This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Himathongkham, S.
Right arrow Articles by Luciw, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Himathongkham, S.
Right arrow Articles by Luciw, P. A.

 Previous Article  |  Next Article 

Journal of Virology, September 2000, p. 7851-7860, Vol. 74, No. 17
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Simian-Human Immunodeficiency Virus Containing a Human Immunodeficiency Virus Type 1 Subtype-E Envelope Gene: Persistent Infection, CD4+ T-Cell Depletion, and Mucosal Membrane Transmission in Macaques

Sunee Himathongkham, Nancy S. Halpin, Jinling Li, Michael W. Stout, Christopher J. Miller, and Paul A. Luciw*

Center for Comparative Medicine, University of California, Davis, California 95616

Received 21 March 2000/Accepted 1 June 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The envelope (env) glycoprotein of human immunodeficiency virus type 1 (HIV-1) determines several viral properties (e.g., coreceptor usage, cell tropism, and cytopathicity) and is a major target of antiviral immune responses. Most investigations on env have been conducted on subtype-B viral strains, prevalent in North America and Europe. Our study aimed to analyze env genes of subtype-E viral strains, prevalent in Asia and Africa, with a nonhuman primate model for lentivirus infection and AIDS. To this end, we constructed a simian immunodeficiency virus/HIV-1 subtype-E (SHIV) recombinant clone by replacing the env ectodomain of the SHIV-33 clone with the env ectodomain from the subtype-E strain HIV-1CAR402, which was isolated from an individual in the Central African Republic. Virus from this recombinant clone, designated SHIV-E-CAR, replicated efficiently in macaque peripheral blood mononuclear cells. Accordingly, juvenile macaques were inoculated with cell-free SHIV-E-CAR by the intravenous or intravaginal route; virus replicated in these animals but did not produce hematological abnormalities. In an attempt to elicit the pathogenic potential of the recombinant clone, we serially passaged this viral clone via transfusion of blood and bone marrow through juvenile macaques to produce SHIV-E-P4 (fourth-passage virus). The serially passaged virus established productive infection and CD4+ T-cell depletion in juvenile macaques inoculated by either the intravenous or the intravaginal route. Determination of the coreceptor usage of SHIV-E-CAR and serially passaged SHIV-E-P4 indicated that both of these viruses utilized CXCR4 as a coreceptor. In summary, the serially passaged SHIV subtype-E chimeric virus will be important for studies aimed at developing a nonhuman primate model for analyzing the functions of subtype-E env genes in viral transmission and pathogenesis and for vaccine challenge experiments with macaques immunized with HIV-1 env antigens.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Genetic variability is a hallmark of human immunodeficiency virus type 1 (HIV-1). Diverse HIV-1 genotypes have been identified in the worldwide AIDS epidemic; by comparison of nucleotide sequences in the env or gag regions, these viruses have been classified into subtypes A through H (major group, M) as well as the highly divergent groups N and O (outlier) (6). The env glycoprotein of HIV-1 governs several viral properties (i.e., coreceptor usage, cell tropism, and cytopathicity) and is the major target for antiviral immune responses (10). Thus, the high degree of sequence variability of HIV-1 env presents a significant challenge for antiviral vaccine development aimed at preventing infection and AIDS (32). HIV-1 subtype E, identified as a unique subtype by phylogenetic analysis of sequences in env, was first discovered in Thailand (31, 37). At present, subtype-E viruses are the most prevalent strains in Thailand and neighboring nations in Asia (33, 40; B. G. Weniger and T. Brown, Letter, N. Engl. J. Med. 335:343-345, 1996) and have also been found in Africa (4, 36, 41). Recently, subtype-E viruses have begun to enter other continents (2, 4, 41, 43).

The lack of an animal model for HIV-1 infection and fatal immunodeficiency has hindered the identification of the genetic determinants of transmission and pathogenesis of different viral subtypes. To address issues related to functions of HIV-1 genes in vivo, several investigators have constructed replication-competent recombinant viruses by substituting genes of the simian immunodeficiency virus (SIV) pathogenic clone SIVmac239 with various genes from HIV-1 subtype-B clones (38, 54). These recombinants, or chimeras, are designated simian-human immunodeficiency viruses (SHIV). Infection of macaques with chimeric SHIV clones generally produces low-level infection with no clinical signs (21, 27, 49). From these clones, pathogenic SHIV isolates were derived by serial passage (15, 18, 45) or after long-term infection of macaques (26, 51). All of these chimeras contained the env gene of various subtype-B HIV-1 clones, including clones that utilize CCR5 (15), CXCR4 (18, 26), or both CCR5 and CXCR4 (45, 51) coreceptors. Several of these pathogenic chimeras were transmitted across mucosal membranes and produced fatal immunodeficiency disease (16, 17, 25, 26).

An SHIV containing the env gene of subtype-E HIV-19466, an isolate from Thailand, replicated in cultures of baboon lymphoid cells and established a low-level persistent infection without clinical signs in this species (20). However, the utility of this chimera was limited by the finding that it did not infect cultures of rhesus macaque lymphoid cells, thus precluding assessment in macaques. HIV-1CAR402, a subtype-E viral isolate obtained from an AIDS patient in the Central African Republic (36), exhibits about 20% sequence variation from subtype-E viral isolates from Thailand (13, 30). Chimpanzees experimentally inoculated with this virus, by either the intravenous (i.v.), or the intravaginal (IVAG) route, showed persistent infection without disease (3). Virus molecularly cloned from an infected chimpanzee peripheral blood mononuclear cell (PBMC) culture was used to construct a chimeric virus, designated the SHIV-E-CAR clone, that contains the env ectodomain of HIV-1CAR402. This chimeric virus replicated efficiently in cultures of rhesus macaque lymphoid cells, in contrast to the chimeric virus containing the env gene of the subtype-E virus from Thailand (20). Multiple serial passages produced a chimeric isolate that caused rapid depletion of CD4+ T cells in peripheral blood and lymph nodes of juvenile macaques. Infection with SHIV subtype-E env through vaginal mucosal membranes was demonstrated in this monkey species. Thus, an SHIV chimera containing the subtype-E env gene and possessing pathogenic potential is now available for examining properties of the env gene in the virus-host relationship and as a challenge virus for evaluating vaccines for cross-subtype immunity.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cells and virus stocks. PBMC were obtained from healthy rhesus macaques free of simian type D retroviruses, SIV, and simian T-lymphotropic virus. These cells, purified from whole blood by Ficoll-Hypaque centrifugation, were stimulated with staphylococcal enterotoxin A and maintained in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum (FCS), interleukin-2 (50 U/ml) (Chiron Corp., Emeryville, Calif.), and antibiotics (100 U of penicillin per ml and 100 µg of streptomycin per ml). Mm221 cells (provided by R. Desrosiers, New England Regional Primate Research Center, Southboro, Mass.) are interleukin-2-dependent rhesus macaque T cells permissive for SIV and SHIV (1). Human PBMC were isolated from a healthy blood donor stimulated with phytohemagglutinin. CEMx174 cells, a human hybrid T-cell-B-cell line (provided by J. Hoxie, University of Pennsylvania, Philadelphia), were maintained in RPMI 1640 medium supplemented with 10% FCS and antibiotics. PM-1 cells (obtained from R. Gallo, University of Maryland, Baltimore) are a human T-cell line permissive for primary as well as T-cell-line-adapted strains of HIV-1 (28).

The SHIV-E-CAR clone was constructed by substituting the ectodomain of the envelope glycoprotein of SHIV-33 (27) with the counterpart of the HIV-1CAR402 envelope region. Details of construction, involving various plasmids, are available from the authors upon request. A stock of cell-free SHIV-E-CAR was prepared by transfection of proviral plasmid DNA in RD-4 cells and cocultured with human PBMC. SHIV-E-P3 and SHIV-E-P4 were isolated from plasma of passage 3 and passage 4 macaques, respectively, and propagated in cultures of human PBMC. Culture supernatants were collected, tested for virus by an SIV p27 antigen capture enzyme-linked immunosorbent assay (ELISA) (Coulter Immunology, Hialeah, Fla.), passed through a 0.45-µm-pore-size filter, and frozen in aliquots. The 50% tissue culture infective doses (TCID50) of these viral stocks in CEMx174 cells were determined by end-point dilution with microtiter plates as described previously (29).

Inoculation of macaques. All animals were colony-bred juvenile rhesus macaques (Macaca mulatta) free of simian type D retroviruses, SIV, and simian T-lymphotropic virus; these animals are housed at the California Regional Primate Research Center, Davis, in accordance with American Association for Accreditation of Laboratory Animal Care Standards. Before inoculation, 12 ml of blood from juvenile macaques was collected by venipuncture for complete blood count, including platelet count, T-lymphocyte phenotyping by flow cytometry, and preinfection plasma and PBMC samples. Peripheral lymph nodes were obtained by excisional biopsy, and portions of lymph nodes were fixed in formaldehyde. The scheme for inoculating macaques is shown in Fig. 1. Two juvenile male (Mmu28729 and Mmu28863) and four female (Mmu30440, Mmu30471, Mmu28907, and Mmu28825) macaques were inoculated with a cell-free stock of SHIV-E-CAR via the i.v. or IVAG route. The SHIV-E-CAR clone was serially passaged through macaques by i.v. inoculation of cell-free virus for passage 1 (Mmu29514 and Mmu29579) and transfusion of blood and bone marrow for passage 2 (Mmu29585 and Mmu29512) and passage 3 (Mmu29509 and Mmu29581). Cell-free SHIV-E-P3 virus, isolated from passage 3 animals, was inoculated i.v. into two macaques (Mmu30904 and Mmu30932). Cell-free SHIV-E-P4 virus, isolated from passage 4 macaques, was inoculated into two male macaques (Mmu29127 and Mmu28780) by the i.v. route and two female macaques via vaginal mucosal membranes (Mmu29379 and Mmu29644). Animals were observed daily and weighed regularly by the California Regional Primate Research Center veterinary staff. Complete physical examinations were performed to monitor for weight loss, lymphadenopathy and/or splenomegaly, opportunistic infections, and any other clinical signs of disease.


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 1.   Plan for analysis and serial passage of the SHIV-E-CAR clone in rhesus macaques. Two juvenile male (Mmu28729 and Mmu28863) and four juvenile female (Mmu30440, Mmu30471, Mmu28907, and Mmu28825) macaques were inoculated with a cell-free stock of the SHIV-E-CAR clone via the i.v. or IVAG route. The SHIV-E-CAR clone was serially passaged through juvenile macaques by i.v. inoculation of cell-free virus for passage 1 (Mmu29514 and Mmu29579) and transfusion of blood and bone marrow for passage 2 (Mmu29585 and Mmu29512) and passage 3 (Mmu29509 and Mmu29581). Cell-free P3 virus, isolated from passage 3 animals, was inoculated by the i.v. route into two juvenile macaques (Mmu30904 and Mmu30932). Cell-free SHIV-E-P4 isolated from passage 4 juvenile macaques was inoculated into two juvenile macaques (Mmu29127 and Mmu28780) by the i.v. route and two female macaques via vaginal mucosal membranes (Mmu29379 and Mmu29644). These animals were monitored for hematological abnormalities, T-cell subsets, antibody responses, and viral loads in plasma, peripheral blood, and lymph nodes.

Hematologic evaluation and T-lymphocyte immunophenotyping. Complete blood counts were obtained by a standard automated method (Biochem Immunosystems, Allentown, Pa.) with EDTA-anticoagulated blood. CD4 and CD8 T-lymphocyte immunophenotyping was performed by flow cytometry using a tricolor whole-blood lysis technique (Q-Prep; Coulter) (44). Fifty microliters of whole blood or 5 × 105 lymph node cells were incubated in the dark at 25°C with combinations of the following monoclonal antibodies conjugated according to the manufacturer's instructions: anti-CD3-fluorescein isothiocyanate (Pharmingen, San Diego, Calif.), anti-CD4-phycoerythrin (Becton Dickinson, Mountain View, Calif.), and anti-CD8-Leu2a-peridinin chlorophyl protein (Becton Dickinson). These samples were assayed by flow cytometry using a FACScan and analyzed with CellQuest software (Becton Dickinson).

Measurement of viral load. Levels of viral RNA in plasma were measured by a branched-DNA (bDNA) assay (Chiron-Bayer Diagnostics, Emeryville, Calif.). For the detection of associated virus loads in peripheral blood and lymph nodes, 106 PBMC or lymph node cells (and serial 10-fold dilutions of these cells) from each infected macaque were cocultured with 2.5 × 105 CEMx174 cells per well, with four wells per dilution. These cocultures were monitored by light microscopy for cytopathology, and samples of culture supernatants were assayed for SIV p27 antigen by an ELISA (29). Titers were calculated by the method of Reed and Muench (43a) to determine the number of infected cells per 106 total PBMC. To measure virus load in lymph node cells, peripheral lymph node samples were obtained by transcutaneous biopsy and aseptically teased into single-cell suspensions; cell numbers were determined by counting in a hemocytometer. For detection of viral DNA in animals with an undetectable viral load, PCR amplification analysis of SIV gag was performed (35).

Sequencing of viral DNA. For PCR amplification of viral DNA, two pairs of primers were used. One primer pair included a forward primer from the conserved SIVmac239 sequence (6,675 nucleotides [nt]) and a reverse primer 5' of HIV-1CAR402 env (7,011 nt). Another primer pair contained a forward primer 5' of HIV-1CAR402 env (6,472 nt) and a reverse primer 3' of the HIV-1CAR402 env gp120/gp41 cleavage site (7,886 nt). Nucleotide positions are from the sequences of the SIVmac239 clone (GenBank accession number M33262) and HIV-1CAR402 (GenBank accession number U51188). Oligonucleotide primers were designed with Amplify v1.2 (Bill Engels, University of Wisconsin, Madison). The forward primer was SIV-6675 or SHIV-640 (5'CTCTCTCAGCTATACCGCCCT or 5'CACATGCCTGTGTACCCACA), and the reverse primer was SHIV-MK650 or SHIV-20771 (5'GTGTGCATTGTACTGAGCTGACATT or 5'GCCTGTACCGTCAGCGTTATTGAC, respectively). The DNA template for amplification was prepared from cultures of human PBMC infected with plasma from passage 4 animals at week 2 postinoculation (p.i.).

PCR was done with 2 to 5 µl of cell lysate in a final volume of 50 µl of the following reaction mixture overlaid with 40 µl of mineral oil: 10 mM Tris-HCl (pH 8.3); 50 mM KCl; 1.5 mM MgCl2; 200 µM each dATP, dCTP, dGTP, and dTTP; 40 pmol of each primer; and 1 U of AmpliTaq DNA polymerase (Perkin-Elmer Cetus). This first reaction mixture with primers SIV-6675 and SHIV-MK650 was transferred to a DNA thermal cycler (Perkin-Elmer Cetus), with 1 cycle at 94°C for 2 min, 30 cycles at 94°C for 1 min and 64°C for 3 min, and incubation for 20 min at 72°C. The second reaction with primers SHIV-640 and SHIV-20771 was done with 1 cycle at 94°C for 2 min, 30 cycles at 94°C for 1 min, 65°C for 1 min 30 s, and 72°C for 3 min, and incubation for 20 min at 72°C. The 1,210- and 1,441-nt PCR products were Qiaex (Qiagen, Valencia, Calif.) purified after agarose gel electrophoresis and ligated to pCR2.1 using a TA cloning kit (Invitrogen, Carlsbad, Calif.). Plasmid clones were screened for insert size and sequenced. Amino acid alignment was done using GeneWorks (Oxford Molecular, Campbell, Calif.).

Determination of coreceptor usage. The coreceptor usage of envelope glycoproteins of the SHIV-E-CAR clone and SHIV-E-P4 were determined by using the human glioma cell line U87 expressing the CD4 gene and either of the coreceptors CXCR4 and CCR5 (U87-CXCR4 and U87-CCR5, respectively). These cells, obtained from the National Institutes of Health AIDS Reagents Program, were maintained in Dulbecco's modified Eagle medium (Gibco) with 10% FCS, 300 µg of G418 per ml, and 1 µg of puromycin per ml. U87 cells were cultured without puromycin. Viruses were inoculated onto 3 × 104 U87, U87-CXCR4, or U87-CCR5 cells per well in 24-well plates at a multiplicity of infection of 0.03. After incubation at 37°C for 2 h, the cultures were washed three times with phosphate-buffered saline and maintained in the medium described above. Culture supernatants were collected at 5 days and assayed for SIV p27 antigen. SHIV-33A and SIVmac239 supernatants were analyzed as controls.

Nucleotide sequence accession numbers. The DNA sequences of the clones have been deposited in GenBank under accession no. AF251195 through AF251201.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Construction and in vitro analysis of subtype-E SHIV. The SHIV-E-CAR chimera was constructed to contain the env ectodomain from subtype-E HIV-1CAR402 (Fig. 2A). Infectious virus was recovered from the SHIV-E-CAR clone by transfection of the human carcinoma cell line RD-4 followed by coculturing with human PBMC. Virus stocks were collected and titrated for TCID50 in CEMx174 cells. To characterize SHIV-E-CAR in vitro, the replication kinetics of this virus in human and rhesus macaque cells were analyzed. The chimeric virus replicated efficiently in human lymphoid cell lines (PM-1 cells and CEMx174 cells) and in human PBMC. Syncytium formation and cytopathology were observed during 5 to 10 days of infection in both the human cell lines and the PBMC. Interestingly, this virus replicated efficiently in the rhesus Mm221 cell line and in cultures of rhesus macaque PBMC (Fig. 2B). This result indicates that the SHIV-E-CAR clone is highly infectious and cytopathic in cultures of human and rhesus macaque T-lymphoid cells.


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2.   Construction and in vitro analysis of the subtype-E SHIV-E-CAR clone. (A) The genomic structure of the SHIV-E-CAR construct is shown at the bottom. The structure of the SHIV-33 proviral genome is shown at the top. Sequences of SIVmac239 are indicated by open boxes, sequences of HIV-1SF33 (subtype B) are indicated by stippled boxes, and solid boxes represent sequences of the HIV-1CAR402 (subtype E, Africa) envelope. The surface (SU) and transmembrane (TM) subunits of the envelope glycoproteins are indicated. LTR, long terminal repeat. (B) Replication kinetics of the SHIV-E-CAR clone analyzed in human cells (PM-1 cells [], CEMx174 cells [], and human PBMC [black-triangle]) and rhesus macaque cells (Mm221 cells [open circle ] and rhesus PBMC []). Culture supernatants were collected every 3 to 4 days after infection and assayed for SIV p27 by an antigen capture ELISA.

SHIV-E-CAR clone in juvenile macaques inoculated by the i.v. or IVAG route. The ability of a cell-free preparation of the SHIV-E-CAR clone to infect rhesus macaques parenterally or through mucosal membranes was evaluated. Cell-associated viral loads in peripheral blood and lymph nodes of inoculated animals were measured by coculturing of PBMC and lymph node mononuclear cells (LNMC) with CEMx174 cells. The level of plasma viremia was determined by a bDNA assay. Cytopathic effect and detection of p27 antigen by an ELISA were used to monitor the presence of virus in the coculture assay. T-cell subsets from these animals were analyzed by flow cytometry.

Two juvenile macaques inoculated once with 2,000 TCID50 of SHIV-E-CAR by the i.v. route became viremic at the acute stage of infection. The viral loads in plasma transiently increased up to 1.1 × 107 and 3 × 107 copies per ml at weeks 2 p.i. in Mmu28729 and Mmu28863, respectively; thereafter, viral RNA levels declined to undetectable levels (Fig. 3A). Absolute CD4+ T-cell counts in PBMC of these animals were in the reference range of healthy macaques at all times during infection, and the CD4/CD8 ratios were higher than 0.5 (Table 1). Neither animal showed signs of hematological abnormalities (data not shown). Viral infection, detected by isolation of virus from peripheral blood, persisted in Mmu28729 until 8 weeks p.i. and in Mmu28863 until 32 weeks p.i. (Table 2). Both of these animals exhibited antiviral antibody responses detected by an ELISA at 4 weeks p.i. (Table 3) and remained healthy during the observation period of 62 weeks. Taken together, these data demonstrate that the SHIV-E-CAR clone inoculated via the i.v. route established a productive infection in rhesus macaques.


View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3.   Plasma viral loads in juvenile rhesus macaques inoculated i.v. and IVAG with the SHIV-E-CAR clone. Plasma viral loads were measured during the course of infection of two juvenile macaques (Mmu28729 and Mmu28863) inoculated i.v. (A) and four female macaques (Mmu30440, Mmu30471, Mmu28825, and Mmu28907) inoculated IVAG (B) with the SHIV-E-CAR clone. Viral loads are given in SHIV RNA copy numbers determined by a bDNA assay.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Total numbers of CD4+ T lymphocytes and CD4/CD8 ratios of macaques inoculated with the SHIV-E-CAR clone or serially passaged SHIV-E-P4


                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Cell-associated virus loads of macaques inoculated with the SHIV-E-CAR clone or serially passaged SHIV-E-P4


                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Antiviral antibody responses of macaques inoculated with the SHIV-E-CAR clone or serially passaged SHIV-E-P4

Four female macaques were inoculated by two applications of the cell-free SHIV-E-CAR clone onto vaginal mucosal membranes. The dose of virus at each application was 35,000 TCID50 in a total of 1 ml of culture medium. One animal in this group, Mmu30440, exhibited a peak plasma viral RNA level of 6.7 × 106 copies per ml at 4 weeks; subsequently, this viremia declined to undetectable levels after 8 weeks (Fig. 3B). Positive detection of cell-associated viral loads in peripheral blood and lymph nodes at all times during the course of infection (through week 32 p.i.) indicated that Mmu30440 was persistently infected with the chimeric virus (Table 2). Mm28907 did not show detectable viral RNA in plasma (Fig. 3B). However, this animal was positive for viral isolation from PBMC at the acute stage of infection; cell-associated virus was also detected in peripheral blood and lymph node cells at the chronic stage of infection (Table 2). In Mmu30471 and Mmu28825, virus was not detected in plasma, peripheral blood, or lymph nodes at any time until 32 weeks (Table 2). PCR amplification analysis with SIV gag primers did not detect viral DNA in PBMC collected from Mmu30471 and Mmu28825 at 12 weeks (data not shown). Absolute CD4+ T-cell counts in peripheral blood of Mmu28907 showed a slight decline during the course of infection, but CD4/CD8 T-cell ratios remained in the reference range (1 or above) (Table 1). All four animals remained healthy throughout the 62-week observation period, with no sign of hematological abnormalities. Antiviral antibody was detected as early as 8 weeks p.i. in Mmu30440 and 16 weeks p.i. in Mmu28907; no antibody response was detected in Mmu28825 or Mmu30471 (Table 3). These findings demonstrated that the SHIV-E-CAR clone established a persistent infection in two of four female macaques after IVAG exposure. The different degrees of viral infection in these animals suggest that host factors play critical roles in viral transmission via mucosal membranes.

Serial passage of the SHIV-E-CAR clone in juvenile macaques. To augment the pathogenicity of the SHIV-E-CAR clone, rapid serial passaging of this virus in juvenile rhesus macaques was conducted (Fig. 1). Cell-free chimeric virus was inoculated by the i.v. route into two juvenile macaques (Mmu29514 and Mmu29579) at 20,000 TCID50 per animal. Blood and bone marrow (P1 virus) were collected from these animals at week 2 p.i., at the peak of viremia, combined, and transfused into passage 2 macaques (Mmu29585 and Mmu29512). Blood and bone marrow (P2 virus) were collected from passage 2 animals at week 2 p.i., at the peak of viremia, pooled, and transfused into passage 3 animals (Mmu29509 and Mmu29581). Cell-free P3 virus was isolated from plasma of passage 3 animals at week 2 p.i., at the peak of viremia. A stock of this virus, designated SHIV-E-P3, was prepared using human PBMC. Subsequently, SHIV-E-P3 (20,000 TCID50) was inoculated i.v. into passage 4 animals (Mmu30904 and Mmu30932). SHIV-E-P4 was isolated from plasma of passage 4 animals at week 2 p.i., at the peak of viremia, and a stock of this virus was prepared using human PBMC.

i.v. and IVAG inoculation of serially passaged SHIV-E-P4 in juvenile macaques. A cell-free preparation of 10,000 TCID50 of SHIV-E-P4 was inoculated into two juvenile rhesus macaques (Mmu29127 and Mmu28780) by the i.v. route (Fig. 1). Both animals demonstrated CD4+ T-cell depletion at levels ranging from about 100 to 300 cells/µl through 8 weeks of observation; also, CD4/CD8 T-cell ratios declined to 0.1 (Table 1). The peak plasma viral RNA levels at 2 weeks p.i. were 6.3 × 107 copies per ml for Mmu29187 and 4.3 × 107 copies per ml for Mmu28780 (Fig. 4A). Although viral RNA was not detected in the plasma of these two macaques at 8 weeks, cell-associated virus was found in lymph nodes and peripheral blood at this time (Table 1). Both animals produced antiviral antibodies, first detected at 4 weeks (Table 2).


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 4.   Plasma viral loads in juvenile rhesus macaques inoculated i.v. and IVAG with serially passaged SHIV-E-P4. SHIV-E-P4 was analyzed using juvenile macaques (Mmu29379 and Mmu29644) inoculated i.v. (A) and female juvenile macaques (Mmu29379 and Mmu29644) inoculated via vaginal mucosal membranes (B). These animals were analyzed for plasma viral loads during the course of infection. Viral loads are given in SHIV RNA copy numbers determined by a bDNA assay.

Two juvenile female macaques (Mmu29379 and Mmu29644) were also inoculated with two doses totalling 60,000 TCID50 of a cell-free preparation of serially passaged SHIV-E-P4 through vaginal mucosal membranes (Fig. 1). Beginning at 2 weeks in Mmu29379 and at 4 weeks in Mmu29644, the numbers of CD4+ T cells declined to low levels through 12 weeks of observation; in addition, both animals showed a large decline in CD4/CD8 T-cell ratios (Table 1). The plasma viral RNA level of macaque Mmu29379 was 3.6 × 106 copies per ml at 2 weeks p.i., whereas plasma viral RNA was detected later, at 4 weeks p.i., in Mmu29644, at 4.9 × 106 copies per ml (Fig. 4B). Through 12 weeks of observation, cell-associated virus was detected in peripheral blood and lymph node cells of both animals (Table 2), and they exhibited antiviral antibody responses, first measured at 4 weeks (Table 3).

Sequence analysis of serially passaged SHIV-E-P4. The amino acid sequences encoded by the vpu gene, the env gp120 domain, and the first coding exons of tat and rev were determined for serially passaged SHIV-E-P4. The parental SHIV-E-CAR clone contains a stop codon at the second codon of the vpu translation frame, whereas in SHIV-E-P4, the vpu gene is open for its full length (data not shown). Sequence analysis of several clones containing the env gp120 domain of SHIV-E-P4 revealed three amino acid changes, R424M, Q467H, and L501I, in all clones in comparison with the SHIV-E-CAR clone (Fig. 5). The sequence R424-I425-K426-Q427, which is adjacent to the V4 loop, is highly conserved in HIV-1 subtype-B and subtype-E isolates; interestingly, these amino acids interact with the CCR5 coreceptor (48). Whether the R424M change in SHIV-E-P4 or any of the other changes in the env amino acid sequence is significant for adaptation to the macaque host remains to be determined.


View larger version (32K):
[in this window]
[in a new window]
 
FIG. 5.   Amino acid sequence changes in the SHIV-E-P4 envelope glycoprotein. The top line shows the sequence of the env gp120 domain of HIV-1CAR402. Seven env genes were amplified by PCR from SHIV-E-P4-infected PBMC, cloned, and sequenced. Predicted amino acid sequence changes are shown for each env clone. Variable regions V1 to V5 are overlined. Dashes represent amino acid identity.

In vitro replication and coreceptor usage of serially passaged SHIV-E-P4. The replication kinetics of the SHIV-E-CAR clone, serially passaged SHIV-E-P4, and SIVmac239 in rhesus macaque PBMC cultures were compared. SHIV-E-P4 replicated at higher levels than the SHIV-E-CAR clone in these macaque cells (Fig. 6). The replication of both SHIV was delayed compared to that of SIVmac239 (Fig. 6). The coreceptor usage of the SHIV-E-CAR clone and serially passaged SHIV-E-P4 was analyzed. Virus production, measured by use of SIV p27 antigen, was detected in culture supernatants of U87-CXCR4 cells infected with either SHIV-E-CAR or SHIV-E-P4 (Table 4). Viral replication was not detected in U87-CCR5 cultures infected with these viruses. Controls for this coreceptor usage assay included SHIV-33A, which uses CXCR4, and SIVmac239, which uses CCR5 (7).


View larger version (15K):
[in this window]
[in a new window]
 
FIG. 6.   Replication kinetics of the SHIV-E-CAR clone and serially passaged SHIV-E-P4 in rhesus macaque PBMC. Macaque PBMC were inoculated with SHIV-E-CAR (), SHIV-E-P4 (), and SIVmac239 (black-triangle) at the multiplicity of infection of 0.001. Culture supernatants were collected at 0, 4, 7, 11, and 14 days after infection and analyzed for SIV p27 by an antigen capture ELISA. open circle , mock infection. The data shown here for PBMC from Mmu26047 are representative for a total of three different donor animals.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 4.   Coreceptor usage of the SHIV-E-CAR clone and serially passaged SHIV-E-P4


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

A summary of the major findings on the virus-host relationship of rhesus macaques infected with chimeric viruses containing the env ectodomain of the subtype-E HIV-1 isolates is presented in Table 5. The SHIV-E-CAR clone established a productive infection in juvenile rhesus macaques without clinical signs of immunodeficiency; this outcome was obtained in both i.v.- and IVAG-inoculated animals. Previous investigators demonstrated that serial passage of chimeric virus in macaques produced virus that exhibited a relatively high viral load, caused rapid depletion of CD4+ T cells, and resulted in fatal simian AIDS (18, 45). Accordingly, we performed serial passage of the SHIV-E-CAR clone in juvenile macaques by transfer of blood and bone marrow cells. Virus from the serial passage, designated SHIV-E-P4, produced depletion of CD4+ T cells in peripheral blood and lymph nodes. In vitro assessments in cell culture systems were performed to determine whether the serial passage produced a phenotypic change(s) in the virus. Passaged SHIV-E-P4, like the SHIV-E-CAR parental clone, utilized the CXCR4 but not the CCR5 coreceptor. Also, SHIV-E-P4 replicated to about twofold-higher levels in rhesus PBMC cultures than did the SHIV-E-CAR clone. The significance of this small difference in replication in vitro remains to be determined.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 5.   Summary of analysis of the SHIV-E-CAR clone and serially passaged SHIV-E-P4 in macaques

Studies on various SHIV clones and strains containing env genes of subtype-B HIV-1 isolates have focused on the relationships of virus load and the potential for causing fatal immunodeficiency. Levels of viremia at 2 to 4 weeks p.i. and after this initial stage appear to be predictive of the pathogenic potential of lentiviruses in macaques (22, 46, 53). In two i.v.-inoculated macaques, the SHIV-E-CAR clone exhibited peak levels in plasma of 1 × 107 to 3 × 107 viral RNA copies per ml (Fig. 3A). At 8 weeks p.i. and thereafter, these levels declined to less than 1.5 × 103 copies per ml. The serially passaged virus, SHIV-E-P4, showed initial plasma virus levels of 4 × 107 to 6 × 107 copies per ml in two i.v.-infected macaques; however, the virus load declined to less than 1.5 × 103 copies per ml at 8 weeks p.i. Thus, serial passage of the SHIV-E-CAR clone did not dramatically augment the virus load at primary infection in recipient animals, although serial passage produced a virus that caused CD4+ T-cell depletion. Other investigators reported that serially passaged pathogenic SHIV containing subtype-B env genes exhibited about 5 × 105 copies of viral RNA in plasma in the chronic stage of infection (46, 53). Because of the low virus load in the chronic stage of infection with SHIV-E-P4, this virus may not be as pathogenic as subtype-B SHIV strains (e.g., SHIV-89.6P) (46). However, the absolute number of plasma viral RNA copies in HIV-1-infected humans who progress to AIDS is similar to that in SHIV-E-P4-infected macaques (23, 47, 50). Longer observation periods will be required to determine the relationships of virus load and pathogenesis and to compare subtype-B and subtype-E SHIV strains.

Mucosal membrane transmission of HIV-1CAR402 was demonstrated in chimpanzees (14); however, major disadvantages of this animal model for HIV-1 infection and AIDS are high cost and limited supply of chimpanzees. We showed that the SHIV-E-CAR clone could be transmitted through vaginal mucosal membranes in two of four female macaques tested. The serially passaged virus SHIV-E-P4 infected two of two animals when inoculated by the vaginal route. Thus, serial passage is not an absolute requirement for SHIV transmission through mucosal membranes (24). Additionally, because SHIV-E-CAR is a T-cell-tropic virus and utilizes the CXCR4 coreceptor, our results confirm the finding that macrophage tropism and CCR5 coreceptor usage by the virus are not required for lentivirus transmission through mucosal membranes. A similar conclusion was reached from studies of SIVmac- and SHIV-infected macaques in which the infectivity of the virus in dendritic cells or macrophages in vitro was not required for mucosal transmission (11, 16, 34). However, it is possible that serial passage selects for viral variants that exhibit increased efficiency for mucosal membrane infection. Taken together, these findings indicate that macaques represent an economical and readily accessible model for investigating the viral and host factors that govern the mucosal transmission of subtype-E chimeric virus (9, 39, 52).

All the SHIV-infected macaques in our study developed antiviral antibodies. In contrast, other investigators reported that rhesus macaques infected with pathogenic subtype-B SHIV strains did not make detectable antiviral antibodies (18, 25, 45, 51); notably, these animals did not show a recovery of CD4+ T cells. Because the macaques infected with SHIV-E-P4 demonstrated a recovery of CD4+ T cells, it is possible that antiviral antibodies reduced the rate of virus replication and allowed repopulation with CD4+ T cells. Thus, detection of antiviral antibodies in these animals may be a marker for lack of simian AIDS progression. The status of cell-mediated immune responses, which might also control levels of virus, remains to be examined in these animals. Through a comparison of the env glycoproteins of the SHIV-E-CAR clone and serially passaged SHIV-E-P4, a small number of predicted amino acid sequence changes in the gp120 domain were noted. These changes in env could be due to immunological selection for escape variants in the host (8). In addition, changes in gp120, as well as other parts of the viral genome, could contribute to CD4+ T-cell depletion in the macaque host (19).

The chimeric clone SHIV9466.33, containing the ectodomain of the subtype-E Thai isolate HIV-19466, replicated in human and baboon lymphoid cells but not in rhesus macaque cells; in contrast, SHIV-E-CAR replicated efficiently in macaque cells. HIV-1CAR402 was recovered from an infected individual from Africa, cultured in chimpanzee PBMC, and molecularly cloned (3, 13, 36). It is possible that the growth of HIV-1CAR402 in chimpanzee cells may have selected for a viral variant that contained an env gene, allowing for the growth of the chimeric SHIV-E-CAR clone in macaque cells. Such adaptation in vitro (i.e., passage in chimpanzee cells) may be important for producing SHIV isolates containing env genes of other HIV-1 subtypes that infect nonhuman primates.

In summary, this report demonstrates that SHIV-E-P4, derived by serial passage in macaques, will be useful for analyzing the role of the subtype-E env gene in CD4+ T-cell depletion and mucosal membrane transmission. Importantly, this chimeric virus can serve as a challenge virus in the evaluation of vaccines based on HIV-1 env immunogens in nonhuman primate models. Although cross-subtype cytotoxic T-lymphocyte activity and cross-subtype neutralizing antibody have been demonstrated in HIV-1-infected individuals (5, 42, 55), the significance of such immune responses for protection from infection is not known (12, 56). It is likely that the most effective anti-HIV-1 vaccines will be those that induce immune responses with the strongest recognition of the virus population (i.e., subtype variants) in a particular geographic region.


    ACKNOWLEDGMENTS

We thank Feng Gao and Beatrice Hahn (University of Alabama) for providing the molecular clone of HIV-1CAR402. Expert technical assistance was provided by Lou Adamson, Emily Yu, Kim Schmidt, Claudia Weber, Jo-Anne Yee, Abigail Spinner, and Karen Shaw. Special thanks are due to the following research services staff members for help with rhesus macaques: Linda Hirst, David Bennett, and Wilhelm Von Morgenland, of the California Regional Primate Research Center. We thank Murray Gardner for helpful discussions.

The research in this report was supported by NIH grants to P.A.L. (AI41907 and AI42608) and a postdoctoral fellowship awarded to S.H. from the State of California Universitywide AIDS Research Program (F98-D-142). Grants RR-00169 and AI 42494 from the NIH also provided support.


    FOOTNOTES

* Corresponding author. Mailing address: Center for Comparative Medicine, School of Medicine, University of California, Davis, CA 95616-8557. Phone: (530) 752-3430. Fax: (530) 752-7914. E-mail: paluciw{at}ucdavis.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Alexander, L., Z. Du, M. Rosenzweig, J. U. Jung, and R. C. Desrosiers. 1997. A role for natural simian immunodeficiency virus and human immunodeficiency virus type 1 nef alleles in lymphocyte activation. J. Virol. 71:6094-6099[Abstract].
2. Artenstein, A. W., J. Coppola, A. E. Brown, J. K. Carr, E. Sanders-Buell, E. Galbarini, J. R. Mascola, T. C. VanCott, P. Schonbrood, F. E. McCutchan, et al. 1995. Multiple introductions of HIV-1 subtype E into the Western hemisphere. Lancet 346:1197-1198[CrossRef][Medline]. (Erratum, 346:1376.)
3. Barré-Sinoussi, F., M. C. Georges-Courbot, P. N. Fultz, H. Nguyen Thi Tuyet, E. Muchmore, S. Saragosti, G. Dubreuil, A. Georges, E. van der Ryst, and M. Girard. 1997. Characterization and titration of an HIV type 1 subtype E chimpanzee challenge stock. AIDS Res. Hum. Retrovir. 13:583-591[Medline].
4. Bobkov, A. F., E. V. Kazennova, L. M. Selimova, N. N. Ladnaia, M. R. Bobkova, A. V. Kravchenko, and V. V. Pokrovski. 1999. HIV-1 subtypes in Russia in 1987-1988. Zh. Mikrobiol. Epidemiol. i Immunobiol. 71:43-45. (In Russian.)
5. Cao, H., P. Kanki, J. L. Sankalé, A. Dieng-Sarr, G. P. Mazzara, S. A. Kalams, B. Korber, S. Mboup, and B. D. Walker. 1997. Cytotoxic T-lymphocyte cross-reactivity among different human immunodeficiency virus type 1 clades: implications for vaccine development. J. Virol. 71:8615-8623[Abstract].
6. Carr, J. K., B. T. Foley, T. Leitner, M. Salminen, B. Korbor, and F. McCutchan. 1998. Reference sequences representing the principal genetic diversity of HIV-1 in the pandemic, p. 10-19. In B. Korber, C. L. Kuiken, B. Foley, B. Hahn, F. McCutchan, J. W. Mellors, and J. Sodroski (ed.), A compilation and analysis of nucleic acid and amino acid sequences. Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, N.Mex.
7. Chen, Z., P. Zhou, D. D. Ho, N. R. Landau, and P. A. Marx. 1997. Genetically divergent strains of simian immunodeficiency virus use CCR5 as a coreceptor for entry. J. Virol. 71:2705-2714[Abstract].
8. Cheng-Mayer, C., A. Brown, J. Harouse, P. A. Luciw, and A. J. Mayer. 1999. Selection for neutralization resistance of the simian/human immunodeficiency virus SHIVSF33A variant in vivo by virtue of sequence changes in the extracellular envelope glycoprotein that modify N-linked glycosylation. J. Virol. 73:5294-5300[Abstract/Free Full Text].
9. Dittmar, M. T., G. Simmons, S. Hibbitts, M. O'Hare, S. Louisirirotchanakul, S. Beddows, J. Weber, P. R. Clapham, and R. A. Weiss. 1997. Langerhans cell tropism of human immunodeficiency virus type 1 subtype A through F isolates derived from different transmission groups. J. Virol. 71:8008-8013[Abstract].
10. Doms, R. W., and J. P. Moore. 1997. HIV-1 coreceptor use: a molecular window into viral tropism, p. 1-12. In B. Korber, B. Hahn, B. Forley, J. W. Mellors, T. Leitner, G. Myers, F. McCutchan, and C. L. Kuiken (ed.), A compilation and analysis of nucleic acid and amino acid sequences. Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, N.Mex.
11. Enose, Y., K. Ibuki, K. Tamaru, M. Ui, T. Kuwata, T. Shimada, and M. Hayami. 1999. Replication capacity of simian immunodeficiency virus in cultured macaque macrophages and dendritic cells is not prerequisite for intravaginal transmission of the virus in macaques. J. Gen. Virol. 80:847-855[Abstract].
12. Ferrari, G., W. Humphrey, M. J. McElrath, J. L. Excler, A. M. Duliege, M. L. Clements, L. C. Corey, D. P. Bolognesi, and K. J. Weinhold. 1997. Clade B-based HIV-1 vaccines elicit cross-clade cytotoxic T lymphocyte reactivities in uninfected volunteers. Proc. Natl. Acad. Sci. USA 94:1396-1401[Abstract/Free Full Text].
13. Gao, F., D. L. Robertson, S. G. Morrison, H. Hui, S. Craig, J. Decker, P. N. Fultz, M. Girard, G. M. Shaw, B. H. Hahn, and P. M. Sharp. 1996. The heterosexual human immunodeficiency virus type 1 epidemic in Thailand is caused by an intersubtype (A/E) recombinant of African origin. J. Virol. 70:7013-7029[Abstract/Free Full Text].
14. Girard, M., J. Mahoney, Q. Wei, E. van der Ryst, E. Muchmore, F. Barré-Sinoussi, and P. N. Fultz. 1998. Genital infection of female chimpanzees with human immunodeficiency virus type 1. AIDS Res. Hum. Retrovir. 14:1357-1367[Medline].
15. Harouse, J. M., A. Gettie, R. C. Tan, J. Blanchard, and C. Cheng-Mayer. 1999. Distinct pathogenic sequela in rhesus macaques infected with CCR5 or CXCR4 utilizing SHIVs. Science 284:816-819[Abstract/Free Full Text].
16. Harouse, J. M., R. C. Tan, A. Gettie, P. Dailey, P. A. Marx, P. A. Luciw, and C. Cheng-Mayer. 1998. Mucosal transmission of pathogenic CXCR4-utilizing SHIVSF33A variants in rhesus macaques. Virology 248:95-107[CrossRef][Medline].
17. Joag, S. V., I. Adany, Z. Li, L. Foresman, D. M. Pinson, C. Wang, E. B. Stephens, R. Raghavan, and O. Narayan. 1997. Animal model of mucosally transmitted human immunodeficiency virus type 1 disease: intravaginal and oral deposition of simian/human immunodeficiency virus in macaques results in systemic infection, elimination of CD4+ T cells, and AIDS. J. Virol. 71:4016-4023[Abstract].
18. Joag, S. V., Z. Li, L. Foresman, E. B. Stephens, L. J. Zhao, I. Adany, D. M. Pinson, H. M. McClure, and O. Narayan. 1996. Chimeric simian/human immunodeficiency virus that causes progressive loss of CD4+ T cells and AIDS in pig-tailed macaques. J. Virol. 70:3189-3197[Abstract].
19. Karlsson, G. B., M. Halloran, D. Schenten, J. Lee, P. Racz, K. Tenner-Racz, J. Manola, R. Gelman, B. Etemad-Moghadam, E. Desjardins, R. Wyatt, N. P. Gerard, L. Marcon, D. Margolin, J. Fanton, M. K. Axthelm, N. L. Letvin, and J. Sodroski. 1998. The envelope glycoprotein ectodomains determine the efficiency of CD4+ T lymphocyte depletion in simian-human immunodeficiency virus-infected macaques. J. Exp. Med. 188:1159-1171[Abstract/Free Full Text].
20. Klinger, J. M., S. Himathongkham, H. Legg, P. A. Luciw, and S. W. Barnett. 1998. Infection of baboons with a simian immunodeficiency virus/HIV-1 chimeric virus constructed with an HIV-1 Thai subtype E envelope. AIDS 12:849-857[CrossRef][Medline].
21. Li, J., C. I. Lord, W. Haseltine, N. L. Letvin, and J. Sodroski. 1992. Infection of cynomolgus monkeys with a chimeric HIV-1/SIVmac virus that expresses the HIV-1 envelope glycoproteins. J. Acquir. Immune Defic. Syndr. 5:639-646.
22. Lifson, J. D., M. A. Nowak, S. Goldstein, J. L. Rossio, A. Kinter, G. Vasquez, T. A. Wiltrout, C. Brown, D. Schneider, L. Wahl, A. L. Lloyd, J. Williams, W. R. Elkins, A. S. Fauci, and V. M. Hirsch. 1997. The extent of early viral replication is a critical determinant of the natural history of simian immunodeficiency virus infection. J. Virol. 71:9508-9514[Abstract].
23. Little, S. J., A. R. McLean, C. A. Spina, D. D. Richman, and D. V. Havlir. 1999. Viral dynamics of acute HIV-1 infection. J. Exp. Med. 190:841-850[Abstract/Free Full Text].
24. Lu, Y., P. Brosio, M. Lafaile, J. Li, R. G. Collman, J. Sodroski, and C. J. Miller. 1996. Vaginal transmission of chimeric simian/human immunodeficiency viruses in rhesus macaques. J. Virol. 70:3045-3050[Abstract].
25. Lu, Y., C. D. Pauza, X. Lu, D. C. Montefiori, and C. J. Miller. 1998. Rhesus macaques that become systemically infected with pathogenic SHIV 89.6-PD after intravenous, rectal, or vaginal inoculation and fail to make an antiviral antibody response rapidly develop AIDS. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 19:6-18[Medline].
26. Luciw, P. A., C. P. Mandell, S. Himathongkham, J. Li, T. A. Low, K. A. Schmidt, K. E. S. Shaw, and C. Cheng-Mayer. 1999. Fatal immunopathogenesis by SIV/HIV-1 (SHIV) containing a variant form of the HIV-1SF33 env gene in juvenile and newborn rhesus macaques. Virology 263:112-127[CrossRef][Medline].
27. Luciw, P. A., E. Pratt-Lowe, K. E. Shaw, J. A. Levy, and C. Cheng-Mayer. 1995. Persistent infection of rhesus macaques with T-cell-line-tropic and macrophage-tropic clones of simian/human immunodeficiency viruses (SHIV). Proc. Natl. Acad. Sci. USA 92:7490-7494[Abstract/Free Full Text].
28. Lusso, P., F. Cocchi, C. Balotta, P. D. Markham, A. Louie, P. Farci, R. Pal, R. C. Gallo, and M. S. Reitz, Jr. 1995. Growth of macrophage-tropic and primary human immunodeficiency virus type 1 (HIV-1) isolates in a unique CD4+ T-cell clone (PM1): failure to downregulate CD4 and to interfere with cell-line-tropic HIV-1. J. Virol. 69:3712-3720[Abstract].
29. Marthas, M. L., R. A. Ramos, B. L. Lohman, K. K. Van Rompay, R. E. Unger, C. J. Miller, B. Banapour, N. C. Pedersen, and P. A. Luciw. 1993. Viral determinants of simian immunodeficiency virus (SIV) virulence in rhesus macaques assessed by using attenuated and pathogenic molecular clones of SIVmac. J. Virol. 67:6047-6055[Abstract/Free Full Text].
30. McCutchan, F. E., A. W. Artenstein, E. Sanders-Buell, M. O. Salminen, J. K. Carr, J. R. Mascola, X. F. Yu, K. E. Nelson, C. Khamboonruang, D. Schmitt, M. P. Kieny, J. G. McNeil, and D. S. Burke. 1996. Diversity of the envelope glycoprotein among human immunodeficiency virus type 1 isolates of clade E from Asia and Africa. J. Virol. 70:3331-3338[Abstract].
31. McCutchan, F. E., P. A. Hegerich, T. P. Brennan, P. Phanuphak, P. Singharaj, A. Jugsudee, P. W. Berman, A. M. Gray, A. K. Fowler, and D. S. Burke. 1992. Genetic variants of HIV-1 in Thailand. AIDS Res. Hum. Retrovir. 8:1887-1895[Medline].
32. McCutchan, F. E., M. O. Salminen, J. K. Carr, and D. S. Burke. 1996. HIV-1 genetic diversity. AIDS 10(Suppl. 3):S13-S20.
33. Menu, E., T. X. Truong, M. E. Lafon, T. H. Nguyen, M. C. Müller-Trutwin, T. T. Nguyen, A. Deslandres, G. Chaouat, Q. T. Duong, B. K. Ha, H. J. Fleury, and F. Barré-Sinoussi. 1996. HIV type 1 Thai subtype E is predominant in South Vietnam. AIDS Res. Hum. Retrovir. 12:629-633[Medline].
34. Miller, C. J. 1998. Does viral tropism play a role in heterosexual transmission of HIV? Findings in the SIV-rhesus macaque model. AIDS Res. Hum. Retrovir. 14(Suppl. 1):S79-S82.
35. Miller, C. J., M. B. McChesney, X. Lü, P. J. Dailey, C. Chutkowski, D. Lu, P. Brosio, B. Roberts, and Y. Lu. 1997. Rhesus macaques previously infected with simian/human immunodeficiency virus are protected from vaginal challenge with pathogenic SIVmac239. J. Virol. 71:1911-1921[Abstract].
36. Murphy, E., B. Korber, M. C. Georges-Courbot, B. You, A. Pinter, D. Cook, M. P. Kieny, A. Georges, C. Mathiot, F. Barré-Sinoussi, et al. 1993. Diversity of V3 region sequences of human immunodeficiency viruses type 1 from the Central African Republic. AIDS Res. Hum. Retrovir. 9:997-1006[Medline].
37. Ou, C. Y., Y. Takebe, C. C. Luo, M. Kalish, W. Auwanit, C. Bandea, N. de la Torre, J. L. Moore, G. Schochetman, S. Yamazaki, et al. 1992. Wide distribution of two subtypes of HIV-1 in Thailand. AIDS Res. Hum. Retrovir. 8:1471-1472[Medline].
38. Overbaugh, J., P. A. Luciw, and E. A. Hoover. 1997. Models for AIDS pathogenesis: simian immunodeficiency virus, simian-human immunodeficiency virus and feline immunodeficiency virus infections. AIDS 11(Suppl. A):S47-S54.
39. Pope, M., S. S. Frankel, J. R. Mascola, A. Trkola, F. Isdell, D. L. Birx, D. S. Burke, D. D. Ho, and J. P. Moore. 1997. Human immunodeficiency virus type 1 strains of subtypes B and E replicate in cutaneous dendritic cell-T-cell mixtures without displaying subtype-specific tropism. J. Virol. 71:8001-8007[Abstract].
40. Porter, K. R., J. R. Mascola, H. Hupudio, D. Ewing, T. C. VanCott, R. L. Anthony, A. L. Corwin, S. Widodo, S. Ertono, F. E. McCutchan, D. S. Burke, C. G. Hayes, F. S. Wignall, and R. R. Graham. 1997. Genetic, antigenic and serologic characterization of human immunodeficiency virus type 1 from Indonesia. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 14:1-6[Medline].
41. Puchhammer-Stöckl, E., C. Kunz, E. Faatz, P. Kasper, and F. X. Heinz. 1998. Introduction of HIV-1 subtypes C, E and A into Austria. Clin. Diagn. Virol. 9:25-28[CrossRef][Medline].
42. Quinnan, G. V., Jr., P. F. Zhang, D. W. Fu, M. Dong, and H. J. Alter. 1999. Expression and characterization of HIV type 1 envelope protein associated with a broadly reactive neutralizing antibody response. AIDS Res. Hum. Retrovir. 15:561-570[CrossRef][Medline].
43. Quiñones-Mateu, M. E., J. L. Albright, V. Torre, M. Reini, J. Vandasová, M. Brucková, and E. J. Arts. 1999. Molecular epidemiology of HIV type 1 isolates from the Czech Republic: identification of an env E subtype case. AIDS Res. Hum. Retrovir. 15:85-89[CrossRef][Medline].
43a. Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27:493-497.
44. Reimann, K. A., R. L. Cate, Y. Wu, L. Palmer, D. Olson, B. C. Waite, N. L. Letvin, and L. C. Burkly. 1995. In vivo administration of CD4-specific monoclonal antibody: effect on provirus load in rhesus monkeys chronically infected with the simian immunodeficiency virus of macaques. AIDS Res. Hum. Retrovir. 11:517-525[Medline].
45. Reimann, K. A., J. T. Li, R. Veazey, M. Halloran, I. W. Park, G. B. Karlsson, J. Sodroski, and N. L. Letvin. 1996. A chimeric simian/human immunodeficiency virus expressing a primary patient human immunodeficiency virus type 1 isolate env causes an AIDS-like disease after in vivo passage in rhesus monkeys. J. Virol. 70:6922-6928[Abstract/Free Full Text].
46. Reimann, K. A., A. Watson, P. J. Dailey, W. Lin, C. I. Lord, T. D. Steenbeke, R. A. Parker, M. K. Axthelm, and G. B. Karlsson. 1999. Viral burden and disease progression in rhesus monkeys infected with chimeric simian-human immunodeficiency viruses. Virology 256:15-21[CrossRef][Medline].
47. Riddler, S. A., and J. W. Mellors. 1997. HIV-1 viral load and clinical outcome: review of recent studies. AIDS 11(Suppl. A):S141-S148.
48. Rizzuto, C. D., R. Wyatt, N. Hernández-Ramos, Y. Sun, P. D. Kwong, W. A. Hendrickson, and J. Sodroski. 1998. A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding. Science 280:1949-1953[Abstract/Free Full Text].
49. Sakuragi, S., R. Shibata, R. Mukai, T. Komatsu, M. Fukasawa, H. Sakai, J. Sakuragi, M. Kawamura, K. Ibuki, M. Hayami, et al. 1992. Infection of macaque monkeys with a chimeric human and simian immunodeficiency virus. J. Gen. Virol. 73:2983-2987[Abstract/Free Full Text].
50. Schacker, T. W., J. P. Hughes, T. Shea, R. W. Coombs, and L. Corey. 1998. Biological and virologic characteristics of primary HIV infection. Ann. Intern. Med. 128:613-620[Abstract/Free Full Text].
51. Shibata, R., F. Maldarelli, C. Siemon, T. Matano, M. Parta, G. Miller, T. Fredrickson, and M. A. Martin. 1997. Infection and pathogenicity of chimeric simian-human immunodeficiency viruses in macaques: determinants of high virus loads and CD4 cell killing. J. Infect. Dis. 176:362-373[Medline].
52. Soto-Ramirez, L. E., B. Renjifo, M. F. McLane, R. Marlink, C. O'Hara, R. Sutthent, C. Wasi, P. Vithayasai, V. Vithayasai, C. Apichartpiyakul, P. Auewarakul, V. Peña Cruz, D. S. Chui, R. Osathanondh, K. Mayer, T. H. Lee, and M. Essex. 1996. HIV-1 Langerhans' cell tropism associated with heterosexual transmission of HIV. Science 271:1291-1293[Abstract].
53. Ten Haaft, P., B. Verstrepen, K. Uberla, B. Rosenwirth, and J. Heeney. 1998. A pathogenic threshold of virus load defined in simian immunodeficiency virus- or simian-human immunodeficiency virus-infected macaques. J. Virol. 72:10281-10285[Abstract/Free Full Text].
54. Vasil, S., R. Thakallapally, S. Pillai, and C. Kuiken. 1998. Reagents for HIV/SIV vaccine studies, p. 91-101. In B. Korber, C. L. Kuiken, B. Foley, B. Hahn, F. McCutchan, J. W. Mellors, and J. Sodroski (ed.), A compilation and analysis of nucleic acid and amino acid sequences. Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, N.Mex.
55. Zolla-Pazner, S., M. K. Gomy, and P. N. Nyambi. 1999. The implications of antigenic diversity for vaccine development. Immunol. Lett. 66:159-164[CrossRef][Medline].
56. Zolla-Pazner, S., M. Lubeck, S. Xu, S. Burda, R. J. Natuk, F. Sinangil, K. Steimer, R. C. Gallo, J. W. Eichberg, T. Matthews, and M. Robert-Guroff. 1998. Induction of neutralizing antibodies to T-cell line-adapted and primary human immunodeficiency virus type 1 isolates with a prime-boost vaccine regimen in chimpanzees. J. Virol. 72:1052-1059[Abstract/Free Full Text].


Journal of Virology, September 2000, p. 7851-7860, Vol. 74, No. 17
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Mohan, M., Aye, P. P., Borda, J. T., Alvarez, X., Lackner, A. A. (2007). Gastrointestinal Disease in Simian Immunodeficiency Virus-Infected Rhesus Macaques Is Characterized by Proinflammatory Dysregulation of the Interleukin-6-Janus Kinase/Signal Transducer and Activator of Transcription3 Pathway. Am. J. Pathol. 171: 1952-1965 [Abstract] [Full Text]  
  • Hsu, M., Harouse, J. M., Gettie, A., Buckner, C., Blanchard, J., Cheng-Mayer, C. (2002). Increased Mucosal Transmission but Not Enhanced Pathogenicity of the CCR5-Tropic, Simian AIDS-Inducing Simian/Human Immunodeficiency Virus SHIVSF162P3 Maps to Envelope gp120. J. Virol. 77: 989-998 [Abstract] [Full Text]  
  • Chakrabarti, L. A., Ivanovic, T., Cheng-Mayer, C. (2002). Properties of the Surface Envelope Glycoprotein Associated with Virulence of Simian-Human Immunodeficiency Virus SHIVSF33A Molecular Clones. J. Virol. 76: 1588-1599 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Himathongkham, S.
Right arrow Articles by Luciw, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Himathongkham, S.
Right arrow Articles by Luciw, P. A.