, for NS2 proteins, respectively (5, 34). The
deduced sequences, however, did not provide obvious clues to the
function of NS proteins in the virus life cycle. The HRSV NS1 protein
was reported to be associated with the M protein, while the NS2 protein
did not show any detectable association with RSV structural proteins,
indicating distinct functions of NS1 and NS2 (16, 47). An
inhibitory function of NS1 in virus RNA transcription and RNP
replication was recently suggested by experiments in which artificial
HRSV minigenomes were grown in the absence or presence of NS1. In the
same study, an inhibitory but far less pronounced effect was also
observed for NS2 (3).
Recently established protocols for recovery of infectious minus-strand
RNA viruses from cDNA (11) have allowed the generation of
recombinant HRSV (8, 29) and BRSV (5) and allowed
researchers to address individual protein functions in the virus
context. The successful recovery of viable NS2 gene deletion mutants
has confirmed that NS2 is not essential for virus replication in cell culture (5, 43). However, the deletion mutants were
attenuated, indicating that NS2 is an accessory factor able to
substantially support virus growth, by a so far unknown mechanism.
To examine more closely the function of BRSV NS proteins, we generated
additional BRSV deletion mutants lacking the NS1 gene or both NS1 and
NS2 and analyzed their behavior in different cell lines. We have
identified the BRSV NS proteins as potent antagonists of interferon
(IFN)-mediated host cell responses. Most outstanding is the finding
that the IFN antagonistic activity requires both NS1 and NS2 and that
each protein alone does not show any activity. By using another
minus-strand RNA virus, rabies virus (RV), as a vector for the
expression of BRSV-derived NS genes, we could also show that the
activity of the two NS proteins can enhance the IFN resistance of an
unrelated virus.
 |
MATERIALS AND METHODS |
Cells and virus.
Recombinant BRSV (rBRSV) was derived from
BRSV strain A51908 (American Type Culture Collection) (33)
variant ATue51908 (GenBank accession no. AF092942) and grown in MDBK
cells as described previously (5). For preparation of virus
stocks, 80% confluent MDBK or Vero cell monolayers were infected at a
multiplicity of infection (MOI) of 0.1 in serum-free Dulbecco's
minimal essential medium (DMEM). After 1 h of adsorption, the
inoculum was removed and the cells were incubated at 37°C in DMEM
supplemented with 2.5% fetal calf serum (FCS) in a 5% CO2
atmosphere until an extensive cytopathic effect (CPE) was observed.
Virus was released by freezing and thawing. Virus titers were
determined on Vero cells by limiting dilution in microwell plates and
counting of infected-cell foci after indirect staining with a fusion
protein antibody (kindly provided by J. A. Melero, Madrid, Spain).
Stocks of NS deletion mutants were prepared on Vero cell monolayers
after infection at an MOI of 0.01. Bovine macrophages were isolated
from the blood of a cow and a calf by Ficoll gradient centrifugation
(Lymphoflot; Biotest, Dreieich, Germany) at 1,500 rpm in a Heraeus 8074 rotor and adsorption of the mononuclear cell fraction to the bottom of
cell culture flasks. After overnight incubation, nonadherent cells were
removed by washing three times with RPMI (Gibco) without FCS. The
remaining adherent cells (90 to 95% positive for CD14) were incubated
in RPMI with 10% FCS at 37°C and 5% CO2.
Construction of BRSV NS gene deletion mutants.
Construction
of an expression plasmid containing full-length BRSV cDNA (pBRSV) and
an NS2 gene deletion mutant (pBRSV
NS2) has been described
previously (5). The NS1 gene was deleted from pBRSV by
cutting with NotI and AseI, subsequently filling in with Klenow polymerase, and religation, giving rise to pBRSV
NS1.
For generation of the double-deletion mutant pBRSV
NS1/2, a 0.6-kb
PCR fragment spanning part of the N gene was amplified with primer
NNot(+)
(5'-TAGGCGGCCGCAAAAATGGCTCTTAGCAAGGTG-3') containing a NotI recognition site (underlined)
upstream of the N start codon (italics) and reverse primer NStu(
)
(5'-TCCTTTGTATCGTTTCATTTC-3') corresponding to nucleotides
(nt) 1735 to 1715 of rBRSV located downstream of a unique
StuI restriction site (rBRSV position 1671). After deletion
of the NS21 and NS2 genes and part of the N gene from pBRSV by
NotI (rBRSV position 72) and StuI (rBRSV position 1671) digestion, the NotI- and StuI-cut PCR
fragment (543 nt) was used to replace the deleted sequence (Fig.
1).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Diagram of the genomes of recombinant BRSV. The
locations of transcripts (shaded bars) and protein-encoding frames
(open bars) are shown relative to the viral genome (vRNA) (solid bars).
In the enlargement, the organizations of full-length and NS deletion
mutants are compared. Leader RNA is marked by vertical stripes, and the
relative positions of the corresponding nucleotides and restriction
sites used for cloning are indicated. (B) Organization of rRV
containing tagged BRSV NS1 or BRSV NS2 open reading frames between the
RV G and L genes.
|
|
rRVs carrying the NS1 or NS2 genes (Fig.
1) were constructed on the
basis of a full-length RV cDNA (SAD L16) containing an
extra
transcriptional stop-restart sequence in the 3' noncoding
sequence of
the G gene (SAD VB) (
32). First, cDNAs encoding
C-terminally
tagged versions of BRSV NS1 or NS2 proteins were
constructed. An
additional 27 nt corresponding to an internal
region of the influenza
virus hemagglutinin (HA) protein was inserted
right before the NS1 stop
codon by PCR using a reverse primer,
NS1HAr-EcoRI
(5'-GCAATA
GAATTCCTAAGCGTAATCTGGTACATCATAAGGATAAT
TCAGACCAAGAAGAGT-3'),
containing an
EcoRI recognition sequence
(underlined). For
NS2, 24 nt encoding the synthetic FLAG peptide
was inserted with
reverse primer NS2FLr-EcoRI
(5'-GCAATA
GAATTCCTATTTATCGTCATCATCTTTATAATCTGGATTTAAATCATACTTATA-3')
(the
EcoRI sequence is underlined). The PCR fragments
were used
to substitute corresponding sequences of a plasmid
(pBSBRSVNS1NS2)
containing nt 1 to 957 of the full-length BRSV cDNA
(
5). The
NS1-HA gene was excised with
NotI and
EcoRI. After filling in
with Klenow polymerase, the
resulting 475-nt fragment was inserted
into a unique
SmaI
site in pSAD VB immediately downstream of the
extra transcription start
signal, leading to pSAD VB-NS1HA. A
470-nt fragment containing NS2-FL
was cloned accordingly, after
excision with
AseI and
EcoRI and filling in with Klenow enzyme,
resulting in SAD
VB-NS2FL.
Transfection experiments and recovery of BRSVs and rRVs.
rBRSV lacking the NS1 or NS2 gene and rRV containing the NS1 or NS2
gene were rescued as described previously (5, 19), after
transfection of CaPO4-precipitated (mammalian transfection kit [Stratagene]) T7 promoter-controlled plasmids containing the respective virus cDNA (10 µg). For BRSV, plasmids encoding BRSV proteins N and P (pTITB-N and pTITB-P, 4 µg each) and L and M2 (pTITB-L and pTITB-M2, 2 µg each), and for RV, plasmids encoding RV
proteins N (pTIT-N, 5 µg) and P and L (pTIT-P and pTIT-L, 2.5 µg
each), were cotransfected with the respective virus cDNA into approximately 106 BSR T7/5 cells stably expressing phage T7
RNA polymerase (5). The transfection medium was removed
after 4 h, and the cells were further incubated in BHK-21 medium
(Gibco) containing 5% FCS for BRSV and 10% calf serum for RV. Cells
transfected with BRSV cDNA were split every 5 days at a ratio of 1:3
until a CPE was detectable. For RV recovery, cell culture supernatants
were harvested 6 days posttransfection and were transferred onto fresh
BSR cells. Infectious RV was detected by immunostaining with a
fluorescein isothiocyanate conjugate (Centocor) recognizing RV N protein.
Northern hybridization.
Total RNA from Vero cells infected
with the recombinant viruses rBRSV, rBRSV
NS1, rBRSV
NS2, and
rBRSV
NS1/2 was isolated upon development of extensive CPE (RNeasy;
Quiagen). RNA was separated by denaturing gel electrophoresis, blotted
to nylon membranes (Duralon-UV; Stratagene), and crosslinked to
membranes by UV irradiation. NS1, NS2, and N gene-specific DNA probes
of approximately 500 nt were labeled with [
-32P]dCTP
(3,000 Ci/mmol; Amersham) by nick translation (nick translation kit;
Amersham). Hybridized filters were exposed to Kodak BioMax MS films at
70°C with intensifying screens or processed for phosphorimaging (Storm; Molecular Dynamics).
Cocultivation experiments and treatment with IFN.
For
cocultivation experiments, Vero responder cells were mock infected or
infected in suspension with rBRSV, rBRSV
NS1, rBRSV
NS2, or rBRSV
NS1/2 at an MOI of 0.1 for 1 h in DMEM without FCS. After being
washed, 5 × 105 cells were seeded into six-well
dishes in DMEM plus 2.5% FCS. MDBK effector cells or bovine
macrophages activated by overnight incubation with 10 µg of
lipopolysaccharide (LPS) (Sigma) per ml were infected in suspension for
1 h at a MOI of 1 with rBRSV. After being washed, 106
cells were seeded into 25-mm tissue culture inserts with
200-nm-pore-size Anopore membranes (Nunc) and placed into the wells
containing the infected Vero responder cells. After cocultivation for 3 days, membrane inserts were removed and virus titers in Vero cells were determined as described above. Responder cells were treated with antibodies immediately after infection by incubation for 1 h with 5 µg of neutralizing mouse anti-human IFN-
/
receptor chain 2 (CD118) antibody (PBL Biomedical Laboratories) per ml or with 5 µg of
a control antibody recognizing tumor necrosis factor receptor type I
(TNFRI) or major histocompatibility complex (MHC) class I per ml. After
being seeded into six-well plates, the cells were grown further in the
presence of 1 µg of the respective antibody per ml.
To determine the effect of IFN-

/

on the replication of BRSV and
NS deletion mutants, Vero or MDBK cells were infected at
a MOI of 0.1 with the different viruses as described above and
incubated in six-well
dishes in DMEM plus 2.5% FCS. Recombinant
human IFN-

A/D or human
IFN-

(PBL Biomedical Laboratories) was
added to concentrations of up
to 15,000 U/ml immediately after
seeding. Virus titers were determined
after 3 days of incubation
by limiting dilution and indirect staining
of infected cell foci
with an F protein antibody as described
above.
Infections with rRV SAD VB, SAD VB-NS1, and SAD VB-NS2, respectively,
were done in suspension as described previously (
18)
with an
MOI of 5. For coinfections with SAD VB-NS1 and SAD VB-NS2,
an MOI of
2.5 was used for each recombinant. Recombinant IFN-
A/D was added to
concentrations of up to 500 U/ml immediately
after seeding. Virus
titers were determined 2 days postinfection
by limiting dilution and
immunostaining with a fluorescein isothiocyanate
conjugate against RV N
protein
(Centocor).
 |
RESULTS |
Construction and rescue of BRSV deletion mutants lacking NS
genes.
We have previously described the cloning of full-length
cDNA of BRSV strain ATue51908 and the construction of plasmids allowing T7 RNA polymerase-driven transcription of BRSV full-length antigenome RNA (pBRSV) or of RNA lacking the NS2 gene (pBRSV
NS2)
(5). Constructs lacking the NS1 gene (pBRSV
NS1) or both
NS1 and NS2 (pBRSV
NS1/2) were also made from pBRSV, as detailed in
Materials and Methods. Compared to the sequence of the recombinant
wild-type (wt) virus rBRSV, the NS1, NS2, and NS1/2 deletion mutants
lack 496, 509, and 1,060 nt, respectively. In all constructs,
transcription of the 3' terminal gene is directed by the original
leader/NS1 transcription start signal junction (Fig. 1).
Viable recombinant viruses rBRSV, rBRSV

NS1, rBRSV

NS2, and rBRSV

NS1/2 were recovered from the respective cDNA constructs
in BSR T7/5
cells expressing T7 RNA polymerase as previously described
(
5). In all cases, including the NS1/2 double-deletion
mutant,
cotransfection with support plasmids encoding BRSV N, P, L, and
M2 proteins resulted in the formation of syncytia. Viruses were
isolated after a 1:3 splitting of transfected cells and the appearance
of extensive CPE. For production of virus stocks, Vero cells were
infected with the recombinant viruses at an MOI of 0.1 until pronounced
CPE was visible, which took 3 days for rBRSV and 5 days for the
NS
deletion
mutants.
After infection of cells with rBRSV or NS deletion mutants at a MOI of
0.1 and incubation for 3 and 5 days, respectively,
total RNA was
isolated and processed for Northern hybridization.
Similar transcript
pattern were observed, with the viruses differing
only in the presence
or absence of NS1- and NS2-specific RNAs
(Fig.
2). As previously observed with BRSV and
HRSV NS2 deletion
mutants (
5,
43), similar amounts of N mRNA
and genome RNA
(data not shown) were present in cells infected with all
recombinants.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 2.
Lack of NS1 and NS2 transcripts in recombinant BRSVs.
Total RNA from BSR cells infected with the indicated viruses was
isolated 2 to 4 days postinfection and analyzed by Northern
hybridization with probes spanning the NS1, NS2, NS1 to NS2, and N
genes, respectively. NS1, NS2, and N mRNAs are indicated.
|
|
The growth of NS deletion mutants is cell type dependent.
Virus growth characteristics were first analyzed in the BHK-derived BSR
T7/5 cells which had been used for recovery experiments. In comparison
with the parental full-length virus, all three mutants were attenuated,
suggesting a contribution of both NS proteins to virus replication.
Interestingly, no marked differences in spread in infected cell
cultures and final titers were noted between the two NS single-gene
deletion mutants and the NS1/2 double-deletion mutant. All mutants
reached infectious titers of 2 × 105 PFU after
infection of BSR T7/5 cells at an MOI at 0.1 and incubation for 6 days,
while the parental virus yielded up to 106 PFU (Fig.
3A). Similar results with slightly
augmented titers were obtained after culturing the viruses in HEp-2
cells or in Vero cells, the preferred cell lines for cultivation of
HRSV (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
NS deletion mutants are more attenuated in MDBK cells
than in BSR cells. Nearly confluent BSR T7-5 (A) and MDBK (B) cell
monolayers were infected at an MOI of 0.1 with BRSV, BRSV NS1, BRSV
NS2, or BRSV NS1/2. Infectious virus titers were determined every
2 days as described in Materials and Methods. From day 6 onward,
replication of all mutants in Vero cells and of wt BRSV in MDBK cells
leads to massive cell destruction. Values are from two independent
experiments, each performed in triplicate. Bars show standard
deviations.
|
|
We then switched to a cell line of bovine origin, MDBK, which has been
shown to optimally support the growth of wt BRSV (
5).
Indeed, MDBK yielded slightly increased wt BRSV titers of 2 ×
10
6 PFU after 6 days of infection (Fig.
3B). Most
unexpectedly, however,
the growth of the deletion mutants was severely
impeded in this
cell line. The single-deletion mutants lacking NS1 or
NS2 yielded
titers of only 3 × 10
3 PFU after 6 days,
which is 100-fold lower than in BSR cells.
The NS1/2 double-deletion
mutant was not able to grow significantly
during the first 6 days. Only
after splitting of cells and incubation
for another 8 days could virus
titers of 2 × 10
2 be obtained (data not shown).
Obviously, MDBK cells represent
the host of choice for full-length wt
BRSV whereas they are nearly
nonpermissive for all the NS deletion
mutants. In striking contrast,
BSR and Vero cells, which are suboptimal
hosts for wt BRSV supported
the NS deletion mutants rather
well.
Soluble factors produced by MDBK cells and bovine macrophages
affect the growth of NS deletion mutants in Vero cells.
To reveal
the MDBK cell factors responsible for the apparently selective
impediment of NS deletion mutants but not of wt BRSV, we first checked
whether soluble molecules produced by MDBK cells are able to restrain
the growth of NS deletion mutants in Vero cells. This was done by
coculturing MBDK and Vero cells in devices in which the two cell
cultures are separated by a virus-tight membrane filter allowing the
passage of soluble factors (Fig. 4A). In
the upper well, MDBK cells were used as effector cells. In the lower
well, Vero cells infected at a MOI of 0.1 with wt BRSV or with each of
the NS deletion mutants served as responder cells. At least five
independent cocultivation experiments were performed. Noninfected MDBK
effector cells, or BSR cells which were used as a negative control, did
not show an inhibitory effect on the growth of either wt BRSV or the NS
deletion mutants in the Vero responder cells. Cocultivation with MDBK
cells infected with BRSV at an MOI of 1, however, resulted in a small
but reproducible inhibition of the NS deletion mutants whereas the
growth of wt BRSV was not affected (Fig. 4B). The most clear-cut effect
was observed with the NS1/NS2 double-deletion mutant, whose titers were
reduced approximately sevenfold in the presence of infected MDBK cells
compared to noninfected MDBK cells. The titers of the single-deletion
mutants rBRSV
NS1 and rBRSV
NS2 were reduced two- and threefold,
respectively.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
Supernatants from virus-infected MDBK cells or infected
macrophages inhibit the growth of BRSV NS deletion mutants in
cocultured Vero cells. (A) Schematic of the design of cocultivation
experiments. (B) MDBK cells or LPS-stimulated bovine macrophage
effector cells (EC) were infected with BRSV at a MOI of 1, seeded into
Nunc Anopore membrane cell culture inlays, and cocultured with Vero
responder cells (RC) infected with wt BRSV, BRSV NS1, BRSV NS2,
or BRSV NS1/2. After 3 days, the inlays were removed and infectious
virus titers in Vero cultures were determined. The results are shown as
percent inhibition, including standard deviation (+/ ), and fold
reduction (of the mean) relative to controls using noninfected MDBK or
noninfected, nonstimulated macrophages. Values were obtained from six
(MDBK) and four (macrophages) cocultivation experiments.
|
|
Since supernatants from noninfected MDBK cells were not able to
suppress the growth of the NS deletion mutants in Vero responder
cells,
the effective MDBK factor(s) seemed to be induced by virus
infection.
Not only wt BRSV infection but also infection with
a series of BRSV
gene deletion mutants, including rBRSV

NS1/2
and a mutant lacking
the SH and G-genes (rBRSV

SH/G; unpublished
data), led to comparable
secretion of the suppressive factors.
In addition, infection with
another RNA virus, RV, was found to
induce the effective substance in
MDBK cells to a similar degree
(data not shown). These results strongly
argued in favor of cytokine-mediated
induction of an antiviral state in
Vero responder cells, with
the prime candidates being
IFNs.
To further address the nature of cytokines involved, we used bovine
macrophages as effector cells in cocultivation experiments.
Bovine
macrophages isolated from two animals were stimulated with
LPS
overnight, infected with rBRSV, and cocultivated with Vero
cells.
Yields of full-length rBRSV were similar after incubation
with
stimulated, virus-infected macrophages and with nonstimulated
macrophages. However, compared to the nonstimulated, noninfected
macrophage control, a prominent 30- to 50-fold reduction was noted
for
the NS deletion mutants (Fig.
4B). Also, stimulation of macrophages
with LPS alone, without subsequent virus infection, was sufficient
to
cause approximately a 10-fold reduction in the yield of rBRSV

NS1/2
(data not shown). Since stimulated macrophages are known
to be
producers of IFN-

/

, these experiments pointed to an involvement
of IFN-

and/or IFN-

in repressing the growth of the BRSV NS
deletion
mutants.
Deletion of NS genes renders BRSV IFN-
/
sensitive.
It
was previously reported that Vero cells have a genetic defect in IFN
production (15, 46). However, as determined by fluorescence-activated cell sorter analysis (data not shown), the Vero
cells used as responder cells in cocultivation experiments expressed
the alpha subunit of the IFN-
/
receptor (IFNAR2) (44). To determine whether IFN-
and/or IFN-
produced by infected MDBK cells or macrophages was mediating the inhibitory effects on NS deletion mutants, Vero responder cells were infected with rBRSV
NS1/2, rBRSV
NS2, or rBRSV
NS1/2 and were treated with a
monoclonal antibody blocking IFNAR2 (PBL Laboratories). Control cells
were treated in parallel with MHC class I- and TNFAR-specific
monoclonal antibodies. The cells were then incubated in the presence of
infected MDBK effector cells for 3 days. Whereas inhibition of NS
deletion mutants was noted in cell cultures incubated with the control antibodies or in the absence of antibody, the inhibitory effect was
almost completely neutralized in cells incubated with the IFNAR2
antibody (Fig. 5). Thus, the induction of
an antiviral state in Vero responder cells leading to suppression of NS
deletion mutants was exclusively due to IFN-
/
produced by MDBK
cells or macrophages.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
An IFNAR2 monoclonal antibody neutralizes the effect of
the inhibitory factor produced by MDBK or macrophage supernatants. Vero
responder cells infected at an MOI of 0.1 with rBRSV NS1, rBRSV
NS2, rBRSV NS1/2, or wt rBRSV were incubated for 3 h with 5 µg each of a monoclonal antibody against IFNAR2 (lanes 2), MHC class
I (lanes 3), or TNFR1 (lanes 4) or in the absence of antibodies (lanes
1). Cocultivation with infected MDBK cells (see Fig. 4 for the design
of the experiment) was done in the presence of 1 µg of the respective
antibody per ml. Titers were determined in six (lanes 1 and 2) or two
experiments (lanes 3 and 4). Bars show standard deviation.
|
|
Recombinant human IFN-

/

were then used to directly analyze the
behavior of wt and mutant BRSV in IFN-stimulated cells. Vero
cells
infected at an MOI of 0.1 with BRSV or NS deletion mutants
were treated
with increasing amounts of IFN-

A/D or IFN-

immediately
after
infection, and virus titers were determined 3 days after
infection. All
three NS deletion mutants showed a highly similar,
severe, and
dose-dependent sensitivity to the IFN-induced cellular
response, with
1,500 U resulting in more than a 10,000-fold reduction
of infectious
titers (Fig.
6). In contrast, wt BRSV was
significantly
resistant to IFN treatment. However, protection was not
complete,
and an approximately 13-fold reduction in yield was caused by
1,500 U of IFN-

or IFN-

.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
All BRSV NS deletion mutants are IFN- / sensitive.
Vero cells infected at an MOI of 0.1 with BRSV, BRSV NS1, BRSV
NS2, or BRSV NS1/2 were incubated with the indicated amounts of
recombinant IFN- A/D (A) or IFN- (B). Infectious virus titers
from four independent experiments were determined 4 days postinfection.
Bars show standard deviation.
|
|
To test the possibility that protection of wt BRSV is more pronounced
in bovine cells than in Vero cells, we infected MDBK
and Vero cells in
parallel experiments at an MOI of 1 and added
equal amounts of IFN. In
untreated MDBK and Vero cells, BRSV grew
to titers of 1.7 × 10
7 and 4 × 10
6 PFU/ml, respectively
(Fig.
7). With IFN treatment, the titers
in Vero cells declined more quickly than those in MDBK cells.
After
application of 10,000 U of IFN, infectious titers in Vero
cells were
555-fold lower than were those in MDBK cells, although
in the latter,
substantial cell damage was already noted. As demonstrated
by the
vigorous inhibition of NS deletion mutants, the antiviral
response of
MDBK cells is at least as powerful as that of Vero
cells. Thus, the
enhanced protection of wt BRSV in MDBK cells
indicates that BRSV may
cope with bovine cell antiviral responses
more efficiently than with
primate cell responses.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
IFN resistance of BRSV in MDBK and Vero cells. MDBK
cells (solid columns) or Vero cells (open columns) were infected at an
MOI of 1 with rBRSV and treated with the indicated amounts of
recombinant IFN- A/D. Infectious virus titers were determined 3 days
postinfection. Bars represent standard deviations.
|
|
BRSV NS1 and NS2 cooperatively enhance the resistance of RV to
IFN-mediated antiviral responses.
Deletion of each NS gene from
BRSV leads to approximately equal degrees of sensitivity against
IFN-mediated responses, suggesting that both NS proteins are
required to counteract antiviral mechanisms. To verify the obligatory
cooperative function of NS1 and NS2 and to determine whether the two NS
proteins can be used to protect an unrelated virus, we generated rRV
expressing either NS1 (SAD VB-NS1) or NS2 (SAD VB-NS2). The additional
gene was introduced between the G and L genes of the attenuated RV SAD
L16 (Fig. 1B), as previously described for successful expression of
other genes (12, 39). Recombinants were rescued from cDNA in
BSR T7/5 cells expressing the RV N, P, and L proteins from transfected plasmids. Expression of the NS proteins had no obvious adverse effect
on the replication, growth characteristics, and infectious titers of
the recombinants in BSR cells (data not shown).
To study the activity of the expressed BRSV proteins, Vero cells were
infected at an MOI of 5 with parental RV (SAD VB) or
with each of the
recombinants or were coinfected with SAD VB-NS1
and SAD VB-NS2 at an
MOI of 2.5 each. Infected cultures were then
treated with increasing
amounts of IFN-

, and the production of
infectious RV titers and the
expression of RV proteins was analyzed
2 days postinfection in at least
four independent experiments.
Growth of the parental RV SAD VB and of
NS1 or NS2 protein-expressing
viruses from the single infections was
similarly affected (Fig.
8A). On
application of 50 IU of IFN-

, the titers dropped by approximately
1 log unit and then further decreased very slowly with increasing
IFN
amounts, indicating a weak IFN response of Vero cells or a
high
intrinsic resistance of RV to IFN-mediated responses in Vero
cells. In
cells coinfected with NS1- and NS2-expressing viruses,
however,
protection of virus replication could be shown. Virus
titers remained
significantly higher than in single infections
and decreased slowly in
a dose-dependent manner.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 8.
IFN resistance of RV in cells coinfected with RVs
expressing NS1 and NS2. Vero cells (A) or MDBK cells (B) were infected
with wt RV SAD VB, SAD VB-NS1, or SAD VB-NS2 or coinfected with SAD
VB-NS1 and SAD VB-NS2. Immediately after infection, cultures were
treated with the indicated amounts of IFN- A/D. Infectious virus
titers were determined 2 days postinfection. Results represent the mean
values of at least four independent experiments, with error bars
indicating standard deviation.
|
|
To re-examine the above observation that BRSV NS proteins are more
efficacious in antagonizing antiviral responses in bovine
cells than in
Vero cells, parallel experiments were performed
in MDBK cells (Fig.
8B). Standard RV SAD VB and the NS-expressing
recombinants replicated
to slightly lower titers in untreated
MDBK cells than in Vero cells. In
contrast to Vero cells, treatment
with IFN dramatically reduced
infectious titers of wt RV and of
NS-expressing viruses from single
infections. An immediate reduction
in infectious titers by 3 log units
indicated a highly effective
IFN-mediated response. However, in cells
coexpressing NS1 and
NS2 proteins, virus replication was completely
protected until
more than 150 IU of IFN was applied (Fig.
8B). These
results were
reflected by the analysis of RV protein synthesis. In
untreated
cells, all recombinants produced substantial and comparable
amounts
of RV proteins, whereas in IFN-treated cells, only coinfections
with SAD VB-NS1 and SAD VB-NS2 led to substantial protein synthesis,
until more than 150 to 200 IU was applied (data not
shown).
The above results showed that the two BRSV NS proteins are able to
confer resistance to IFN-mediated antiviral response not
only on BRSV
but also on another, unrelated virus. In addition,
they confirmed that
both NS proteins are required, and sufficient,
for exerting the IFN
antagonist
activity.
 |
DISCUSSION |
In this study, we could assign an important biological function to
the NS proteins of BRSV, namely, in mediating virus escape from
cellular antiviral mechanisms induced by IFN-
/
. Moreover, we
found that both NS proteins are required for this function and that
either one alone has no substantial activity. To our knowledge, this is
the first example of two virus proteins that obligatorily cooperate to
antagonize IFN.
The first indication of the increased sensitivity of NS deletion
mutants to host cell factors was observed after infection of MDBK
cells, which are fully permissive for wt BRSV infection and which yield
higher titers of wt BRSV than do any other cell lines tested. In
striking contrast, viruses lacking one or both NS genes grew worst in
MDBK cells whereas in other cells, like Vero or BSR, the lack of the NS
genes caused only a moderate (10-fold) decrease in infectious titers.
Cocultivation experiments identified IFN-
/
as the critical host
cell factors produced by BRSV-infected MDBK cells. Obviously, in
infected MDBK cultures, an antiviral state is induced by autocrine and
paracrine stimulation of cells. While wt BRSV is able to counteract
this response, none of the NS deletion mutants can do so. Vero cells,
in contrast, lack IFN-
/
genes (15, 46), and so virus
infection does not result in the induction of an antiviral state,
allowing the NS deletion mutants to grow. The observed 10-fold-slower
growth in Vero cells of the NS deletion mutants compared to wt BRSV may
be due to some intrinsic antiviral activity or, more likely, may
reflect the contribution of NS gene products to virus replication.
Although not able to produce IFN, Vero cells are able to respond to
exogenous IFN stimulation through the IFN-
receptor complex (IFNAR)
by JAK/STAT signaling. Bovine IFNs secreted from infected MDBK cells induced an antiviral response in Vero "responder" cells,
suppressing the growth of the NS deletion mutants but not of wt BRSV.
The antiviral effect caused by MDBK supernatants was abolished by incubation of Vero cells with an antibody blocking the binding of IFN
to IFNAR. Therefore, IFN-
and/or IFN-
was the sole active component of supernatants from MDBK cells in inducing the antiviral response in Vero cells. The cocultivation experiments also showed that
the IFN antagonistic activity of BRSV NS proteins is acting on the IFN
response rather than on IFN induction, since similar IFN activities
were induced in effector cells by wt BRSV, BRSV deletion mutants, and
RV rhabdovirus.
The inhibitory effect on NS deletion mutants in Vero cells treated with
supernatants from MDBK cells was weak, with a maximum sevenfold
reduction in the yield of the double-deletion mutant, and was thus not
comparable to the severe inhibition of NS deletion mutants in MDBK
cells. This may be due to various factors. Stimulation of the primate
Vero cells with the heterologous IFN of bovine origin is probably less
efficient than stimulation of MDBK cells. Similar to the situation in
humans, different types of bovine IFN-
(types 2 to 8) and bovine
IFN-
(types 1 and 3) which exhibit different biological activity
have been identified (7). In addition, the induced antiviral
mechanisms of Vero cells seem to be less effective than those of MDBK.
Supernatants from stimulated and infected macrophages, which are known
to secrete larger amounts of IFN-
/
than other cells, caused an
increased reduction of up to 50-fold in the yield of NS deletion
mutants in Vero responder cells. Finally, by stimulation of Vero cells
with recombinant human IFN-
A/D or IFN-
, replication of the NS
deletion mutants could be inhibited in a dose-dependent manner, with
500 U nearly abolishing any replication activity.
A series of proteins from diverse DNA viruses (reviewed in reference
35) and RNA viruses (14, 20, 21, 23, 24, 41,
42) with the ability to antagonize the effects of IFN have been
described. Some viruses, like hepatitis C virus, appear to have
multiple proteins able to independently target antiviral mechanisms
(20, 42). However, we were not prepared for the finding that
both NS1 and NS2 are necessary to accomplish IFN antagonist activity
whereas each protein on its own apparently does not possess any
activity. The observation that the growth characteristics of deletion
mutants lacking either NS1 or NS2 or both NS genes were very similar in
all cell lines was appealing. Only in the experiment involving the
lowest dose of active IFN, namely, the cocultivation using MDBK
effector cells, could a differential behavior of NS1 and NS2 deletion
mutants be suspected. In these experiments, the average reduction in
the yield of the NS1 deletion mutant was slightly lower than that of
the NS2 and the NS1/2 double deletion mutant; however, variability was
high in these experiments and so their significance is questionable. A
reproducible difference was observed only in MDBK cells, where the
single-deletion mutants could be grown to somewhat higher titers than
the double-deletion mutant after splitting of infected cell cultures.
However, it is unclear whether this should be attributed to functions
of NS proteins in IFN escape or in RNA synthesis.
Final evidence that both proteins are required and also sufficient to
interfere with the establishment of an antiviral state was obtained by
using rRV expressing individual NS proteins. The BRSV NS1 and NS2 genes
are located side by side in the most upstream position of the genome
(Fig. 1), which should result in a high and similar level of expression
in BRSV-infected cells. Accordingly, to approximately reproduce the
conditions in BRSV-infected cells, coinfections with rRV vectors were
done at the same MOI for both recombinants. Comparable amounts of NS1
or NS2 protein, respectively, should be expressed in cells infected
with the single recombinants and in cells coinfected with both
recombinants. However, only in coinfected cells was a significantly
enhanced resistance of the RV vector to IFN stimulation observed.
Whereas standard RV titers dropped by 3 log units in MDBK cells after
IFN treatment, complete protection was observed in coinfected cells.
Depending on the experiment, the effects caused by IFN doses of up to
approximately 200 U were completely neutralized. Since coinfections are
prone to some variability, we suspect that a more regulated
coexpression of NS proteins, at appropriate stoichiometric amounts,
might bring about a much greater protective capacity.
Treatment of Vero cells with recombinant IFN showed that full-length
BRSV was not completely protected against the IFN response of the
primate cells. Although the sensitivity was lower than that of the NS
deletion mutants by several orders of magnitude (Fig. 6), a
dose-dependent reduction of wt BRSV titers was observed. However,
parallel experiments with the bovine MDBK cells revealed almost perfect
protection until very high doses of IFN were reached and cell damage
was apparent (Fig. 7). As with BRSV, a more pronounced effect in MDBK
cells was indicated by the rRV vectors. From the severe inhibition of
BRSV NS deletion mutants and of wt RV in MDBK cells, it is obvious that
the antiviral response mechanisms of MDBK cells are at least as
efficient as those of Vero cells. This may indicate that the NS
proteins of BRSV have evolved with the bovine host to optimally
counteract bovine cell antiviral responses. The human counterpart of
BRSV, HRSV, was recently reported to be highly resistant to IFN-induced
antiviral activity in human cells (2), and it appears that
HRSV NS proteins are optimized to antagonize IFN responses of human cells.
Adaptation of viral proteins to counteract innate responses in cells of
their natural host is an important factor in determining the virus host
range and may prevent viruses from crossing species barriers (13,
22, 26). The V protein of simian virus 5 (SV5) for example, is
able to block the activation of IFN-responsive genes in primate cells
but not in murine cells (14). This may be the major element
preventing productive SV5 infection of mice, even SCID mice
(13).
Indeed, the contribution of NS proteins to the permissivity of hosts to
RSV infection might be crucial and might explain why the closely
related viruses display a highly restricted host spectrum. BRSV and
HRSV are able to enter human, bovine, and murine cells; however, the
differential capability of NS proteins to more or less efficiently
antagonize the host-specific innate responses might then determine
whether the virus is eliminated. This is also supported by previous
observations. Growth of HRSV in primary mouse embryo cells was markedly
restricted; however, when anti-mouse IFN serum was added to the medium,
virus yields were enhanced and the infection spread in the entire
monolayer (26). In addition, recombinant BRSV in which the G
and F surface protein genes were replaced by their HRSV counterparts
was somewhat more competent than BRSV for replication in chimpanzees.
However, the infection remained highly restricted and was not
sufficient to induce any protection against homologous HRSV challenge
(6). On the basis of our observations we conclude that the
low efficiency of BRSV NS proteins in antagonizing primate IFN
responses represents a major determinant for host range.
Our findings have important implications for the design of efficacious
live attenuated RSV vaccines. It is suggested that deletion of either
NS1 or NS2, as proposed previously (5, 43, 48), results in
overattenuated viruses that are not able to escape from any IFN
response. Promising approaches would be, for example, the reciprocal
exchange of BRSV and HRSV NS proteins. This could generate BRSV and
HRSV vaccines with intermediate ability to escape from the innate
bovine and human response, respectively. In addition, mutations in NS
proteins could be identified that only partially knock out the IFN
antagonistic activity.
Further studies will reveal how NS proteins cooperate and how they
interfere with antiviral responses. RV vectors as described here should
prove especially helpful, since they provide the possibility to
investigate NS protein functions independent of the so far unidentified
functions they might have in BRSV replication.
 |
ACKNOWLEDGMENTS |
We thank Stefan Finke for critical reading of the manuscript and
J. A. Melero, Madrid, Spain, and G. Taylor, Compton, United Kingdom, for providing RSV antibodies.
This work was supported in part by the Deutsche Forschungsgemeinschaft
(SFB 455-A3) and the European Commission (EC 5th FP-RSV Vac,
QLK2-CT-1999-00443).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Max von
Pettenkofer Institute & Gene Center, Feodor-Lynen-Str. 25, D-81377
Munich, Germany. Phone: 49 89 2180 6851. Fax: 49 89 2180 6899. E-mail: conzelma{at}lmb.uni-muenchen.de.
 |
REFERENCES |
| 1.
|
Ahmadian, G.,
P. Chambers, and A. J. Easton.
1999.
Detection and characterization of proteins encoded by the second ORF of the M2 gene of pneumoviruses.
J. Gen. Virol.
80:2011-2016[Abstract/Free Full Text].
|
| 2.
|
Atreya, P. L., and S. Kulkarni.
1999.
Respiratory syncytial virus strain A2 is resistant to the antiviral effects of type I interferons and human MxA.
Virology
261:227-241[CrossRef][Medline].
|
| 3.
|
Atreya, P. L.,
M. E. Peeples, and P. L. Collins.
1998.
The NS1 protein of human respiratory syncytial virus is a potent inhibitor of minigenome transcription and RNA replication.
J. Virol.
72:1452-1461[Abstract/Free Full Text].
|
| 4.
|
Bermingham, A., and P. L. Collins.
1999.
The M2-2 protein of human respiratory syncytial virus is a regulatory factor involved in the balance between RNA replication and transcription.
Proc. Natl. Acad. Sci. USA
96:11259-11264[Abstract/Free Full Text].
|
| 5.
|
Buchholz, U. J.,
S. Finke, and K. K. Conzelmann.
1999.
Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter.
J. Virol.
73:251-259[Abstract/Free Full Text].
|
| 6.
|
Buchholz, U. J.,
H. Granzow,
K. Schuldt,
S. S. Whitehead,
B. R. Murphy, and P. L. Collins.
2000.
Chimeric bovine respiratory syncytial virus with glycoprotein gene substitutions from human respiratory syncytial virus (HRSV): effects on host range and evaluation as a live-attenuated HRSV vaccine.
J. Virol.
74:1187-1199[Abstract/Free Full Text].
|
| 7.
|
Chaplin, P. J.,
K. R. Parsons, and R. A. Collins.
1996.
The cloning of cattle interferon-A subtypes isolated from the gut epithelium of rotavirus-infected calves.
Immunogenetics
44:143-145[CrossRef][Medline].
|
| 8.
|
Collins, P. L.,
M. G. Hill,
E. Camargo,
H. Grosfeld,
R. M. Chanock, and B. R. Murphy.
1995.
Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development.
Proc. Natl. Acad. Sci. USA
92:11563-11567[Abstract/Free Full Text].
|
| 9.
|
Collins, P. L.,
K. McIntosh, and R. M. Chanock.
1996.
Respiratory syncytial virus, p. 1313-1352.
In
B. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J. L. Melnik, T. P. Monath, B. Roizman, and S. E. Straus (ed.), Fields virology. Lippincott-Raven, Philadelphia, Pa.
|
| 10.
|
Collins, P. L., and G. W. Wertz.
1985.
Nucleotide sequences of the 1B and 1C nonstructural protein mRNAs of human respiratory syncytial virus.
Virology
143:442-451[CrossRef][Medline].
|
| 11.
|
Conzelmann, K. K.
1998.
Nonsegmented negative-strand RNA viruses: genetics and manipulation of viral genomes.
Annu. Rev. Genet.
32:123-162[CrossRef][Medline].
|
| 12.
|
Conzelmann, K. K.,
J. H. Cox,
L. G. Schneider, and H. J. Thiel.
1990.
Molecular cloning and complete nucleotide sequence of the attenuated rabies virus SAD B19.
Virology
175:485-499[CrossRef][Medline].
|
| 13.
|
Didcock, L.,
D. F. Young,
S. Goodbourn, and R. E. Randall.
1999.
Sendai virus and simian virus 5 block activation of interferon-responsive genes: importance for virus pathogenesis.
J. Virol.
73:3125-3133[Abstract/Free Full Text].
|
| 14.
|
Didcock, L.,
D. F. Young,
S. Goodbourn, and R. E. Randall.
1999.
The V protein of simian virus 5 inhibits interferon signalling by targeting STAT1 for proteasome-mediated degradation.
J. Virol.
73:9928-9933[Abstract/Free Full Text].
|
| 15.
|
Emeny, J. M., and M. J. Morgan.
1979.
Regulation of the interferon system: evidence that Vero cells have a genetic defect in interferon production.
J. Gen. Virol.
43:247-252[Abstract/Free Full Text].
|
| 16.
|
Evans, J. E.,
P. A. Cane, and C. R. Pringle.
1996.
Expression and characterisation of the NS1 and NS2 proteins of respiratory syncytial virus.
Virus Res.
43:155-161[CrossRef][Medline].
|
| 17.
|
Fearns, R., and P. L. Collins.
1999.
Role of the M2-1 transcription antitermination protein of respiratory syncytial virus in sequential transcription.
J. Virol.
73:5852-5864[Abstract/Free Full Text].
|
| 18.
|
Finke, S., and K. K. Conzelmann.
1997.
Ambisense gene expression from recombinant rabies virus: random packaging of positive- and negative-strand ribonucleoprotein complexes into rabies virions.
J. Virol.
71:7281-7288[Abstract].
|
| 19.
|
Finke, S., and K. K. Conzelmann.
1999.
Virus promoters determine interference by defective RNAs: selective amplification of mini-RNA vectors and rescue from cDNA by a 3' copy-back ambisense rabies virus.
J. Virol.
73:3818-3825[Abstract/Free Full Text].
|
| 20.
|
Gale, M. J.,
C. M. Blakely,
B. Kwieciszewski,
S. L. Tan,
M. Dossett,
N. M. Tang,
M. J. Korth,
S. J. Polyak,
D. R. Gretch, and M. G. Katze.
1998.
Control of PKR protein kinase by hepatitis C virus nonstructural 5A protein: molecular mechanisms of kinase regulation.
Mol. Cell. Biol.
18:5208-5218[Abstract/Free Full Text].
|
| 21.
|
Gale, M. J. J.,
M. J. Korth,
N. M. Tang,
S. L. Tan,
D. A. Hopkins,
T. E. Dever,
S. J. Polyak,
D. R. Gretch, and M. G. Katze.
1997.
Evidence that hepatitis C virus resistance to interferon is mediated through repression of the PKR protein kinase by the nonstructural 5A protein.
Virology
230:217-227[CrossRef][Medline].
|
| 22.
|
García-Sastre, A.,
R. K. Durbin,
H. Zheng,
P. Palese,
R. Gertner,
D. E. Levy, and J. E. Durbin.
1998.
The role of interferon in influenza virus tissue tropism.
J. Virol.
72:8550-8558[Abstract/Free Full Text].
|
| 23.
|
García-Sastre, A.,
A. Egorov,
D. Matassov,
S. Brandt,
D. E. Levy,
J. E. Durbin,
P. Palese, and T. Muster.
1998.
Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems.
Virology
252:324-330[CrossRef][Medline].
|
| 24.
|
Garcin, D.,
P. Latorre, and D. Kolakofsky.
1999.
Sendai virus C proteins counteract the interferon-mediated induction of an antiviral state.
J. Virol.
73:6559-6565[Abstract/Free Full Text].
|
| 25.
|
Grosfeld, H.,
M. G. Hill, and P. L. Collins.
1995.
RNA replication by respiratory syncytial virus (RSV) is directed by the N, P, and L proteins: transcription also occurs under these conditions but requires RSV superinfection for efficient synthesis of full-length mRNA.
J. Virol.
69:5677-5686[Abstract].
|
| 26.
|
Hanada, N.,
T. Morishima,
K. Nishikawa,
S. Isomura, and Y. Nagai.
1986.
Interferon-mediated self-limiting growth of respiratory syncytial virus in mouse embryo cells.
J. Med. Virol.
20:363-370[Medline].
|
| 27.
|
Hardy, R. W., and G. W. Wertz.
1998.
The product of the respiratory syncytial virus M2 gene ORF1 enhances readthrough of intergenic junctions during viral transcription.
J. Virol.
72:520-526[Abstract/Free Full Text].
|
| 28.
|
Jin, H.,
X. Cheng,
H. Z. Zhou,
S. Li, and R. Seid.
2000.
Respiratory syncytial virus that lacks open reading frame 2 of the M2 gene (M2-2) has altered growth characteristics and is attenuated in rodents.
J. Virol.
74:74-82[Abstract/Free Full Text].
|
| 29.
|
Jin, H.,
D. Clarke,
H. Z. Zhou,
X. Cheng,
K. Coelingh,
M. Bryant, and S. Li.
1998.
Recombinant human respiratory syncytial virus (RSV) from cDNA and construction of subgroup A and B chimeric RSV.
Virology
251:206-214[CrossRef][Medline].
|
| 30.
|
Lerch, R. A.,
E. J. Stott, and G. W. Wertz.
1989.
Characterization of bovine respiratory syncytial virus proteins and mRNAs and generation of cDNA clones to the viral mRNAs.
J. Virol.
63:833-840[Abstract/Free Full Text].
|
| 31.
|
Mallipeddi, S. K.,
S. K. Samal, and S. B. Mohanty.
1990.
Analysis of polypeptides synthesized in bovine respiratory syncytial virus-infected cells.
Arch. Virol.
115:23-36[CrossRef][Medline].
|
| 32.
|
Mebatsion, T.,
M. J. Schnell,
J. H. Cox,
S. Finke, and K. K. Conzelmann.
1996.
Highly stable expression of a foreign gene from rabies virus vectors.
Proc. Natl. Acad. Sci. USA
93:7310-7314[Abstract/Free Full Text].
|
| 33.
|
Mohanty, S. B.,
A. L. Ingling, and M. G. Lillie.
1975.
Experimentally induced respiratory syncytial viral infection in calves.
Am. J. Vet. Res.
36:417-419[Medline].
|
| 34.
|
Pastey, M. K., and S. K. Samal.
1995.
Nucleotide sequence analysis of the non-structural NS1 (1C) and NS2 (1B) protein genes of bovine respiratory syncytial virus.
J. Gen. Virol.
76:193-197[Abstract/Free Full Text].
|
| 35.
|
Ploegh, H. L.
1998.
Viral strategies of immune evasion.
Science
280:248-253[Abstract/Free Full Text].
|
| 36.
|
Pringle, C. R.
1996.
Virus taxonomy 1996 a bulletin from the Xth International Congress of Virology in Jerusalem.
Arch. Virol.
141:2251-2256[CrossRef][Medline].
|
| 37.
|
Pringle, C. R.
1998.
The universal system of virus taxonomy of the International Committee on Virus Taxonomy (ICTV), including new proposals ratified since publication of the Sixth ICTV Report in 1995.
Arch. Virol.
143:203-210[CrossRef][Medline]. (Erratum, 143:630.)
|
| 38.
|
Samal, S. K.,
M. K. Pastey,
T. H. McPhillips, and S. B. Mohanty.
1993.
Bovine respiratory syncytial virus nucleocapsid protein expressed in insect cells specifically interacts with the phosphoprotein and the M2 protein.
Virology
193:470-473[CrossRef][Medline].
|
| 39.
|
Schnell, M. J.,
T. Mebatsion, and K. K. Conzelmann.
1994.
Infectious rabies viruses from cloned cDNA.
EMBO J.
13:4195-4203[Medline].
|
| 40.
|
Stott, E. J.,
L. H. Thomas,
G. Taylor,
A. P. Collins,
J. Jebbett, and S. Crouch.
1984.
A comparison of three vaccines against respiratory syncytial virus in calves.
J. Hyg.
93:251-261.
|
| 41.
|
Tan, S. L., and M. G. Katze.
1998.
Biochemical and genetic evidence for complex formation between the influenza A virus NS1 protein and the interferon-induced PKR protein kinase.
J. Interferon Cytokine Res.
18:757-766[Medline].
|
| 42.
|
Taylor, D. R.,
S. T. Shi,
P. R. Romano,
G. N. Barber, and M. M. Lai.
1999.
Inhibition of the interferon-inducible protein kinase PKR by HCV E2 protein.
Science
285:107-110[Abstract/Free Full Text].
|
| 43.
|
Teng, M. N., and P. L. Collins.
1999.
Altered growth characteristics of recombinant respiratory syncytial viruses which do not produce NS2 protein.
J. Virol.
73:466-473[Abstract/Free Full Text].
|
| 44.
|
Uzé, G.,
G. Lutfalla, and K. E. Mogensen.
1995.
Alpha and beta interferons and their receptor and their friends and relations.
J. Interferon Cytokine Res.
15:3-26[Medline].
|
| 45.
|
van der Poel, W. H.,
A. Brand,
J. A. Kramps, and J. T. van Oirschot.
1994.
Respiratory syncytial virus infections in human beings and in cattle.
J. Infect.
29:215-228[CrossRef][Medline].
|
| 46.
|
Wathelet, M. G.,
P. M. Berr, and G. A. Huez.
1992.
Regulation of gene expression by cytokines and virus in human cells lacking the type-I interferon locus.
Eur. J. Biochem.
206:901-910[Medline].
|
| 47.
|
Weber, E.,
B. Humbert,
H. J. Streckert, and H. Werchau.
1995.
Nonstructural protein 2 (NS2) of respiratory syncytial virus (RSV) detected by an antipeptide serum.
Respiration
62:27-33[Medline].
|
| 48.
|
Whitehead, S. S.,
A. Bukreyev,
M. N. Teng,
C. Y. Firestone,
M. St Claire,
W. R. Elkins,
P. L. Collins, and B. R. Murphy.
1999.
Recombinant respiratory syncytial virus bearing a deletion of either the NS2 or SH gene is attenuated in chimpanzees.
J. Virol.
73:3438-3442[Abstract/Free Full Text].
|
| 49.
|
Yu, Q.,
R. W. Hardy, and G. W. Wertz.
1995.
Functional cDNA clones of the human respiratory syncytial (RS) virus N, P, and L proteins support replication of RS virus genomic RNA analogs and define minimal trans-acting requirements for RNA replication.
J. Virol.
69:2412-2419[Abstract].
|
Journal of Virology, September 2000, p. 8234-8242, Vol. 74, No. 18
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ling, Z., Tran, K. C., Teng, M. N.
(2009). Human Respiratory Syncytial Virus Nonstructural Protein NS2 Antagonizes the Activation of Beta Interferon Transcription by Interacting with RIG-I. J. Virol.
83: 3734-3742
[Abstract]
[Full Text]
-
Buchholz, U. J., Ward, J. M., Lamirande, E. W., Heinze, B., Krempl, C. D., Collins, P. L.
(2009). Deletion of Nonstructural Proteins NS1 and NS2 from Pneumonia Virus of Mice Attenuates Viral Replication and Reduces Pulmonary Cytokine Expression and Disease. J. Virol.
83: 1969-1980
[Abstract]
[Full Text]
-
Randall, R. E., Goodbourn, S.
(2008). Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J. Gen. Virol.
89: 1-47
[Abstract]
[Full Text]
-
Jewell, N. A., Vaghefi, N., Mertz, S. E., Akter, P., Peebles, R. S. Jr., Bakaletz, L. O., Durbin, R. K., Flano, E., Durbin, J. E.
(2007). Differential Type I Interferon Induction by Respiratory Syncytial Virus and Influenza A Virus In Vivo. J. Virol.
81: 9790-9800
[Abstract]
[Full Text]
-
Krempl, C. D., Wnekowicz, A., Lamirande, E. W., Nayebagha, G., Collins, P. L., Buchholz, U. J.
(2007). Identification of a Novel Virulence Factor in Recombinant Pneumonia Virus of Mice. J. Virol.
81: 9490-9501
[Abstract]
[Full Text]
-
Elliott, J., Lynch, O. T., Suessmuth, Y., Qian, P., Boyd, C. R., Burrows, J. F., Buick, R., Stevenson, N. J., Touzelet, O., Gadina, M., Power, U. F., Johnston, J. A.
(2007). Respiratory Syncytial Virus NS1 Protein Degrades STAT2 by Using the Elongin-Cullin E3 Ligase. J. Virol.
81: 3428-3436
[Abstract]
[Full Text]
-
Bitko, V., Shulyayeva, O., Mazumder, B., Musiyenko, A., Ramaswamy, M., Look, D. C., Barik, S.
(2007). Nonstructural Proteins of Respiratory Syncytial Virus Suppress Premature Apoptosis by an NF-{kappa}B-Dependent, Interferon-Independent Mechanism and Facilitate Virus Growth. J. Virol.
81: 1786-1795
[Abstract]
[Full Text]
-
Wang, H., Peters, N., Schwarze, J.
(2006). Plasmacytoid Dendritic Cells Limit Viral Replication, Pulmonary Inflammation, and Airway Hyperresponsiveness in Respiratory Syncytial Virus Infection. J. Immunol.
177: 6263-6270
[Abstract]
[Full Text]
-
Riffault, S., Dubuquoy, C., Castagne, N., Baranowski, E., Charley, B., Eleouet, J.-F.
(2006). Replication of Bovine respiratory syncytial virus in murine cells depends on type I interferon-receptor functionality.. J. Gen. Virol.
87: 2145-2148
[Abstract]
[Full Text]
-
Schweizer, M., Matzener, P., Pfaffen, G., Stalder, H., Peterhans, E.
(2006). "Self" and "Nonself" Manipulation of Interferon Defense during Persistent Infection: Bovine Viral Diarrhea Virus Resists Alpha/Beta Interferon without Blocking Antiviral Activity against Unrelated Viruses Replicating in Its Host Cells. J. Virol.
80: 6926-6935
[Abstract]
[Full Text]
-
Kotelkin, A., Belyakov, I. M., Yang, L., Berzofsky, J. A., Collins, P. L., Bukreyev, A.
(2006). The NS2 Protein of Human Respiratory Syncytial Virus Suppresses the Cytotoxic T-Cell Response as a Consequence of Suppressing the Type I Interferon Response.. J. Virol.
80: 5958-5967
[Abstract]
[Full Text]
-
Chi, B., Dickensheets, H. L., Spann, K. M., Alston, M. A., Luongo, C., Dumoutier, L., Huang, J., Renauld, J.-C., Kotenko, S. V., Roederer, M., Beeler, J. A., Donnelly, R. P., Collins, P. L., Rabin, R. L.
(2006). Alpha and lambda interferon together mediate suppression of CD4 T cells induced by respiratory syncytial virus.. J. Virol.
80: 5032-5040
[Abstract]
[Full Text]
-
Llorente, M. T., Garcia-Barreno, B., Calero, M., Camafeita, E., Lopez, J. A., Longhi, S., Ferron, F., Varela, P. F., Melero, J. A.
(2006). Structural analysis of the human respiratory syncytial virus phosphoprotein: characterization of an {alpha}-helical domain involved in oligomerization. J. Gen. Virol.
87: 159-169
[Abstract]
[Full Text]
-
Nishio, M., Tsurudome, M., Ito, M., Ito, Y.
(2005). Human Parainfluenza Virus Type 4 Is Incapable of Evading the Interferon-Induced Antiviral Effect. J. Virol.
79: 14756-14768
[Abstract]
[Full Text]
-
Cheng, X., Park, H., Zhou, H., Jin, H.
(2005). Overexpression of the M2-2 Protein of Respiratory Syncytial Virus Inhibits Viral Replication. J. Virol.
79: 13943-13952
[Abstract]
[Full Text]
-
Claassen, E. A. W., van der Kant, P. A. A., Rychnavska, Z. S., van Bleek, G. M., Easton, A. J., van der Most, R. G.
(2005). Activation and Inactivation of Antiviral CD8 T Cell Responses during Murine Pneumovirus Infection. J. Immunol.
175: 6597-6604
[Abstract]
[Full Text]
-
Hohle, C., Karger, A., Konig, P., Giesow, K., Keil, G. M.
(2005). High-level expression of biologically active bovine alpha interferon by Bovine herpesvirus 1 interferes only marginally with recombinant virus replication in vitro. J. Gen. Virol.
86: 2685-2695
[Abstract]
[Full Text]
-
Guerrero-Plata, A., Baron, S., Poast, J. S., Adegboyega, P. A., Casola, A., Garofalo, R. P.
(2005). Activity and Regulation of Alpha Interferon in Respiratory Syncytial Virus and Human Metapneumovirus Experimental Infections. J. Virol.
79: 10190-10199
[Abstract]
[Full Text]
-
Lo, M. S., Brazas, R. M., Holtzman, M. J.
(2005). Respiratory Syncytial Virus Nonstructural Proteins NS1 and NS2 Mediate Inhibition of Stat2 Expression and Alpha/Beta Interferon Responsiveness. J. Virol.
79: 9315-9319
[Abstract]
[Full Text]
-
Openshaw, P. J. M., Tregoning, J. S.
(2005). Immune Responses and Disease Enhancement during Respiratory Syncytial Virus Infection. Clin. Microbiol. Rev.
18: 541-555
[Abstract]
[Full Text]
-
Wright, P. F., Ikizler, M. R., Gonzales, R. A., Carroll, K. N., Johnson, J. E., Werkhaven, J. A.
(2005). Growth of Respiratory Syncytial Virus in Primary Epithelial Cells from the Human Respiratory Tract. J. Virol.
79: 8651-8654
[Abstract]
[Full Text]
-
Brzozka, K., Finke, S., Conzelmann, K.-K.
(2005). Identification of the Rabies Virus Alpha/Beta Interferon Antagonist: Phosphoprotein P Interferes with Phosphorylation of Interferon Regulatory Factor 3. J. Virol.
79: 7673-7681
[Abstract]
[Full Text]
-
Shaw, M. L., Cardenas, W. B., Zamarin, D., Palese, P., Basler, C. F.
(2005). Nuclear Localization of the Nipah Virus W Protein Allows for Inhibition of both Virus- and Toll-Like Receptor 3-Triggered Signaling Pathways. J. Virol.
79: 6078-6088
[Abstract]
[Full Text]
-
Conzelmann, K.-K.
(2005). Transcriptional Activation of Alpha/Beta Interferon Genes: Interference by Nonsegmented Negative-Strand RNA Viruses. J. Virol.
79: 5241-5248
[Full Text]
-
Spann, K. M., Tran, K. C., Collins, P. L.
(2005). Effects of Nonstructural Proteins NS1 and NS2 of Human Respiratory Syncytial Virus on Interferon Regulatory Factor 3, NF-{kappa}B, and Proinflammatory Cytokines. J. Virol.
79: 5353-5362
[Abstract]
[Full Text]
-
Schlender, J., Hornung, V., Finke, S., Gunthner-Biller, M., Marozin, S., Brzozka, K., Moghim, S., Endres, S., Hartmann, G., Conzelmann, K.-K.
(2005). Inhibition of Toll-Like Receptor 7- and 9-Mediated Alpha/Beta Interferon Production in Human Plasmacytoid Dendritic Cells by Respiratory Syncytial Virus and Measles Virus. J. Virol.
79: 5507-5515
[Abstract]
[Full Text]
-
Thorpe, L. C., Easton, A. J.
(2005). Genome sequence of the non-pathogenic strain 15 of pneumonia virus of mice and comparison with the genome of the pathogenic strain J3666. J. Gen. Virol.
86: 159-169
[Abstract]
[Full Text]
-
Hornung, V., Schlender, J., Guenthner-Biller, M., Rothenfusser, S., Endres, S., Conzelmann, K.-K., Hartmann, G.
(2004). Replication-Dependent Potent IFN-{alpha} Induction in Human Plasmacytoid Dendritic Cells by a Single-Stranded RNA Virus. J. Immunol.
173: 5935-5943
[Abstract]
[Full Text]
-
Shaw, M. L., Garcia-Sastre, A., Palese, P., Basler, C. F.
(2004). Nipah Virus V and W Proteins Have a Common STAT1-Binding Domain yet Inhibit STAT1 Activation from the Cytoplasmic and Nuclear Compartments, Respectively. J. Virol.
78: 5633-5641
[Abstract]
[Full Text]
-
Elliott, M. B., Pryharski, K. S., Yu, Q., Parks, C. L., Laughlin, T. S., Gupta, C. K., Lerch, R. A., Randolph, V. B., LaPierre, N. A., Dack, K. M. H., Hancock, G. E.
(2004). Recombinant Respiratory Syncytial Viruses Lacking the C-Terminal Third of the Attachment (G) Protein Are Immunogenic and Attenuated In Vivo and In Vitro. J. Virol.
78: 5773-5783
[Abstract]
[Full Text]
-
Ramaswamy, M., Shi, L., Monick, M. M., Hunninghake, G. W., Look, D. C.
(2004). Specific Inhibition of Type I Interferon Signal Transduction by Respiratory Syncytial Virus. Am. J. Respir. Cell Mol. Bio.
30: 893-900
[Abstract]
[Full Text]
-
Spann, K. M., Tran, K.-C., Chi, B., Rabin, R. L., Collins, P. L.
(2004). Suppression of the Induction of Alpha, Beta, and Gamma Interferons by the NS1 and NS2 Proteins of Human Respiratory Syncytial Virus in Human Epithelial Cells and Macrophages. J. Virol.
78: 4363-4369
[Abstract]
[Full Text]
-
Easton, A. J., Domachowske, J. B., Rosenberg, H. F.
(2004). Animal Pneumoviruses: Molecular Genetics and Pathogenesis. Clin. Microbiol. Rev.
17: 390-412
[Abstract]
[Full Text]
-
Schwarze, J., O'Donnell, D. R., Rohwedder, A., Openshaw, P. J. M.
(2004). Latency and Persistence of Respiratory Syncytial Virus Despite T Cell Immunity. Am. J. Respir. Crit. Care Med.
169: 801-805
[Abstract]
[Full Text]
-
Dauber, B., Heins, G., Wolff, T.
(2004). The Influenza B Virus Nonstructural NS1 Protein Is Essential for Efficient Viral Growth and Antagonizes Beta Interferon Induction. J. Virol.
78: 1865-1872
[Abstract]
[Full Text]
-
Spann, K. M., Collins, P. L., Teng, M. N.
(2003). Genetic Recombination during Coinfection of Two Mutants of Human Respiratory Syncytial Virus. J. Virol.
77: 11201-11211
[Abstract]
[Full Text]
-
Bossert, B., Marozin, S., Conzelmann, K.-K.
(2003). Nonstructural Proteins NS1 and NS2 of Bovine Respiratory Syncytial Virus Block Activation of Interferon Regulatory Factor 3. J. Virol.
77: 8661-8668
[Abstract]
[Full Text]
-
Valarcher, J.-F., Furze, J., Wyld, S., Cook, R., Conzelmann, K.-K., Taylor, G.
(2003). Role of Alpha/Beta Interferons in the Attenuation and Immunogenicity of Recombinant Bovine Respiratory Syncytial Viruses Lacking NS Proteins. J. Virol.
77: 8426-8439
[Abstract]
[Full Text]
-
Finke, S., Mueller-Waldeck, R., Conzelmann, K.-K.
(2003). Rabies virus matrix protein regulates the balance of virus transcription and replication. J. Gen. Virol.
84: 1613-1621
[Abstract]
[Full Text]
-
Schlender, J., Zimmer, G., Herrler, G., Conzelmann, K.-K.
(2003). Respiratory Syncytial Virus (RSV) Fusion Protein Subunit F2, Not Attachment Protein G, Determines the Specificity of RSV Infection. J. Virol.
77: 4609-4616
[Abstract]
[Full Text]
-
Munir, S., Kapur, V.
(2003). Regulation of Host Cell Transcriptional Physiology by the Avian Pneumovirus Provides Key Insights into Host-Pathogen Interactions. J. Virol.
77: 4899-4910
[Abstract]
[Full Text]
-
Young, D. F., Andrejeva, L., Livingstone, A., Goodbourn, S., Lamb, R. A., Collins, P. L., Elliott, R. M., Randall, R. E.
(2003). Virus Replication in Engineered Human Cells That Do Not Respond to Interferons. J. Virol.
77: 2174-2181
[Abstract]
[Full Text]
-
Park, M.-S., Shaw, M. L., Munoz-Jordan, J., Cros, J. F., Nakaya, T., Bouvier, N., Palese, P., Garcia-Sastre, A., Basler, C. F.
(2002). Newcastle Disease Virus (NDV)-Based Assay Demonstrates Interferon-Antagonist Activity for the NDV V Protein and the Nipah Virus V, W, and C Proteins. J. Virol.
77: 1501-1511
[Abstract]
[Full Text]
-
Muller-Doblies, D., Ackermann, M., Metzler, A.
(2002). In Vitro and In Vivo Detection of Mx Gene Products in Bovine Cells following Stimulation with Alpha/Beta Interferon and Viruses. CVI
9: 1192-1199
[Abstract]
[Full Text]
-
Neumann, G., Whitt, M. A., Kawaoka, Y.
(2002). A decade after the generation of a negative-sense RNA virus from cloned cDNA - what have we learned?. J. Gen. Virol.
83: 2635-2662
[Abstract]
[Full Text]
-
Krempl, C., Murphy, B. R., Collins, P. L.
(2002). Recombinant Respiratory Syncytial Virus with the G and F Genes Shifted to the Promoter-Proximal Positions. J. Virol.
76: 11931-11942
[Abstract]
[Full Text]
-
Wansley, E. K., Parks, G. D.
(2002). Naturally Occurring Substitutions in the P/V Gene Convert the Noncytopathic Paramyxovirus Simian Virus 5 into a Virus That Induces Alpha/Beta Interferon Synthesis and Cell Death. J. Virol.
76: 10109-10121
[Abstract]
[Full Text]
-
Mahalingam, S., Meanger, J., Foster, P. S., Lidbury, B. A.
(2002). The viral manipulation of the host cellular and immune environments to enhance propagation and survival: a focus on RNA viruses. J. Leukoc. Biol.
72: 429-439
[Abstract]
[Full Text]
-
Weber, F., Bridgen, A., Fazakerley, J. K., Streitenfeld, H., Kessler, N., Randall, R. E., Elliott, R. M.
(2002). Bunyamwera Bunyavirus Nonstructural Protein NSs Counteracts the Induction of Alpha/Beta Interferon. J. Virol.
76: 7949-7955
[Abstract]
[Full Text]
-
Bossert, B., Conzelmann, K.-K.
(2002). Respiratory Syncytial Virus (RSV) Nonstructural (NS) Proteins as Host Range Determinants: a Chimeric Bovine RSV with NS Genes from Human RSV Is Attenuated in Interferon-Competent Bovine Cells. J. Virol.
76: 4287-4293
[Abstract]
[Full Text]
-
Durbin, J. E., Johnson, T. R., Durbin, R. K., Mertz, S. E., Morotti, R. A., Peebles, R. S., Graham, B. S.
(2002). The Role of IFN in Respiratory Syncytial Virus Pathogenesis. J. Immunol.
168: 2944-2952
[Abstract]
[Full Text]
-
Andrejeva, J., Young, D. F., Goodbourn, S., Randall, R. E.
(2002). Degradation of STAT1 and STAT2 by the V Proteins of Simian Virus 5 and Human Parainfluenza Virus Type 2, Respectively: Consequences for Virus Replication in the Presence of Alpha/Beta and Gamma Interferons. J. Virol.
76: 2159-2167
[Abstract]
[Full Text]
-
Zhirnov, O. P., Konakova, T. E., Wolff, T., Klenk, H.-D.
(2002). NS1 Protein of Influenza A Virus Down-Regulates Apoptosis. J. Virol.
76: 1617-1625
[Abstract]
[Full Text]
-
Schlender, J., Walliser, G., Fricke, J., Conzelmann, K.-K.
(2002). Respiratory Syncytial Virus Fusion Protein Mediates Inhibition of Mitogen-Induced T-Cell Proliferation by Contact. J. Virol.
76: 1163-1170
[Abstract]
[Full Text]
-
Bukreyev, A., Belyakov, I. M., Berzofsky, J. A., Murphy, B. R., Collins, P. L.
(2001). Granulocyte-Macrophage Colony-Stimulating Factor Expressed by Recombinant Respiratory Syncytial Virus Attenuates Viral Replication and Increases the Level of Pulmonary Antigen-Presenting Cells. J. Virol.
75: 12128-12140
[Abstract]
[Full Text]
-
Stope, M. B., Karger, A., Schmidt, U., Buchholz, U. J.
(2001). Chimeric Bovine Respiratory Syncytial Virus with Attachment and Fusion Glycoproteins Replaced by Bovine Parainfluenza Virus Type 3 Hemagglutinin-Neuraminidase and Fusion Proteins. J. Virol.
75: 9367-9377
[Abstract]
[Full Text]
-
Kato, A., Ohnishi, Y., Kohase, M., Saito, S., Tashiro, M., Nagai, Y.
(2001). Y2, the Smallest of the Sendai Virus C Proteins, Is Fully Capable of both Counteracting the Antiviral Action of Interferons and Inhibiting Viral RNA Synthesis. J. Virol.
75: 3802-3810
[Abstract]
[Full Text]
-
Wang, X., Li, M., Zheng, H., Muster, T., Palese, P., Beg, A. A., García-Sastre, A.
(2000). Influenza A Virus NS1 Protein Prevents Activation of NF-kappa B and Induction of Alpha/Beta Interferon. J. Virol.
74: 11566-11573
[Abstract]
[Full Text]
-
Basler, C. F., Wang, X., Mühlberger, E., Volchkov, V., Paragas, J., Klenk, H.-D., García-Sastre, A., Palese, P.
(2000). The Ebola virus VP35 protein functions as a type I IFN antagonist. Proc. Natl. Acad. Sci. USA
10.1073/pnas.220398297v1
[Abstract]
[Full Text]
-
Basler, C. F., Wang, X., Muhlberger, E., Volchkov, V., Paragas, J., Klenk, H.-D., Garcia-Sastre, A., Palese, P.
(2000). The Ebola virus VP35 protein functions as a type I IFN antagonist. Proc. Natl. Acad. Sci. USA
97: 12289-12294
[Abstract]
[Full Text]