Previous Article | Next Article 
Journal of Virology, September 2000, p. 8166-8175, Vol. 74, No. 17
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Regulation of the Epstein-Barr Virus C Promoter by
AUF1 and the Cyclic AMP/Protein Kinase A Signaling Pathway
Ezequiel M.
Fuentes-Pananá,1
RongSheng
Peng,1
Gary
Brewer,2
Jie
Tan,1 and
Paul D.
Ling1,*
Department of Molecular Virology and
Microbiology, Baylor College of Medicine, Houston, Texas
77030,1 and Department of Molecular
Genetics and Microbiology, UMDNJ-Robert Wood Johnson Medical
School, Piscataway, New Jersey 088542
Received 10 January 2000/Accepted 6 June 2000
 |
ABSTRACT |
EBNA2 is an Epstein-Barr virus (EBV)-encoded protein that regulates
the expression of viral and cellular genes required for EBV-driven
B-cell immortalization. Elucidating the mechanisms by which EBNA2
regulates viral and cellular gene expression is necessary to understand
EBV-induced B-cell immortalization and viral latency in humans. EBNA2
targets to the latency C promoter (Cp) through an interaction with the
cellular DNA binding protein CBF1 (RBPJk). The EBNA2 enhancer in Cp
also binds another cellular factor, C promoter binding factor 2 (CBF2),
whose protein product(s) has not yet been identified. Within the EBNA2
enhancer in Cp, we have previously identified the DNA sequence required
for CBF2 binding and also determined that this element is required for efficient activation of Cp by EBNA2. In this study, the CBF2 activity was biochemically purified and microsequenced. The peptides sequenced were identical to the hnRNP protein AUF1. Antibodies against AUF1 but
not antibodies to related hnRNP proteins reacted with CBF2 in gel
mobility shift assays. In addition, stimulation of the cellular cyclic
AMP (cAMP)/protein kinase A (PKA) signal transduction pathway results
in an increase in detectable CBF2/AUF1 binding activity extracted from
stimulated cells. Furthermore, the CBF2 binding site was able to confer
EBNA2 responsiveness to a heterologous promoter when transfected cells
were treated with compounds that activate PKA or by cotransfection of
plasmids expressing a constitutively active catalytic subunit of PKA.
EBNA2-mediated stimulation of the latency Cp is also increased in
similar cotransfection assays. These results further support an
important role for CBF2 in mediating EBNA2 transactivation; they
identify the hnRNP protein AUF1 as a major component of CBF2 and are
also the first evidence of a cis-acting sequence other than
a CBF1 binding element that is able to confer responsiveness to EBNA2.
 |
INTRODUCTION |
Epstein-Barr virus (EBV) is a human
lymphocryptovirus associated with various human malignancies, including
Burkitt's lymphoma (BL), Hodgkin's disease, nasopharyngeal carcinoma,
and lymphoma in immunosuppressed individuals (53). EBV
establishes a lifelong infection in humans, where B lymphocytes are the
primary latent reservoir from which occasional virus reactivation
occurs (53).
EBV also establishes latent infection in B lymphocytes in vitro and
transforms them into continuously proliferating lymphoblastoid cell
lines (LCLs). LCLs generally express 11 viral genes (referred to as
latency III) that include EBNAs 1, 2, 3A, 3B, and 3C and EBNA-LP,
latent membrane proteins LMP-1, -2A, and 2B, and two small noncoding
RNAs (EBERs 1 and 2) (37). EBNA2 is essential for
EBV-induced immortalization of B lymphocytes (9, 26). One of
the major roles for EBNA2 is that it stimulates the expression of the
major latency C promoter (Cp) as well as the LMP-1 and LMP-2A genes
(18, 56, 63, 65, 69). EBNA2 also stimulates expression of
several cellular proteins, including c-Myc, which is likely to be
crucial for the immortalization process (11, 32, 38, 40, 47, 61,
62). Thus, EBNA2 is a key regulator of both viral and cellular
gene expression during the latent stage of viral infection.
The regulation of EBNA2 expression in EBV-infected cells is likely to
be important for viral persistence and the development of
EBV-associated malignancies. With the exception of EBNA1, all viral
latent proteins possess epitopes which induce a strong cytotoxic T-cell
response (43, 53). Downregulation of EBNA2 expression and
the concomitant downregulation of other latent proteins may allow a
latently infected B cell to escape immune surveillance and also permit
proliferation of malignant cells containing EBV. In healthy
individuals, latent EBV infection appears to be primarily confined to
resting B cells. The only EBV-expressed gene detected in these cells is
LMP-2A (a pattern of gene expression termed latency 0) (49, 50,
58). In BL cells, only EBNA1 is expressed (latency I) (53,
58). In Hodgkin's disease, nasopharyngeal carcinoma, and T-cell
lymphomas, EBNA1 and one or both LMPs are expressed (latency II)
(53, 58). However, all EBNAs and LMPs are expressed when a
competent immune response is not present, such as in primary infection,
infectious mononucleosis, lymphoproliferative syndromes of
immunocompromised individuals, and also LCLs (latency III) (53,
58). The association of these specific patterns of protein
expression with various physiological and pathological states
underscores the importance of viral gene regulation for persistence and
oncogenesis. Cp and EBNA2 expression are likely to be major targets of
this regulation. Elucidating the mechanisms that regulate transcription
mediated by EBNA2 is therefore important for understanding EBV biology.
EBNA2 interacts with target promoters through contact with the
ubiquitous cellular DNA binding protein C promoter binding factor 1 (CBF1 or RBPJk) (24, 28, 45, 69). CBF1 binding sites are
found in all of the well-characterized EBNA2-responsive enhancers, and
recombinant viruses expressing a mutant EBNA2 protein unable to
interact with CBF1 fail to immortalize B cells (66). In
addition to CBF1, another cellular factor(s) binds the Cp
EBNA2-responsive enhancer, called C promoter binding factor 2 (CBF2)
(33, 44). We have recently reported that the CBF2 binding
site is also very important for EBNA2 stimulation of Cp in transient
cotransfection assays (19). Moreover, this site is conserved
in Cp from EBV-like lymphocryptoviruses of nonhuman primates and, like
EBV Cp, is required for optimal stimulation by EBNA2 (20).
In more biological assays, EBV recombinant viruses with a Cp containing
a mutant CBF1 binding site had a modest average reduction in Cp
activity relative to wild-type viruses (17). In another
study, EBV recombinant viruses deleted for the Cp EBNA2 enhancer, which
binds both CBF1 and CBF2, are strongly biased for Bam W
promoter (Wp) usage and have little detectable Cp activity
(67). These results suggest that in the context of the viral
genome, Cp activity is dependent on factors other than CBF1, possibly
including CBF2.
In this study, we sought to identify the cellular protein(s) that
comprise CBF2. We have determined that a principal component of CBF2 is
the hnRNP protein AUF1. Interestingly, we also found that CBF2 is
regulated by the cyclic AMP-protein kinase A (cAMP/PKA) signaling
pathway, and this pathway contributes to the regulation of Cp activity.
 |
MATERIALS AND METHODS |
Cell culture.
EBV-negative BL cell lines DG75 and CA46 were
maintained in RPMI 1640 supplemented with 10% fetal bovine serum and
incubated in 5% CO2 at 37°C. In some experiments, PKA
was induced by treatment of cells with 1 µM dibutyryl cAMP (Sigma).
Plasmids.
Reporter plasmids (pEFP40 and CpLUC) containing
EBV sequences from nucleotides 10312 to 11336, which correspond to
nucleotides
1021 to +3 relative to the C promoter (Cp)
transcriptional initiation site, have been described previously
(19). Derivatives of pEFP40 containing mutations
in the CBF2 (pEFP56 or mut.CBF2CpLUC) and CBF1 (pEFP76 or
mut.CBF1CpLUC) binding sites have also been described previously
(19). Plasmid pEFP100 carries 16 copies of the wild-type Cp
CBF2 binding site (16xCBF2LUC), and pEFP101 carries 16 copies of a
mutant CBF2 binding site (GGTTCA
GGGGCA)
cloned into the pGL3 promoter vector. Construction of multiple
tandem copies of the CBF2 binding oligonucleotides was done as
previously described (45). The oligonucleotides used for
these constructions are as follows: CBF2 binding site: 5'
GATCTAAAAATTTATGGTTCAGTGCGTCGAGTGCTG 3' (sense strand) and
5' GATCCAGCACTCGACGCACTGAACCATAAATTTTTA 3' (antisense
strand); and mutant CBF2 binding site (transversion changes are
underlined): 5' GATCTAAAAATTTATGGGGCAGTGCGTCGAGTGCTG 3' (sense strand) and 5'
GATCCAGCACTCGACGCACTGCCCCATAAATTTTTA 3' (antisense strand).
Plasmid pRSP18 is a derivative of pPDL176A, which contains the
wild-type version of EBNA2 cloned in the SG5 expression vector and an
N-terminal FLAG sequence which was introduced in-frame with the EBNA2
initiation codon. The LMP-2A reporter plasmid contains the LMP-2A
promoter region from
276 to +91 and was generously provided by Ursula
Zimber-Strobl (LMP2ALUC) (69). Plasmid pPDL151 expressing
the wild-type form of EBNA2 has been described previously (45). The plasmid expressing the catalytic subunit of
PKA
was generously provided by Richard Maurer (46). AUF1
plasmids have been described previously (68).
Protein purification and microsequencing.
CA46 cells were
used to produce nuclear extracts by a standard Dignam procedure.
Nuclear extracts from 2 × 1010 cells were
fractionated by application to a heparin-Sepharose column and eluted
with a linear 0.1 to 1.0 M KCl gradient. After elution from the
heparin-Sepharose column, the CBF2 activity of the fractions was
determined by an electrophoretic mobility shift assay (EMSA) using the
Cp CBF2 binding site as a probe. Fractions with binding activity were
combined and further purified by DNA affinity chromatography using the
Cp CBF2 oligonucleotide coupled to agarose, using procedures described
previously (28). Fractions obtained from the DNA affinity
column containing CBF2 binding activity were tested by EMSA. The
proteins present in the fractions with CBF2 activity were visualized by
silver staining of a sodium dodecyl sulfate (SDS)-polyacrylamide gel.
UV cross-linking analysis was performed as previously described to
reveal the protein which bound to the CBF2 binding oligonucleotide
(19). To obtain the amino acid sequence from this protein,
the gel fragment containing the activity was excised and digested in
situ with Lys-C endoprotease. Single peptides were subjected to
NH2-terminal microsequencing (Baylor College of Medicine
protein sequencing core facility).
EMSA.
EMSAs were performed as described previously
(19). Unless otherwise indicated, pooled fractions
containing CBF2 activity derived from CA46 nuclear extracts that had
been purified by heparin-Sepharose chromatography were used for EMSAs
(44). For competition assays, unlabeled mutant
oligonucleotides were annealed and added to the binding reaction at the
indicated molar concentrations relative to the labeled wild-type
oligonucleotide probe. For competition assays, unlabeled competitor
oligonucleotides were incubated for 10 min with the nuclear extracts
before addition of the radioactive probe. After EMSA, the amount of
bound CBF2 activity was quantitated with a Molecular Dynamics
PhosphorImager. Relative affinities of oligonucleotide binding to CBF2
were calculated as described previously (19). The following
series of oligonucleotides were used in EMSAs (top strand only shown):
wild-type Cp CBF2, 5' GATCAATTTATGGTTCAGTGCGTCGAGTGCTAG 3'
(19); Mut Cp CBF2, 5'
GATCAATTTATGGGGCAGTGCGTCGAGTGCTAG 3' (19);
hnRNP A, 5' GATCTATGATAGGGACTTAGGGTG 3' (5);
hnRNP C, 5' GATCCTGGGAGGAGTTGGGGGAGGAGATTAGG 3'
(57); CarG, 5' GATCTTTTTTACCTAATTAGGAAATG 3'
(55); and AUF1, 5' GATCTAGATTACTTCAAAATAA 3'
(59).
Each top-strand oligonucleotide contains a GATC 5' overhang when
annealed to its complimentary oligonucleotide and enables
the duplex
oligonucleotides to be labeled by a Klenow fill-in
procedure
(
44).
Antibodies.
Monoclonal antibodies 4B10 (anti-hnRNP A), 4F4
(anti-hnRNP C), and 5B9 (anti-AUF1/hnRNP D) were kindly provided by
Gideon Dreyfuss (7, 52). Monoclonal antibodies to nucleolin,
CREB/ATF, and Jun/Fos proteins were purchased from Santa Cruz
Biotechnology. Polyclonal serum against AUF1 was prepared as described
previously (68).
Immunoblotting.
DG75 cells were transfected with expression
plasmids and 48 h later were lysed in radioimmunoprecipitation
assay buffer containing protease inhibitors. Protein (30 µg) was
resolved on an SDS-8% polyacrylamide gel and then transferred to
nitrocellulose membranes (Schleicher and Schuell). The membrane was
blocked overnight with 5% nonfat dried milk and 0.05% Tween 20 in
phosphate-buffered saline (PBS). Anti-FLAG M5 monoclonal antibody
(Sigma) was added at a 1:5,000 dilution and incubated for 1 h at
room temperature. After several washes in PBS, a secondary antibody,
horseradish peroxidase-conjugated anti-mouse immunoglobulin (Ig) (Santa
Cruz Biotechnology) was added at a 1:3,000 dilution. The proteins
recognized by the antibodies were detected by an enhanced
chemiluminescence Western detection system (Pierce). Bands were
quantified with a densitometer (Bio-Rad).
Transfections and luciferase assays.
Cells were transfected
by the DEAE-dextran method as previously described (19).
Transfections were harvested after 2 days of incubation, and the
luciferase dual system (Promega) was used to determine the luciferase
activity of the reporter genes and of the internal control (pRL-SV40;
Promega) according to the manufacturer's instructions.
 |
RESULTS |
AUF1/hnRNP D binds the Cp CBF2 binding site.
In order to
identify the protein component(s) that mediates CBF2 activity, nuclear
extracts from CA46 cells were purified by heparin-Sepharose and DNA
affinity chromatography (see Materials and Methods). Fractions obtained
from the DNA affinity column containing the CBF2 binding activity were
determined by EMSA using the CBF2 binding oligonucleotide as a probe.
While several polypeptides of 15 to 45 kDa were observed, UV
cross-linking showed that only a peptide of 40 kDa reacted with the
CBF2 binding oligonucleotide probe (data not shown). The 40-kDa protein
was excised from the polyacrylamide gel, and the amino acid sequence
was determined. Three internal peptides derived from digestion of the
protein with endonuclease Lys-C were sequenced. The sequences of the
three peptides had 100% homology to the protein AUF1/hnRNP D (Fig.
1).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Amino acid sequences of three peptides derived from
purified CBF2 polypeptide aligned with the AUF1/hnRNP D protein. The
sequence of the AUF1/hnRNP D protein has been reported previously
(68). The peptide sequences are shown below the region
matching the AUF1/hnRNP D protein sequence (top line).
|
|
Because of the high homology between members of the hnRNP proteins,
oligonucleotides containing the binding sites for some
of the hnRNPs
were synthesized, and the affinity of each hnRNP
binding site for the
CBF2 activity was measured by EMSA. hnRNPs
are mostly single-stranded
RNA binding proteins, although they
have also been shown to bind
single-stranded DNA with high affinity.
Single-stranded DNA
oligonucleotides containing the binding sites
for AUF1, hnRNP A and C,
and the hnRNP-related protein CarG binding
factor (CBF-A) were used as
competitors in an EMSA. CA46 nuclear
extracts (see Materials and
Methods) were used as a source of
CBF2 for these studies. The affinity
of each hnRNP binding site
for the CBF2 activity was measured by its
ability to compete for
binding with the double-stranded Cp CBF2 binding
site. Competitor
oligonucleotides were used at a 40 M excess relative
to the concentration
of the probe. The competition assay showed that
the oligonucleotide
containing the binding site for AUF1 had the
highest affinity
for CBF2 relative to the other hnRNP binding
oligonucleotides
(Fig.
2). Competition
with this binding site was similar to competition
with the CBF2 binding
site itself (Fig.
2). Using a 40 M excess
of competitor, the hnRNP A
oligonucleotide competes with 50% efficiency
relative to the CBF2
binding oligonucleotide. This oligonucleotide
contains the telomeric
sequence TTAGGG that has also been reported
to bind AUF1,
which may explain the partial competition. At this
concentration of
competitor, there is also a partial competition
with the CBF-A
oligonucleotide, while there is no competition
with the hnRNP C binding
site. These results indicate that the
activity that binds the Cp CBF2
binding site has a similar binding
specificity to AUF1.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
Affinity of hnRNP binding sites for CBF2. Different
hnRNP binding oligonucleotides were used to compete for CBF2 binding
activity in an EMSA. CA46 nuclear extracts were mixed with a 40 M
excess of the unlabeled hnRNP oligonucleotides. A
32P-labeled oligonucleotide containing the CBF2 binding
site, Cp sequences 339 to 368, was then added to the shift
reaction. The unlabeled competitor oligonucleotide (see Materials and
Methods) used are indicated above the autoradiograph. Lanes with probe
only (probe) and nuclear extract with no competitor added ( ) are also
shown.
|
|
To further identify the component of the CBF2 binding activity,
different antibodies against hnRNPs were tested for their
ability to
react with CBF2 complexes in an EMSA (Fig.
3A). Antibodies
to AUF1/hnRNP D
supershifted CBF2, while antibodies to hnRNP A
or C or a negative
control, HMG I(Y), were unable to supershift
CBF2 (Fig.
3A). The
anti-AUF1 serum was able to complex with approximately
70% of CBF2
binding activity as determined by quantitation of
the EMSA bands using
a PhosphorImager. A nonspecific binding activity
is present when
antibody is incubated without nuclear extract
which is also present in
the preimmune sera (Fig.
3B). Preimmune
antiserum does not affect CBF2
binding activity or produce a supershifted
complex (Fig.
3B). This
result indicates that AUF1 is a major
part of the cellular activity
that binds the Cp CBF2 binding site.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Anti-AUF1/hnRNP D binds CBF2. Anti-hnRNP antibodies were
incubated with CA46 nuclear extracts, and after 30 min of incubation, a
32P-labeled oligonucleotide probe containing the binding
site for CBF2 was added to the reaction. (A) Autoradiography of a
supershift analysis with antibodies against hnRNPs AUF1/hnRNP D (lane
5), A (lane 7), and C (lane 9) and control antibody against the HMG
I(Y) protein (lane 11). Antibodies added to gel shift reactions without
any added nuclear extract are shown in lanes 6 (AUF1/hnRNP D), 8 (hnRNP
A), 10 (hnRNP C), and 12 [HMG I(Y)]. The CBF2-specific complex is
confirmed by competitions with wild-type (wt) and mutant (mut)
oligonucleotides shown in lanes 2 to 4. (B) Autoradiography of the
supershift with preimmune and anti-AUF1/hnRNP D antisera. Lanes 1 to 6 are the same as in panel A. Preimmune serum was added to reactions in
lanes 7 and 8 with and without nuclear extract, respectively. Both
preimmune and immune sera form minor complexes with the labeled DNA
probe and are indicated by asterisks.
|
|
CBF2/AUF1 activity binds both double- and single-stranded DNA.
Like other RNA binding proteins, AUF1 has been reported to bind
single-stranded DNA. We therefore estimated by EMSA the preference of
AUF1 binding for double-stranded and the sense and antisense strands of
the Cp CBF2 binding site. CA46 nuclear extracts were mixed with
increasing concentrations of the unlabeled double-stranded or
single-stranded sense and antisense CBF2 binding oligonucleotides, and
CBF2/AUF1 binding activity was detected by EMSA. Single-stranded antisense DNA had the highest affinity for CBF2, while the
double-stranded DNA and single-stranded sense DNA oligonucleotides had
twofold and sixfold decreasing affinities, respectively (Fig.
4A). The ability of CBF2 to bind
single-stranded DNA and to prefer binding to the antisense strand is
similar to previous studies of AUF1 binding preferences
(60).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 4.
CBF2/AUF1 is a sequence-specific DNA binding protein
that binds single- and double-stranded DNA. (A) Autoradiograph of a
competitive EMSA in which double- and single-stranded DNAs were used as
competitors. A duplex oligonucleotide containing the Cp CBF2 binding
site was used as a probe, and the same oligonucleotide in its double-
or single-stranded form was used as the competitor. Competitor
oligonucleotides were added at a 2.5-, 5-, and 25-fold molar excess
relative to the probe, as indicated by the open triangles. Probe alone
and probe bound with nuclear extract only are shown in lanes 1 and 2, respectively. (B) Autoradiograph of an EMSA in which different mutant
CBF2 binding sites were used as competitors for CBF2 binding to the Cp
CBF2 oligonucleotide probe. The indicated competitor oligonucleotide
probes (see text) were added at a 2.5-, 5-, and 25-fold molar excess
relative to the probe, as indicated by the open triangles. Probe alone
and probe bound with nuclear extract only are shown in lanes 1 and 2, respectively. The asterisks denote a smaller shifted complex that is
seen occasionally and is dependent on the batch of nuclear extract used
for the experiments.
|
|
We then proceeded to test if the binding to single-stranded DNA had the
same specificity as binding to double-stranded DNA.
We have shown that
the most critical residues for CBF2 binding
in Cp are to the sequence
GGTTCA (or TGAACC of the antisense strand)
(
19). A competitive EMSA was performed using several mutant
CBF2 oligonucleotide probes that have been characterized previously.
Mutants 3 (GGTTCA

ttTTCA) and 4 (GGTTCA

GGggCA) have changes
within the residues
important for CBF2 binding. Mutant 8 has changes
of two
nucleotides eight bases downstream of the GGTTCA motif,
and
this mutant has an increased affinity for binding (
19).
The
[
32P]antisense strand was used as a probe, and mutant
antisense oligonucleotides
were added as unlabeled competitors to the
shift reaction. Competition
results show that mutant 8 has the higher
affinity for binding,
while mutants 3 and 4 have a greatly reduced
affinity (Fig.
4B).
These competitions indicate that the binding to
single-stranded
DNA is also highly specific and has the same
requirement for the
GGTTCA sequence binding to the
double-stranded binding
site.
The CBF2 oligonucleotide contains an A/T-rich region upstream of the
GGTTCA sequence that resembles binding sites for AUF1/hnRNP
D, hnRNP A, and CarG. Mutagenesis of the A/T-rich region did not
significantly affect the binding of the CBF2/AUF1 activity, indicating
that the GGTTCA sequence is the only binding site for
CBF2/AUF1
present in the Cp CBF2 oligonucleotide (data not
shown).
AUF1/hnRNP D activity is induced by stimulation of the cAMP/PKA
signaling pathway.
In vitro binding of AUF1 to the cellular CD21
promoter is enhanced in cellular extracts derived from cells treated
with cAMP analogs (59). Activation of the cAMP/PKA signaling
pathway also results in upregulation of the CD21 promoter
(59). Since the cAMP/PKA signaling pathway appeared to
influence AUF1-mediated activation of the CD21 promoter, we wanted to
determine if induction of the cAMP/PKA signaling pathway would also
result in increased CBF2/AUF1 binding activity. DG75 cells were treated
with different conditions to stimulate the cAMP/PKA pathway. DG75 cells
were used for these studies because they are more amenable to
transfection than CA46 cells (unpublished observations)
(41). CA46 cells were used in the earlier biochemical
studies because they are more easily adapted for growth in spinner
cultures that were used to generate large numbers of cells for
preparation of nuclear extracts for biochemical purification. Previous
studies have indicated that EBNA2 activity is indistinguishable in the
two cell types (41). DG75 cells were either transfected with
a plasmid that expresses the catalytic subunit of
PKA, incubated
with the cAMP analog dibutyryl cAMP, or given both stimuli. Cellular
extracts were obtained 48 h posttreatment, and equal
concentrations of protein were used in an EMSA to test the CBF2/AUF1
binding activity after induction. Unstimulated or untransfected cell
extracts were used as a negative control. Highly purified and
concentrated cellular extracts from CA46 cells were used as a positive
control. CBF2/AUF1 binding activity was induced ninefold when the cells
were transfected with a PKA expression plasmid and treatment with
dibutyryl cAMP, while individual stimulation with plasmid transfection
or the cAMP analog caused a six- and fivefold induction, respectively (Fig. 5A). Both the CA46 CBF2/AUF1
activity and the cAMP/PKA-stimulated activity of DG75 extracts had the
same specificity for binding to the Cp CBF2/AUF1 site, as demonstrated
by competition with wild-type and mutant binding sites (Fig. 5B).
Furthermore, the cAMP/PKA-stimulated activity is also recognized by an
anti-AUF1 antibody (Fig. 5B). These results strongly suggest that the
activity from DG75 cells that is upregulated by stimulation of the
cAMP/PKA pathway is the same CBF2/AUF1 activity present in the
heparin-purified nuclear extracts from CA46 cells. Thus, the CBF2/AUF1
activity that binds the EBNA2 enhancer in the Cp is targeted for
regulation by signals transduced by the cAMP/PKA cellular pathway. To
address whether stimulation through the cAMP/PKA pathway modifies
existing CBF2/AUF1 protein to bind DNA or induces transcriptional or
translational mechanisms that result in greater synthesis of CBF2/AUF1,
we also performed immunoblot analysis on the cellular extracts used in Fig. 5A. Using antibodies to the AUF1 protein (68), the
total amounts of AUF1 detected by immunoblot did not change when the cAMP/PKA pathway was induced (Fig. 5C). Thus, induction of cAMP/PKA is
likely to modify existing pools of AUF1 that result in induction of
AUF1 binding. To test whether other transcription factors were affected
by PKA/cAMP treatment, we also performed an EMSA using a CBF1-specific
DNA probe. DG75 cells treated cotransfected with a PKA expression
plasmid or treated with dibutyryl cAMP did not have any demonstrable
increase in CBF1 binding. Thus, PKA/cAMP induction does not appear to
have global effects on DNA binding activity of other transcription
factors.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 5.
CBF2/AUF1 binding activity is increased by induction of
the cAMP/PKA signal transduction pathway. (A) Autoradiograph of an EMSA
that shows CBF2/AUF1 binding from heparin-Sepharose-purified CA46
control extracts (lanes 2 to 4) and cell extracts from DG75 cells that
were untreated (lane 5), transfected with a plasmid constitutively
expressing PKA (lane 6), treated with a cAMP analog dibutyryl cAMP
(lane 7), or both (lane 8). Heparin-Sepharose-purified CA46 extracts
were used as a control, and competitions with wild-type (wt) and mutant
(mut) CBF2 binding oligonucleotides were used as a control for
specificity of binding (lanes 2 to 4). (B) Autoradiograph of an EMSA
that shows CBF2 binding from partially purified CA46 control extracts
(lanes 2 to 4) and cell extracts from DG75 cells transfected with a
plasmid constitutively expressing PKA and treated with the cAMP analog
dibutyryl cAMP. Wild-type competitor oligonucleotide inhibits CBF2
(lanes 3 and 7), while the mutant competitor does not (lanes 4 and 8).
Antibody to AUF1 was added to the gel shift reaction mixtures in lanes
5 and 9. (C) Immunoblot of AUF1 protein from SG5- or PKA-transfected
DG75 cells and DG75 cells transfected with PKA and treated with
dibutyryl cAMP. Blots were probed with AUF1 antiserum as described
previously (66). Molecular size standards are shown on the
right (in kilodaltons). AUF1 appears as a doublet of p40 and p42
proteins. (D) Autoradiograph of an EMSA that shows CBF1 binding from
DG75 cells transfected with pSG5 expression vector alone (lane 1), a
PKA expression vector (lane 2), or a PKA expression vector and
treatment with dibutyryl cAMP (lane 3). Lanes 4 and 5 show CBF1 binding
in the presence of an unlabeled wild-type CBF1 binding competitor
oligonucleotide and a mutant oligonucleotide unable to bind CBF1,
respectively. Probe- and CBF1-specific complexes are indicated to the
right. In some cases CBF1 binding activity is detected as two bands,
with the slower migrating form in less abundance
(43; unpublished observations).
|
|
cAMP/PKA signaling enhances EBNA2 stimulation of Cp and confers
EBNA2 responsiveness to CBF2 binding sites.
Because the
binding of CBF2/AUF1 to the response element in Cp is increased
severalfold by cAMP/PKA signaling, we wanted to know if the
cAMP/PKA pathway regulates expression of Cp. DG75 cells were
cotransfected with a Cp reporter construct (CpLUC) and plasmids
constitutively expressing EBNA2 (pPDL151) and the catalytic
subunit of
PKA (pPKA). Cp-driven reporter activity was then
measured. Interestingly, we found that while activity of Cp is not
induced by PKA expression alone, PKA together with EBNA2 expression
resulted in higher levels of Cp stimulation (6.3-fold) than observed
with EBNA2 expression alone (4-fold) (Fig.
6A). Cotransfection of pPDL151 and pPKA
with the control reporter vector without Cp sequences failed to
stimulate gene activity (data not shown).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6.
Cotransfection of EBNA2 and constitutively active PKA
activates Cp and confers EBNA2 responsiveness to a minimal promoter
containing CBF2 binding sites. (A) Target plasmids were cotransfected
with or without EBNA2- and PKA-expressing plasmids. The amounts of
effector plasmids are indicated below the bar graph, and fold
activation is indicated to the left. The CpLUC reporter plasmid pEFP40
was used as the target reporter plasmid. Results are averages from
three independent experiments. Bars show standard errors of the means.
(B) Cotransfection assays using either 16xCBF2LUC (open bars) or
16xmut.CBF2LUC (solid bars) as target plasmids and EBNA2 and/or PKA
expression plasmids as effector plasmids. Concentrations of effector
plasmids are indicated below the bar graph, and fold activation is
indicated to the left. Target plasmids were generally used at 2.0 µg
unless otherwise specified. Results are averages from three independent
experiments ± standard errors of the mean. (C) Western blot to
estimate the abundance of EBNA2 in transfected DG75 cells in the
presence and absence of PKA induction. Extracts derived from cells
transfected with FLAG-EBNA2 (lane 1), EBNA2 and PKA (lane 2), or vector
alone (lane 3) were resolved by SDS-PAGE, transferred to
nitrocellulose, and immunoblotted using the M5 anti-FLAG antibody. The
EBNA2-specific band is indicated by the arrow on the left. Nonspecific
bands were detected by the FLAG monoclonal antibody in all cellular
extracts.
|
|
Since the CBF2/AUF1 binding activity is increased when the
cAMP/PKA signaling pathway is stimulated, we tested whether Cp
CBF2/AUF1 binding sites alone could confer EBNA2 responsiveness
when
the cAMP/PKA pathway was activated. Reporter plasmids containing
multimerized wild-type (pEFP100 or 16xCBF2LUC) and mutant
CBF2
(pEFP101 or 16xmut.CBF2LUC) binding sites were
cotransfected with
EBNA2 or PKA expression plasmids. In the absence of
PKA cotransfection,
EBNA2 did not stimulate either reporter plasmid
containing wild-type
or mutant binding sites to any appreciable level
(Fig.
6B). However,
cotransfection of both EBNA2 and PKA expression
plasmids resulted
in stimulation of reporter gene activity up to
38-fold for wild-type
reporter plasmids, but stimulated reporter
plasmids containing
mutant CBF2 binding sites to only 2- or 3-fold
above background
levels (Fig.
6B). While these data demonstrate a
powerful ability
of PKA to confer EBNA2 responsiveness on CBF2 reporter
plasmids,
it is likely that in the context of natural promoters
containing
only a single CBF2 binding site, the role of CBF2 will be
somewhat
reduced. This is in agreement with data in Fig.
6A that shows
an increase in EBNA2-mediated Cp activation by PKA stimulation
that,
while statistically significant, is somewhat more modest.
Levels of
endogenous PKA modulation may also mask some of CBF2's
effect on Cp
activation and are addressed in the experiments shown
in Fig.
8. As a
control, cotransfection of a plasmid expressing
the

isoform of PKC
was unable to stimulate the expression of
16xCBF2LUC, indicating a
specific requirement for the cAMP/PKA
pathway (data not shown). A
different level of specificity was
demonstrated in experiments in which
plasmids expressing the active
cytoplasmic form of human Notch 1 and
Notch 2, which also activate
promoters through interaction with CBF1,
were used instead of
EBNA2. Neither form of Notch was able to activate
the 16xCBF2LUC
reporter plasmid either alone or combined with PKA (data
not
shown).
To rule out the possibility that PKA expression affects EBNA2
expression in the transient cotransfection assays, we performed
an
immunoblot analysis to detect EBNA2 protein levels. An N-terminally
FLAG-tagged EBNA2 (pRSP18) was transfected into DG75 cells with
and
without pPKA. Western blot analysis using an anti-FLAG antibody
shows that the abundance of EBNA2 in the transfected cells is
not
significantly induced by cotransfection with PKA (Fig.
6C).
Dose-response experiments using pRSP18 did not show any
difference
in its ability to stimulate the 16xCBF2LUC reporter
compared to
stimulation by nontagged EBNA2 (data not
shown).
Enhancement of EBNA2-mediated stimulation of Cp by PKA is dependent
on a functional CBF2/AUF1 binding site.
Because EBNA2 stimulation
of both Cp and CBF2/AUF1 reporter plasmids is enhanced by PKA
signaling, we hypothesized that the activation of the full-length Cp
would be in part dependent on the CBF2/AUF1 binding site. A Cp
reporter plasmid containing a mutation in the CBF1 binding site was
also examined to determine if there was a dependence on CBF1 for this
activity. As expected, there was an almost fourfold activation of
the CpLUC with EBNA2 alone and a sixfold activation with EBNA2 and PKA
coexpression (Fig. 7). The
mut.CBFCp1LUC reporter plasmid was not stimulated under any condition,
while the mut.CBF2CpLUC reporter was slightly activated. We have
previously reported that mut.CBF2CpLUC can be activated to low levels
when cotransfected with high levels of EBNA2 expression plasmid
(19). These results indicate that the PKA-dependent
enhancement of EBNA2 stimulation of Cp requires both CBF2/AUF1 and CBF1
elements. Alternatively, the presence of only a single CBF2 binding
site in the context of Cp may not be sufficient to confer EBNA2
responsiveness under these conditions.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 7.
Enhancement of EBNA2-mediated stimulation of Cp is
dependent on CBF1 and CBF2 binding sites. DG75 cells were transfected
with target promoters CpLUC (open bars), CBF2mut.CpLUC (shaded
bars), and CBF1mut.CpLUC (solid bars). Cells were harvested
48 h after transfection, and the luciferase activity was
calculated. Target plasmids were cotransfected with EBNA2- or
PKA-expressing plasmids alone or together. Target plasmids were
generally used at 2.0 µg unless otherwise specified. Concentrations
of effector plasmids used are indicated below the bar graph, and fold
activation is indicated to the left. Results represent an average of
three independent experiments ± standard errors of the mean.
|
|
Kinetics of CBF2LUCIp activation after cAMP induction.
To
further characterize the PKA enhancement of EBNA2 stimulation of the
16xCBF2LUC reporter plasmid, the kinetics of promoter activation were
determined after treatment with dibutyryl cAMP. DG75 cells were
cotransfected with the 16xCBF2LUC- and EBNA2-expressing plasmids. At
24 h after transfection, fresh culture medium containing dibutyryl
cAMP was added to the cells. Cells were harvested at different times
postinduction, and luciferase activity was measured. No promoter
activity was detected at early times postinduction. However, at 24 h there was a fivefold stimulation (Fig.
8). Similar transfections with the CpLUC
reporter also indicated that enhancement by PKA induction required at
least 24 h (data not shown). The levels of 16xCBF2LUC induction
are lower than those observed when constitutively active PKA is
expressed by cotransfection. The difference is most likely due to the
fact that cAMP only activates existing PKA in the cell, while the PKA
expression plasmid provides higher levels of constitutively active PKA
expression. These data suggest that direct modification of CBF2/AUF1 by
PKA is not responsible for PKA-mediated enhancement and that events
further downstream are likely mediating transcriptional enhancement
through EBNA2.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 8.
Kinetics of PKA enhancement of EBNA2-mediated
transactivation after treatment with dibutyryl cAMP. DG75 cells were
cotransfected with the 16XCBF2LUC reporter and the EBNA2 expression
plasmid (8.0 µg of each) and 2.0 µg of the 16xCBF2LUC reporter
plasmid. At 24 h after transfection, cells were stimulated by
adding 1 µM dibutyryl cAMP to the culture medium (solid bars).
Transfected but untreated cells were used as a control (open bars).
Cells were harvested at different points after induction, and the
luciferase activity of the reporter gene was measured. Time points are
shown below the graph in hours, and fold activation is shown on the
left. Results are representative of three independent experiments ± standard errors of the mean.
|
|
Kinase activity of PKA required for enhancement of EBNA2
stimulation of Cp.
To determine whether PKA kinase activity is
required for its ability to enhance EBNA2-mediated transactivation, a
kinase inhibitor was tested. H89 is a Ser/Thr kinase inhibitor which
has a 10-fold-higher specificity for PKA than for other cellular
Ser/Thr kinases. DG75 cells were transfected with the 16xCBF2LUCp or
CpLUC reporter plasmid and expression plasmids for EBNA2 and PKA. In
addition, in some of the transfections, the H89 inhibitor was also
added. H89 treatment was able to block EBNA2/PKA-mediated stimulation of both 16xCBF2LUC and CpLUC to levels of activation observed with
EBNA2 alone (Fig. 9A and B). The results
obtained suggest that the kinase activity of PKA is required to enhance
EBNA2-mediated stimulation of Cp and to reporters containing CBF2
binding sites alone.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 9.
Effect of Ser/Thr kinase inhibitor H89 on the
enhancement of EBNA2-mediated stimulation of Cp by PKA. (A) DG75 cells
were cotransfected with the 16xCBF2LUC reporter and EBNA2 and/or PKA
expression plasmids. Target reporter plasmids were used at 2.0 µg,
and the effector plasmid concentrations are indicated below the graph.
The concentrations of H89 are also indicated below the graph. Cells
were harvested 48 h after transfection, and the luciferase
activity was calculated. Fold activation levels are shown on the left.
Results represent an average of three independent experiments ± standard errors of the mean. (B) Same as panel A except the CpLUC
reporter plasmid was used.
|
|
Enhancement of EBNA2 transactivation by PKA-mediated signaling is
not a general characteristic of all EBNA2-responsive promoters.
Among the EBV latency promoters, EBNA2 stimulates the Cp, LMP-1, and
LMP-2A promoters. Because the cAMP/PKA pathway targets both the Cp and
LMP-1 promoters, it is possible that this type of regulation is a
general characteristic of all latent EBNA2-responsive promoters. In
order to test this question, the EBNA2 enhancer present in the LMP-2A
promoter was tested for its ability to respond to PKA in transient
cotransfection experiments (Fig. 10).
The LMP-2Ap is activated 22-fold when cotransfected with EBNA2.
However, when cotransfected with a PKA-expressing plasmid, no further
stimulation occurs (Fig. 10). This indicates that signaling through PKA
does not target all EBNA2-responsive promoters. An alternative
explanation is that at the concentrations of EBNA2 effector plasmid
used, the LMP-2A promoter is already saturated and remains unresponsive to further stimulation. Similar transfection experiments with the
LMP-2A promoter were performed using different concentrations of
the EBNA2-expressing plasmid, with the same results (data not shown).
In agreement with these transfection results, our previous results
showed that CBF2/AUF1 does not bind to the EBNA2 enhancer located in
LMP-2A promoter sequences (19).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 10.
Analysis of the ability of EBNA2-responsive elements to
be activated by PKA. DG75 cells were transfected with the LMP-2A
promoter. Some cells were also transfected with EBNA2-expressing
plasmids or the PKA expression plasmid. Cells were harvested 48 h
after transfection, and the luciferase activity was calculated. Results
represent an average of three independent experiments ± standard
errors of the mean.
|
|
Expression of AUF1 cDNA results in a dose-dependent increase in
EBNA2 stimulation of Cp.
To further confirm that AUF1 was
conferring EBNA2 responsivness on CBF2-containing promoters, we
performed cotransfection experiments with AUF1 cDNA expression
plasmids. Cotransfection of EBNA2 with PKA or AUF1 alone did not result
in any activation of the 16xCBF2LUC reporter (Fig.
11). However, cotransfection of all
three plasmids resulted in a 10-fold activation of 16xCBF2LUC that
was further increased by cotransfection with increasing amounts of AUF1 expression plasmid (Fig. 11). Since AUF1 exists as four different isoforms (p37, p40, p42, and p45), we used the p40 isoform first, since this isoform was identical in size to the purified protein
identified previously (Fig. 1) and also identified in immunoblot
analysis (Fig. 5C). However, subsequent experiments using the other
AUF1 isoforms also have shown identical results (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 11.
Overexpression of an AUF1 cDNA results in stimulation
of a minimal promoter containing CBF2 binding sites in a dose-dependent
manner. Target plasmids were cotransfected with plasmids expressing
EBNA2, PKA, or AUF1 or not transfected. The amounts of effector
plasmids are indicated below the bar graph, and fold activation is
indicated to the left. The 16xCBF2LUC reporter plasmid was used as the
target reporter plasmid. Results are averages from three independent
experiments ± standard errors of the mean.
|
|
 |
DISCUSSION |
In this study, we demonstrated that AUF1/hnRNP D binds the CBF2
binding site from the EBV latency Cp. AUF1/hnRNP D binds to both
single- and double-stranded DNA containing the CBF2 element in a
sequence-specific manner. Stimulation of the cAMP/PKA signaling pathway
results in an increase in detectable AUF1/hnRNP D binding to the CBF2
element from Cp. We also found that Cp CBF2 binding sites alone were
able to confer EBNA2 responsiveness to a heterologous promoter in the
presence of stimulatory signals from the cAMP/PKA pathway. Finally, the
ability of EBNA2 to stimulate Cp is enhanced by cAMP/PKA signaling, and
this regulation requires functional CBF2 and CBF1 binding elements.
Although AUF1/hnRNP D was initially characterized as a factor that
regulated mRNA stability, recent studies have also shown that it
functions as a transcription factor. The LR1 factor, which is composed
of AUF1 complexed with nucleolin, regulates the c-myc and
EBV Fp promoters (3, 4, 15, 27). The CD21 promoter is also
regulated by AUF1 (59). Like CBF2, both of these activities appear to be B-cell specific, and the binding sites have some similarity to the CBF2 element (Fig.
12) (3, 59, 60). None of the
DNA response elements for these factors appears to resemble the
previously reported RNA binding sites (14, 23, 30, 31, 35, 36,
48). It is worth noting that both c-Myc and CD21 are direct
targets for EBNA2 activation and that AUF1/hnRNP D might be a general
cellular cofactor required for EBNA2-mediated activation of some viral
and cellular promoters (11, 34).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 12.
Comparison of the CBF2 binding sequence to AUF1 binding
sequences from cellular promoters. Nucleotides shown in bold represent
shared sequences from c-myc and CD21 promoters with the core
CBF2 binding site. Underlined bases indicate nucleotide positions that,
when mutated, affected AUF1 binding to the sequence shown.
|
|
The AUF1/hnRNP D activity that binds Cp may also comprise additional
cellular proteins. Two observations support this possibility. First,
binding of AUF1/hnRNP D to Cp sequences is partially inhibited by
oligonucleotides containing the hnRNP A and CarG binding sites. Second,
anti-hnRNP A antibody partially depletes the AUF1/hnRNP D binding
activity in gel shifts, although a supershifted complex was not
observed. Further characterization of the activity binding the Cp
AUF1/hnRNP D site is required in order to conclude if AUF1/hnRNP D is
working alone or associated with other proteins. Supershift analysis
using an antinucleolin antibody (Santa Cruz Biotechnology) was
negative, suggesting that this protein does not participate in this
activity as it does in LR1 (data not shown). Additionally, we also
found that antibodies to CREB and ATF proteins failed to react with
CBF2/AUF1 in gel mobility shift assays.
HnRNP proteins are also regulated by phosphorylation (8, 21,
29). Phosphorylation of LR1 is required for binding to DNA target
sequences, but the kinase that mediates LR1 phosphorylation is
currently unknown. AUF1/hnRNP D has been shown to be phosphorylated in
vivo, and such a modification could affect its RNA binding and
protein-protein interaction capacity (68). Although the specific signal(s) that results in AUF1/hnRNP D phosphorylation has not
been elucidated, there is some evidence that AUF1/hnRNP D expression
and/or function may be regulated by the G protein/adenylyl cyclase
signal transduction pathway (10, 39, 51, 64). Stimulation of
the
-adrenergic receptor with norepinephrine or the agonist
isoproterenol results in activation of adenylyl cyclase and an
increased abundance of AUF1/hnRNP D (10, 39). Furthermore, treatment of cells with analogs of cAMP results in increased binding of
AUF1/hnRNP D to the CD21 promoter that also correlates with its
induction (59).
The AUF1/hnRNP D activity that binds Cp is also increased in the
presence of inducers of the cAMP/PKA signaling pathway. This result
illustrates the possible targeting of cellular cAMP/PKA signaling
pathways for control of C promoter expression. Similarly, the LMP-1
promoter is also regulated by cAMP and PKA but, unlike Cp, is mediated
through a cAMP response element (CRE) (54). The LMP-1
promoter is also responsive to signaling through the cAMP/PKA pathway
and EBNA2, but analysis of whether both are needed for activation was
not done (54).
The mechanism by which PKA is conferring EBNA2 responsiveness to the Cp
AUF1/hnRNP D binding site is uncertain at this point, and there are
different possible explanations. First, PKA may directly modify EBNA2,
AUF1/hnRNP D, or CBF1 (e.g., by phosphorylation), and this modification
promotes interactions between these proteins. Phosphorylation of EBNA2
at this point seems unlikely, as the bulk of EBNA2 detected in cells
cotransfected with pPKA migrates with a mobility similar to that of
EBNA2 from untreated cells (Fig. 6C). Second, PKA could modify a
different protein, which then promotes or is part of the complex that
activates promoter expression. Finally, a more indirect effect would be
that PKA is upregulating cellular gene expression through CREB/ATF
sites and one of the products of this upregulation is stimulating
AUF1/hnRNP D activation effects.
A kinetic analysis of the induction after cAMP treatment shows no
detectable activity of the promoter at early times posttreatment. Induction is detected after 16 h of treatment (data not shown), and a four- to sixfold activation is reached after 24 h (Fig. 8).
Dibutyryl cAMP is a liposoluble analog of cAMP which is able to diffuse
through and penetrate the cellular membrane. It is known that the
levels of intracytoplasmic dibutyryl cAMP rise in the first 4 h
after cells are placed in the presence of this drug (1, 22, 25,
41). Once cAMP levels have risen, activation of PKA and
translocation to the nuclear compartment occur in about 30 min.
Therefore, gene expression of promoters with binding sites for
transcription factors that are directly modified by PKA have a peak of
expression 4 to 8 h after treatment with cAMP analogs (1, 22,
25, 41). Because Cp activation occurs between 16 and 24 h
post-cAMP induction, our results seem to be in agreement with a
secondary or indirect effect of PKA.
The role of signaling through the cAMP/PKA pathway in the establishment
and maintenance of latency in the EBV-infected B lymphocyte has not
been studied. However, it is known that activation of this pathway
blocks viral reactivation in the presence of stimuli that otherwise
would result in activation of the lytic cycle and expression of the EBV
immediate-early genes (12). A variety of treatments have
been reported to induce viral reactivation of EBV latent infection. The
most extensively studied and most consistently effective are treatment
with phorbol esters and immune cross-linking of IgG receptors (13,
42, 70). Activation of the EBV lytic cycle by either phorbol
esters or anti-IgG receptors is blocked in the presence of an active
cAMP/PKA pathway (12). These results suggest a positive role
for PKA in the maintenance of latency. Taken together, both positive
roles of signaling through the cAMP/PKA pathway in latency and B-cell
proliferation may explain the significance of the regulation of the
expression of Cp and LMP-1 promoters by this pathway.
Both phorbol esters and cross-linking of the B-cell receptor result in
activation of the PKC and downstream activation of mitogen-activated
protein kinase (MAPK). In several cell lines, activations of cAMP/PKA
and MAPK pathways have antagonistic functions (6, 16).
Therefore, the contribution of the cAMP/PKA pathway to EBV latency may
be given at different levels: (i) by counteracting PKC and MAPK
function; (ii) by stimulating latent gene expression; and (iii) by
providing the appropriate cellular milieu where latency is maintained.
It is interesting to note that upregulation of genes coding G
protein-coupled receptors by EBV infection has been reported, and
cAMP/PKA signaling through these receptors may be an important latency
function (2).
In summary, we have demonstrated that AUF1 is a component of CBF2. In
addition, stimulation of the cAMP/PKA signaling pathway, which is known
to regulate AUF1 activity, has positive effects on EBNA2-mediated
stimulation of Cp. Future studies can now be directed towards
identification of the mechanisms that mediate this phenomenon.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grants R29 CA69437 (P.D.L.) and
RO1 CA52443 (G.B.) and by an award from the William Stamps Farish
Foundation (P.D.L.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Virology, and Microbiology, Baylor College of Medicine, One Baylor Plaza, Mail Stop BCM-385, Houston, TX 77030. Phone: (713) 798-8474. Fax: (713) 798-3586. E-mail:
pling{at}bcm.tmc.edu.
 |
REFERENCES |
| 1.
|
Armstrong, R.,
W. Wen,
J. Meinkoth,
S. Taylor, and M. Montminy.
1995.
A refractory phase in cyclic AMP-responsive transcription requires downregulation of protein kinase A.
Mol. Cell. Biol.
15:1826-1832[Abstract].
|
| 2.
|
Birkenbach, M.,
K. Josefsen,
R. Yalamanchili,
G. Lenoir, and E. Kieff.
1993.
Epstein-Barr virus-induced genes: first lymphocyte-specific G protein-coupled peptide receptors.
J. Virol.
67:2209-2220[Abstract/Free Full Text].
|
| 3.
|
Brys, A., and N. Maizels.
1994.
LR1 regulates c-myc transcription in B-cell lymphomas.
Proc. Natl. Acad. Sci. USA
91:4915-4919[Abstract/Free Full Text].
|
| 4.
|
Bulfone-Paus, S.,
L. A. Dempsey, and N. Maizels.
1995.
Host factors LR1 and Sp1 regulate the Fp promoter of Epstein-Barr virus.
Proc. Natl. Acad. Sci. USA
92:8293-8297[Abstract/Free Full Text].
|
| 5.
|
Burd, C. G., and G. Dreyfuss.
1994.
RNA binding specificity of hnRNP A1: significance of hnRNP A1 high-affinity binding sites in pre-mRNA splicing.
EMBO J.
13:1197-1204[Medline].
|
| 6.
|
Chen, J., and R. Iyengar.
1995.
Interactions between the Gs/protein kinase A and the Ras/MAP-kinase signalling pathways.
Biochem. Soc. Trans.
23:129-133[Medline].
|
| 7.
|
Choi, Y. D., and G. Dreyfuss.
1984.
Isolation of the heterogeneous nuclear RNA-ribonucleoprotein complex (hnRNP): a unique supramolecular assembly.
Proc. Natl. Acad. Sci. USA
81:7471-7475[Abstract/Free Full Text].
|
| 8.
|
Cobianchi, F.,
C. Calvio,
M. Stoppini,
M. Buvoli, and S. Riva.
1993.
Phosphorylation of human hnRNP protein A1 abrogates in vitro strand annealing activity.
Nucleic Acids Res.
21:949-955[Abstract/Free Full Text].
|
| 9.
|
Cohen, J. I.,
F. Wang,
J. Mannick, and E. Kieff.
1989.
Epstein-Barr virus nuclear protein 2 is a key determinant of lymphocyte transformation.
Proc. Natl. Acad. Sci. USA
86:9558-9562[Abstract/Free Full Text].
|
| 10.
|
Cohn, J. N.,
T. B. Levine,
M. T. Olivari,
V. Garberg,
D. Lura,
G. S. Francis,
A. B. Simon, and T. Rector.
1984.
Plasma norepinephrine as a guide to prognosis in patients with chronic congestive heart failure.
N. Engl. J. Med.
311:819-823[Abstract].
|
| 11.
|
Cordier, M.,
A. Calender,
M. Billaud,
U. Zimber,
G. Rousselet,
O. Pavlish,
J. Banchereau,
T. Tursz,
G. Bornkamm, and G. M. Lenoir.
1990.
Stable transfection of Epstein-Barr virus (EBV) nuclear antigen 2 in lymphoma cells containing the EBV P3HR1 genome induces expression of B-cell activation molecules CD21 and CD23.
J. Virol.
64:1002-1013[Abstract/Free Full Text].
|
| 12.
|
Daibata, M.,
R. E. Humphreys,
K. Takada, and T. Sairenji.
1990.
Activation of latent EBV via anti-IgG-triggered, second messenger pathways in the Burkitt's lymphoma cell line Akata.
J. Immunol.
144:4788-4793[Abstract].
|
| 13.
|
Davies, A. H.,
R. J. Grand,
F. J. Evans, and A. B. Rickinson.
1991.
Induction of Epstein-Barr virus lytic cycle by tumor-promoting and non-tumor-promoting phorbol esters requires active protein kinase C.
J. Virol.
65:6838-6844[Abstract/Free Full Text].
|
| 14.
|
DeMaria, C. T., and G. Brewer.
1996.
AUF1 binding affinity to A+U-rich elements correlates with rapid mRNA degradation.
J. Biol. Chem.
271:12179-12184[Abstract/Free Full Text].
|
| 15.
|
Dempsey, L. A.,
L. A. Hanakahi, and N. Maizels.
1998.
A specific isoform of hnRNP D interacts with DNA in the LR1 heterodimer: canonical RNA binding motifs in a sequence-specific duplex DNA binding protein.
J. Biol. Chem.
273:29224-29229[Abstract/Free Full Text].
|
| 16.
|
Dumont, J. E.,
J. C. Jauniaux, and P. P. Roger.
1989.
The cyclic AMP-mediated stimulation of cell proliferation.
Trends Biochem. Sci.
14:67-71[CrossRef][Medline].
|
| 17.
|
Evans, T. J.,
P. J. Farrell, and S. Swaminathan.
1996.
Molecular genetic analysis of Epstein-Barr virus Cp promoter function.
J. Virol.
70:1695-1705[Abstract].
|
| 18.
|
Fahraeus, R.,
A. Jansson,
A. Ricksten,
A. Sjoblom, and L. Rymo.
1990.
Epstein-Barr virus-encoded nuclear antigen 2 activates the viral latent membrane protein promoter by modulating the activity of a negative regulatory element.
Proc. Natl. Acad. Sci. USA
87:7390-7394[Abstract/Free Full Text].
|
| 19.
|
Fuentes-Pananá, E. M., and P. D. Ling.
1998.
Characterization of the CBF2 binding site within the Epstein-Barr virus latency C promoter and its role in modulating EBNA2-mediated transactivation.
J. Virol.
72:693-700[Abstract/Free Full Text].
|
| 20.
|
Fuentes-Pananá, E. M.,
S. Swaminathan, and P. D. Ling.
1999.
Transcriptional activation signals found in the Epstein-Barr virus (EBV) latency C promoter are conserved in the latency C promoter sequences from baboon and rhesus monkey EBV-like lymphocryptoviruses (cercopithicine herpesviruses 12 and 15).
J. Virol.
73:826-833[Abstract/Free Full Text].
|
| 21.
|
Fung, P. A.,
R. Labrecque, and T. Pederson.
1997.
RNA-dependent phosphorylation of a nuclear RNA binding protein.
Proc. Natl. Acad. Sci. USA
94:1064-1068[Abstract/Free Full Text].
|
| 22.
|
Gonzalez, G. A., and M. R. Montminy.
1989.
Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133.
Cell
59:675-680[CrossRef][Medline].
|
| 23.
|
Gorlach, M.,
C. G. Burd, and G. Dreyfuss.
1994.
The determinants of RNA-binding specificity of the heterogeneous nuclear ribonucleoprotein C proteins.
J. Biol. Chem.
269:23074-23078[Abstract/Free Full Text].
|
| 24.
|
Grossman, S. R.,
E. Johannsen,
X. Tong,
R. Yalamanchili, and E. Kieff.
1994.
The Epstein-Barr virus nuclear antigen 2 transactivator is directed to response elements by the J kappa recombination signal binding protein.
Proc. Natl. Acad. Sci. USA
91:7568-7572[Abstract/Free Full Text].
|
| 25.
|
Hagiwara, M.,
A. Alberts,
P. Brindle,
J. Meinkoth,
J. Feramisco,
T. Deng,
M. Karin,
S. Shenolikar, and M. Montminy.
1992.
Transcriptional attenuation following cAMP induction requires PP-1-mediated dephosphorylation of CREB.
Cell
70:105-113[CrossRef][Medline].
|
| 26.
|
Hammerschmidt, W., and B. Sugden.
1989.
Genetic analysis of immortalizing functions of Epstein-Barr virus in human B lymphocytes.
Nature
340:393-397[CrossRef][Medline].
|
| 27.
|
Hanakahi, L. A.,
L. A. Dempsey,
M. J. Li, and N. Maizels.
1997.
Nucleolin is one component of the B cell-specific transcription factor and switch region binding protein, LR1.
Proc. Natl. Acad. Sci. USA
94:3605-3610[Abstract/Free Full Text].
|
| 28.
|
Henkel, T.,
P. D. Ling,
S. D. Hayward, and M. G. Peterson.
1994.
Mediation of Epstein-Barr virus EBNA2 transactivation by recombination signal-binding protein J kappa.
Science
265:92-95[Abstract/Free Full Text].
|
| 29.
|
Idriss, H.,
A. Kumar,
J. R. Casas-Finet,
H. Guo,
Z. Damuni, and S. H. Wilson.
1994.
Regulation of in vitro nucleic acid strand annealing activity of heterogeneous nuclear ribonucleoprotein protein A1 by reversible phosphorylation.
Biochemistry
33:11382-11390[CrossRef][Medline].
|
| 30.
|
Ishikawa, F.,
M. J. Matunis,
G. Dreyfuss, and T. R. Cech.
1993.
Nuclear proteins that bind the pre-mRNA 3' splice site sequence r(UUAG/G) and the human telomeric DNA sequence d(TTAGGG)n.
Mol. Cell. Biol.
13:4301-4310[Abstract/Free Full Text].
|
| 31.
|
Jarzembowski, J. A., and J. S. Malter.
1997.
Cytoplasmic fate of eukaryotic mRNA: identification and characterization of AU-binding proteins.
Prog. Mol. Subcell. Biol.
18:141-172[Medline].
|
| 32.
|
Jayachandra, S.,
K. G. Low,
A. E. Thlick,
J. Yu,
P. D. Ling,
Y. Chang, and P. S. Moore.
1999.
Three unrelated viral transforming proteins (vIRF, EBNA2, and E1A) induce the MYC oncogene through the interferon-responsive PRF element by using different transcription coadaptors.
Proc. Natl. Acad. Sci. USA
96:11566-11571[Abstract/Free Full Text].
|
| 33.
|
Jin, X. W., and S. H. Speck.
1992.
Identification of critical cis elements involved in mediating Epstein-Barr virus nuclear antigen 2-dependent activity of an enhancer located upstream of the viral BamHI C promoter.
J. Virol.
66:2846-2852[Abstract/Free Full Text].
|
| 34.
|
Kaiser, C.,
G. Laux,
D. Eick,
N. Jochner,
G. W. Bornkamm, and B. Kempkes.
1999.
The proto-oncogene c-myc is a direct target gene of Epstein-Barr virus nuclear antigen 2.
J. Virol.
73:4481-4484[Abstract/Free Full Text].
|
| 35.
|
Kajita, Y.,
J. Nakayama,
M. Aizawa, and F. Ishikawa.
1995.
The UUAG-specific RNA binding protein, heterogeneous nuclear ribonucleoprotein D0: common modular structure and binding properties of the 2xRBD-Gly family.
J. Biol. Chem.
270:22167-22175[Abstract/Free Full Text].
|
| 36.
|
Kamada, S., and T. Miwa.
1992.
A protein binding to CArG box motifs and to single-stranded DNA functions as a transcriptional repressor.
Gene
119:229-236[CrossRef][Medline].
|
| 37.
|
Kieff, E.
1996.
Epstein-Barr virus and its replication, p. 107-172.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippencott-Raven Publishers, Philadelphia, Pa.
|
| 38.
|
Kieser, A.,
E. Kilger,
O. Gires,
M. Ueffing,
W. Kolch, and W. Hammerschmidt.
1997.
Epstein-Barr virus latent membrane protein-1 triggers AP-1 activity via the c-Jun N-terminal kinase cascade.
EMBO J.
16:6478-6485[CrossRef][Medline].
|
| 39.
|
Kiledjian, M.,
X. Wang, and S. A. Liebhaber.
1995.
Identification of two KH domain proteins in the alpha-globin mRNP stability complex.
EMBO J.
14:4357-4364[Medline].
|
| 40.
|
Knutson, J. C.
1990.
The level of c-fgr RNA is increased by EBNA-2, an Epstein-Barr virus gene required for B-cell immortalization.
J. Virol.
64:2530-2536[Abstract/Free Full Text].
|
| 41.
|
Koh, W. S.,
Y. J. Jeon,
A. C. Herring, and N. E. Kaminski.
1997.
Transient CRE- and kappa B site-binding is cross-regulated by cAMP-dependent protein kinase and a protein phosphatase in mouse splenocytes.
Life Sci.
60:425-432[CrossRef][Medline].
|
| 42.
|
Lazdins, J.,
C. Zompetta,
S. Grimaldi,
G. Barile,
M. Venanzoni,
L. Frati, and A. Faggioni.
1987.
TPA induction of Epstein-Barr virus early antigens in Raji cells is blocked by selective protein kinase-C inhibitors.
Int. J. Cancer
40:846-849[Medline].
|
| 43.
|
Levitskaya, J.,
M. Coram,
V. Levitsky,
S. Imreh,
P. M. Steigerwald-Mullen,
G. Klein,
M. G. Kurilla, and M. G. Masucci.
1995.
Inhibition of antigen processing by the internal repeat region of the Epstein-Barr virus nuclear antigen-1.
Nature
375:685-658[CrossRef][Medline].
|
| 44.
|
Ling, P. D.,
D. R. Rawlins, and S. D. Hayward.
1993.
The Epstein-Barr virus immortalizing protein EBNA-2 is targeted to DNA by a cellular enhancer-binding protein.
Proc. Natl. Acad. Sci. USA
90:9237-9241[Abstract/Free Full Text].
|
| 45.
|
Ling, P. D.,
J. J. Ryon, and S. D. Hayward.
1993.
EBNA-2 of herpesvirus papio diverges significantly from the type A and type B EBNA-2 proteins of Epstein-Barr virus but retains an efficient transactivation domain with a conserved hydrophobic motif.
J. Virol.
67:2990-3003[Abstract/Free Full Text].
|
| 46.
|
Maurer, R. A.
1989.
Both isoforms of the cAMP-dependent protein kinase catalytic subunit can activate transcription of the prolactin gene.
J. Biol. Chem.
264:6870-6873[Abstract/Free Full Text].
|
| 47.
|
Meitinger, C.,
L. J. Strobl,
G. Marschall,
G. W. Bornkamm, and S. U. Zimber.
1994.
Crucial sequences within the Epstein-Barr virus TP1 promoter for EBNA2-mediated transactivation and interaction of EBNA2 with its responsive element.
J. Virol.
68:7497-7506[Abstract/Free Full Text].
|
| 48.
|
Miwa, T., and L. Kedes.
1987.
Duplicated CArG box domains have positive and mutually dependent regulatory roles in expression of the human alpha-cardiac actin gene.
Mol. Cell. Biol.
7:2803-2813[Abstract/Free Full Text].
|
| 49.
|
Miyashita, E. M.,
B. Yang,
G. J. Babcock, and D. A. Thorley-Lawson.
1997.
Identification of the site of Epstein-Barr virus persistence in vivo as a resting B cell.
J. Virol.
71:4882-4891[Abstract]. (Erratum, 72:9419, 1998.)
|
| 50.
|
Miyashita, E. M.,
B. Yang,
K. M. Lam,
D. H. Crawford, and D. A. Thorley-Lawson.
1995.
A novel form of Epstein-Barr virus latency in normal B cells in vivo.
Cell
80:593-601[CrossRef][Medline].
|
| 51.
|
Pende, A.,
K. D. Tremmel,
C. T. DeMaria,
B. C. Blaxall,
W. A. Minobe,
J. A. Sherman,
J. D. Bisognano,
M. R. Bristow,
G. Brewer, and J. Port.
1996.
Regulation of the mRNA-binding protein AUF1 by activation of the beta-adrenergic receptor signal transduction pathway.
J. Biol. Chem.
271:8493-8501[Abstract/Free Full Text].
|
| 52.
|
Pinol-Roma, S.,
Y. D. Choi,
M. J. Matunis, and G. Dreyfuss.
1988.
Immunopurification of heterogeneous nuclear ribonucleoprotein particles reveals an assortment of RNA-binding proteins.
Genes Dev.
2:215-227[Abstract/Free Full Text]. (Erratum, 2:490.)
|
| 53.
|
Rickinson, A. B., and E. Kieff.
1996.
Epstein-Barr virus, p. 2397-2446.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 54.
|
Sjoblom, A.,
W. Yang,
L. Palmqvist,
A. Jansson, and L. Rymo.
1998.
An ATF/CRE element mediates both EBNA2-dependent and EBNA2-independent activation of the Epstein-Barr virus LMP1 gene promoter.
J. Virol.
72:1365-1376[Abstract/Free Full Text].
|
| 55.
|
Smidt, M. P.,
B. Russchen,
L. Snippe,
J. Wijnholds, and G. Ab.
1995.
Cloning and characterisation of a nuclear, site specific ssDNA binding protein.
Nucleic Acids Res.
23:2389-2395[Abstract/Free Full Text].
|
| 56.
|
Sung, N. S.,
S. Kenney,
D. Gutsch, and J. S. Pagano.
1991.
EBNA-2 transactivates a lymphoid-specific enhancer in the BamHI C promoter of Epstein-Barr virus.
J. Virol.
65:2164-2169[Abstract/Free Full Text].
|
| 57.
|
Tay, N.,
S. H. Chan, and E. C. Ren.
1992.
Identification and cloning of a novel heterogeneous nuclear ribonucleoprotein C-like protein that functions as a transcriptional activator of the hepatitis B virus enhancer II.
J. Virol.
66:6841-6848[Abstract/Free Full Text].
|
| 58.
|
Thorley-Lawson, D. A.,
E. M. Miyashita, and G. Khan.
1996.
Epstein-Barr virus and the B cell: that's all it takes.
Trends Microbiol.
4:204-208[CrossRef][Medline].
|
| 59.
|
Tolnay, M.,
J. D. Lambris, and G. C. Tsokos.
1997.
Transcriptional regulation of the complement receptor 2 gene: role of a heterogeneous nuclear ribonucleoprotein.
J. Immunol.
159:5492-5501[Abstract].
|
| 60.
|
Tolnay, M.,
L. A. Vereschagina, and G. C. Tsokos.
1999.
Heterogeneous nuclear ribonucleoprotein D0B is a sequence-specific DNA-binding protein.
Biochem. J.
338:417-425.
|
| 61.
|
Wang, F.,
C. Gregory,
C. Sample,
M. Rowe,
D. Liebowitz,
R. Murray,
A. Rickinson, and E. Kieff.
1990.
Epstein-Barr virus latent membrane protein (LMP1) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP1 cooperatively induce CD23.
J. Virol.
64:2309-2318[Abstract/Free Full Text].
|
| 62.
|
Wang, F.,
C. D. Gregory,
M. Rowe,
A. B. Rickinson,
D. Wang,
M. Birkenbach,
H. Kikutani,
T. Kishimoto, and E. Kieff.
1987.
Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23.
Proc. Natl. Acad. Sci. USA
84:3452-3456[Abstract/Free Full Text].
|
| 63.
|
Wang, F.,
S. F. Tsang,
M. G. Kurilla,
J. I. Cohen, and E. Kieff.
1990.
Epstein-Barr virus nuclear antigen 2 transactivates latent membrane protein LMP1.
J. Virol.
64:3407-3416[Abstract/Free Full Text].
|
| 64.
|
Wilson, G. M., and G. Brewer.
1999.
The search for trans-acting factors controlling messenger RNA decay.
Prog. Nucleic Acids Res. Mol. Biol.
62:257-291[Medline].
|
| 65.
|
Woisetschlaeger, M.,
X. W. Jin,
C. N. Yandava,
L. A. Furmanski,
J. L. Strominger, and S. H. Speck.
1991.
Role for the Epstein-Barr virus nuclear antigen 2 in viral promoter switching during initial stages of infection.
Proc. Natl. Acad. Sci. USA
88:3942-3946[Abstract/Free Full Text].
|
| 66.
|
Yalamanchili, R.,
X. Tong,
S. Grossman,
E. Johannsen,
G. Mosialos, and E. Kieff.
1994.
Genetic and biochemical evidence that EBNA 2 interaction with a 63-kDa cellular GTG-binding protein is essential for B lymphocyte growth transformation by EBV.
Virology
204:634-641[CrossRef][Medline].
|
| 67.
|
Yoo, L. I.,
M. Mooney,
M. T. Puglielli, and S. H. Speck.
1997.
B-cell lines immortalized with an Epstein-Barr virus mutant lacking the Cp EBNA2 enhancer are biased toward utilization of the oriP-proximal EBNA gene promoter Wp1.
J. Virol.
71:9134-9142[Abstract].
|
| 68.
|
Zhang, W.,
B. J. Wagner,
K. Ehrenman,
A. W. Schaefer,
C. T. DeMaria,
D. Crater,
K. DeHaven,
L. Long, and G. Brewer.
1993.
Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1.
Mol. Cell. Biol.
13:7652-7665[Abstract/Free Full Text].
|
| 69.
|
Zimber-Strobl, U.,
E. Kremmer,
F. Grasser,
G. Marschall,
G. Laux, and G. W. Bornkamm.
1993.
The Epstein-Barr virus nuclear antigen 2 interacts with an EBNA2 responsive cis-element of the terminal protein 1 gene promoter.
EMBO J.
12:167-175[Medline].
|
| 70.
|
zur Hausen, H.,
F. J. O'Neill,
U. K. Freese, and E. Hecker.
1978.
Persisting oncogenic herpesvirus induced by the tumour promoter TPA.
Nature
272:373-375[CrossRef][Medline].
|
Journal of Virology, September 2000, p. 8166-8175, Vol. 74, No. 17
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pautz, A., Linker, K., Altenhofer, S., Heil, S., Schmidt, N., Art, J., Knauer, S., Stauber, R., Sadri, N., Pont, A., Schneider, R. J., Kleinert, H.
(2009). Similar Regulation of Human Inducible Nitric-oxide Synthase Expression by Different Isoforms of the RNA-binding Protein AUF1. J. Biol. Chem.
284: 2755-2766
[Abstract]
[Full Text]
-
Chau, C. M., Deng, Z., Kang, H., Lieberman, P. M.
(2008). Cell Cycle Association of the Retinoblastoma Protein Rb and the Histone Demethylase LSD1 with the Epstein-Barr Virus Latency Promoter Cp. J. Virol.
82: 3428-3437
[Abstract]
[Full Text]
-
Peng, C.-W., Zhao, B., Chen, H.-C., Chou, M.-L., Lai, C.-Y., Lin, S.-Z., Hsu, H.-Y., Kieff, E.
(2007). Hsp72 up-regulates Epstein-Barr virus EBNALP coactivation with EBNA2. Blood
109: 5447-5454
[Abstract]
[Full Text]
-
Portal, D., Rosendorff, A., Kieff, E.
(2006). Epstein-Barr nuclear antigen leader protein coactivates transcription through interaction with histone deacetylase 4. Proc. Natl. Acad. Sci. USA
103: 19278-19283
[Abstract]
[Full Text]
-
Banihashemi, L., Wilson, G. M., Das, N., Brewer, G.
(2006). Upf1/Upf2 Regulation of 3' Untranslated Region Splice Variants of AUF1 Links Nonsense-Mediated and A+U-Rich Element-Mediated mRNA Decay. Mol. Cell. Biol.
26: 8743-8754
[Abstract]
[Full Text]
-
Chau, C. M., Zhang, X.-Y., McMahon, S. B., Lieberman, P. M.
(2006). Regulation of Epstein-Barr Virus Latency Type by the Chromatin Boundary Factor CTCF.. J. Virol.
80: 5723-5732
[Abstract]
[Full Text]
-
Mohan, J., Dement-Brown, J., Maier, S., Ise, T., Kempkes, B., Tolnay, M.
(2006). Epstein-Barr virus nuclear antigen 2 induces FcRH5 expression through CBF1. Blood
107: 4433-4439
[Abstract]
[Full Text]
-
Lu, J.-Y., Bergman, N., Sadri, N., Schneider, R. J.
(2006). Assembly of AUF1 with eIF4G-poly(A) binding protein complex suggests a translation function in AU-rich mRNA decay. RNA
12: 883-893
[Abstract]
[Full Text]
-
Fechir, M., Linker, K., Pautz, A., Hubrich, T., Forstermann, U., Rodriguez-Pascual, F., Kleinert, H.
(2005). Tristetraprolin Regulates the Expression of the Human Inducible Nitric-Oxide Synthase Gene. Mol. Pharmacol.
67: 2148-2161
[Abstract]
[Full Text]
-
Farrell, C. J., Lee, J. M., Shin, E.-C., Cebrat, M., Cole, P. A., Hayward, S. D.
(2004). Inhibition of Epstein-Barr virus-induced growth proliferation by a nuclear antigen EBNA2-TAT peptide. Proc. Natl. Acad. Sci. USA
101: 4625-4630
[Abstract]
[Full Text]
-
Raineri, I., Wegmueller, D., Gross, B., Certa, U., Moroni, C.
(2004). Roles of AUF1 isoforms, HuR and BRF1 in ARE-dependent mRNA turnover studied by RNA interference. Nucleic Acids Res
32: 1279-1288
[Abstract]
[Full Text]
-
Peng, C.-W., Xue, Y., Zhao, B., Johannsen, E., Kieff, E., Harada, S.
(2004). Direct interactions between Epstein-Barr virus leader protein LP and the EBNA2 acidic domain underlie coordinate transcriptional regulation. Proc. Natl. Acad. Sci. USA
101: 1033-1038
[Abstract]
[Full Text]
-
Maruo, S., Johannsen, E., Illanes, D., Cooper, A., Kieff, E.
(2003). Epstein-Barr Virus Nuclear Protein EBNA3A Is Critical for Maintaining Lymphoblastoid Cell Line Growth. J. Virol.
77: 10437-10447
[Abstract]
[Full Text]
-
Sarkar, B., Xi, Q., He, C., Schneider, R. J.
(2003). Selective Degradation of AU-Rich mRNAs Promoted by the p37 AUF1 Protein Isoform. Mol. Cell. Biol.
23: 6685-6693
[Abstract]
[Full Text]
-
Wilson, G. M., Lu, J., Sutphen, K., Sun, Y., Huynh, Y., Brewer, G.
(2003). Regulation of A + U-rich Element-directed mRNA Turnover Involving Reversible Phosphorylation of AUF1. J. Biol. Chem.
278: 33029-33038
[Abstract]
[Full Text]
-
Dudziak, D., Kieser, A., Dirmeier, U., Nimmerjahn, F., Berchtold, S., Steinkasserer, A., Marschall, G., Hammerschmidt, W., Laux, G., Bornkamm, G. W.
(2003). Latent Membrane Protein 1 of Epstein-Barr Virus Induces CD83 by the NF-{kappa}B Signaling Pathway. J. Virol.
77: 8290-8298
[Abstract]
[Full Text]
-
Alazard, N., Gruffat, H., Hiriart, E., Sergeant, A., Manet, E.
(2003). Differential Hyperacetylation of Histones H3 and H4 upon Promoter-Specific Recruitment of EBNA2 in Epstein-Barr Virus Chromatin. J. Virol.
77: 8166-8172
[Abstract]
[Full Text]
-
Sarkar, B., Lu, J.-Y., Schneider, R. J.
(2003). Nuclear Import and Export Functions in the Different Isoforms of the AUF1/Heterogeneous Nuclear Ribonucleoprotein Protein Family. J. Biol. Chem.
278: 20700-20707
[Abstract]
[Full Text]
-
Johansen, L. M., Deppmann, C. D., Erickson, K. D., Coffin, W. F. III, Thornton, T. M., Humphrey, S. E., Martin, J. M., Taparowsky, E. J.
(2003). EBNA2 and Activated Notch Induce Expression of BATF. J. Virol.
77: 6029-6040
[Abstract]
[Full Text]
-
Cooper, A., Johannsen, E., Maruo, S., Cahir-McFarland, E., Illanes, D., Davidson, D., Kieff, E.
(2002). EBNA3A Association with RBP-J{kappa} Down-Regulates c-myc and Epstein-Barr Virus-Transformed Lymphoblast Growth. J. Virol.
77: 999-1010
[Abstract]
[Full Text]
-
Saitoh, Y., Miyagi, S., Ariga, H., Tsutsumi, K.-i.
(2002). Functional domains involved in the interaction between Orc1 and transcriptional repressor AlF-C that bind to an origin/promoter of the rat aldolase B gene. Nucleic Acids Res
30: 5205-5212
[Abstract]
[Full Text]
-
Laroia, G., Schneider, R. J.
(2002). Alternate exon insertion controls selective ubiquitination and degradation of different AUF1 protein isoforms. Nucleic Acids Res
30: 3052-3058
[Abstract]
[Full Text]
-
Gordadze, A. V., Poston, D., Ling, P. D.
(2002). The EBNA2 Polyproline Region Is Dispensable for Epstein-Barr Virus-Mediated Immortalization Maintenance. J. Virol.
76: 7349-7355
[Abstract]
[Full Text]
-
Hille, A., Badu-Antwi, A., Holzer, D., Grasser, F. A.
(2002). Lysine residues of Epstein-Barr virus-encoded nuclear antigen 2 do not confer secondary modifications via ubiquitin or SUMO-like proteins but modulate transcriptional activation. J. Gen. Virol.
83: 1037-1042
[Abstract]
[Full Text]
-
Lin, J., Johannsen, E., Robertson, E., Kieff, E.
(2002). Epstein-Barr Virus Nuclear Antigen 3C Putative Repression Domain Mediates Coactivation of the LMP1 Promoter with EBNA-2. J. Virol.
76: 232-242
[Abstract]
[Full Text]
-
Gordadze, A. V., Peng, R., Tan, J., Liu, G., Sutton, R., Kempkes, B., Bornkamm, G. W., Ling, P. D.
(2001). Notch1IC Partially Replaces EBNA2 Function in B Cells Immortalized by Epstein-Barr Virus. J. Virol.
75: 5899-5912
[Abstract]
[Full Text]
-
Salamon, D., Takacs, M., Ujvari, D., Uhlig, J., Wolf, H., Minarovits, J., Niller, H. H.
(2001). Protein-DNA Binding and CpG Methylation at Nucleotide Resolution of Latency-Associated Promoters Qp, Cp, and LMP1p of Epstein-Barr Virus. J. Virol.
75: 2584-2596
[Abstract]
[Full Text]