Previous Article | Next Article 
Journal of Virology, September 2000, p. 8018-8027, Vol. 74, No. 17
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Targeted Infection of Endothelial Cells by Avian
Influenza Virus A/FPV/Rostock/34 (H7N1) in Chicken Embryos
Anke
Feldmann,1
Martin K.-H.
Schäfer,2
Wolfgang
Garten,1 and
Hans-Dieter
Klenk1,*
Institut für
Virologie1 and Institut für
Anatomie und Zellbiologie,2
Philipps-Universität, Marburg, Germany
Received 15 February 2000/Accepted 26 May 2000
 |
ABSTRACT |
The tissue tropism and spread of infection of the highly pathogenic
avian influenza virus A/FPV/Rostock/34 (H7N1) (FPV) were analyzed in
11-day-old chicken embryos. As shown by in situ hybridization, the
virus caused generalized infection that was strictly confined to
endothelial cells in all organs. Studies with reassortants of FPV and
the apathogenic avian strain A/chick/Germany/N/49 (H10N7) revealed that
endotheliotropism was linked to FPV hemagglutinin (HA). To further
analyze the factors determining endotheliotropism, the
HA-activating protease furin was cloned from chicken tissue. Ubiquitous expression of furin and other proprotein convertases in the chick embryo indicated that proteolytic activation of HA was not
responsible for restriction of infection to the endothelium. To
determine the expression of virus receptors in embryonic tissues, histochemical analysis of
2,3- and
2,6-linked neuraminic acid was carried out by lectin-binding assays. These receptors were found on
endothelial cells and on several epithelial cells, but not on tissues
surrounding endothelia. Finally, we analyzed the polarity of
virus maturation in endothelial cells. Studies on cultured human
endothelial cells employing confocal laser scanning microscopy revealed
that HA is specifically targeted to the apical surface of
these cells, and electron microscopy of embryonic tissues showed that
virus maturation occurs also at the luminar side. Taken together, these
observations indicate that endotheliotropism of FPV in the chicken
embryo is determined, on one hand, by the high cleavability of HA,
which mediates virus entry into the vascular system, and, on the other
hand, by restricted receptor expression and polar budding, which
prevent spread of infection into tissues surrounding endothelia.
 |
INTRODUCTION |
Influenza A viruses are found in
humans, pigs, and several other mammals as well as in many birds. It is
generally believed that the mammalian viruses emerge from the large
reservoir of avian strains comprising 15 hemagglutinin (HA) and 9 neuraminadase (NA) subtypes (42). Most influenza A
viruses cause local infection that is confined to the respiratory tract
or, in the case of some avian strains, to the gut. The avian viruses
showing this type of infection usually have low pathogenicity or are
completely apathogenic. In contrast, some avian strains belonging to
subtypes H5 and H7 cause generalized infection. These viruses are
highly pathogenic, killing the birds within a few days. An important determinant for these differences in spread of infection is cleavage activation of HA, which, in the case of the pathogenic strains, is
exerted by ubiquitous proteases, such as the proprotein
convertase furin, whereas strains causing localized infection are
activated by proteases expressed specifically in the respective tissues (for review, see reference 16).
Until recently, it was believed that the highly pathogenic avian
strains are not transmitted to humans. However, in the course of an
H5N1 outbreak among chickens, several human infections with a high case
fatality rate were observed in 1997 in Hong Kong (6, 35).
Furthermore, an H7N7 virus was isolated in 1996 from a human with
milder disease symptoms that proved to be closely related to the avian
isolate A/turkey/Ireland/PV74/95 (1, 18). These observations
demonstrate that H5 and H7 strains can be transmitted from birds to
humans without an intermediate host and without reassortment and, even
more importantly, that the pathogenetic potential of these viruses as
determined by HA is preserved to some extent in the new host.
As a result of the systemic infection caused by the pathogenic H5 and
H7 strains in birds, virus can be recovered from many organs. Large
hemorrhages distributed all over the body, edema, and cutaneous
ischemia are major symptoms of the disease. The final stage of the
infection can be characterized by the emergence of neurological signs,
such as photophobia and dullness (13, 20). Although
hemorrhages and edema indicate an affliction of the vascular system,
only few data are available pertaining to cell tropism in the natural
host. The virulent influenza strain A/turkey/Ontario/7732/66 (H5N9),
for example, has a pronounced effect on lymphocytes and lymphoid tissue
of its avian host (39, 40). Another pathogenic strain,
A/turkey/England/50-92/91 (H5N1), strongly attacks the cardiovascular
system of the birds by predominantly infecting myocytes and endothelial
cells of the heart muscle (17). Similar results have been
obtained when chickens were experimentally infected with avian and
human isolates obtained during the H5N1 outbreak in 1997 in Hong Kong
(34). Conclusions on tissue and cell tropism drawn from
investigations using one strain are not necessarily applicable to others.
Although the importance of HA cleavability for spread of infection in
the organism is beyond doubt, cell tropism is likely to be controlled
by multiple virus and host factors. Polarity of virus budding may be
such a determinant, as indicated by studies on Sendai virus. Wild-type
Sendai virus, which is pneumotropic in mice, has been found to bud
strictly from the luminal side of polarized epithelial cells, whereas a
pantropic mutant showed bipolar budding, allowing virus spread into
adjacent tissues (37, 38). Influenza virus also buds
specifically from the apical side of polarized epithelial cells in
culture (23), but little is known about the biological
significance of the budding polarity of this virus in vivo. Binding of
HA to the receptor may be another determinant controlling spread of
infection in the organism. It is well known from the work of several
groups that influenza viruses differ in their receptor specificity. For
instance, it has been reported that most avian influenza viruses
recognize preferentially neuraminic acid bound by
2,3-linkage
to galactose (NeuAc-
2,3-Gal), whereas human influenza viruses
prefer NeuAc-
2,6-Gal (5, 10, 24, 25). This difference is
important for host tropism, but it is not known whether receptor
binding plays a role in cell tropism within a given organism.
In the present study, we have analyzed spread of infection by the fowl
plague virus (FPV) strain A/FPV/Rostock/34 (H7N1) in the chicken
embryo. We have found that the virus is strictly endotheliotropic in
this host. We have also investigated the viral and host factors underlying endotheliotropism.
 |
MATERIALS AND METHODS |
Viruses.
Influenza virus strains A/FPV/Rostock/34 (H7N1)
(FPV), A/chick/Germany/N/49 (H10N7) (virus N), reassortants of both
influenza virus strains, and strain Indiana of vesicular stomatitis
virus (VSV) were used. The generation of the influenza virus
reassortants as well as the identification of their genotypes have been
described before (26, 31, 32). Seed stocks of influenza
virus were grown in the allantoic cavity of 11-day-old embryonated
eggs. VSV seed stocks were grown in MDCK cells.
Cloning of chicken furin (gfur) and generation of cRNA probes for
PC6a, LPC/PC7, and PACE4 from chicken tissue.
The complete
gfur gene was cloned from a chicken liver cDNA gene bank
(Stratagene, La Jolla, Calif., catalog no. 965402) and sequenced
(GenBank Z68093). A 331-nucleotide (nt) fragment (nt 533 to 864) of
bovine furin (41) (GenBank X75956) labeled with
[32P]CTP served as a screening probe. Recombinant
vaccinia virus encoding gfur (VV:gfur) was generated using
the pSC11smaI vector (41). For the other chicken
proprotein convertases, riboprobes were generated by reverse
transcription (RT)-PCR from chicken liver RNA using oligonucleotide
primers derived from the corresponding human genes (hPC5/PC6, GenBank
U56387; hLPC/PC7, GenBank U40623; and hPACE4, GenBank M80482).
The following primers were used: PC6a,
5'GATGA(C/T)GG(C/A)T(C/T)GAGAGAACCCA(C/T)CCAGATC3' (529 to
559) and 5'CTCCG(C/A)CCCATTCT(C/A)AC(G/A)CC(G/A)TTCTCAAAG3' (920 to 890); LPC/PC7, 5'ACTATCAGATCAATGACATCTA3'
(851 to 873) and 5'GTCTCCGCGACGTC3' (1300 to 1281);
and PACE4, 5'CATAAAGTTAGCCATTTCTAT3' (1574 to 1597) and
5'TTCAGCCTTTTTCTCCCCAGCA3' (1966 to 1945). The gPC6a
fragment (391 nt) (GenBank AJ252169) showed 96% homology to nt 29 to
920 of hPC6a. The gLPC/PC7 fragment (449 nt) (GenBank AJ252170) showed
85% homology to nt 851 to 1300 of hLPC/PC7. The gPACE4 fragment (392 nt) (GenBank AJ25271) exhibited 70% homology to nt 1574 to 1966 of
hPACE4. The VEGF receptor 2 probe (Qflk-344-1/351 nt) cloned from quail
RNA was kindly provided by Ingo Flamme (Zentrum für Molekulare
Medizin, Cologne, Germany). A fragment of 46 nt corresponding to nt
1252 to 1713 of the HA cDNA of A/FPV/Rostock/34 (H7N1) (11)
(GenBank M24457) was subcloned into the transcription vector
pBluescript KS+. A fragment corresponding to nt 846 to 1300 of the HA
gene of A/chick/Germany/N/49 (H10N7) (8) (GenBank M21646)
was cloned by RT-PCR using viral RNA into the transcription vector
pBluescript KS+.
Tissue preparation.
Virus (200 µl, about 103
to 104 PFU) was injected directly into the allantoic cavity
of 11-day-old embryonated eggs. At 18 h after infection, the head,
legs, and wings were removed from the embryo and immediately frozen in
isopentane at
30 to
50°C on dry ice. Sections (20 µm) were
prepared on a cryostat (2800 Frigocut N; Leica, Bensheim, Germany) in
sagittal planes. Tissues were stored at
80°C.
In situ hybridization.
In situ hybridization was performed
according to a reported protocol (29). Briefly, frozen
sections were fixed in 4% phosphate-buffered paraformaldehyde solution
for 60 min at room temperature and then washed three times in 0.05 M
phosphate-buffered saline (PBS; pH 7.4) for 10 min each. Deproteination
was carried out with proteinase K (1 µg/ml) for 6 min at 37°C.
Slides were transferred to 0.1 M triethanolamine (pH 8.0) and incubated
in the same solution containing acetic anhydride (0.25%, vol/vol) for
10 min at room temperature. Sections were washed in PBS and dehydrated
in ethanol (50 and 70%). Radioactive cRNA probes were diluted in
hybridization buffer (50% formamide, 10% dextran solution, 1×
Denhardt's solution, 0.2% [wt/vol] bovine serum albumin, 0.02%
[wt/vol] Ficoll 400, 0.02% [wt/vol] polyvinylpyrrolidone, 0.1 mg
of yeast RNA per ml, and sheared salmon sperm DNA [0.1 mg/ml]) to a
final concentration of 5 × 104 cpm/µl.
Dithiothreitol was added to a final concentration of 10 mM.
Hybridization mix (30 to 50 µl per slide) was applied, and sections
were coverslipped and sealed with rubber cement. The tissue was
incubated at 58°C for 16 h in a humid chamber. The coverslips
were removed in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate). Sections were treated with RNase A (20 µg/ml) and RNase
T1 (1 U/ml) at 37°C for 60 min to remove single-stranded RNA molecules. Successive washes followed at room temperature in 2×,
1×, 0.5×, and 0.2× SSC for 10 min each and in 0.2× SSC at 60°C
for 60 min. The tissue was dehydrated and exposed to a Kodak Biomax
X-ray film for 1 to 4 days. For microscopic analysis, sections were
dipped in Kodak NTB2 nuclear emulsion and stored at 4°C. Following
exposure times of from 4 (H7 and H10) to 30 days (VEGF receptor 2 and
proteases), autoradiograms were developed in Kodak D19 for 5 min and
fixed in Rapid fix (Kodak, Rochester, N.Y.) for 10 min. Tissues were
counterstained by hematoxylin-eosin staining.
Lectin binding assays.
For detection of NeuAc-
2,3-Gal and
NeuAc-
2,6-Gal on the surface of the cells of chicken embryos, a
digoxigenin (DIG) glycan differentiation kit (Boehringer, Mannheim,
Germany) was used. Sections (200 µm) of uninfected chicken embryos
were fixed for 2 min in ice-cold methanol containing 1 mM levamisole
(Sigma, Deisenhofen, Germany), a specific inhibitor of endogenous
alkaline phosphatase. Sections were then incubated for 12 h with a
blocking solution supplied with the kit. The slides were washed twice
with TBS buffer (0.05 M Tris-HCl [pH 8.5], 0.15 M NaCl) for 10 min each and once with buffer 1 (TBS, 1 mM MgCl2, 1 mM
CaCl2, 1 mM MnCl2). DIG-labeled lectins
(Sambucus nigra agglutinin [SNA], specific for
NeuAc-
2,6-Gal, and Maackia amurensis agglutinin [MAA],
specific for NeuAc-
2,3-Gal) dissolved in buffer 1 were then
incubated with the slides for 2 h. After three washes with TBS,
the sections were incubated for 1 h with anti-DIG antibody conjugated to alkaline phosphatase (1:1,000 in TBS). After three washes
with TBS, the sections were incubated with buffer 2 (0.1 M Tris-HCl
[pH 9.5], 0.05 M MgCl2, 0.1 M NaCl), and the substrate solution NBT/X-phosphate (supplied with the kit) dissolved in buffer 2 containing 1 mM levamisole was applied to the sections. After 5 to 10 min, the reaction was stopped by washing the slides in H2O.
The sections were coverslipped without counterstaining.
Analysis of infected HUVECs on Transwell filters.
Polycarbonate filters (1-µm pore size, 2.5 cm in diameter) were
coated with 0.1% gelatin for 2 h. Subsequently, the gelatin was
cross-linked for 30 min with 2% glutaraldehyde (in PBS) and washed
with 70% ethanol. After excessive washing with PBS overnight, filters
were put into six-well plates. Primary cultures of endothelial cells
from human umbilical cord vein (HUVEC) were prepared by standard
methods (12) and seeded on the coated filter in 1.5 ml of
medium 199 with 10% fetal calf serum (FCS) (upper compartment) and
cultured until confluency (24 to 48 h). The lower compartment contained 2 ml of medium.
For infection, cells were washed with medium 199 with 10% FCS and
incubated apically for 1 h at 37°C with egg-grown FPV or MDCK
cell-grown VSV at a multiplicity of infection (MOI) of 0.5. After a
further washing step, viral inoculum was replaced by medium 199 with
10% FCS. At 4 h postinfection, cells were cooled on ice and
washed three times with PBS. Cells were then incubated for 20 min from
either the apical or the basolateral side with 1 ml of PBS containing
1.5 mg of Sulfo-NHS-Biotin (Pierce, Rockford, Ill.). At the nonlabeled
sides, the filters were always incubated with PBS-0.1 M glycine to
inactivate biotin penetrating the pores of the filter. After
biotinylation, one washing step with PBS-0.1 M glycine and three
additional washes with PBS were performed. The membranes were cut out
and incubated on ice for 1 h with radioimmunoprecipitation assay-lysation buffer. The supernatant was cleared by
ultracentrifugation (20 min, 40,000 rpm, 4°C, Beckman rotor
TLA100.3). Half of the supernatant was incubated with a monoclonal
antibody against FPV HA (HA1-2A11H7, generated in the institute) or a
polyclonal rabbit antiserum against VSV. Immunoprecipitation and sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under
nonreducing conditions followed. The viral proteins were transferred to
nitrocellulose (0.4 mA/cm2 for 1 h). After a blocking
step (5% nonfat drymilk in PBS) for 45 min at 4°C, the membrane was
washed three times with PBS-0.1% Tween. This was followed by
incubation for 45 min with streptavidin-peroxidase (1:2,000 in PBS) and
three additional washing steps. Labeled proteins were visualized with
the enhanced chemiluminescence detection system Super signal ultra (Pierce).
Immunofluorescence studies.
Confluent monolayers of HUVEC
grown on filters (see below) were infected with FPV or VSV at an MOI of
0.5. At 4 h postinfection (p.i.), cells were fixed with 2%
formaldehyde in PBS for 15 min, washed twice with PBS, and incubated
for 1 h with a monoclonal antibody directed against FPV HA
(HA1-2A11H7). Subsequently, cells were washed twice with PBS and
incubated with specific fluorescein isothiocyanate (FITC)-conjugated
antiserum against mouse or rabbit immunoglobulins (Dako, Glostrup, Denmark).
Electron microscopy.
The organs of infected chicken embryos
were prepared at 18 h p.i. and fixed immediately in ITO buffer
according to a reported protocol (15). Subsequently an
additional fixation step with OsO4 was carried out. The
tissue was embedded in Epon and ultrathin sections were prepared and
contrasted by uranyl acetate and lead citrate prior to microscopic
analysis using a Zeiss 109 electron microscope.
 |
RESULTS |
Endothelial cells, a target of FPV infection.
When 11-day-old
chicken embryos were infected via the allantoic route with
103 PFU of FPV, they died 18 h p.i. and displayed
ubiquitous and extensive subcutaneous hemorrhages. In contrast, embryos
infected with virus N, which was used as an "apathogenic" control
virus, usually died at 30 h p.i. without significant bleeding.
To determine spread of infection and organ tropism of these viruses,
20-µm sagittal sections of the embryos were subjected
to in situ
hybridization with specific radioactive riboprobes.
Figure
1 shows autoradiograms of hybridized
sections. All organs
of the chicken embryo infected with FPV (Fig.
1a)
were heavily
labeled with the riboprobe, indicating that the virus
caused systemic
infection. In contrast, virus N caused only local
infection of
the allantoic membrane and of the cloaca connected with
the allantoic
cavity (Fig.
1c). Sections of uninfected embryos
displayed only
background staining (Figs.
1b and d).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 1.
Spread of FPV and virus N in the chick embryo.
Embryonated eggs were infected with 103 PFU via the
allantoic route. At 17 h (FPV) or 40 h (N) p.i., cryosections
were prepared that were subjected to autoradiography after in situ
hybridization with [35S]UTP-labeled riboprobes directed
against mRNA of H7 HA (a) and H10 HA (c). Sections of uninfected chick
embryos were used as controls (b and d). Exposure time for
autoradiography was 8 h.
|
|
Our next aim was to determine individual cell types within organs in
which FPV replication takes place. To this end, sections
of chicken
embryos were analyzed at higher resolution. After in
situ
hybridization, slides were covered with photoemulsion, exposed
for 2 days, developed, and counterstained with hematoxylin-eosin.
The
presence of viral RNA in all organs examined confirmed the
pantropic
character of the infection. It was interesting to see,
however, that
infection was confined in the organs almost exclusively
to endothelial
cells (Fig.
2). This is clearly indicated
by the
results obtained from a large blood vessel. Besides a few
signals
in peripheral blood cells, there was extensive endothelial
labeling,
whereas viral RNA was virtually absent in all other cells of
the
wall of the vessel (Fig.
2a). Distinct endothelial labeling
patterns
were also observed in lung, stomach, heart, and liver (Fig.
2b,
c, d, and e). The hexagonal labeling pattern with the parabronchi
in the center that was observed in the lung reflects the typical
arrangement of developing blood vessels in this organ (Fig.
2b).
In the
stomach, HA-specific RNA was detected in endothelial cells
of the
vascularized submucosa as well as in endothelial cells
of vessels
within the stomach wall but not in epithelial cells
(Fig.
2c). In the
heart, the number of endothelial cells almost
equals that of myocytes.
Therefore, this organ was heavily infected
with FPV, but again, only
endothelial cells and not myocytes were
stained by the HA-specific
probe (Fig.
2d). In the liver, viral
RNA was detectable in endothelium,
whereas the columns of hepatocytes
were not infected (Fig.
2e). The
spleen, in contrast to other
organs, showed a diffuse labeling pattern
with the HA-specific
riboprobe (Fig.
2f). This can be explained by the
specific architecture
of this organ, which does not possess a closed
blood circulation,
since the splenal sinusoids are lined by a
discontinuous layer
of endothelial cells.

View larger version (116K):
[in this window]
[in a new window]
|
FIG. 2.
Localization of FPV-infected cells in embryonic tissues
by in situ hybridization. Bright-field photomicrographs showing
autoradiograms with black grains representing bound HA-specific
riboprobe in organs of the chick embryo. After in situ hybridization,
slides were covered by photoemulsion, exposed for 2 days, developed,
and counterstained by hematoxylin-eosin. (a) Blood vessel (arrowheads
indicate infected blood cells); (b) lung; (c) stomach; (d) heart; (e)
liver; (f) spleen. Magnification, ×57.
|
|
To further assess the identity of endothelial cells and to confirm the
concept that these cells are the specific target of
FPV, we compared
the labeling pattern of the HA-specific riboprobe
with that of a
riboprobe directed against the mRNA of vascular
endothelial growth
factor receptor 2 (VEGF receptor 2). VEGF receptor
2, which is
expressed in rather small amounts and could therefore
be visualized
only by dark-field microscopy, is a protein involved
in angiogenesis
and is exclusively expressed in endothelial cells
(
9). The
labeling patterns obtained by the VEGF receptor-specific
riboprobe were
essentially those obtained by the HA-specific probe.
Thus, VEGF
receptor 2 showed the typical hexagonal expression
pattern in the lung,
as did HA (cf. Fig.
3a and
2b), whereas,
again like HA, it was diffusely expressed in spleen (cf. Fig.
3b and
2f). The in situ hybridization experiments therefore demonstrate
clearly that endothelial cells are the main target of FPV in chicken
embryos.

View larger version (158K):
[in this window]
[in a new window]
|
FIG. 3.
Identification of endothelia by in situ hybridization
using VEGF receptor 2 as a marker. Dark-field microscopy showing
autoradiographic silver grains representing bound VEGF receptor
2-specific mRNA in lung and spleen of chick embryos. After in situ
hybridization with a radioactive probe directed against mRNA of VEGF
receptor 2, the slides were covered by photoemulsion, exposed for 30 days, and developed. Magnification, ×71.
|
|
Linkage of endotheliotropism to FPV HA.
To determine the genes
responsible for endotheliotropism, we analyzed a set of reassortants of
FPV and the apathogenic virus N (7) (Table
1). All reassortants except for 108 and
109 displayed the same endotheliotropism as wild-type FPV, although in
some cases more than half of the RNA segments were derived from virus N
(e.g., 118). In contrast to all other reassortants, reassortants 108 and 109 have the HA of virus N, which, unlike FPV HA, has restricted
cleavability. Viral RNA from the two reassortants could not be detected
in embryonic tissues, although they reached high HA titers
(
27) within the allantoic fluid. This result is in good
agreement with earlier studies showing a clear correlation between the
cleavability of HA and spread of infection from the allantoic cavity
into the embryo (27). In addition, it demonstrates that FPV
HA is both necessary and sufficient for infection of endothelia.
Identification and localization of proprotein convertases
activating FPV HA in the chicken embryo.
Proteolytic activation of
the hemagglutinin by cellular proteases is an important factor
determining spread of infection and organ tropism of influenza viruses.
Although FPV HA is generally believed to be activated in most cells, it
had to be excluded that confinement of FPV infection to endothelial
cells is due to the absence of an appropriate protease in these cells.
FPV HA is activated at its multibasic cleavage site by the
proprotein convertases furin (33) and PC5/PC6
(14), as has been established in expression experiments in
which cDNA clones of human or murine origin were used. To find out if
these enzymes were also involved in replication and spread of FPV in
its natural host, they first had to be identified in chicken tissue. By
cloning cDNA from chicken liver RNA, we could show that chicken furin
(gfur) displays all of the structural characteristics of human furin,
including the propeptide that is autocatalytically removed by cleavage,
the subtilisin-like domain with the active residues Asp, His, and Ser
of the catalytic triad, the cysteine-rich domain, the transmembrane domain, and the cytoplasmic tail. By cloning gene fragments of gPC5/PC6, gLPC/PC7, and gPACE4, the presence of these
proprotein convertases in chicken tissues has also been established.
To examine cleavage of HA by gfur, expression studies using recombinant
vaccinia virus as the vector were carried out in the
furin-deficient
LoVo cell line (
36). As shown in Fig.
4, gfur
is expressed in these cells and
able to cleave FPV HA.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 4.
Cleavage of HA by chicken furin. LoVo cells
(35) were infected with VV:gfur and VV:HAwt (22),
each at an MOI of 10. Virus inocula were replaced by DMEM without FCS
1 h after infection. At 4 h after infection, LoVo cells
(diameter of the culture dishes, 35 mm) were starved for methionine for
1 h and then labeled with 100 µCi of
[35S]methionine (1,000 Ci/mmol; Amersham, Braunschweig,
Germany) for 3 h in 0.5 ml of methionine-free MEM. The medium was
replaced by MEM containing nonradioactive methionine, and incubation
was continued for an additional hour. Cells were lysed in
radioimmunoprecipitation buffer. After immunoprecipitation with
anti-FPV or anti-hfur rabbit serum (final dilution, 1:500) and protein
A-Sepharose CL-4B (Sigma, Deisenhofen, Germany), proteins were analyzed
by SDS-10% PAGE under reducing conditions. Sizes are shown in
kilodaltons.
|
|
It was then of interest to find out which proteases are expressed
in endothelial cells of chicken embryos. To this end we
analyzed the
presence of proprotein convertase mRNA in feather
germs
of chicken embryos by in situ hybridization (Fig.
5). HA-specific
viral RNA visualized by
in situ hybridization served as a marker
for endothelial cells in the
center of the feather germs. It was
absent in the surrounding epidermal
layer. gfur- and gPC5/PC6-specific
signals were seen in the epidermal
region as well as in endothelial
cells. No gLPC/PC7-specific
hybridization signal could be detected
in feather germs, while a large
amount of gPACE4-specific mRNA
was visible. Thus, furin and PC5/PC6,
two potential activating
proteases of FPV HA, are expressed in
endothelial cells of the
chicken embryo. High amounts of PACE4-specific
mRNA were also
observed within the cells of the feather germs, but this
protease
probably plays a minor role as an activating protease of FPV
HA
(
14).

View larger version (112K):
[in this window]
[in a new window]
|
FIG. 5.
Localization and identification of FPV and
proprotein convertases in feather germs by in situ
hybridization. For the analysis of proprotein convertases,
cryosections of uninfected chicken embryos were incubated with
[35S]UTP-labeled riboprobes directed against mRNA of the
proteases. Slides were covered by photoemulsion, exposed for 21 days,
developed, and inspected by dark-field microscopy. For analysis of
FPV-infected cells, cryosections prepared at 17 h p.i. were
subjected to in situ hybridization with an HA-specific probe, covered
with photoemulsion, exposed for 2 days, developed, stained with
hematoxylin-eosin, and inspected by bright-field microscopy.
Magnification, ×75.
|
|
To analyze cleavage in isolated endothelial cells, we infected HUVEC
cells with FPV, since chicken endothelia are difficult
to culture. The
presence of the proprotein convertase PC5/PC6
in HUVEC has been
shown before (
3). By Northern blot analysis
and RT-PCR, we
could also show the expression of furin and LPC/PC7
in HUVEC (data not
shown). FPV replicates well in HUVEC (Fig.
6A). The analysis of released virus
particles indicated that HA
is readily cleaved in these cells (Fig.
6B). Taken together, the
results shown in Fig.
4,
5, and
6 indicate
that the limitation
of the infection to endothelial cells cannot be
explained by the
absence of activating proteases within these cells or
in adjacent
tissues.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Replication of FPV in HUVEC. (A) Confluent
cell layer of HUVEC was infected with egg-grown FPV at an MOI of 1. Release of virus was measured by hemagglutinating activity in the
supernatant. (B) Autoradiography of
[35S]methionine-labeled proteins of virus particles
purified from the supernatant of infected HUVEC. At 20 h p.i.,
virus in the cell supernatant was centrifuged through a 20% sucrose
cushion, and purified virus was disrupted in sample buffer containing
2% 2-mercaptoethanol and separated on a 10% polyacrylamide gel
followed by autoradiography. Sizes are shown in kilodaltons.
|
|
Expression of viral receptors in embryonic tissues.
Since
little was known about the role of the host cell receptor in tissue
tropism, we investigated cell-specific expression of neuraminic acid in
the chick embryo. This was done by histochemical analysis employing
MAA, specific for NeuAc-
2,3-Gal, the preferential receptor of avian
influenza viruses, and SNA, specific for NeuAc-
2,6-Gal, the receptor
determinant favored by mammalian strains. It has to be pointed out that
these lectins react only with protein-bound oligosaccharides. There is
therefore no information from our experiments on a possible role of
gangliosides as receptors. Figure 7 shows the results obtained with lung and liver. Labeling of lung tissue with
SNA yielded the characteristic hexagonal endothelial pattern that was
also observed after in situ hybridization with the HA-specific probe.
In contrast, MAA bound exclusively to the epithelia of the parabronchi
that were not infected (cf. Fig. 2b). Several conclusions can be drawn
from these observations. First, they show that NeuAc-
2,6-Gal can
serve as a receptor for FPV and that it specifically mediates infection
of lung endothelia. Second, endothelial and epithelial cells of the
lung of an 11-day-old chicken embryo contain FPV receptors, although
only the former are infected. The data shown in Fig. 7 demonstrate
furthermore that, at least with the methods employed in this work,
neuraminic acid cannot be detected in mesenchymal cells between the
endothelial and epithelial cells of the alveolae. Thus, it appears that
mesenchymal cells have a barrier function preventing spread of
infection from the endothelia to the alveolae.

View larger version (121K):
[in this window]
[in a new window]
|
FIG. 7.
Histochemical analysis of NeuAc- 2,3-Gal and
NeuA-c 2,6-Gal in the lung and the liver of chicken embryos by lectin
binding. Cryosections of uninfected chicken embryos were incubated with
MAA, specific for NeuAc- 2,3-Gal, or SNA, specific for
NeuAc- 2,6-Gal, as described in Materials and Methods. Bound lectins
were identified using the DIG-glycan differentiation kit (Boehringer).
Magnifications: ×75x and ×150 (liver). Symbols in lung sections
indicate endothelial cells (solid arrowheads), mesenchymal cells
(stars), alveolar and epithelia (open arrowheads). Symbols in liver
sections indicate endothelial cells (solid arrowheads), Kupffer cells
(open arrowheads), hepatocytes (asterisks), and sinusoids (arrows).
|
|
When liver tissue was analyzed with the SNA probe, the continuous layer
of endothelial cells lining the sinusoids was stained,
indicating that
these cells contain NeuAc-

2,6-Gal, as is the
case in the lung. A
different staining pattern was again obtained
when MAA was used. The
cells labeled with this lectin extended
into the lumen of the
sinusoids, most likely representing Kupffer
cells. It therefore appears
that Kupffer cells specifically express
NeuAc-

2,3-Gal. These data
indicate that in liver tissue, virus
receptors are expressed only on
cells facing the lumen of the
sinusoids, whereas they could not be
detected on hepatocytes.
Thus, the distribution of virus receptors in
the liver corresponds
exactly to the pattern of virus infection (cf.
Fig.
2e), again
suggesting that expression of neuraminic acid receptors
is an
important determinant for the endotheliotropism of
FPV.
Polarized maturation of FPV in endothelial cells.
As has been
pointed out already in the Introduction, an important factor for virus
spread is the polarized release of virions from infected cells. When we
analyzed the heart of an infected chick embryo by electron microscopy,
we could confirm polar budding of FPV from endothelial cells. Virus
particles were present exclusively at the apical part of the cell
membrane; no budding virus was detected at the basolateral side (Fig.
8).

View larger version (158K):
[in this window]
[in a new window]
|
FIG. 8.
Electron micrograph of an FPV-infected endothelial cell
from a heart capillary. At 18 h p.i., the heart of an infected
chicken embryo was prepared for transmission electron microscopy. (Top)
Numerous virus particles bud from the luminal side of the endothelial
cell. (Bottom) The section boxed in the top panel at higher
magnification.
|
|
We then examined the expression of HA at the surface of infected HUVEC
grown on Transwell filters. Figure
9A
shows the results
obtained by confocal laser scanning microscopy.
HA-specific fluorescence
was distributed all over the cell surface when
inspected from
the top. Examination of sagittal sections revealed
selective staining
of the apical membrane. HA-specific fluorescence was
not observed
at the basal membrane below the nucleus. Finally, we
analyzed
HA by an assay for the selective biotinylation of surface
proteins
(
19). In Fig.
9B we show that biotinylated FPV HA
was immunoprecipitated
almost exclusively from apically labeled cell
lysates indicating
a strong targeting of HA to the apical cell
membrane. In contrast,
VSV G protein, known to be transported to the
basolateral side
of polarized epithelial cells (
23), was
detected predominantly
on the basal side of endothelial cells.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 9.
Polarized expression of HA at the luminal side of
FPV-infected HUVEC. (A) HUVEC were grown on Transwell filters. At
4 h p.i. with FPV, they were analyzed by confocal laser scanning
microscopy using an HA-specific monoclonal antibody (HA1-A11H7) for
immunofluorescence labeling. Magnification, ×630. (B) Distribution of
viral glycoproteins on the apical (a) and basolateral (b) surfaces of
HUVEC infected with either FPV or VSV. Surface proteins were labeled by
domain-specific biotinylation and immunoprecipitated using the
monoclonal antibody against FPV HA or a polyclonal antiserum against
VSV (for details, see Materials and Methods).
|
|
Taken together, the data shown in Fig.
8 and
9 indicate that HA is
targeted exclusively to the luminal surface of endothelial
cells and
that virus budding also occurs only at this side. Thus,
the polarity of
virus maturation in endothelial cells may be another
factor promoting
spread of infection via the blood while hindering
infection of
subendothelial
tissues.
 |
DISCUSSION |
We have found in this study that FPV shows strict
endotheliotropism when infecting 11-day-old chick embryos. Since
hemorrhages and edema are major symptoms in FPV-infected chickens, it
was not unexpected to see that the vasculature is an important target of infection. However, we were surprised when we could not detect viral
replication in other cell types. Besides endothelia, myocytes and
lymphatic tissues were found to be sites of virus replication when
hatched chickens were infected with other pathogenic H5 and H7 strains
(17, 39, 40). These differences in cell tropism may depend
on the developmental stage of the host and on the virus strains used.
The results obtained with the reassortants of FPV and virus N clearly
indicate that endotheliotropism requires the presence of FPV HA. This
observation is in line with the concept that, because of its
susceptibility to ubiquitous proteolytic activation, FPV HA allows
virus entry from the allantoic cavity into the highly vascularized
mesenchymal layer of the chorioallantoic membrane and thus mediates
hematogenic spread of infection. On the other hand, the restricted
cleavability of virus N HA confines infection to the inner layer of the
membrane and the allantoic cavity (27). Reassortants
containing virus N HA therefore did not have access to endothelia when
infecting through the chorioallantoic route.
Whereas cleavage activation of HA proved to be essential for targeting
the virus to endothelia, it was not responsible for confining the
infection to these cells. To demonstrate this, we first had to clone
gfur, gPC5/PC6, gLPC/PC7, and gPACE4, since none of the
proprotein convertases had been identified before in the
natural host of FPV. All of these proteases, which showed 70 to 96%
nucleotide sequence homology to their mammalian analogues, were
expressed in the chicken embryo. Furin and PC5/PC6, known to activate
FPV HA when originating from mammalian species (14, 33),
were identified in all chicken tissues analyzed, including endothelial
cells. These enzymes had also been detected in murine and human
endothelia (2, 3). Furthermore, we showed that gfur is able
to cleave FPV HA and that cultured endothelia allow productive FPV
infection. Taken together, these observations indicate that the lack of
spread of infection from endothelia to surrounding tissues cannot be
attributed to the absence of activating proteases.
In contrast, tissue-specific expression of virus receptors appears to
be an important factor in restricting infection to endothelia. With the
lectin-binding assays employed in this study, we could detect
2,3-linked and
2,6-linked neuraminic acid, both of which proved
to be able to serve as FPV receptors only on epithelial cells and on
cells of the reticuloendothelial system.
Similar results have been obtained in a study on the brain
microvasculature of the chicken embryo, in which another neuraminic acid-binding lectin was shown to selectively bind to the luminal side
of the endothelia (21). However, with the methods employed here, we could not detect receptor determinants on other cells, such as
myocytes, fibroblasts, and hepatocytes. Thus, it appears that cells
lacking a measurable number of neuraminic acid receptors cannot be
infected by FPV and are therefore a barrier to the spread of infection.
This concept is nicely supported by the observations made on lung
tissue. When this organ is infected via the hematogenic route, as is
the case in the embryo at day 11, the virus is retained in the
endothelial cells of the capillary vessels. Since neuraminic acid is
present in
2,6 linkage on these cells, it is clear that this type of
neuraminic acid can serve as an FPV receptor, although it appears that
binding of avian strains is generally determined by the
2,3 linkage.
The alveolar epithelia, although expressing the virus receptor in large
amounts, are not infected because virus access is prevented by the
connective tissue lacking neuraminic acid. On the other hand, when
embryos are infected through the airways, as can be done by inoculating
virus 2 days before hatching into the now almost dry allantoic cavity,
virus replication is readily detected in lung epithelia (data not shown).
It has to be pointed out that expression of neuraminic acid in the
chick embryo depends on tissue differentiation (4). This may
explain the absence of detectable amounts of neuraminic acid on
fibroblasts in situ, whereas cultured fibroblasts readily express
receptors, as indicated by their ability to allow efficient virus
replication. It also has to be assumed that the subendothelial connective tissue is not a very tight barrier in the choriallantoic membrane, where it allows penetration of the virus from the allantoic epithelium into the mesodermal endothelia. In fact, small amounts of
virus budding from mesodermal fibroblasts have been observed, indicating that these cells may play a role in mediating spread of
infection (27). Whether the spread through the mesodermal layer is driven by the particularly high virus replication rates in the
allantoic epithelium and the presence of neuraminic acid on mesodermal
fibroblasts or by some other mechanism remains to be seen.
Our data also show that the polarity of virus budding is another factor
contributing to the confinement of infection to endothelial cells.
Studies on Sendai virus in a mouse model have shown before that the
sidedness of virus maturation has a distinct effect on spread of
infection in the organism and on pathogenicity. Wild-type Sendai virus
released exclusively from the apical surface of lung epithelia is
strictly pneumotropic, whereas the mutant F1-R, which matures at the
apical as well as the basolateral side, causes pantropic infection
(37, 38). It has long been known that FPV matures
preferentially at the luminal side of endothelia (27), and
the observations made here on virus budding and HA transport support
this concept. The luminal budding polarity of FPV therefore supports
the hematogenic spread of the virus and at the same time prevents
infection of subendothelial cells.
Finally, we have obtained evidence that the architecture of the
endothelia also plays a role in virus spread. Whereas endothelia form a
continuous cell layer in most organs, they are fenestrated in the liver
and spleen. Our data show that the endothelial gaps have little effect
on FPV dissemination in the liver because the underlying hepatocytes
are resistant to infection. The spleen, however, does not have such a
barrier beneath the endothelia. The virus can therefore spread freely
within this organ, as indicated by the diffuse in situ hybridization pattern.
Taken together, our data indicate that endotheliotropism of FPV in the
chick embryo is the result of an interplay of several factors
determined by the virus and the host. These include proteolytic activation of HA by ubiquitous proteases, which is responsible for
entry of the virus into the vascular system, and at least two
mechanisms contributing to the confinement of the virus to endothelia:
the polarity of virus budding at the luminal side of endothelial cells
and cell-specific differences in the expression of neuraminic acid
receptors. Endotheliotropism without doubt plays an important role in
the generalization of FPV infection and in the generation of typical
symptoms of the disease, such as hemorrhages and edema. Systemic
infection and severe vascular injury are also the central pathogenetic
mechanisms of hemorrhagic fevers in primates caused by filoviruses and
other agents, and there is evidence that at least some of these viruses
also replicate in endothelia (28, 30, 43). It will therefore
be interesting to see if mechanisms similar to those described here for
FPV infection also play a role in the pathogenesis of hemorrhagic
fevers in other species.
 |
ACKNOWLEDGMENTS |
We are grateful to R. Rott and C. Scholtissek, Giessen, for
helpful discussions and for providing influenza virus reassortants. We
thank E. Weihe for support in autoradiographic and microscopic techniques. The electron micrographs were made by B. Agricola.
This study was supported by grants from the Deutsche
Forschungsgemeinschaft (SFB 286 and KL 238/6-1) and from the Fonds der Chemischen Industrie.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Virologie, Postfach 2360, 35011 Marburg, Germany. Phone:
06421/28 66253. Fax: 06421/28 68962. E-mail:
klenk{at}mailer.uni-marburg.de.
 |
REFERENCES |
| 1.
|
Banks, J.,
E. Speidel, and D. J. Alexander.
1998.
Characterization of an avian influenza A virus isolated from a human is an intermediate host necessary for the emergence of pandemic influenza viruses?
Arch. Virol.
143:781-787[CrossRef][Medline].
|
| 2.
|
Beaubien, G.,
M. K. Schafer,
E. Weihe,
W. Dong,
M. Chretien,
N. G. Seidah, and R. Day.
1995.
The distinct gene expression of the pro-hormone convertases in the rat heart suggests potential substrates.
Cell Tissue Res.
279:539-549[Medline].
|
| 3.
|
Campan, M.,
M. Yoshizumi,
N. G. Seidah,
M. E. Lee,
C. Bianchi, and E. Haber.
1996.
Increased proteolytic processing of protein tyrosine phosphatase mu in confluent vascular endothelial cells: the role of PC5, a member of the subtilisin family.
Biochemistry
35:3797-3802[CrossRef][Medline].
|
| 4.
|
Codogno, P., and M. Aubery.
1983.
Changes in cell-surface sialic acid content during chick embryo development.
Mech. Ageing Dev.
23:307-314[CrossRef][Medline].
|
| 5.
|
Connor, R. J.,
Y. Kawaoka,
R. G. Webster, and J. C. Paulson.
1994.
Receptor specificity in human, avian, and equine H2 and H3 influenza virus isolates.
Virology
205:17-23[CrossRef][Medline].
|
| 6.
|
de Jong, J. C.,
E. C. Claas,
A. D. Osterhaus,
R. G. Webster, and W. L. Lim.
1997.
A pandemic warning?
Nature
389:554[Medline].
|
| 7.
|
Dinter, Z., and J. Bakos.
1950.
Ueber die Beziehungen des Virus N zu dem Virus der klassischen Gefluegelpest.
Berl. Muench. Tieraerztl. Wochenschr.
63:101-105.
|
| 8.
|
Feldmann, H.,
E. Kretzschmar,
B. Klingeborn,
R. Rott,
H. D. Klenk, and W. Garten.
1988.
The structure of serotype H10 hemagglutinin of influenza A virus: comparison of an apathogenic avian and a mammalian strain pathogenic for mink.
Virology
165:428-437[CrossRef][Medline].
|
| 9.
|
Flamme, I.,
G. Breier, and W. Risau.
1995.
Vascular endothelial growth factor (VEGF) and VEGF receptor 2 (flk-1) are expressed during vasculogenesis and vascular differentiation in the quail embryo.
Dev. Biol.
169:699-712[CrossRef][Medline].
|
| 10.
|
Gambaryan, A. S.,
A. B. Tuzikov,
V. E. Piskarev,
S. S. Yamnikova,
D. K. Lvov,
J. S. Robertson,
N. V. Bovin, and M. N. Matrosovich.
1997.
Specification of receptor-binding phenotypes of influenza virus isolates from different host using synthetic sialylglycopolymers: non-egg-adapted human H1 and H3 influenza A and influenza B viruses share a common high binding affinity for 6'-sialyl(N-acetyllactosamine).
Virology
232:345-350[CrossRef][Medline].
|
| 11.
|
Garten, W.,
D. Linder,
R. Rott, and H. D. Klenk.
1982.
The cleavage site of the hemagglutinin of fowl plague virus.
Virology
122:186-190[CrossRef][Medline].
|
| 12.
|
Gimbrone, M. A. J.,
R. S. Cotran, and J. Folkman.
1974.
Human vascular endothelial cells in culture. Growth and DNA synthesis.
J. Cell Biol.
60:673-684[Abstract/Free Full Text].
|
| 13.
|
Gratzl, E., and H. Koehler.
1968.
Gefluegelpest, p. 178-200.
In
Spezielle Pathologie und Therapie der Gefluegelkrankheiten. Ferdinand Enke Verlag, Stuttgart, Germany.
|
| 14.
|
Horimoto, T.,
K. Nakayama,
S. P. Smeekens, and Y. Kawaoka.
1994.
Proprotein-processing endoproteases PC6 and furin both activate hemagglutinin of virulent avian influenza viruses.
J. Virol.
68:6074-6078[Abstract/Free Full Text].
|
| 15.
|
Karnovsky, M. J.
1968.
The ultrastructural basis of transcapillary exchanges.
J. Gen. Physiol.
52(Suppl.):95.
|
| 16.
|
Klenk, H. D., and W. Garten.
1994.
Activation cleavage of viral spike proteins by host proteases, p. 241-280.
In
E. Wimmer (ed.), Cellular receptors for animal viruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 17.
|
Kobayashi, Y.,
T. Horimoto,
Y. Kawaoka,
D. Alexander, and C. Itakura.
1996.
Pathological studies of chickens experimentally infected with two highly pathogenic avian influenza viruses.
Avian Pathol.
25:285-304[Medline].
|
| 18.
|
Kurtz, I.,
R. J. Manvell, and J. Banks.
1996.
Avian influenza virus isolated from a woman with conjunctivitis.
Lancet
348:901-902[CrossRef][Medline].
|
| 19.
|
Lisanti, M. P.,
M. Sargiacomo,
L. Graeve,
A. R. Saltiel, and E. Rodriguez-Boulan.
1988.
Polarized apical distribution of glycosyl-phosphatidylinositol-anchored proteins in a renal epithelial cell line.
Proc. Natl. Acad. Sci. USA
85:9557-9561[Abstract/Free Full Text].
|
| 20.
|
Narayan, O.,
J. Thorsen,
T. J. Hulland,
G. Ankeli, and P. G. Joseph.
1972.
Pathogenesis of lethal influenza virus infection in turkeys. I. Extraneural phase of infection.
J. Comp. Pathol.
82:129-137[CrossRef][Medline].
|
| 21.
|
Nico, B.,
F. Quondamatteo,
D. Ribatti,
M. Bertossi,
G. Russo,
R. Herken, and L. Roncali.
1998.
Ultrastructural localization of lectin binding sites in the developing brain microvasculature.
Anat. Embryol. (Berlin)
197:305-315[CrossRef][Medline].
|
| 22.
|
Roberts, P. C.,
W. Garten, and H. D. Klenk.
1993.
Role of conserved glycosylation sites in maturation and transport of influenza A virus hemagglutinin.
J. Virol.
67:3048-3060[Abstract/Free Full Text].
|
| 23.
|
Rodriguez-Boulan, E.,
K. T. Paskiet, and D. D. Sabatini.
1983.
Assembly of enveloped viruses in Madin-Darby canine kidney cells: polarized budding from single attached cells and from clusters of cells in suspension.
J. Cell Biol.
96:866-874[Abstract/Free Full Text].
|
| 24.
|
Rogers, G. N., and B. L. D'Souza.
1989.
Receptor binding properties of human and animal H1 influenza virus isolates.
Virology
173:317-322[CrossRef][Medline].
|
| 25.
|
Rogers, G. N., and J. C. Paulson.
1983.
Receptor determinants of human and animal influenza virus isolates: differences in receptor specificity of the H3 hemagglutinin based on species of origin.
Virology
127:361-373[CrossRef][Medline].
|
| 26.
|
Rott, R.,
M. Orlich, and C. Scholtissek.
1979.
Correlation of pathogenicity and gene constellation of influenza A viruses. III. Non-pathogenic recombinants derived from highly pathogenic parent strains.
J. Gen. Virol.
44:471-477[Abstract/Free Full Text].
|
| 27.
|
Rott, R.,
M. Reinacher,
M. Orlich, and H. D. Klenk.
1980.
Cleavability of hemagglutinin determines spread of avian influenza viruses in the chorioallantoic membrane of chicken embryo.
Arch. Virol.
65:123-133[CrossRef][Medline].
|
| 28.
|
Ryabchikova, E. J.,
L. V. Kolesnikova, and S. V. Netesov.
1999.
Animal pathology of filoviral infections.
Curr. Top. Microbiol. Immunol.
235:145-173[Medline].
|
| 29.
|
Schaefer, M. K., and R. Day.
1995.
In situ hybridization techniques to map processing enzymes.
Methods Neurosci.
23:16-44.
|
| 30.
|
Schnittler, H. J.,
F. Mahner,
D. Drenckhahn,
H.-D. Klenk, and H. Feldmann.
1993.
Replication of Marburg virus in human endothelial cells. A possible mechanism for the development of viral hemorrhagic disease.
J. Clin. Investig.
91:1301-1309.
|
| 31.
|
Scholtissek, C.,
I. Koennecke, and R. Rott.
1978.
Host range recombinants of fowl plague (influenza A) virus.
Virology
91:79-85[CrossRef][Medline].
|
| 32.
|
Scholtissek, C., and B. R. Murphy.
1978.
Host range mutants of an influenza A virus.
Arch. Virol.
58:323-333[CrossRef][Medline].
|
| 33.
|
Stieneke-Gröber, A.,
M. Vey,
H. Angliker,
E. Shaw,
G. Thomas,
C. Roberts,
H. D. Klenk, and W. Garten.
1992.
Influenza virus hemagglutinin with multibasic cleavage site is activated by furin, a subtilisin-like endoprotease.
EMBO J.
11:2407-2414[Medline].
|
| 34.
|
Suarez, D. L.,
M. L. Perdue,
N. Cox,
T. Rowe,
C. Bender,
J. Huang, and D. E. Swayne.
1998.
Comparisons of highly virulent H5N1 influenza A viruses isolated from humans and chickens from Hong Kong.
J. Virol.
72:6678-6688[Abstract/Free Full Text].
|
| 35.
|
Subbarao, K.,
A. Klimov,
J. Katz,
H. Regnery,
W. Lim,
H. Hall,
M. Perdue,
D. Swayne,
C. Bender,
J. Huang,
M. Hemphill,
T. Rowe,
M. Shaw,
X. Xu,
K. Fukuda, and N. Cox.
1998.
Characterization of an avian influenza A (H5N1) virus isolated from a child with fatal respiratory illness.
Science
279:393-396[Abstract/Free Full Text].
|
| 36.
|
Takahashi, S.,
T. Nakagawa,
K. Kasai,
T. Banno,
S. J. Duguay,
W. J. Van de Ven,
K. Murakami, and K. Nakayama.
1995.
A second mutant allele of furin in the processing-incompetent cell line LoVo: evidence for involvement of the homo B domain in autocatalytic activation.
J. Biol. Chem.
270:26565-26569[Abstract/Free Full Text].
|
| 37.
|
Tashiro, M.,
J. T. Seto,
S. Choosakul,
M. Yamakawa,
H. D. Klenk, and R. Rott.
1992.
Budding site of Sendai virus in polarized epithelial cells is one of the determinants for tropism and pathogenicity in mice.
Virology
187:413-422[CrossRef][Medline].
|
| 38.
|
Tashiro, M.,
M. Yamakawa,
K. Tobita,
J. T. Seto,
H. D. Klenk, and R. Rott.
1990.
Altered budding site of a pantropic mutant of Sendai virus, F1-R, in polarized epithelial cells.
J. Virol.
64:4672-4677[Abstract/Free Full Text].
|
| 39.
|
van Campen, H.,
B. C. Easterday, and V. S. Hinshaw.
1989.
Destruction of lymphocytes by a virulent avian influenza A virus.
J. Gen. Virol.
70:467-472[Abstract/Free Full Text].
|
| 40.
|
van Campen, H.,
B. C. Easterday, and V. S. Hinshaw.
1989.
Virulent avian influenza A viruses: their effect on avian lymphocytes and macrophages in vivo and in vitro.
J. Gen. Virol.
70:2887-2895[Abstract/Free Full Text].
|
| 41.
|
Vey, M.,
W. Schäfer,
S. Berghofer,
H. D. Klenk, and W. Garten.
1994.
Maturation of the trans-Golgi network protease furin: compartmentalization of propeptide removal, substrate cleavage, and COOH-terminal truncation.
J. Cell Biol.
127:1829-1842[Abstract/Free Full Text].
|
| 42.
|
Webster, R. G.,
W. J. Bean,
O. T. Gorman,
T. M. Chambers, and Y. Kawaoka.
1992.
Evolution and ecology of influenza A viruses.
Microbiol. Rev.
56:152-179[Abstract/Free Full Text].
|
| 43.
|
Zaki, S. R., and C. S. Goldsmith.
1999.
Pathologic features of filovirus infections in humans.
Curr. Top. Microbiol. Immunol.
235:97-116[Medline].
|
Journal of Virology, September 2000, p. 8018-8027, Vol. 74, No. 17
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ito, K., Kim, K.-H., Lok, A. S.-F., Tong, S.
(2009). Characterization of Genotype-Specific Carboxyl-Terminal Cleavage Sites of Hepatitis B Virus e Antigen Precursor and Identification of Furin as the Candidate Enzyme. J. Virol.
83: 3507-3517
[Abstract]
[Full Text]
-
Vascellari, M., Granato, A., Trevisan, L., Basilicata, L., Toffan, A., Milani, A., Mutinelli, F.
(2007). Pathologic Findings of Highly Pathogenic Avian Influenza Virus A/Duck/Vietnam/12/05 (H5N1) in Experimentally Infected Pekin Ducks, Based on Immunohistochemistry and In Situ Hybridization. Vet Pathol
44: 635-642
[Abstract]
[Full Text]
-
Harvey, R., Martin, A. C. R., Zambon, M., Barclay, W. S.
(2004). Restrictions to the Adaptation of Influenza A Virus H5 Hemagglutinin to the Human Host. J. Virol.
78: 502-507
[Abstract]
[Full Text]
-
Wichmann, D., Grone, H.-J., Frese, M., Pavlovic, J., Anheier, B., Haller, O., Klenk, H.-D., Feldmann, H.
(2002). Hantaan Virus Infection Causes an Acute Neurological Disease That Is Fatal in Adult Laboratory Mice. J. Virol.
76: 8890-8899
[Abstract]
[Full Text]